1. health and fitness
2. disease

The Plant Journal (2014) 78, 834–849
doi: 10.1111/tpj.12508
A homolog of ETHYLENE OVERPRODUCER, OsETOL1,
differentially modulates drought and submergence tolerance
in rice
Hao Du, Nai Wu, Fei Cui, Lei You, Xianghua Li and Lizhong Xiong*
National Key Laboratory of Crop Genetic Improvement and National Center of Plant Gene Research (Wuhan), Huazhong
Agricultural University, Wuhan 430070, China
Received 18 August 2013; revised 24 January 2014; accepted 10 March 2014; published online 19 March 2014.
*For correspondence (e-mail [email protected]).
SUMMARY
Submergence and drought are major limiting factors for crop production. However, very limited studies
have been reported on the distinct or overlapping mechanisms of plants in response to the two water
extremes. Here we report an ETHYLENE OVERPRODUCER 1-like gene (OsETOL1) that modulates differentially drought and submergence tolerance in rice (Oryza sativa L.). Two allelic mutants of OsETOL1 showed
increased resistance to drought stress at the panicle development stage. Interestingly, the mutants exhibited a significantly slower growth rate under submergence stress at both the seedling and panicle development stages. Over-expression (OE) of OsETOL1 in rice resulted in reverse phenotypes when compared with
the mutants. The OsETOL1 transcript was differentially responsive to abiotic stresses. OsETOL1 was found
to interact with OsACS2, a homolog of 1-amino-cyclopropane-1-carboxylate (ACC) synthase (ACS), which
acts as a rate-limiting enzyme for ethylene biosynthesis. In the osacs2 mutant and OsETOL1-OE plants, ACC
and ethylene content were decreased significantly, and exogenous ACC restored the phenotype of osetol1
and OsETOL1-OE to wild-type under submergence stress, implying a negative role for OsETOL1 in ethylene
biosynthesis. The expression of several genes related to carbohydrate catabolism and fermentation showed
significant changes in the osetol1 and OsETOL1-OE plants, implying that OsETOL1 may affect energy
metabolism. These results together suggest that OsETOL1 plays distinct roles in drought and submergence
tolerance by modulating ethylene production and energy metabolism. Findings from the expression and
functional comparison of three ethylene overproducer (ETOL) family members in rice further supported the
specific role of OsETOL1 in the responses to the two water stresses.
Keywords: Oryza sativa, drought, submergence, ethylene, energy metabolism.
INTRODUCTION
Sessile plants are often challenged by various abiotic stresses such as extremes in water availability including
drought and submergence stress during their life cycle. To
respond to these stresses, plants have evolved a variety of
biochemical and physiological mechanisms that allows
them to adapt to adverse conditions (Hirayama and Shinozaki, 2010; Fukao and Xiong, 2013). Many of the adaptation
mechanisms are related to changes in the levels of endogenous hormones such as abscisic acid (ABA) and ethylene.
The ABA biosynthesis and signalling pathways are well
known for their roles in various stress responses. Ethylene
as an important gaseous hormone participates in a diverse
array of plant growth and development mechanisms such
as hypocotyl growth, cell elongation, fruit ripening, leaf
and flower abscission, nodulation, and plant senescence
834
(Wang et al., 2004; Frankowski et al., 2007). Meanwhile,
ethylene is also important for plants to respond rapidly
and coordinately to adverse environments, such as pathogen attack, hypoxia, and exposure to drought or submergence stress (Metraux and Kende, 1983; Xu et al., 2006;
Wilkinson and Davies, 2010; Fukao et al., 2011). In the early
developmental stages of Arabidopsis thaliana, ethylene
appears to act as a negative regulator of ABA, and a positive regulator in the drought stress response, while in roots
it has a positive synergistic effect on ABA action (Ghassemian et al., 2000). Under drought stress conditions, the
increased endogenous ABA levels can limit ethylene production to maintain the growth ratio between shoots and
roots (Sharp, 2002). Furthermore, ethylene signalling inhibits ABA-induced stomatal closure by impairing ABA
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd
An ETOL1 homolog modulates water stress tolerance in rice 835
regulation of stomatal closure (Tanaka et al., 2005). These
results suggest that ethylene may play a negative role in
the drought stress response, and that the developmental
and stress-responsive processes are controlled by a combination of biosynthesis, signal perception, and signal transduction of ethylene and other factors.
Extensive genetic analyses in Arabidopsis have uncovered an elaborate pathway for ethylene synthesis. These
studies have focused on cloning and characterization of
the genes for two key enzymes, 1-amino-cyclopropane-1carboxylate (ACC) synthase (ACS) and ACC oxidase (ACO).
ACS is a rate-limiting enzyme that converts S-adenosyl-Lmethionine to ACC (Wang et al., 2002), and ACC is then
converted to ethylene by members of the ACO family.
ACSs are encoded by a gene family with at least 12 members in Arabidopsis (Yamagami et al., 2003; Tsuchisaka
and Theologis, 2004). The ACS genes are differentially regulated at the transcriptional level in response to environmental stresses and developmental cues (Wang et al.,
2002). Arabidopsis eto1 is a recessive mutant of the ETHYLENE OVERPRODUCER 1 (ETO1), which was proposed to
encode a post-transcriptional regulator of ACS (Woeste
et al., 1999). ETO1 and ETO1-like (EOL) proteins in Arabidopsis have been shown to interact directly with the C-terminus of the ACS5 protein, and thus inhibit ACS5 activity
by proteasome-dependent degradation in an in vitro activity assay (Wang et al., 2004). ETO1 has been characterized
as a protein with a Broad-Complex, Tramtrack, and Bric-abrac (BTB) domain at its amino-terminus, and six tetratricopeptide repeat motifs together with a coiled-coil motif at
its C-terminus. The BTB domain functions in protein–
protein interactions to mediate the interaction of ETO1
with other proteins (Wang et al., 2004). Arabidopsis contains two potential paralogs of ETO1, designated as ETO1LIKE 1 (EOL1) and EOL2, which share significant similarity
to ETO1, including the presence of a six tetratricopeptide
repeat and the coiled-coil motif. The two paralogs can also
interact with ACS5 in yeast and indicate that they may also
direct ACS ubiquitination and turnover (Yoshida et al.,
2006; Christians et al., 2009). However, it has been found
that a single null mutation of EOL1 and EOL2 failed to
cause obvious growth defects and, in particular, no defects
in ethylene overproduction were observed; this result suggested that EOL1 and EOL2 may act through non-ethylene
signalling pathways or have a more subtle effect on ethylene biosynthesis than ETO1 (Gingerich et al., 2005; Christians et al., 2009). Collectively, previous results in
Arabidopsis have indicated that the Arabidopsis BTB-type
E3 ligases work together with ETO1 to negatively regulate
ethylene synthesis and thus degrade type-2 ACSs
(Christians et al., 2009).
It is well known that submergence can induce ethylene
production, and that ethylene is involved in the control of
energy metabolism under submergence or hypoxic
conditions, as a lack of oxygen causes a reduction in respiratory and photosynthetic efficiency and, as a consequence, in energy production (Gupta et al., 2009). The role
of ethylene in energy metabolism under submergence conditions has been well elucidated by the role of the SUBMERGENCE-1 A (SUB1A) gene in submergence-tolerant
rice. SUB1A, an ethylene responsive factor (ERF), promotes
a ‘quiescent strategy’ to avoid any unnecessary energy
consumption caused by gibberellin (GA)-mediated elongation in the submerged tissues (Bailey-Serres and Voesenek,
2010). In another distinct mechanism, the ERF transcription
factors SNORKEL1 and SNORKEL2 promote GA-mediated
internode elongation in deep-water rice varieties (Hattori
et al., 2009). Ethylene drives the expression of SUB1A and
SNORKEL1/2 that controls the quiescence of submergence
tolerance and the escape responses of deep-water rice,
respectively (Bailey-Serres and Voesenek, 2010). Such an
adaptation mechanism illustrates the exceptional effect of
ethylene and GA under submergence stress conditions.
Both the transcriptional and translational regulation of
energy metabolism-related genes have been found to be
involved in the adaptation of plants to submergence or oxygen-limited conditions (Bailey-Serres and Voesenek, 2008).
Under such conditions, hypoxia-induced genes that encode
alcohol dehydrogenase (ADH), pyruvate decarboxylase
(PDC), and sucrose synthase (SUSY) in several plant species
have contributed to the identification of several ciselements for hypoxia inducibility (de Bruxelles et al., 1996;
Magneschi and Perata, 2009). In Arabidopsis, the hypoxiaresponsive ERF genes HRE1 and HRE2 also belong to the
same ERF group as SUB1A. HRE1-OE plants showed an
increase in the activity of the fermentative enzymes pyruvate decarboxylase and alcohol dehydrogenase together
with increased ethanol production under hypoxia (Licausi
et al., 2010), which is a similar adaptive strategy to SUB1A.
Recently, the CBL-interacting protein kinase OsCIPK15 was
reported for its role in regulation of energy homeostasis
and Snf1 (sucrose non-fermenting-1)-related protein kinase
SnRK1A; it linked O2-deficiency signals to the SnRK1Adependent sugar-sensing cascade that regulates sugar and
energy production, and enabled rice to germinate and grow
under submergence conditions (Lee et al., 2009).
In contrast with the intensive molecular and genetic
studies of the regulation of ethylene synthesis in Arabidopsis and its role in the energy metabolism-related adaptive
strategies for submergence tolerance in rice, the role of
ethylene in linking both drought and submergence stresses has seldom been addressed. In this study, we characterized a rice gene OsETOL1, a homolog of Arabidopsis
ETO1 that encodes a putative E3 ubiquitin ligase involved
in the regulation of ethylene synthesis. We also found that
OsETOL1 plays different roles in the submergence and
drought tolerance of rice by regulation of the balance of
energy metabolism under the two water stresses.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
836 Hao Du et al.
RESULTS
OsETOL1 functions in submergence tolerance
Function of OsETOL1 in drought tolerance
By screening drought-tolerant or sensitive rice mutants collected from the T-DNA mutant library in the Rice Mutant
Database (Wu et al., 2003; Zhang et al., 2006), one mutant
(in the background of japonica rice Zhonghua11 [ZH11])
was identified that showed increased drought resistance at
the reproductive stage. Flanking sequence analysis of this
mutant indicated that a gene (LOC_Os03g18360) that
encoded a putative E3 ubiquitin ligase that belonged to the
ETO family was interrupted (Figure 1a), and this mutant
was designated as osetol1-1. Co-segregation analysis suggested that the drought resistance phenotype was due to
the T-DNA insertion in the OsETOL1 gene (Figure 1b). We
collected an allelic mutant of the OsETOL1 gene, named
osetol1-2, that also showed the drought-resistant phenotype. The T-DNA insertion sites of the osetol1-1 and
osetol1-2 mutants were located in the third intron and the
first exon, respectively (Figure 1a). Transcript analysis of
OsETOL1 suggested that the expression of OsETOL1 was
abolished in both the osetol1-1 and osetol1-2 mutants (Figure 1c). Under normal conditions, the homozygous mutant
showed no obvious phenotypic changes when compared
with the wild-type genotype (designated WT0 hereafter)
segregated from the heterozygous mutant (Figure 1d). During the course of drought stress, the osetol1 mutant
showed no obvious difference in leaf wilting compared
with the WT0 . However, after recovery, the mutant showed
a significantly higher spikelet fertility and biomass aboveground when compared with the WT0 (Figure 1e,f). Nevertheless, no significant difference in drought tolerance was
observed for the mutant and WT0 at the seedling stage
(data not shown).
To test whether OsETOL1 over-expression (OE) has any
effect on drought resistance, the full-length cDNA of OsETOL1 under the control of the maize ubiquitin promoter
(Figure S1a) was transformed into rice ZH11. Among the
22 independent transgenic plants generated, 13 plants
showed OE of the OsETOL1 transcript (Figure S1b). Two
of them (O9 and O22) were tested for drought resistance
at the four-leaf seedling and reproductive stages. Under
normal conditions, no phenotypic difference was
observed between the transgenic plants and wild-type
(WT), and no difference in drought tolerance was
observed at the seedling stage. After being droughtstressed at the early panicle development stage followed
by recovery at the flowering stage, the positive OE plants
retained more green leaves (Figure 1g), but exhibited a
significantly lower spikelet fertility than WT (Figure 1h).
Nevertheless, the difference in the above-ground biomass
was not significant. These results suggest that the OsETOL1 gene may have a negative role in drought tolerance
at the reproductive stage.
OsETOL1 is a homolog of the Arabidopsis ETO1 protein
that participates in the degradation of type-2 ACS, a ratelimiting enzyme of ethylene biosynthesis (Wang et al.,
2004), and ethylene is involved in submergence tolerance
in rice (Fukao et al., 2006). Therefore, we further examined
the osetol1 mutant under submergence stress. The mutant
seedlings exhibited slower growth than the WT0 after being
submerged for 7 days (Figure 2a,b). We extended the submergence stress for 60 days up to the grain-filling (milking)
stage by keeping only the top leaf tips exposed in the air,
and observed that the osetol1 mutant grew slower than
the WT0 throughout the duration of the stress period (Figure 2c). Under normal conditions, however, no significant
difference was detected at both the seedling stage and the
panicle development stage. These results suggested that
OsETOL1 may have an important role for the growth of
rice under submergence stress.
The influence of OsETOL1-OE on submergence tolerance
was also evaluated. The OsETOL1-OE plants showed
increased plant height when compared with the controls at
4 days after complete submergence treatment (Figure 3a,b).
After a prolonged submergence treatment (for 12 days),
all of the first and second leaves of the OE plants were
longer than the controls (Figure 3a,b). In rice, submergence can induce the expression and enzymatic activity of
amylase, which promotes the degradation of starch (Lee
et al., 2009; Magneschi and Perata, 2009). We found that
the total soluble sugar content declined gradually in both
the OsETOL1-OE plants and the control plants, however
the OE plants maintained significantly higher levels of soluble sugar content than the controls during the course of
submergence stress (Figure 3c). Meanwhile, the soluble
sugar content was significantly lower in the osetol1
mutant than in the corresponding WT’ under submergence stress (Figure 3c). Nevertheless, no significant difference of starch level in osetol1 and OE plants was found
under normal and submergence conditions (Figure S2).
These results suggest that the positive effect of OsETOL1-OE
on plant growth under submergence conditions may be
partially due to the relatively high level of soluble sugar for
energy metabolism. In addition, the positive role of
OsETOL1 in submergence tolerance may be independent of
SNORKEL1/2 and SUB1A as these genes are absent in the
rice ZH11 (Figure S3).
Expression profiles of OsETOL1
The different phenotypes of the osetol1 mutant and OsETOL1-OE plants under drought and submergence stresses
prompted us to examine the expression level of OsETOL1
under different stress and phytohormone treatments. As
shown in Figure 4(a), the OsETOL1 transcript level was
strongly induced by drought (18-fold) and ABA (11-fold),
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 837
(a)
(d)
(e)
(b)
(f)
(c)
(h)
(g)
Figure 1. Identification of the osetol1 mutants and drought performance of osetol1 mutant and OsETOL1-over-expression rice.
(a) Schematic diagram of the OsETOL1 gene structure and two allelic T-DNA insertion mutants, osetol1-1 and osetol1-2.
(b) Genotypes of the segregated osetol1-1 and osetol1-2 mutants (nine plants shown) by using the forward primer (FP), reverse primer (RP), and the T-DNA primer (NTLB5). M, homozygous mutant; h, heterozygous mutant; WT0 , wild-type segregated from the progenies of heterozygous mutant.
(c) Relative expression levels of OsETOL1 gene in the leaves of osetol1 mutants and wild-type (WT0 ) at seedling stage detected by quantitative polymerase chain
reaction (qPCR) using primer pairs FP1/RP1 and FP2/RP2 as indicated in Figure 1(a).
(d) Drought resistance phenotype at the panicle developmental stage (details in Experimental Procedures).
(e, f) The spikelet fertility and above-ground dry biomass (including straw and seeds at harvesting stage) after exposure to drought stress. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are means standard deviation (SD) (n = 3).
(g) Appearance of positive OsETOL1-over-expression plants (09) and wild-type (WT-1) at the panicle developmental stage before drought stress and after
drought stress treatment and recovery.
(h) Analysis of the spikelet fertility and above-ground biomass. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are
means SD (n = 3).
and it was also slightly induced by salt, heat, and ethylene treatments (Figure 4a). During submergence treatment, the OsETOL1 transcript was rapidly induced to
about seven-fold at 12 h after the initiation of stress, but
after this time point the expression declined slowly to the
level seen under normal conditions, and it was
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
838 Hao Du et al.
(a)
(b)
(c)
suppressed after submergence for 5 days (Figure 4a).
OsETOL1 was not responsive significantly to the other
treatments (Figure 4a). As the mutant showed no obvious
phenotypic changes under other stress or phytohormone
treatments (data not shown), we propose that OsETOL1
may function primarily in regulation of drought and submergence tolerance.
The tempo-spatial expression of OsETOL1 under normal
growth conditions was also analysed. According to microarray data available from the rice gene expression database (Wang et al., 2010), OsETOL1 is expressed
constitutively in most tissues and organs. It has relatively
higher expression levels in mature tissues than in immature tissues (Figure S4); this expression pattern was confirmed by quantitative polymerase chain reaction (qPCR)
analysis (Figure 4b). To further confirm the expression profile of OsETOL1, the OsETOL1 promoter (approximately
2.5 kb upstream of the translation start site) fused to the bglucuronidase (GUS) gene (Figure 4c) was transformed
into rice ZH11. The GUS signal in the transgenic rice was
strong in the anther, spikelet hull, node, old root, sheaths,
and mature leaves by comparison, but the signal was weak
in callus, young bud, root, and immature endosperm (Figure 4d–m), a finding that agreed well with the results from
the microarray and qPCR.
OsETOL1 interacts with OsACS2 in the cytosol
To determine the subcellular localization of OsETOL1, the
OsETOL1 coding sequence was fused in frame to the
green fluorescent protein (GFP) gene under the control of
Figure 2. Phenotype of the osetol1 mutants
under submergence.
(a, b) The osetol1 mutant showed significantly
increased sensitivity to partial submergence
(complete submergence for 3 days and then
the water level was maintained so that the top
leaf tips were exposed, as indicated by the
white arrow, for 14 days) at the seedling
stage as indicated by the reduced growth rate.
Asterisks indicate significant difference (t-test),
**P < 0.01 level, values are means standard
deviation (SD) (n = 8).
(c) The osetol1 mutant showed significantly
increased sensitivity to partial submergence
(complete submergence for 3 days and then
the water level was maintained, as indicated by
the white arrow, for up to 60 days) during the
vegetative and reproductive stages, as indicated by the reduced plant height.
the cauliflower mosaic virus 35S promoter. Arabidopsis
leaf protoplasts were co-transformed with 35S::OsETOL1EGFP and 35S::AtAOS-ERFP by polyethylene glycol (PEG)
treatment. AtAOS was used as a reference marker as it
has been reported as a cytosolic protein (Wang et al.,
1999). As shown in Figure 5(b), green fluorescence produced by OsETOL1-EGFP overlapped with red fluorescence (RFP) produced by 35S: AtAOS–ERFP (Figure 5a–d),
suggesting that OsETOL1 is a cytosolic protein. In Arabidopsis, ETO1 specifically interacts with and negatively regulates type 2 ACS (Wang et al., 2004). In rice, only one
type 2 ACS (OsACS2) was identified (Souza Cde et al.,
2008). In a yeast two-hybrid assay, OsETOL1 interacted
with OsACS2 (Figure 5e). The interaction between OsETOL1 and OsACS2 was further confirmed by a bimolecular fluorescence complementation (BiFC) assay in
Arabidopsis protoplasts (Figure 5f–i). This result indicated
that OsETOL1 may function in ACC biosynthesis by interacting with OsACS2 in rice.
OsETOL1 plays a negative role in ethylene biosynthesis
To further address the function of the OsETOL1OsACS2
interaction in controlling the biosynthesis of ACC and ethylene, we obtained a mutant of OsACS2 (also in the background of ZH11) with the T-DNA inserted in the promoter.
The transcript level of OsACS2 in the osacs2 mutant was
very low compared with the WT0 (Figure 6a). The OsACS2
gene was also responsive to drought and submergence
stresses (Figure 6b). As expected, the ACC level in the
osacs2 mutant was reduced significantly under normal,
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 839
(a)
(b)
(c)
Figure 3. OsETOL1-over-expression rice showed increased submergence tolerance.
(a, b) OsETOL1-over-expressing rice grew faster than the wild-type (WT0 ) under complete submergence conditions.
(c) Analysis of the soluble sugar content of OsETOL1 transgenic plants under submergence. Asterisks indicate significant difference (t-test), *P < 0.05,
**P < 0.01 level, values are means SD (n = 3).
drought, and submergence conditions (Figure 6c). The osacs2 mutant had a significantly lower spikelet fertility after
drought stress at the reproductive stage (Figure 6d), similar to the phenotypes of OsETOL1-OE rice.
To test whether OsACS2 and OsETOL1 are critical for
ACC and ethylene production in rice, we measured the relative contents of ACC and ethylene in the mutant and OsETOL1-OE plants. The osetol1-1 plants produced higher
levels of ACC and ethylene than the control, while lower
contents of ACC and ethylene were detected in the OsETOL1-OE plants under normal and stress conditions
(Figure 7a,b). In addition, the ethylene level was suppressed by drought stress but enhanced by submergence
(Figure 7b). These results suggest that OsETOL1 negatively
influences the biosynthesis of ACC and ethylene via
interaction with OsACS2 in rice, the same mechanism as
established in Arabidopsis. To ascertain whether the accumulation of ACC was associated with rice growth under
submergence conditions, the osetol1 mutant and OsETOL1OE plants with altered ACC levels were treated with exogenous ACC under submergence or normal conditions. Without ACC treatment, OsETOL1-OE plants grew significantly
faster than the control under submergence conditions,
while the osetol1 mutant grew slower (Figure 7c). When
supplied with 10 lM ACC during the submergence stress,
the growth of osetol1 and OsETOL1-OE plants was not significantly different compared with the corresponding WT
controls (Figure 7c,d); this result suggested that the effect
of OsETOL1 on plant growth under submergence conditions was mainly due to the altered ACC (and/or ethylene)
levels in the mutant or over-expression plants. These
results when taken together suggested that OsETOL1 has a
role in control of the submergence response through the
regulation of ACC or ethylene biosynthesis.
Expression of energy metabolism-related genes in the
OsETOL1-OE and osetol1 plants
Regulation of energy metabolism has been commonly
adopted by plants in response to adverse environmental
changes. To determine whether the OsETOL1 gene is
involved in the regulation energy metabolism, a set of well
characterized genes that are related to carbohydrate catabolism and fermentation in rice were examined for their
expression levels in the OsETOL1-OE and WT plants. The
transcript levels of OsCIPK15, OsSnRK1, SUSY OsSUS1,aamylase genes aAmy1, aAmy3, aAmy7, aAmy8 and alcohol
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
840 Hao Du et al.
Figure 4. Expression pattern of OsETOL1.
(a) Relative expression of OsETOL1 under different treatments. The quantitative polymerase
chain reaction (qPCR) values were normalized
to Actin1 gene and then presented as foldchange relative to time point 0. Seedlings (fourleaf stage) were subjected to cold (4°C), heat
shock (42°C), salt (200 mM NaCl), ABA (200 lM),
GA (200 lM), UV (ultraviolet), wounding, ethylene, drought and submergence stresses (details
in Experimental Procedures).
(b) Expression profiles of OsETOL1 in different
tissues or organs including: (1) clum; (2) node;
(3) sheath; (4) three-leaf shoot; (5) hull; (6) seed;
(7) secondary branching of inflorescence; (8)
anther; (9) calli induction stage; (10) calli
screening stage; (11) calli differentiation stage;
(12) young shoot; (13) young root; (14) flag leaf
(sampled in the morning); (15) flag leaf (sampled in the afternoon); and (16) pulvinus.
(c) Diagram of the POsETOL1:GUS construct.
(d–m) GUS staining is shown in the first node
at the tiller stage (d), clum (e), leaf at tiller stage
(f), callus (g), plumule and radicle, 48 h after
emergence in the dark (h), root at tiller stage (i),
ligule, auricle, pulvini and sheath (j), the secondary branching and inflorescence (k), seed
(l), and hull (m).
(a)
(b)
(c)
(d)
(e)
(f)
(i)
(j)
(k)
(l)
(h)
(m)
(g)
dehydrogenase genes Adh1 and Adh2 were increased in
the WT0 under submergence conditions at the seedling
stage. Under drought stress at the panicle development
stage, however, most of these genes showed no obvious
change in expression level, and two genes, aAmy7 and OsSUS1, were even suppressed (Figure 8a). Adh1 and Adh2,
which encode alcohol dehydrogenases necessary for fermentative metabolism, showed significantly increased
expression in the osetol1 mutant under submergence conditions (Figure 8a). The four genes (OsSUS1, aAmy1,
aAmy3, and aAmy8) that encode SUSY and a-amylase
were up-regulated significantly in the OsETOL1-OE plants,
but were slightly down-regulated in the osetol1 mutant
(Figure 8a). These results suggested that fermentation and
starch metabolism may be regulated reversely under
submergence conditions. OsCIPK15 regulates OsSnRK1A
and MYBS1, which influence the transcription of a-amylase
genes and alcohol dehydrogenase genes, which are
required for seedling germination and growth under complete submergence conditions (Lee et al., 2009). We found
that the transcript levels of OsCIPK15, OsSnRK1A, and
MYBS1 were increased in the OsETOL1-OE plants under
submergence (Figure 8a). However, OsCIPK15 was upregulated in the osetol1 mutant under drought stress
conditions. Furthermore, the OsETOL1 transcript was suppressed in the OsCIPK15-OE plants, which showed
enhanced salt stress tolerance in our previous study (Xiang
et al., 2007) (Figure 8b); this result suggested that the
expression of OsETOL1 may also be regulated by OsCIPK15-mediated signalling processes under submergence
stress. These results together indicated that OsETOL1 may
function in the increase in starch degradation to produce
soluble sugar, but may suppress the fermentation pathway
under submergence conditions.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 841
Figure 5. Cytosol-localized OsETOL1 interacts
with OsACS2.
(a–d) Localization of the OsETOL1–GFP fusion
protein is merged with the cytosol marker protein AtAOS–RFP in the cytosol.
(e) Interaction of OsETOL1 and OsACS2 in a
yeast two-hybrid assay. The constructs for
yeast transformation are as follows: 1, OsETOL1-BD and OsACS2-AD; 2, Negative control;
3, positive control C; 4, positive control D.
(f–i) Interaction of OsETOL1 and OsACS2
detected by fluorescence in bimolecular fluorescence complementation (BiFC) in Arabidopsis
protoplasts.
(a)
(b)
(c)
(d)
(g)
(h)
(i)
(e)
(f)
Specificity of OsETOL1 in stress tolerance
Two additional ETO homologs, OsETOL2 (LOC_
Os07g08120) and OsETOL3 (LOC_Os11g37520) showing 73
and 78% identity, respectively, to OsETOL1, were predicted
in the rice genome. According to the expression profiles of
these genes, retrieved from the publicly available Collections of Rice Expression Profiling (CREP) database (Wang
et al., 2010). OsETOL1 exhibits an expression pattern that
was distinctly different from OsETOL2 and OsETOL3. The
OsETOL1 expression level was high in stamens and young
panicles (Figures 4 and S3), while OsETOL2 and OsETOL3
showed extremely low levels (Figure S4). In endosperm
and sheath, the expression of OsETOL1 was significantly
lower than OsETOL2 and OsETOL3 (Figure S4). The expression levels of the OsETOL family genes were also significantly different under various stress conditions. Although
OsETOL1 and OsETOL3 displayed similar expression patterns in salt, submergence and ethylene treatments, only
OsETOL1 was induced strongly by drought stress and ABA
treatment (Figure S5).
The distinctive expression patterns imply that OsETOL1
may play a specific role in stress tolerance. To verify this
hypothesis, we produced RNA interference (RNAi) transgenic rice for OsETOL2 and OsETOL3, and amiR-OsETOL1/
2/3-transgenic rice in which the three genes were suppressed by an artificial microRNA approach (Figure 9a). T1
plants (three OsETOL2-RNAi (2Li5, 2Li7, 2Li14), three OsETOL3-RNAi (3Li1, 3Li5, 3Li13), and two amiRNA (ai-3 and
ai-8)) were tested for drought resistance at the panicle
development stage. Under normal conditions, these plants
were very similar to the WT (Figure 9b). After drought
stress treatment, the OsETOL2 and OsETOL3 RNAi plants
showed no difference in spikelet fertility compared with
the WT (Figures S6 and S7), but the amiRNA plants
showed a significantly higher spikelet fertility (Figure 9c,d).
With the exception that the amiR-OsETOL1/2/3-transgenic
plants showed slightly reduced growth under submergence stress, the other RNAi plants showed no obvious difference when exposed to the submergence stress
conditions. In addition, ACC content in the OsETOL2-RNAi
and OsETOL3-RNAi plants showed no significant changes
(data not shown). These results together suggested that
OsETOL1, but not OsETOL2 and OsETOL3, may function
specifically in regulating drought and submergence tolerance.
DISCUSSION
Previous studies have implicated that ethylene is a principal stress modulator, especially in pathogen-induced
defense responses, and ethylene production was elevated in many plants upon pathogen attack (Bleecker
and Kende, 2000; Broekaert et al., 2006). Studies also
suggest that submergence or hypoxia induces the accumulation of ethylene, and ethylene triggers GA-promoted
cell elongation needing carbohydrate consumption
(Kende et al., 1998; Fukao et al., 2006). Previous studies
demonstrated that the direct inhibition of ACS5 (a ratelimiting enzyme in ethylene biosynthesis) activity by the
ETO1 protein family depends on the ubiquitin/26S
proteasome system (Wang et al., 2004; Broekaert et al.,
2006). In this study, yeast two-hybrid and BiFC assays
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
842 Hao Du et al.
(a)
(b)
(c)
(d)
Figure 6. Identification of the 1-amino-cyclopropane-1-carboxylate (ACC)-deficient mutant osacs2.
(a) Schematic diagram of the OsACS2 gene structure and T-DNA insertion position in osacs2 mutant (top) and transcript analysis of OsACS2 in the leaves of osacs2-1 and osacs2-2 (two progenies generated from a heterozygous osacs2 mutant) and WT’ at seedling stage detected by quantitative polymerase chain reaction (qPCR) (bottom). F1, forward primer; R1 (reverse primer). The qPCR values were normalized to Actin1 gene and then presented as fold-change relative to
osacs2-1.
(b) Relative expression of OsACS2 under drought and submergence treatments detected by qPCR (with qPCR values normalized to Actin1 gene and then presented as fold-change relative to osacs2-1).
(c) Quantification of the relative ACC content in osacs2 leaves at seedling stage before and after drought stress for 2 days. The values are relative to WT0 -1 under
normal conditions. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are means SD (n = 3).
(d) The spikelet fertility in normal condition and after drought stress. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 level, values are
means standard deviation (SD) (n = 3).
indicated that OsETOL1 can interact with OsACS2. Additionally, we found that ACC and ethylene production
were impaired significantly in the osetol1 mutant (Figure 7a,b), and the ACC level was also reduced in the osacs2 rice mutant (Figure 6c), similar to that in the
OsETOL1-OE plants (Figure 7a). These results suggested
that OsETOL1 is also a negative regulator of ethylene
biosynthesis, and that the interaction between ETO1 and
ACS2 may be conserved in plants. In addition, the
expression of OsACS2 was also induced by drought and
submergence stresses (Figure S8), further supporting the
involvement of the ETO–ACS2 interaction in the regulation of stress tolerance.
A role for ETO genes in drought tolerance has not yet
been reported. Although the osetol1 mutant showed no
significant differences when compared with the WT0 at
the seedling stage, the mutant exhibited a significantly
higher spikelet fertility and biomass than the WT0 after
exposure to drought stress at the reproductive stage (Figure 1e,f). The OsETOL1-OE plants showed decreased
drought tolerance as indicated by significantly lower
spikelet fertility after exposure to drought stress even
though the OE plants retained more green leaves compared with the WT (Figure 1g,h). The ACC-deficient osacs2 mutant also showed reduced spikelet fertility after
exposure to drought stress (Figure 6d). These results
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 843
(b)
(a)
(c)
(d)
Figure 7. Quantification and identification of the 1-amino-cyclopropane-1-carboxylate (ACC) and ethylene levels.
(a) Quantification of the relative ACC content in the leaves of osetol1 and OsETOL1-over-expression plants under normal and drought stress (for 2 days; 2d) and
submergence (for 3 days; 3d) at seedling stage. osetol1-1 and osetol1-2 are two independent osetol1 plants; WT0 , wild-type segregated from the progenies of
heterozygous osetol1 mutant; 06 and 09 as OsETOL1-over-expression lines. Asterisks indicate significant difference (t-test), *P < 0.05, **P < 0.01 levels respectively, Values, relative to the corresponding WT0 , are means standard deviation (SD) (n = 3).
(b) Quantification of ethylene content in the leaves by gas chromatograph at seedling stage. Asterisks indicate significant difference at P < 0.05 and P < 0.01
levels, respectively. Values are means SD (n = 3).
(c) Growth performance of ACC-deficient rice seedlings under normal and submergence conditions with exogenous ACC (10 lM ACC was added along with
submergence treatment.
(d) Statistics result for (c). Asterisks indicate significant difference at P < 0.05 and P < 0.01 levels, respectively. Values are means SD (n = 3).
provide a link between ethylene and adaptation strategies
under drought conditions. Water stress can limit ethylene
production and the process may interact with ABA or
other hormones (Sharp, 2002), and suggested that ethylene has an important role in the plant response to
drought stress. Microarray and qPCR analyses showed
that many genes involved in ethylene biosynthesis or signalling pathways were suppressed under drought stress
conditions (Manavella et al., 2006). Over-expression of
the HD-Zip type transcription factor gene Hahb-4 in Ara-
bidopsis caused enhanced drought tolerance, mainly due
to the inhibition of ethylene-induced senescence (Manavella et al., 2006). The senescence delay may help to
maintain active photosynthesis for longer periods, thus
allowing plants to synthesize osmoprotectants and other
metabolites (Manavella et al., 2006). And drought stress
decreases photosynthetic potential and an array of complex metabolic progresses, resulting in disturbances in
energy metabolism (Chaves et al., 2009). In this study, no
significant difference in the photosynthetic rate was
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
844 Hao Du et al.
(a)
(b)
Figure 8. Expression levels of genes related to energy metabolism under normal condition (NC) and stress (DR, drought; Sub, submergence) conditions in rice
leaves at seedling stage. The quantitative polymerase chain reaction (qPCR) values were normalized to Actin1 and then presented as fold-change relative to the
wild-type (WT) under NC.
(a) Expression of selected energy-metabolic genes in the OsETOL1-OE and osetol1 mutant.
(b) Expression of OsETOL1 in OsCIPK15 over-expression plants.
observed between the osetol1 mutant and the WT0 (data
not shown). However, the OsETOL1-OE rice exhibited an
obvious delay in senescence under drought stress conditions (Figure 1g), which may result in a delay in the
transportation of carbohydrates from leaves to the
developing seeds, and finally lead to a reduced spikelet
fertility.
ABA plays an important role in drought resistance, and
has been well studied in many plants. We examined the
expression of several ABA-dependent drought-responsive
genes including TRAB1, RAB16A, and LEA3, however none
of them exhibited a difference in transcript level between
osetol1 and the WT0 under normal, drought, or submergence conditions. The endogenous ABA level, ABA
sensitivity, and water loss rate of leaves were not significantly different between osetol1 and the WT’ either under
normal or drought conditions (data not shown), implying
that OsETOL1 may be involved in drought resistance independently of ABA signalling pathways. Interestingly, the
OsCIPK15 gene, which was reported to have a role in regulation of energy homeostasis (Lee et al., 2009), was upregulated, but the a-amylase genes (aAmy1 and aAmy3),
which participate in starch degradation under drought
stress, were suppressed in the osetol1 mutant (Figure 8).
These results when taken together imply that energy
metabolism may be obstructed in osetol1 mutant. When
considering the conserved biochemical function of OsETOL1 in negatively modulating ethylene production, we
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 845
(a)
(b)
(c)
(d)
Figure 9. Functional specificity of OsETOL1.
(a) The relative expression levels of amiR-OsETOL1/2/3 transgenic plants by quantitative polymerase chain reaction (qPCR) analysis. For each gene, the qPCR
values were normalized to Actin1 and then presented as fold-change relative to wild-type (WT).
(b) Performance of the osetol1 mutant, OsETOL2-RNAi, OsETOL2-RNAi, amiR-OsETOL1/2/3, and WT plants at heading stage.
(c) The performance of ai-3 and WT in the field before exposure to drought stress (top) and after drought stress and recovery (bottom).
(d) The spikelet fertility of RNA interference plants under normal conditions and after drought treatment at reproductive stage. Asterisks indicate significant difference (t-test), **P < 0.01 level, values are means SD (n = 3).
propose that ethylene plays an important role in the starch
metabolism under drought stress conditions, especially at
the grain-filling and maturation stages.
Ethylene and GA were accumulated to higher levels
under submergence (Bailey-Serres and Voesenek, 2010). In
this study, we observed that OsETOL1 was induced by ethylene and submergence, but was suppressed by GA (Figure 4a), this result suggested that OsETOL1 is indeed
involved in the submergence response in rice. SNORKEL1
and SNORKEL2 were cloned from a deep-water rice variety,
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
846 Hao Du et al.
in which ethylene accumulates under submergence conditions to induce remarkable internode elongation via the ethylene and GA signalling pathways (Hattori et al., 2009).
However, SNORKEL1 and SNORKEL2 were not present in
the non-deep-water rice variety ZH11 used in this study and
the SUB1A allele was also absent in ZH11 either (Figure S3).
Furthermore, rice varieties that possessed the SUB1A gene
displayed a distinct flooding-tolerant phenotype. This evidence suggested that the function of OsETOL1 may be independent of the SNORKEL or SUB1A pathway.
Recently, an in silico flux analysis revealed that metabolic utilization of glycolysis and ethanol fermentation
were based on the oxygen availability and the efficient
breakdown of sucrose through SUSY instead of invertase
under submergence conditions (Lakshmanan et al., 2013),
this finding suggested essential roles for energy production and distribution in the adaptation of plants to submergence conditions. Moreover, previous study showed that
alcohol dehydrogenase genes were induced by complete
submergence in SUB1A rice (Fukao et al., 2006), and transcriptome profiling analysis suggested that SUB1A regulates multiple pathways associated with growth,
metabolism, and stress endurance (Jung et al., 2010). In
this study, Adh1 and Adh2 were suppressed in the OsETOL1-OE plants under submergence conditions (Figure 8a), implying that the fermentation process may be
suppressed by OsETOL1, which is different to that in the
SUB1A rice. A previous study has shown that alcohol
dehydrogenase can repress the expression of a-amylases
involved in starch degradation and cell elongation in
leaves (Ismond et al., 2003). Protein levels and the activity
of a-amylase were shown to be induced by anoxia at the
seedling stage in rice (Guglielminetti et al., 1995). Here, we
found that the a-amylase and SUSY genes were induced
under submergence stress and that the induction was
increased in the OsETOL1-OE plants under submergence
conditions (Figure 8a), a finding that agrees with the significantly higher levels of soluble sugar in OsETOL1-OE
plants under submergence conditions (Figure 3c). A previous study has shown that SnRK1A is an important intermediate in the sugar signalling cascade, functioning upstream
of MYBS1 and aAmy3, and playing a key role in regulating
seed germination and seedling growth in rice (Lu et al.,
2007). Another study has suggested that OsCIPK15 is a key
regulator in the SnRK1-dependent sugar-sensing cascade,
and that it regulates sugar and energy production to
enable rice growth under submergence conditions (Lee
et al., 2009). Interestingly, the OsETOL1 transcript was
up-regulated in the OsCIPK15-OE plants (Figure 8b),
and suggested that the expression of OsETOL1 may also
be regulated by OsCIPK15-mediated signalling processes
under submergence conditions. Meanwhile, several energy
metabolism-related upstream genes, including MYBS1,
SnRK1A, and OsCIPK15 and starch degradation genes
aAmy and Sus1, were up-regulated in the OsETOL1-OE
plants under submergence conditions (Figure 8a); this
result further supported the idea that OsETOL1 may be
involved in the regulation of energy metabolism under
submergence conditions.
In conclusion, our findings suggested that OsETOL1 negatively controls ACC and ethylene production, and we propose a simplified model for the distinct roles of OsETOL1 in
drought and submergence tolerance (Figure 10). Under
drought stress at the reproductive stage, the function of OsETOL1 may inhibit the transportation of carbohydrates from
leaves to the developing seeds and result in a reduction in
grain-filling and spikelet fertility and a delay in ethyleneinduced maturation. Under submergence conditions, however, carbohydrate consumption and energy production was
promoted by OsETOL1, this change enabled the upper
leaves to elongate to extend above the surface of the water.
Thus, the same function of OsETOL1 in modulation of ethylene production caused different morphological alterations
in rice under drought and submergence conditions. The
OsETOL1-mediated ethylene production and energy metabolism may provide an access to reveal the adaptation strategy to drought and submergence stresses in plants.
EXPERIMENTAL PROCEDURES
Plant materials and stress treatments
The osetol1-1 (04Z11DH56), osetol1-2 (05Z11E078), and osacs2
(03Z11BK09) mutants (in the background of japonica rice Zhonghua11 [ZH11]) were obtained from the Rice Mutant Database
(http://rmd.ncpgr.cn/) (Wu et al., 2003; Zhang et al., 2006). For
drought testing of the mutant and OE plants, seeds of T1 or T2
Figure 10. Working model for the function of OsETOL1 in response to
drought and submergence stresses.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 847
over-expression families and osetol1 mutants were germinated on
Murashige and Skoog (MS) medium with 50 mg/L hygromycin.
Drought stress at the reproductive stage was performed in sandymixed-soil field facilitated with a removable rain-off shelter. The
details of drought treatment and trait measurement were the
same as in a previous report (Hu et al., 2006). For submergence
treatment, WT plants of ZH11 were grown in the greenhouse
under a 14-h light/10-h dark cycle. Seedlings at the 4-leaf stage
were transferred to a deep tank, and fully submerged in the tanks
for 3 days, and the leaves were sampled (leaves from nonstressed control plants were collected at the same time points).
The plants were maintained in submerged conditions, with the
top leaf tips (3–5 cm) exposed above the water, until the plant
height and other traits were measured.
To examine the transcript levels of genes under various stresses, seedlings at the four-leaf stage were subjected to cold (4°C);
heat shock (42°C); salt (200 mM NaCl); and ultraviolet (UV) light
treatment as described in our previous study (Du et al., 2010).
Other treatments for expression level analyses were also conducted at the four-leaf stage. Wounding treatment was conducted
by pricking leaves with a syringe followed by sampling at 0, 1, 3,
and 6 h. Submergence treatment was conducted by transferring
the seedlings to a deep tank, with plants fully submerged, and
leaves were sampled at 6 h, 12 h, 1 day, 3 days, 5 days, 7 days,
and at 2 days after recovery. Ethylene treatment was conducted
by injecting ethylene into a small plant growth chamber followed
by sampling at 0, 1, 6, and 12 h. ABA or GA treatment was conducted by spraying 200 lM ABA or 200 lM GA on leaves followed
by sampling at 0, 2, 6, 12 h, or 0, 1, 3, 6, and 12 h for GA, after
spraying. For ACC treatment, the seeds were sterilized with HgCl2
(0.15%) and germinated for 4 days, and then grown in transparent
plastic boxes (6 9 6 9 12 cm) with ½MS medium (0.6% agar, with
or without 10 lM ACC; Sigma, USA, http://www.sigma-aldrich.com) in a growth chamber at 25°C with a 14 h light/10 h dark cycle
for 2 days. Then the seedlings were submerged with sterilized
water and kept to grow for 5 days before photography and measurement.
Plasmid construction and rice transformation
To generate the OsETOL1 OE constructs, the full-length cDNA of
OsETOL1 was amplified from rice ZH11, and the full-length cDNA
product was introduced into the destination vector pCB1301U
(under the control of the maize ubiquitin promoter). To investigate
the expression profile of OsETOL1, a genomic DNA sequence from
the OsETOL1 promoter region (2500 bp to +100 bp relative to the
initiation of transcription) was cloned into the DX2181 vector in
front of the GUS reporter gene. The OsETOL2-RNAi and OsETOL3RNAi constructs were made by introducing a fragment of 500 and
600 bp, respectively, in the open reading frame region, into the
pDS1301 vector (Chu et al., 2006). For the artificial microRNA construct, we used TAAACTGCGCATTCCAGCCTT as a conserved
sequence to target the OsETOL1, OsETOL2, and OsETOL3 genes
simultaneously using a method reported previously (Warthmann
et al., 2008). The gene-specific primers for constructs are listed in
Table S1. These constructs were introduced into japonica rice ZH11
by Agrobacterium-mediated transformation (Lin and Zhang, 2005).
Gene expression analyses
Total RNA was isolated from rice leaves using Trizol reagent (Invitrogen), and the DNase-treated RNA was reverse transcribed using
SuperScript reverse transcriptase (Invitrogen, http://www.lifetechnologies.com) according to the manufacturer’s instructions. Quantitative polymerase chain reaction (qPCR) was performed on an
optical 96-well plate in an ABI PRISM 7500 real-time PCR system
(Applied Biosystems, http://www.appliedbiosystems.com) by
using SYBR Premix Ex Taq reagent (TaKaRa, http://www.takara.
com). Reactions were performed in 20-ll volumes with the following protocol: first step of 94°C for 5 min and 40 cycles of 94°C for
10 sec, and 68°C for 35 sec. The gene-specific qPCR primers are
listed in Table S1. The relative expression level of genes was
determined with the rice Actin1 gene as an internal control. The
relative expression level was calculated by the function described
previously (Livak and Schmittgen, 2001).
Subcellular localization and bimolecular fluorescence
complementation assays
To investigate the subcellular localization of the OsETOL1 protein, the full OsETOL1 ORF was cloned into the pM999-33 vector, and fused with the GFP reporter gene. Plasmids were
purified using the QIAGEN kit (Valencia, CA, USA, http://
www.qiagen.com) columns in accordance with the manufacturer’s protocol. The plasmids together with 35S::AtAOS:RFP as
a cytosolic marker were introduced into Arabidopsis protoplasts
in accordance with the method reported by (Yoo et al., 2007)
with the minor modification that 5 lg of each plasmid was used.
For BiFC analysis, OsETOL1 was cloned into the pVYNE vector
and fused to the N-terminus (1–155 aa) of yellow fluorescent
protein, and OsACS2 was cloned into the pVYCE vector and
fused to the C-terminus (156–239 aa). The detailed information
regarding the BiFC vectors was provided by Waadt et al. (2008).
Combinations of the BiFC constructs were expressed transiently
in protoplasts from Arabidopsis leaves via polyethylene glycol
transformation. The expression of the fusion protein was monitored after 16 h of incubation in a dark room, and the fluorescence was captured by a confocal microscope (TCS SP2 Leica,
http://www.leica.com).
Yeast two-hybrid assays
The yeast two-hybrid assay was performed using the ProQuest
Two-Hybrid System (Invitrogen). The open reading frame of OsETOL1 that was generated by PCR was fused in frame with the
yeast GAL4 DNA binding domain in the pDEST32 vector by the
Gateway Recombination Cloning method (Invitrogen). Similarly,
the open reading frame of OsACS2 was fused in frame with the
yeast GAL4 activation domain in the pDEST22 vector by the Gateway Recombination Cloning method (Invitrogen) to generate bait
and prey vectors, respectively. The two vectors were co-transformed into the yeast strain Mav203, and the valid transformants
were identified according to the manufacturer’s instructions. The
colony-lift filter assay (X-gal assay) was performed as described
by the manufacturer (Invitrogen).
Quantification of ethylene and ABA
The ethylene levels of the plants grown in gas-chromatography
(GC) vials (B7990-6A; National Scientific Company, Rockwood,
USA, http://www.nsc-ksa.com) were determined by GC as
described previously (Shen et al., 2011). Quantification of ABA
was performed by the ABI 4000Q-TRAR LC-MS system with stable-isotope-labeled ABA (D-ABA) as the standard (OlChemIm,
Czech Specials) according to the methods described previously
(Liu et al., 2012).
ACKNOWLEDGEMENTS
We thank Jian Xu and Rongjian Ye (Huazhong Agricultural University) for providing plasmid pM999-33 and DX2181, respectively.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
848 Hao Du et al.
This work was supported by grants from the National Program for
Basic Research of China (2012CB114305), the National Program on
High Technology Development (2012AA10A303), the National
Natural Science Foundation of China (31271316), the National
Program of China for Transgenic Research (2011ZX08009-003-002,
2011ZX08001-003), and the Huazhong Agricultural University Scientific and Technological Self-innovation Foundation.
SUPPORTING INFORMATION
Additional Supporting Information may be found in the online version of this article.
Figure S1. The OsETOL1 construct and analysis of the expression
level in transgenic plants.
Figure S2. Starch content in leaves of OsETOL1 transgenic plants
and WT at seedling stage under normal and submergence conditions, DW, dry weight.
Figure S3. Genotyping analysis of gene loci (SK1, SK2, and
SUB1A) in the rice genotype ZH11 used in this work.
Figure S4. Expression profiles of three OsETOL genes in the tissues and organs covering the entire life cycle of rice.
Figure S5. Distinctive expression features of OsETOL family members under stress treatments (details in Experimental Procedures)
as shown by heatmaps based on the log-transformed fold-change
(relative time point 0) data derived from qPCR.
Figure S6. Performance of OsETOL2-RNAi plants.
Figure S7. Performance of OsETOL3-RNAi plants.
Figure S8. Distinctive expression features of OsACS2 under stress
treatments.
Table S1. Primers used in this study.
REFERENCES
Bailey-Serres, J. and Voesenek, L.A. (2008) Flooding stress: acclimations
and genetic diversity. Annu. Rev. Plant Biol. 59, 313–339.
Bailey-Serres, J. and Voesenek, L.A. (2010) Life in the balance: a signaling
network controlling survival of flooding. Curr. Opin. Plant Biol. 13, 489–
494.
Bleecker, A.B. and Kende, H. (2000) Ethylene: a gaseous signal molecule in
plants. Annu. Rev. Cell Dev. Biol. 16, 1–18.
Broekaert, W.F., Delaure, S.L., De Bolle, M.F. and Cammue, B.P. (2006) The
role of ethylene in host–pathogen interactions. Annu. Rev. Phytopathol.
44, 393–416.
de Bruxelles, G.L., Peacock, W.J., Dennis, E.S. and Dolferus, R. (1996) Abscisic acid induces the alcohol dehydrogenase gene in Arabidopsis. Plant
Physiol. 111, 381–391.
Chaves, M.M., Flexas, J. and Pinheiro, C. (2009) Photosynthesis under
drought and salt stress: regulation mechanisms from whole plant to cell.
Ann. Bot. 103, 551–560.
Christians, M.J., Gingerich, D.J., Hansen, M., Binder, B.M., Kieber, J.J. and
Vierstra, R.D. (2009) The BTB ubiquitin ligases ET01, EOL1 and EOL2 act
collectively to regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase levels. Plant J, 57, 332–345.
Chu, Z., Yuan, M., Yao, J. et al. (2006) Promoter mutations of an essential
gene for pollen development result in disease resistance in rice. Genes
Dev. 20, 1250–1255.
Du, H., Wang, N., Cui, F., Li, X., Xiao, J. and Xiong, L. (2010) Characterization of the beta-carotene hydroxylase gene DSM2 conferring drought
and oxidative stress resistance by increasing xanthophylls and abscisic
acid synthesis in rice. Plant Physiol. 154, 1304–1318.
Frankowski, K., Kesy, J. and Kopcewicz, J. (2007) Regulation of ethylene
biosynthesis in plants. Postepy Biochem. 53, 66–73.
Fukao, T. and Xiong, L. (2013) Genetic mechanisms conferring adaptation to
submergence and drought in rice: simple or complex? Curr. Opin. Plant
Biol. 16, 196–204.
Fukao, T., Xu, K., Ronald, P.C. and Bailey-Serres, J. (2006) A variable cluster
of ethylene response factor-like genes regulates metabolic and
developmental acclimation responses to submergence in rice. Plant Cell,
18, 2021–2034.
Fukao, T., Yeung, E. and Bailey-Serres, J. (2011) The submergence tolerance
regulator SUB1A mediates crosstalk between submergence and drought
tolerance in rice. Plant Cell, 23, 412–427.
Ghassemian, M., Nambara, E., Cutler, S., Kawaide, H., Kamiya, Y. and
McCourt, P. (2000) Regulation of abscisic acid signaling by the ethylene
response pathway in Arabidopsis. Plant Cell, 12, 1117–1126.
Gingerich, D.J., Gagne, J.M., Salter, D.W., Hellmann, H., Estelle, M., Ma, L.
and Vierstra, R.D. (2005) Cullins 3a and 3b assemble with members of
the broad complex/tramtrack/bric-a-brac (BTB) protein family to form
essential ubiquitin-protein ligases (E3s) in Arabidopsis. J. Biol. Chem.
280, 18810–18821.
Guglielminetti, L., Yamaguchi, J., Perata, P. and Alpi, A. (1995) Amylolytic
activities in cereal seeds under aerobic and anaerobic conditions. Plant
Physiol. 109, 1069–1076.
Gupta, K.J., Zabalza, A. and van Dongen, J.T. (2009) Regulation of respiration when the oxygen availability changes. Physiol. Plant. 137, 383–391.
Hattori, Y., Nagai, K., Furukawa, S. et al. (2009) The ethylene response factors SNORKEL1 and SNORKEL2 allow rice to adapt to deep water. Nature, 460, 1026–1030.
Hirayama, T. and Shinozaki, K. (2010) Research on plant abiotic stress
responses in the post-genome era: past, present and future. Plant J, 61,
1041–1052.
Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q. and Xiong, L. (2006) Overexpressing a NAM, ATAF, and CUC (NAC) transcription factor enhances
drought resistance and salt tolerance in rice. Proc. Natl Acad. Sci. USA,
103, 12987–12992.
Ismond, K.P., Dolferus, R., de Pauw, M., Dennis, E.S. and Good, A.G. (2003)
Enhanced low oxygen survival in Arabidopsis through increased metabolic flux in the fermentative pathway. Plant Physiol. 132, 1292–1302.
Jung, K.H., Seo, Y.S., Walia, H., Cao, P., Fukao, T., Canlas, P.E., Amonpant,
F., Bailey-Serres, J. and Ronald, P.C. (2010) The submergence tolerance
regulator Sub1A mediates stress-responsive expression of AP2/ERF transcription factors. Plant Physiol. 152, 1674–1692.
Kende, H., van der Knaap, E. and Cho, H.T. (1998) Deepwater rice: a model
plant to study stem elongation. Plant Physiol. 118, 1105–1110.
Lakshmanan, M., Zhang, Z., Mohanty, B., Kwon, J.Y., Choi, H.Y., Nam, H.J.,
Kim, D.I. and Lee, D.Y. (2013) Elucidating the rice cells metabolism under
flooding and drought stresses using flux-based modelling and analysis.
Plant Physiol. 162, 2140–2150.
Lee, K.W., Chen, P.W., Lu, C.A., Chen, S., Ho, T.H. and Yu, S.M. (2009) Coordinated responses to oxygen and sugar deficiency allow rice seedlings
to tolerate flooding. Sci. Signal. 2, ra61.
Licausi, F., van Dongen, J.T., Giuntoli, B., Novi, G., Santaniello, A., Geigenberger, P. and Perata, P. (2010) HRE1 and HRE2, two hypoxia-inducible
ethylene response factors, affect anaerobic responses in Arabidopsis thaliana. Plant J, 62, 302–315.
Lin, Y.J. and Zhang, Q. (2005) Optimising the tissue culture conditions for
high efficiency transformation of indica rice. Plant Cell Rep. 23, 540–547.
Liu, H., Li, X., Xiao, J. and Wang, S. (2012) A convenient method for simultaneous quantification of multiple phytohormones and metabolites:
application in study of rice-bacterium interaction. Plant Methods, 8, 2.
Livak, K.J. and Schmittgen, T.D. (2001) Analysis of relative gene expression
data using real-time quantitative PCR and the 2DDCT Method. Methods,
25, 402–408.
Lu, C.A., Lin, C.C., Lee, K.W., Chen, J.L., Huang, L.F., Ho, S.L., Liu, H.J.,
Hsing, Y.I. and Yu, S.M. (2007) The SnRK1A protein kinase plays a key
role in sugar signaling during germination and seedling growth of rice.
Plant Cell, 19, 2484–2499.
Magneschi, L. and Perata, P. (2009) Rice germination and seedling growth
in the absence of oxygen. Ann. Bot. 103, 181–196.
Manavella, P.A., Arce, A.L., Dezar, C.A., Bitton, F., Renou, J.P., Crespi, M.
and Chan, R.L. (2006) Cross-talk between ethylene and drought signalling
pathways is mediated by the sunflower Hahb-4 transcription factor. Plant
J, 48, 125–137.
Metraux, J.P. and Kende, H. (1983) The role of ethylene in the growth
response of submerged deep water rice. Plant Physiol. 72, 441–446.
Sharp, R.E. (2002) Interaction with ethylene: changing views on the role of
abscisic acid in root and shoot growth responses to water stress. Plant
Cell Environ. 25, 211–222.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849
An ETOL1 homolog modulates water stress tolerance in rice 849
Shen, X., Liu, H., Yuan, B., Li, X., Xu, C. and Wang, S. (2011) OsEDR1 negatively regulates rice bacterial resistance via activation of ethylene biosynthesis. Plant Cell Environ. 34, 179–191.
Souza Cde, A., Barbazuk, B., Ralph, S.G., Bohlmann, J., Hamberger, B. and
Douglas, C.J. (2008) Genome-wide analysis of a land plant-specific acyl:
coenzyme A synthetase (ACS) gene family in Arabidopsis, poplar, rice
and Physcomitrella. New Phytol. 179, 987–1003.
Tanaka, Y., Sano, T., Tamaoki, M., Nakajima, N., Kondo, N. and Hasezawa,
S. (2005) Ethylene inhibits abscisic acid-induced stomatal closure in Arabidopsis. Plant Physiol. 138, 2337–2343.
Tsuchisaka, A. and Theologis, A. (2004) Unique and overlapping expression
patterns among the Arabidopsis 1-amino-cyclopropane-1-carboxylate
synthase gene family members. Plant Physiol. 136, 2982–3000.
Waadt, R., Schmidt, L.K., Lohse, M., Hashimoto, K., Bock, R. and Kudla, J.
(2008) Multicolor bimolecular fluorescence complementation reveals
simultaneous formation of alternative CBL/CIPK complexes in planta.
Plant J, 56, 505–516.
Wang, C., Avdiushko, S. and Hildebrand, D.F. (1999) Overexpression of a
cytoplasm-localized allene oxide synthase promotes the wound-induced
accumulation of jasmonic acid in transgenic tobacco. Plant Mol. Biol. 40,
783–793.
Wang, K.L., Li, H. and Ecker, J.R. (2002) Ethylene biosynthesis and signaling
networks. Plant Cell, 14(Suppl), S131–S151.
Wang, K.L., Yoshida, H., Lurin, C. and Ecker, J.R. (2004) Regulation of ethylene
gas biosynthesis by the Arabidopsis ET01 protein. Nature, 428, 945–950.
Wang, L., Xie, W., Chen, Y. et al. (2010) A dynamic gene expression atlas
covering the entire life cycle of rice. Plant J, 61, 752–766.
Warthmann, N., Chen, H., Ossowski, S., Weigel, D. and Herve, P. (2008)
Highly specific gene silencing by artificial miRNAs in rice. PLoS ONE, 3,
e1829.
Wilkinson, S. and Davies, W.J. (2010) Drought, ozone, ABA and ethylene:
new insights from cell to plant to community. Plant Cell Environ. 33,
510–525.
Woeste, K.E., Ye, C. and Kieber, J.J. (1999) Two Arabidopsis mutants that
overproduce ethylene are affected in the posttranscriptional regulation
of 1-aminocyclopropane-1-carboxylic acid synthase. Plant Physiol. 119,
521–530.
Wu, C., Li, X., Yuan, W. et al. (2003) Development of enhancer trap lines for
functional analysis of the rice genome. Plant J, 35, 418–427.
Xiang, Y., Huang, Y. and Xiong, L. (2007) Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement. Plant Physiol.
144, 1416–1428.
Xu, K., Xu, X., Fukao, T., Canlas, P., Maghirang-Rodriguez, R., Heuer, S., Ismail, A.M., Bailey-Serres, J., Ronald, P.C. and Mackill, D.J. (2006) Sub1A
is an ethylene-response-factor-like gene that confers submergence tolerance to rice. Nature, 442, 705–708.
Yamagami, T., Tsuchisaka, A., Yamada, K., Haddon, W.F., Harden, L.A. and
Theologis, A. (2003) Biochemical diversity among the 1-amino-cyclopropane-1-carboxylate synthase isozymes encoded by the Arabidopsis gene
family. J. Biol. Chem. 278, 49102–49112.
Yoo, S.D., Cho, Y.H. and Sheen, J. (2007) Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat.
Protoc. 2, 1565–1572.
Yoshida, H., Wang, K.L., Chang, C.M., Mori, K., Uchida, E. and Ecker, J.R.
(2006) The ACC synthase TOE sequence is required for interaction with
ET01 family proteins and destabilization of target proteins. Plant Mol.
Biol. 62, 427–437.
Zhang, J., Li, C., Wu, C., Xiong, L., Chen, G., Zhang, Q. and Wang, S. (2006)
RMD: a rice mutant database for functional analysis of the rice genome.
Nucleic Acids Res. 34, D745–D748.
© 2014 The Authors
The Plant Journal © 2014 John Wiley & Sons Ltd, The Plant Journal, (2014), 78, 834–849