1. health and fitness
2. disease

CYSTEINYL LEUKOTRIENE RECEPTOR 2 ACTIVATION
MEDIATES POST-MYOCARDIAL ISCHEMIA/REPERFUSION INJURY
INFLAMMATORY PROCESSES
BY
NATHAN CHEN NI
A THESIS SUBMITTED TO THE GRADUATE PROGRAM IN PHYSIOLOGY
IN CONFORMITY WITH THE REQUIREMENTS FOR THE
DEGREE OF DOCTOR OF PHILOSOPHY
QUEEN'S UNIVERSITY
KINGSTON, ONTARIO, CANADA
SEPTEMBER, 2013
COPYRIGHT © NATHAN CHEN NI, 2013
Abstract
Myocardial infarction (MI) is primarily caused by blockade of the coronary circulation, resulting
in ischemic insult. The only available remedy is reperfusion, which induces oxidative stress and
activates inflammatory responses at the site of injury. Cysteinyl leukotrienes (cysLTs) are potent
pro-inflammatory mediators that exert their effects through two classical receptors: cysLT
receptor 1 (CysLT 1 R) and cysLT receptor 2 (CysLT 2 R), the latter of which is prevalent in the
heart and circulatory system and has been implicated in cardiovascular disease. However,
although endothelial CysLT 2 R overexpression exacerbates MI damage and induces vascular
hyperpermeability, understanding of CysLT 2 R activation-induced mechanisms is poor, as
isolating CysLT 2 R-specific effects has proven difficult due to a lack of appropriate
pharmacological agents. We investigate herein the role of CysLT 2 R activation in myocardial
ischemia/reperfusion injury. We have characterized a novel CysLT 2 R-selective antagonist
BayCysLT 2 in both in vitro and in vivo systems, and establish that CysLT 2 R-selective
antagonism attenuates exacerbated MI injury, adhesion molecule gene regulation, and
myocardial neutrophil presence observed in CysLT 2 R overexpressing (EC) mice. We also
examined effects of CysLT 2 R antagonism in long-term cardiac remodeling post-myocardial
infarction, and found that blockade of CysLT 2 R post-reperfusion, regardless of whether
CysLT 2 R is overexpressed or not, elicits a mild pathological cardiac hypertrophic response
despite mitigating infarction damage to the apical ventricular wall. Finally, we created a novel
mouse model (EC/KO) that expresses CysLT 2 R predominantly in vascular endothelium in order
to identify tissue-specific mechanisms of CysLT 2 R activation. Surprisingly, MI injury was
attenuated in EC/KO mice, indicating that both endothelial and non-endothelial CysLT 2 R
ii
expression subsets have roles in mediating infarction injury. Indeed, EC/KO mice demonstrated
hyperpermeability in cremaster venules only when leukotrienes are applied, in contrast to EC
mice. In addition, endothelial CysLT 2 R activation facilitates leukocyte transmigration, whereas
non-endothelial CysLT 2 Rs regulate basal rolling leukocyte flux in microvasculature. Although
much work remains to be done, the characterization of a CysLT 2 R-selective antagonist provides
a vital tool for CysLT 2 R research moving forward, and our investigation of CysLT 2 R activation
reveal the existence of a complicated and multi-faceted pathway resulting in activation of proinflammatory mechanisms.
iii
Co-Authorship
Nathan C. Ni, as part of a collaboration with Dr. Colin D. Funk, conceived all hypotheses
examined in the current work. Unless otherwise stated, Nathan C. Ni designed and performed
experiments, analyzed results, and disseminated the collective works presented for publication.
Dong Yan, as part of a collaboration with Dr. Derek A. Pratt, synthesized BayCysLT 2 for
Chapter 2 and generated the data presented in Figures 2-1, 2-2, 2-3, and 2-5, as well as the
figures themselves. Dr. Alma Barajas-Espinosa assisted with the myeloperoxidase assay for
Chapter 2. Laurel L. Ballantyne performed the LAD ligation surgery for Chapters 2, 3, and 4,
the cremaster muscle surgery for Chapter 4, assisted with the vascular ear permeability assay for
Chapter 2, and conducted the ultrasound measurements under the advisement of Nathan C. Ni for
Chapter 3. Tim St. Amand provided the transfected HEK-293 cells and assisted with the calcium
imaging experiments for Chapter 2. Jeffrey D. Mewburn performed the cremaster muscle
surgery and provided technical assistance for intravital microscopy image capture and analysis
for Chapter 4. Chapter 2 has been published in the Journal of Pharmacology and Experimental
Therapeutics (Volume 339 (3), pages 768-78, Dec 2011).
iv
Acknowledgements
First and foremost, my gratitude goes to my supervisor, Dr. Colin D. Funk, for his support and
mentorship throughout the course of this project, for teaching me much about not only the
academic side of science, but also about lab management and how to cultivate a successful
research environment. This degree would not be possible without him. My gratitude goes out as
well to my committee members Dr. Shetuan Zhang, Dr. Christopher A. Ward, Dr. Donald H.
Maurice, and Dr. Janos Filep, for their invaluable advice and commentary.
To the Funk lab, past and present, you have my gratitude for providing a unique learning and
working environment throughout these four years. Thank you for being there through the ups
and downs, the good and the bad. I would like to give special thanks to Mr. Tim “LoveGame”
St. Amand, Ms. Laurel “Poker Face” Ballantyne, Ms. Crystal “Just Dance” McCracken, Dr.
Alma “Alejandro” Barajas Espinosa, and Mr. Dong “The Edge of Glory” Yan for their
camaraderie, advice, support, and friendship over the years. See, I did learn something from that
blasted radio after all.
I would like to offer my sincere thanks to my parents for all of their effort and love over the
years, for their sweat – and occasionally even blood. Although I can never repay all that they
have given me, I can do my best to at least provide the next generation the same opportunities.
Finally, to my wife Samantha, who has been with me through thick and thin, sickness and health,
and to the ends of the world: ES ERGO SUM.
v
Table of Contents
ABSTRACT................................................................................................................................... ii
CO-AUTHORSHIP ..................................................................................................................... iv
ACKNOWLEDGEMENTS ......................................................................................................... v
LIST OF FIGURES AND ILLUSTRATIONS........................................................................... x
LIST OF TABLES ....................................................................................................................... xi
LIST OF ABBREVIATIONS .................................................................................................... xii
CHAPTER 1: GENERAL INTRODUCTION ..................................................................................... 1
1.1. MYOCARDIAL INFARCTION ................................................................................................... 2
1.1.1. Cause and Prevalence .................................................................................................. 2
1.1.2. Ischemic Injury ............................................................................................................. 3
1.1.3. Reperfusion Injury ........................................................................................................ 4
1.1.4. Post-Reperfusion Inflammation Cascades.................................................................... 6
1.2. LEUKOTRIENES...................................................................................................................... 9
1.2.1. Leukotriene Synthesis Pathway .................................................................................. 10
1.2.2. Leukotriene Transcellular Biosynthesis...................................................................... 16
1.2.3. Leukotriene B 4 ............................................................................................................ 18
1.2.4. Cysteinyl Leukotrienes................................................................................................ 20
1.3. CYSTEINYL LEUKOTRIENE RECEPTORS ............................................................................... 22
1.3.1. Cysteinyl Leukotriene Receptor 1 ............................................................................... 22
1.3.2. Cysteinyl Leukotriene Receptor 2 ............................................................................... 25
1.3.3. Other Cysteinyl Leukotriene Receptors ...................................................................... 27
1.4. LEUKOTRIENE INVOLVEMENT IN PATHOLOGY .................................................................... 30
1.4.1. Asthma/Respiratory Diseases ..................................................................................... 30
1.4.2. Cancer......................................................................................................................... 32
1.4.3. Ischemic/Cardiovascular Disease .............................................................................. 34
1.5. RESEARCH OBJECTIVES AND HYPOTHESES ......................................................................... 39
CHAPTER 2: A SELECTIVE CYSTEINYL LEUKOTRIENE RECEPTOR 2 ANTAGONIST BLOCKS
MYOCARDIAL ISCHEMIA/REPERFUSION INJURY AND VASCULAR PERMEABILITY IN MICE ......... 41
2.1. ABSTRACT ........................................................................................................................... 42
2.2. INTRODUCTION.................................................................................................................... 44
2.3. MATERIALS AND METHODS ................................................................................................ 47
vi
2.3.1. BayCysLT 2 Synthesis .................................................................................................. 47
2.3.2. β-Galactosidase-β-Arrestin Assay .............................................................................. 51
2.3.3. Measurement of Agonist-Induced Intracellular Calcium Mobilization...................... 51
2.3.4. Animal Models ............................................................................................................ 53
2.3.5. Vascular Ear Permeability Assay ............................................................................... 53
2.3.6. Ischemia/Reperfusion Surgical Model........................................................................ 54
2.3.7. Analysis of Infarct Volume.......................................................................................... 55
2.3.8. RNA Extraction and Quantitative Real-Time PCR..................................................... 56
2.3.9. Myeloperoxidase Assay............................................................................................... 57
2.3.10. Statistical Analysis.................................................................................................... 59
2.4. RESULTS ............................................................................................................................. 60
2.4.1. Synthesis and chemistry .............................................................................................. 60
2.4.2. BayCysLT 2 is more potent than Bay-u9773................................................................ 60
2.4.3. BayCysLT 2 is selective for CysLT 2 R in vitro and in vivo ........................................... 62
2.4.4. BayCysLT 2 attenuates exacerbation of myocardial damage in EC mice ................... 66
2.4.5. Upregulation of adhesion molecule gene expression is attenuated by BayCysLT 2 .... 68
2.5. DISCUSSION......................................................................................................................... 72
2.6. ACKNOWLEDGEMENTS ........................................................................................................ 76
CHAPTER 3:. LONG-TERM MYOCARDIAL REMODELING POST-ISCHEMIA/REPERFUSION INJURY
IS MILDLY IMPAIRED BY CYSLT 2 R ANTAGONISM. ...................................................................... 77
3.1. ABSTRACT ........................................................................................................................... 78
3.2. INTRODUCTION.................................................................................................................... 79
3.3. MATERIALS AND METHODS ................................................................................................ 82
3.3.1. Mouse Models ............................................................................................................. 82
3.3.2. Myocardial Infarction Induction ................................................................................ 82
3.3.3. Echocardiography ...................................................................................................... 83
3.3.4. Statistical Analysis...................................................................................................... 85
3.4. RESULTS ............................................................................................................................. 86
3.4.1. Age-related weight gain post-ischemia/reperfusion is unaltered by overexpression of
endothelial CysLT 2 R or by BayCysLT 2 treatment. ............................................................... 86
3.4.2. Post-ischemia/reperfusion pathological cardiac hypertrophy is exacerbated in
animals treated with BayCysLT 2 . ......................................................................................... 86
3.4.3. Mice treated with BayCysLT 2 show mildly decreased cardiac function. ................... 93
vii
3.4.4. Left ventricular volume and mass are increased in BayCysLT 2 -treated mice postischemia/reperfusion injury. ................................................................................................. 93
3.5. DISCUSSION......................................................................................................................... 97
3.5.1. CysLT 2 R blockade post-I/R injury promotes pathological cardiac hypertrophy. ...... 97
3.5.2. Why does CysLT 2 R overexpression not result in a worse long-term outcome? ......... 98
3.5.3. Why does CysLT 2 R blockade result in an apparently worse long-term outcome?..... 99
3.6. ACKNOWLEDGEMENTS ...................................................................................................... 101
CHAPTER 4: MULTIPLE-SITE ACTIVATION OF THE CYSTEINYL LEUKOTRIENE RECEPTOR 2 IS
REQUIRED FOR EXACERBATION OF ISCHEMIA/REPERFUSION INJURY ...................................... 102
4.1. ABSTRACT ......................................................................................................................... 103
4.2. INTRODUCTION.................................................................................................................. 105
4.3. MATERIALS AND METHODS .............................................................................................. 108
4.3.1. Mouse Models ........................................................................................................... 108
4.3.2. Myocardial Ischemia/Reperfusion............................................................................ 108
4.3.3. Analysis of Infarct Volume........................................................................................ 110
4.3.4. Intravital Microscopy of the Cremaster Vasculature ............................................... 111
4.3.5. Analysis of Vascular Permeability............................................................................ 112
4.3.6. Analysis of Vascular Leukocytes............................................................................... 112
4.3.7. Complete Blood Count.............................................................................................. 113
4.3.8. Statistical Analysis.................................................................................................... 113
4.4. RESULTS ........................................................................................................................... 115
4.4.1. Endothelium-targeted CysLT 2 R overexpression does not exacerbate infarction
damage in the absence of endogenous CysLT 2 R ................................................................ 115
4.4.2. Vascular permeability responses in EC/KO mice differ from those in EC mice ...... 115
4.4.3. Genetic knockout of endogenous CysLT 2 R reduces basal rolling leukocyte flux in
cremaster vasculature. ........................................................................................................ 121
4.4.4. Endothelial-targeted CysLT 2 R overexpression results in diminishing leukocyte flux in
cremaster vasculature following leukotriene stimulation ................................................... 121
4.4.5. Cysteinyl leukotriene stimulation results in increased leukocyte slow rolling fraction
in cremaster vasculature in mice expressing endothelial CysLT 2 R. .................................. 123
4.5. DISCUSSION....................................................................................................................... 128
4.5.1. Endothelial CysLT 2 R is not the sole mediator of CysLT 2 R-mediated
ischemia/reperfusion injury exacerbation .......................................................................... 128
4.5.2. Various tissue-specific CysLT 2 R niches play divergent, yet synergistic, roles in
mediating exacerbation of CysLT 2 R-mediated ischemia/reperfusion injury...................... 132
viii
CHAPTER 5: GENERAL DISCUSSION....................................................................................... 136
5.1. CHARACTERIZATION OF A NOVEL CYSLT 2 R-SELECTIVE ANTAGONIST ............................ 137
5.2. IDENTIFICATION OF CYSLT 2 R-MEDIATED MECHANISMS POST-MYOCARDIAL INFARCTION
................................................................................................................................................. 139
5.2.1. CysLT 2 R is the main cysteinyl leukotriene receptor involved in myocardial infarction
responses ............................................................................................................................. 139
5.2.2. CysLT 2 R activation results in promotion of cell adhesion and vascular
hyperpermeability ............................................................................................................... 141
5.2.3. CysLT 2 R activation on different cell types mediate distinct and separate responses
............................................................................................................................................ 143
5.2.4. The CysLT 2 R picture is far from complete ............................................................... 148
5.3. CYSLT 2 R ANTAGONISM POST-REPERFUSION IMPEDES LONG-TERM VENTRICULAR
REMODELING ........................................................................................................................... 152
5.4. POTENTIAL FOR THE CYSLT 2 R AS A THERAPEUTIC TARGET............................................. 154
REFERENCES.......................................................................................................................... 156
APPENDIX................................................................................................................................ 193
FORMULAE USED TO CALCULATE CARDIAC FUNCTION FROM ECHOCARDIOGRAPHY IMAGES . 193
ix
List of Figures and Illustrations
Figure 1-1: Leukotriene synthesis pathway. ................................................................................. 12
Figure 2-1: Chemical synthesis of BayCysLT 2 . ........................................................................... 61
Figure 2-2: BayCysLT2 is a more potent antagonist of the human CysLT2 receptor than Bay-u9773 .. 63
Figure 2-3: BayCysLT 2 selectively antagonizes the human CysLT2 receptor calcium responses.... 64
Figure 2-4: BayCysLT 2 is ≥500-fold more selective for CysLT 2 R than CysLT 1 R. .................... 65
Figure 2-5: BayCysLT 2 is a potent selective antagonist at the CysLT 2 receptor in vivo. ............ 67
Figure 2-6: BayCysLT 2 attenuates CysLT 2 R-mediated exacerbation of myocardial ischemia/
reperfusion injury in mice. .................................................................................................... 69
Figure 2-7: BayCysLT 2 attenuates indirect measures of leukocyte recruitment in ischemia/
reperfusion injury-induced diapedesis. ................................................................................. 71
Figure 3-1: Echocardiography imaging and left ventricular dimensional measurement methodology... 84
Figure 3-2: Representative images of left ventricular remodeling post-myocardial infarction.... 89
Figure 4-1: Myocardial injury is not elevated in EC/KO mice following ischemia/reperfusion..... 117
Figure 4-2: Vascular permeability post-surgical intervention (“basal”) is elevated in EC mice, but
not in EC/KO mice.............................................................................................................. 119
Figure 4-3: CysLT 2 R activation mediates vascular hyperpermeability. .................................... 120
Figure 4-4: Basal rolling leukocyte flux is mediated by endogenous CysLT 2 R. ....................... 122
Figure 4-5: Rolling leukocyte flux diminishes in mice expressing elevated endothelial CysLT 2 R
post-leukotriene stimulation................................................................................................ 124
Figure 4-6: Rolling leukocyte velocity distributions in mice before and after cysteinyl leukotriene
stimulation........................................................................................................................... 126
Figure 4-7: Rolling leukocyte velocity medians in mice before and after cysteinyl leukotriene
stimulation........................................................................................................................... 127
Figure 4-8: Proposed schematic for CysLT 2 R inflammatory response modulation................... 134
x
List of Tables
Table 2-1: Primers used in qualitative real-time PCRs................................................................. 58
Table 3-1: Body weights of mice prior to and following ischemia/reperfusion injury at time of
echocardiography.................................................................................................................. 87
Table 3-2: Left ventricular wall measurements of mice post-I/R injury. ..................................... 90
Table 3-3: Left ventricular dimensions of mice post-I/R injury. .................................................. 91
Table 3-4: Apex wall thickness measurements of mice post-I/R injury....................................... 92
Table 3-5: Evaluation of functional measurements in mice post-I/R injury................................. 94
Table 3-6: Left ventricular volume and mass measurements in mice post-I/R injury.................. 96
Table 4-1: CysLT 2 R expression profile in featured mouse genotypes. ...................................... 109
xi
List of Abbreviations
5-HpETE
aa
ADP
AMP
ANOVA
ATP
BAL
BayCysLT 2
Bay-u9773
BLT 1 R
BLT 2 R
bpm
cAMP
CD
CO
COX
cPLA 2 α
CVD
CysLT
CysLT 1 R
CysLT 2 R
CysLT E R
DiP
DMSO
EC
EC/KO
EC 50
EF
ERK
EtOAc
FITC
FLAP
FS
GAPDH
GGT
GM-CSF
GPCR
5-hydroperoxyeicosatetraenoic acid
amino acid
adenosine diphosphate
adenosine monophosphate
analysis of variance
adenosine triphosphate
bronchoalveolar lavage
3-[[(3-carboxycyclohexyl)amino]carbonyl]-4-[3-[4-(4-phenoxybutoxy)
phenyl]propoxy]-benzoic acid
4-(((1R,2E,4E,6Z,9Z)-1-((1S)-4-carboxy-1-hydroxybutyl)-2,4,6,9pentadecatetraen-1-yl)thio)benzoic acid
Leukotriene B 4 receptor 1
Leukotriene B 4 receptor 2
beats per minute
cyclic adenosine monophosphate
cluster of differentiation
cardiac output
cycloxygenase
cytosolic phospholipase A 2 α
cardiovascular disease
cysteinyl leukotriene
cysteinyl leukotriene receptor 1
cysteinyl leukotriene receptor 2
cysteinyl leukotriene receptor E
dipeptidase
dimethyl sulfoxide
endothelial cell-targeted CysLT 2 R-overexpressing transgenic mouse model
endothelial cell-"restricted" CysLT 2 R-overexpressing transgenic mouse model
half maximal effective concentration
ejection fraction
extracellular signal-regulated kinase
ethyl acetate
fluorescein isothiocyanate
5-lipoxygenase-activating protein
fractional shortening
glyceraldehyde 3-phosphate dehydrogenase
γ-glutamyl transferase
granulocyte/macrophage colony-stimulating factor
G protein-coupled receptor
xii
GPR17
GPR99
GSK
HAMI3379
HEK
HUVEC
I/R
IC 50
ICAM
IFN
IL
IVS
KO
LAD
LFA
LO
LPS
LT
LTA 4 H
LTC 4 S
LV
LVID
LVOD
LVPW
MAPK
MAPKAPK
MCP
M-CSF
mGST
MI
MIP
MK571
MMP
MPO
MRP
NAD(P)H
NMLTC 4
NMR
P2Y 12
G protein-coupled receptor 17
G protein-coupled receptor 99
glycogen synthase kinase
3-[[(3-carboxycyclohexyl)amino]carbonyl]-4-[3-[4-[4-(cyclohexyloxy)
butoxy]phenyl]propoxy]-benzoic acid
human embryonic kidney
human umbilical vein endothelial cell
ischemia/reperfusion
half maximal inhibitory concentration
intercellular adhesion molecule
interferon
interleukin
interventricular septum
knockout
left anterior descending coronary artery
lymphocyte function-associated antigen
lipoxygenase
lipopolysaccharide
leukotriene
leukotriene A 4 hydrolase
leukotriene C 4 synthase
left ventricle
left ventricular internal dimension
left ventricular outer dimension
left ventricular posterior wall
mitogen-activated protein kinases
MAP kinase-activated protein kinase
monocyte chemotactic protein
macrophage colony-stimulating factor
microsomal glutathione-S-transferase
myocardial infarction
macrophage inflammatory protein
(E)-3-[[[3-[2-(7-chloro-2-quinolinyl)ethenyl]phenyl][[3-(dimethylamino)-3oxopropyl]thio]methyl]thio]-propanoic acid
matrix metalloproteinases
myeloperoxidase
multidrug resistance-associated protein
Nicotinamide adenine dinucleotide (phosphate)
N-methyl leukotriene C 4
nuclear magnetic resonance
purinergic receptor P2Y, G-protein coupled, 12
xiii
PAF
PBS
PG
PI3K
PKA
PKC
RLU
ROS
SEM
SRS
SRS-A
SV
TEM
TGF
THF
TLC
TLR
TNF
UDP
VCAM
platelet activating factor
phosphate-buffered saline
prostaglandin
phosphatidylinositide 3-kinase
protein kinase A
protein kinase C
relative light unit
reactive oxygen species
standard error of the mean
slow reacting substance
slow reacting substance of anaphylaxis
stroke volume
Tie2-expressing monocyte
transforming growth factor
tetrahydrofuran
thin layer chromatography
toll-like receptor
tumour necrosis factor
uridine diphosphate
vascular cell adhesion molecule
xiv
Chapter 1: General Introduction
Cardiovascular disease (CVD) is a major problem in modern society: it resulted in over 800,000
deaths (25% more than cancer) in the United States alone in 2008. In addition, CVD related
cases cost the United States health system an estimated ~300 billion dollars per year. Globally,
cardiovascular disease strikes primarily industrialized nations, but is prevalent in Asia, Europe,
and the Americas, making it a global health issue. Further exacerbating the problem is that
cardiovascular disease risk factors, primarily obesity (present in 68% of the United States adult
population), hypertension (33.5%), and diabetes mellitus (11.1%, plus an additional 37% with
prediabetes) are on the rise, and medical costs relating to cardiovascular heart disease are
projected to increase by ~200% in the next twenty years. While the death rate has plateaued in
recent years, the number of CVD related operations performed in the United States increased
22% from 1999 to 2009, indicating an overall increase in disease prevalence (Heidenreich et al.,
2011; Roger et al., 2012).
Treatment options for cardiovascular disease are largely post-hoc, focusing on limiting damage,
where possible, rather than directly attacking underlying mechanisms responsible for
pathogenesis, which is problematic as the heart possesses relatively limited regenerative
properties. Preventative therapy mainly centers around lifestyle changes in order to remove
CVD risk factors or use of pharmaceutical agents to suppress them. Herein, we examine the
involvement of leukotrienes, pro-inflammatory lipid mediators, in myocardial
ischemia/reperfusion injury, and focus in particular on activation of the cysteinyl leukotriene
receptor 2 (cysLT 2 R) as a mediator of leukotriene-triggered pathways during and following
ischemia/reperfusion injury. We seek to identify potential therapeutic targets for the treatment of
1
cardiovascular disease by elucidating the molecular, genetic, and cellular mechanisms underlying
CysLT 2 R-mediated ischemia/reperfusion injury size modulation.
1.1. Myocardial Infarction
1.1.1. Cause and Prevalence
Myocardial infarction (MI), commonly referred to as a “heart attack” (although it is not the sole
condition covered by that blanket vernacular), is a situation where myocardial blood supply is
interrupted, leading to oxygen and nutrient deprivation of the myocardium. If left untreated, MI
leads to myocardial necrosis and loss of cardiac function. The main cause of coronary arterial
blockage is physical disruption of a lipid and macrophage filled atherosclerotic plaque, resulting
in the formation of a thrombus which partially or fully occludes the vascular lumen (Davies et
al., 1976; Van de Werf et al., 2008). Long-term treatment usually revolves around removal or
circumvention of the obstruction (i.e. stenting or coronary bypass surgery). Acute treatment is
surgical (i.e. angioplasty) or pharmacological (i.e. thrombolysis) intervention to restore blood
flow (Van de Werf et al., 2008). Timely reperfusion of the myocardium is not without its
caveats, as a phenomenon termed “reperfusion injury” has been noted for many years - and will
be explored later in this introduction (Yellon and Hausenloy, 2007).
Of all deaths due to cardiovascular disease in the United States, 50% were attributed to coronary
heart disease (including myocardial infarction), and the projected number of coronary heart
disease sufferers is projected to rise by as many as 8 million people in 20 years. Myocardial
2
infarction sufferers are also more susceptible to cardiovascular heart disease (whether stroke,
heart failure, or another infarction) than the general population, and show a 1.5 to 15-fold
increased chance of illness or death following a first myocardial infarction (Roger et al., 2012).
Myocardial infarction pathogenesis is extremely complicated, but known risk factors include
age, gender, hypercholesterolemia/hyperlipidemia, obesity, diabetes mellitus, hypertension,
smoking, and stress (Graham et al., 2007; Nabel and Braunwald, 2012; Roger et al., 2012; Smith
et al., 2006).
1.1.2. Ischemic Injury
Myocardial ischemia, as noted previously, is characterized by a coronary arterial blockage
resulting in oxygen and nutrient deficiency in the affected myocardium. Upon onset of ischemia,
mitochondrial oxidative phosphorylation ceases within seconds, resulting in the loss of the
primary ATP production pathway in the cell and a compensatory increase in anaerobic
glycolysis. Increased glycolysis results in H+ and lactate accumulation, creating a state of
intracellular acidosis (Buja, 2005; Kloner and Jennings, 2001). These metabolic alterations
result in ATP and creatine phosphate depletion, as well as adenine nucleotide pool degradation.
The latter occurs because ADP is formed via the actions of various cellular ATPases much more
rapidly than the phosphorylation of ADP to ATP by anaerobic glycolysis (Rovetto et al., 1975).
Adenylate kinase then captures the high energy phosphate group present on ADP, resulting in the
formation of AMP and adenosine. Adenosine is then able to leave the cell, where it is further
degraded to inosine and hypoxanthine (Kloner and Jennings, 2001).
3
These alterations to the metabolic state of the myocyte result in ionic imbalance as well. K+
efflux is facilitated by an increased osmotic load that occurs due to metabolite accumulation
(Buja, 2005). The cell will also attempt to correct acidosis via Na+/H+ exchange, which results in
increased intracellular Na+ concentrations (Ladilov et al., 1995). Normally, excess intracellular
Na+ would be removed by the Na+/K+ ATPase, but ATP depletion prevents this (Kloner and
Jennings, 2001). Elevated intracellular Na+ leads to H 2 O influx and cell swelling, as well as the
prevention of calcium export via the Na+/Ca2+ exchanger, leading to increased intracellular Ca2+
concentrations. In extreme cases, calcium may be imported by the Na+/Ca2+ exchanger in an
attempt to compensate for elevated Na+ levels (Schafer et al., 2001). Intracellular Ca2+
concentration increase also results in activation of proteases, leading to decreased sensitization to
Ca2+ in contractile proteins and therefore, impaired myocyte contractility (Buja, 2005).
Together, these conditions result in changes to myocardial contractility and a decrease in
membrane potential (Kloner and Jennings, 2001), creating an environment that favours the
development of ventricular arrhythmia (Buja, 2005). The aforementioned changes are
deleterious, but still reversible with timely restoration of oxygen and nutrient supply. However,
prolonged/untreated ischemia will eventually result in loss of cell membrane integrity, as the
alterations to the metabolic state, combined with elevated intracellular Ca2+ levels activate
phospholipases, resulting in the degradation of the phospholipid bilayer. In addition, activated
proteases cleave cytoskeletal filaments, which normally anchor the sarcolemma to myofibrils.
Eventually, these collective changes result in the compromise of sarcolemmal physical integrity
and the death of the myocyte (Buja, 2005).
1.1.3. Reperfusion Injury
4
While prolonged ischemia is obviously deleterious to survival, the restoration of oxygen and
nutrient supply - "reperfusion" - is a double-edged sword. During ischemia, ATP is gradually
degraded to inosine and hypoxanthine (Kloner and Jennings, 2001), and nitric oxide synthase
(NOS) is uncoupled (Raedschelders et al., 2012). Upon reperfusion, four major redox reactions
are activated, all resulting in the production of superoxide radicals. Xanthine oxidase converts
hypoxanthine to xanthine, and then xanthine to uric acid, yielding a superoxide radical each time.
In addition, the uncoupled NOS complex and the activated NAD(P)H oxidase enzyme both
oxidize NAD(P)H to NAD(P)+, resulting in the reduction of O 2 to superoxide (Kleikers et al.,
2012; Raedschelders et al., 2012). The activation of these redox reactions is exacerbated by a
severe increase in arterial flow during the first 5 minutes of reperfusion, resulting in massive
reactive oxygen species (ROS) production (Kloner and Jennings, 2001). Finally, reactivation of
aerobic respiration results in production of ROS via the electron transport chain (Raedschelders
et al., 2012). The increase in free radical presence/production not only serves to deliver
oxidative stress damage, but in tandem with elevated intracellular Ca2+ concentrations, triggers
mitochondrial permeability transition pore opening (Halestrap et al., 2004). This results in
mitochondrial swelling, the collapse of the mitochondrial membrane potential, uncoupling of
oxidative phosphorylation, reversal of F 1 F 0 ATPase activity (the promotion of hydrolysis rather
than synthesis of ATP), and release of cytochrome c - resulting in the activation of pro-apoptotic
caspases (Di Lisa and Bernardi, 2006; Halestrap et al., 2004). Certainly, these deleterious effects
are transient (Kloner and Jennings, 2001), but damage caused at the point of reperfusion is often
more severe than damage suffered during the ischemic period (but of course, not as severe as the
potential damage to a non-reperfused myocardium) (Yellon and Hausenloy, 2007).
5
1.1.4. Post-Reperfusion Inflammation Cascades
Myocardial infarction also results in the activation of a myriad of pro-inflammatory cascades.
Compromise of cell membrane integrity during MI activates the complement cascade of the
innate immune system via release of mitochondrial membrane proteins (Frangogiannis et al.,
2002). Complement pathway component mRNA and protein levels were significantly
upregulated in infarction zones (Vakeva et al., 1998; Yasojima et al., 1998). As outlined
previously, ischemia/reperfusion (I/R) injury provokes the formation of reactive oxygen species.
ROS then triggers the release of proteases and damage-associated molecular pattern molecules the latter of which activate Toll-like receptors (TLRs) 2, 4, and 5, eventually resulting in the
upregulation of adhesion molecules including vascular cell adhesion molecule-1 (VCAM-1),
intercellular adhesion molecule-1 (ICAM-1), and E-selectin (Carden and Granger, 2000;
Marchant et al., 2012; Steffens et al., 2009), as well as pro-inflammatory cytokines such as
tumour necrosis factor (TNF)-α, interleukin (IL)-1α, and IL-1β (Ock et al., 2012). Indeed,
genetic inactivation of TLR-2 and TLR-4 results in reduced damage following MI (Chong et al.,
2004; Shishido et al., 2003). ROS are also capable of acting directly upon endothelial cells,
resulting in the release of pro-chemotaxtic factors such as leukotriene B 4 and platelet activating
factor (PAF), as well as increased surface expression of P-selectin via triggering release of the
adhesion molecule from Weibel-Palade bodies (Carden and Granger, 2000). Indeed, the use of
free radical scavengers, such as SOD and catalase, results in reduction of infarction size (Jolly et
al., 1984), and genetic overexpression of superoxide dismutase is cardioprotective (Chen et al.,
1998; Wang et al., 1998). Finally, I/R injury activates phospholipase A 2 , resulting in increased
6
arachidonic acid levels - which are then subsequently metabolized into pro-inflammatory
prostaglandins, eicosanoids, and/or leukotrienes (LTs) (Ahn and Kim, 2012) by circulating
neutrophils and/or platelets (Tada et al., 1988). These mechanisms promote the activation and
recruitment of peripheral blood leukocytes, resulting in additional sources of pro-inflammatory
cytokines present in the proximity of the injury (Carden and Granger, 2000), as well as enhanced
leukocyte extravasation into the myocardium (Frangogiannis et al., 2002). Activation of mast
cells, neutrophils, and monocytes all promote localized release of pro-inflammatory cytokines
and chemokines following ischemia/reperfusion (Frangogiannis et al., 2002; Nahrendorf et al.,
2007), as well as upregulation of pro-inflammatory cytokines including IL-1, IL-6, IL-8,
monocyte chemotactic protein-1 (MCP-1), and macrophage inflammatory protein-1 (MIP-1)
(Frangogiannis et al., 2002; Vandervelde et al., 2007).
Leukocyte extravasation first requires the capture of circulating cells by the endothelium.
Selectin molecules (P-, L-, and E-selectin) bind to their corresponding ligands, creating
leukocyte-endothelial cell connections, and capturing leukocytes close to the endothelium and
slowing cell velocity. These cells then roll along the endothelium, allowing CD18-possessing
molecules (lymphocyte function-associated antigen (LFA)-1, Mac-1, p150,95) to bind to ICAMs,
resulting in firm adhesion of the circulating cell to the endothelial wall, and facilitating
transendothelial migration (Kolaczkowska and Kubes, 2013). An increase in the number of
adherent leukocytes - especially neutrophils - can cause a phenomenon called "no reflow" where
neutrophil accumulation results in capillary plugging following reperfusion (Frangogiannis et al.,
2002). Furthermore, adherent neutrophils also release ROS almost immediately upon ICAM1/Mac-1-mediated adhesion, resulting in myocyte injury and death (Albelda et al., 1994; Entman
7
et al., 1992). Studies with animal models have shown that neutrophil depletion (via antiserumtargeting, leukocyte depletion (via whole blood filtration), and inhibition of neutrophil adhesion
have all resulted in attenuation of ischemia/reperfusion injury (Marchant et al., 2012).
However, leukocyte infiltration is also vital to proper inflammatory response resolution and
wound healing. These mechanisms are mainly mediated by monocytes and macrophages. In
both mice and humans, monocytes exist in two subsets: pro-inflammatory Ly-6Chi (human
analogue: CD14+CD16-) and anti-inflammatory Ly-6Clo (human analogue: CD14lowCD16+)
(Nahrendorf et al., 2007; Ziegler-Heitbrock, 2007). Both are involved in wound healing: the proinflammatory subset is recruited by MCP-1, is responsible for debris scavenging, and is present
from days 1-4 post-infarction (Kempf et al., 2012; Nahrendorf et al., 2007). Proper clearance of
extracellular matrix fragments is vital, as the fragments themselves serve as activators of proinflammatory cells/signaling pathways (Kempf et al., 2012). In contrast, the anti-inflammatory
subset is dominant from days 5-10, is recruited by the presence of CX 3 CR1, and mediates proinflammatory signal repression as well as angiogenic factor production (Frangogiannis, 2012;
Nahrendorf et al., 2007). The macrophage presence in the myocardium post-infarction is mainly
due to monocyte extravasation, which is mediated by C5a, transforming growth factor-β (TGFβ), and MCP-1 (Birdsall et al., 1997; Kumar et al., 1997). The pro-inflammatory environment
upregulates macrophage colony-stimulating factor (M-CSF), inducing monocyte differentiation
into macrophages (Frangogiannis, 2012). These macrophages then limit the inflammatory
response by phagocytosing apoptotic neutrophils and secreting anti-inflammatory mediators such
as lipoxin A 4 , TGF-β, and IL-10. Like monocytes, there are two established macrophage
subsets: M1 (pro-inflammatory and microbicidal) and M2 (anti-inflammatory and phagocytic),
8
and it is the latter subset that is responsible for inflammatory response resolution post-infarction.
Regulatory T lymphocytes are also involved in regulating the inflammatory response, as they
secrete IL-10 and TGF-β, in additional to recruiting M2 macrophages to the injured area
(Hofmann et al., 2012). The ultimate purpose of these responses is to replace necrotic tissue
with granulation tissue, and eventually a collagen-rich scar (Kempf et al., 2012). If the wound
healing response is insufficient, scar formation and injury stabilization are impaired, creating a
predilection for heart failure (Heymans et al., 1999). However, if the post-infarction
inflammatory response is exacerbated, then infarct expansion - the thinning and lengthening of
the infarct area post-reperfusion - and adverse ventricular remodeling occurs (Vanhoutte et al.,
2007). Thus, a proper balance between pro- and anti-inflammatory mechanisms post-infarction
must be maintained in order to limit myocardial injury and preserve heart function.
1.2. Leukotrienes
Arachidonic acid is a 20-carbon molecule polyunsaturated fatty acid that serves as the precursor
to numerous signaling molecules, termed eicosanoids (from the Greek eikosa, meaning twenty,
referring to the number of carbon molecules within their structures). There are four families of
eicosanoid molecules: prostaglandins, prostacyclins, thromboxanes, and leukotrienes. The first
three are collectively termed “prostanoids,” are formed through the actions of cyclooxygenase
(COX) enzymes, and are heavily involved in regulating pain and inflammation (Smyth et al.,
2009). On the other hand, leukotrienes, dubbed such because they were first found to be
produced by leukocytes and they have three carbon-carbon double bonds in their structures, are
formed through the actions of 5-lipoxygenase (5-LO) (Murphy and Gijon, 2007). The
9
leukotriene family consists of five signaling molecules: LTA 4 , B 4 , C 4 , D 4 , and E 4 – the latter
three collectively known as the “cysteinyl leukotrienes (cysLTs)” due to a shared common
cysteine moiety in their structures (Moos and Funk, 2008).
Leukotrienes, although they were not known as such at the time, were first discovered in 1938 by
the laboratory of Charles Kellaway in Melbourne, Australia, who identified that treatment with
snake venom elicited the secretion of a substance which caused smooth muscle contraction that
was not histamine (Feldberg et al., 1938). This substance, termed "slow reacting substance"
(SRS), was also found to be released during anaphylaxis (Kellaway and Trethewie, 1940). Two
decades later, Brocklehurst identified a “slow reacting substance of anaphylaxis” (SRS-A) that
was formed upon antigen stimulus, rather than stored and released like histamine (Brocklehurst,
1960). It would take a further two decades before the identity of SRS-A would be identified. In
1976, Borgeat et al. (1976) discovered that arachidonic acid is oxygenated at the C-5 carbon, and
further research revealed a family of metabolites sharing this trait, including what would later be
known as LTB 4 (Borgeat and Samuelsson, 1979a) and an unstable intermediate later termed
LTA 4 (Borgeat and Samuelsson, 1979b). Structural characterization of SRS-A via highperformance liquid chromatography and mass spectrometry revealed that it was related to the
two compounds found previously, and it was also formed from LTA 4 , and thus was termed
LTC 4 (Murphy et al., 1979). Identification of leukotrienes D 4 and E 4 would soon follow
(Bernstrom and Hammarstrom, 1981; Orning et al., 1980), and all three would be classified as
the constituents of SRS-A (Samuelsson, 1983).
1.2.1. Leukotriene Synthesis Pathway
10
The leukotriene synthesis pathway (Figure 1-1) begins with the liberation of arachidonic acid
from the perinuclear phospholipid membrane, endoplasmic reticulum, and/or Golgi apparatus by
activation of cytosolic phospholipase A 2 α (cPLA 2 α) (Hirabayashi et al., 2004). Arachidonic
acid is then converted into LTA 4 via a two-step mechanism through activation of 5-LO. First,
arachidonic acid undergoes pro-S hydrogen removal at C-7 with migration of the double bond
from C5-C6 to C6-C7, followed by a lipoxygenation reaction at C-5, resulting in the formation
of 5-hydroperoxyeicosatetraenoic acid (5-HpETE). Finally, the pro-R hydrogen at C-10 is
removed, allowing for the rearrangement of the double bonds and the subsequent migration of
the oxygen at C-5 to C-6, forming an epoxide moiety and yielding LTA 4 (Haeggstrom and Funk,
2011). This process is undertaken by 5-LO, but is also facilitated by the action of a second
protein, appropriately named 5-lipoxygenase-activating protein (FLAP). Despite being devoid of
enzyme activity, FLAP has been shown to stimulate arachidonic acid utilization by 5-LO, as well
as 5-LO 5-HpETE-to-LTA 4 conversion efficiency (Abramovitz et al., 1993; Dixon et al., 1990).
While the exact mechanism of action is not fully known, research indicates that FLAP acts as a
scaffolding protein for 5-LO, and likely presents or transfers arachidonic acid to 5-LO (Poeckel
and Funk, 2010).
LTA 4 can be converted either into LTB 4 by the enzyme LTA 4 hydrolase (LTA 4 H), or into LTC 4
by LTC 4 synthase (LTC 4 S). LTA 4 H generates a carbocation that delocalizes its charge over the
conjugated triene system present from C6-C12 of LTA 4 , leaving the C-12 site open for attack by
a H 2 O molecule, which results in the creation of a hydroxyl group. The conjugated triene system
shifts to C5-C11, and the epoxide moiety is removed, leaving a hydroxyl group at C5 and
11
Figure 1-1: Leukotriene synthesis pathway.
Schematic figure of leukotriene synthesis. Increases in intracellular calcium concentrations
promotes the translocation of cytosolic phospholipase A 2 α (cPLA 2 α) and 5-lipoxygenase (5-LO)
to the nuclear membrane, where they complex with 5-LO activating protein (FLAP). cPLA 2 α
liberates arachidonic acid (AA) from the phospholipid bilayer and presents it to 5-LO, which
converts it to leukotriene A 4 (LTA 4 ). LTA 4 is then converted into either leukotriene B 4 (LTB 4 )
by LTA 4 hydrolase (LTA 4 H) present in the cytosol or to leukotriene C 4 by LTC 4 synthase
(LTC 4 S), which is also present at the nuclear membrane. LTB 4 and LTC 4 are exported from the
cell by multidrug-resistance proteins (MRPs) 4 and 1, respectively. LTB 4 binds to BLT
receptors, whereas LTC 4 binds to cysteinyl leukotriene receptors (cysLTRs) 1 and 2. LTC 4 can
also be converted to leukotriene D 4 (LTD 4 ), which also binds to CysLT 1 R and CysLT 2 R, by γglutamyl transferase (GGT). Finally, LTD 4 is converted to the stable metabolite leukotriene E 4
(LTE 4 ), which activates the newly discovered CysLT E R, by dipeptidase (DiP).
12
yielding LTB 4 (Haeggstrom and Funk, 2011). Conversely, LTC 4 S activates a glutathione thiol
via deprotonation of the sulfhydryl group, the resulting thiolate then attacks LTA 4 at C-6,
opening the epoxide ring and conjugating at C-6 to yield LTC 4 . LTC 4 is then converted into
LTD 4 by the actions of γ-glutamyl transferase, which removes the glutamate residue from
glutathione (Funk, 2001). LTD 4 is in turn converted to LTE 4 by dipeptidase, which removes the
glycine residue (Moos and Funk, 2008). LTC 4 S is responsible for the majority of LTC 4
production (Kanaoka et al., 2001), although two related enzymes are also capable of minor LTC 4
production. Microsomal glutathione-S-transferase (mGST) II and mGST III share 44% and 27%
homology to LTC 4 S respectively, but where LTC 4 S only conjugates glutathione to LTA 4 ,
mGST II and mGST III are also able to conjugate glutathione to xenobiotic substances as part of
the detoxification process (Penrose, 1999). mGST II is the dominant LTC 4 producing enzyme in
liver and endothelial cells (Scoggan et al., 1997; Sjostrom et al., 2001).
Synthesis of LTA 4 , LTB 4 , and LTC 4 occur intracellularly. As previously mentioned, increases
in intracellular calcium levels promote cPLA 2 α translocation to the perinuclear region, allowing
access to phospholipid substrates for the liberation of arachidonic acid (Glover et al., 1995;
Schievella et al., 1995). Likewise, 5-LO translocation to the perinuclear membrane is also
prompted by elevation of intracellular calcium (Rouzer and Samuelsson, 1985), although there is
also evidence that arachidonic acid itself may act on 5-LO to alter the affinity of the latter for the
nuclear bilayer (Flamand et al., 2006). 5-LO activity can also be regulated via phosphorylation
at Ser271 (MAPKAPK-2 dependent) (Werz et al., 2000), Ser663 (ERK2 dependent) (Werz et al.,
2002), and Ser523 (cAMP/PKA dependent) (Luo et al., 2004). Phosphorylation at the first two
sites has been shown to activate the enzyme by promoting translocation (Werz et al., 2002; Werz
13
et al., 2000), whereas phosphorylation at Ser523 inactivates 5-LO by preventing translocation
(Luo et al., 2005; Luo et al., 2004). Translocation of 5-LO and cPLA 2 α results in the formation
of a complex with FLAP, which is already present on the inner nuclear membrane (Christmas et
al., 2002). Although most 5-LO expressing cells express 5-LO in the cytoplasm, some cells
possess nucleoplasm expression of the enzyme. Migration from cytoplasm to nucleoplasm is
mediated by Ser271 phosphorylation (Luo et al., 2003), where subsequent elevations in calcium
concentration cause translocation to the inner nuclear membrane, where it can interact directly
with FLAP, but not cPLA 2 α or LTC 4 S (Murphy and Gijon, 2007). This phenomenon occurs in
neutrophils (Brock et al., 1997), eosinophils (Cowburn et al., 1999), and macrophages (Covin et
al., 1998; Woods et al., 1995), and can be triggered by external stimuli or leukocyte-endothelium
interactions upon cell adhesion (Cowburn et al., 1999). Furthermore, whether 5-LO is located in
the nucleoplasm or in the cytoplasm appears to affect the efficiency of leukotriene production, as
research has shown that neutrophils and macrophages with nucleoplasm-localized 5-LO all
showed elevated leukotriene production compared to counterparts that possessed cytosolic 5-LO
(Brock et al., 1997; Woods et al., 1995). While LTA 4 H is a soluble protein predominantly
located in the cytosol that does not translocate, LTC 4 S is found on the outer nuclear membrane
and may form heterodimers with FLAP, although they are predominantly positioned on opposite
sides of the nuclear membrane (Christmas et al., 2002; Haeggstrom and Funk, 2011).
Once synthesized, LTB 4 and LTC 4 are exported from the cell by members of the multidrug
resistance-associated protein (MRP) family - specifically MRP4 and MRP1, respectively
(Haeggstrom and Funk, 2011). Both of these proteins are members of a group of proteins first
identified due to their ability to eliminate amphipathic anions from the cell, thus conferring
14
resistance to pharmacological agents (Kruh and Belinsky, 2003). MRP1 is an ATP-dependent
transporter of glutathione and glucuronate conjugates that is located on the basolateral membrane
in epithelial cells (Kruh and Belinsky, 2003). Its actions can be blocked via competitive
inhibition by the CysLT 1 R pharmacological inhibitor MK571 (Leier et al., 1994), and genetic
inactivation of MRP1 results in 25 to 90% higher concentrations of intracellular LTC 4 in tissues
that highly express the receptor endogenously (Lorico et al., 1997). MRP4 is also ATPdependent, but transports thiopurine nucleotides and cyclic nucleotides, as well as LTB 4 (Kruh
and Belinsky, 2003; Rius et al., 2008). MRP4 requires glutathione as a substrate in order to
function as an LTB 4 exporter, and can serve as a LTC 4 exporter in the absence of glutathione
(Rius et al., 2008).
Interestingly, the expression sites of leukotriene synthesis pathway enzymes do not all coincide,
indicating the presence of transcellular synthesis mechanisms for leukotriene production.
Whereas cPLA 2 α and LTA 4 H are constitutively expressed in most cells (Haeggstrom and Funk,
2011; Murphy and Gijon, 2007), 5-LO expression is restricted primarily to bone marrow-derived
myeloid cells (Radmark and Samuelsson, 2007). Transplantation of 5-LO knockout bone
marrow cells into irradiated wild-type mice does not yield any leukotriene production, indicating
that bone marrow cells are the ultimate source of all leukotrienes produced in vivo (Zarini et al.,
2009). Similarly, LTC 4 S is only expressed in eosinophils, mast cells, monocytes, macrophages
(all of which express 5-LO), as well as platelets (which do not express 5-LO) (Lam et al., 1995;
Maclouf and Murphy, 1988). Expression of these proteins is upregulated by pro-inflammatory
stimuli: cPLA 2 α is upregulated by pro-inflammatory cytokines such as IL-1α, IL-1β, TNF-α
(Clark et al., 1995). 5-LO is upregulated by cell differentiation promoting factors such as TGF-
15
β, and granulocyte/macrophage colony-stimulating factor (GM-CSF) (Radmark et al., 2007). 5LO expression is also upregulated upon monocyte transmigration and subsequent differentiation
into macrophages (Covin et al., 1998; Pueringer et al., 1992). FLAP expression is also
upregulated by GM-CSF stimulation (Pouliot et al., 1994), as well as by pro-inflammatory
mediators cytokines such as IL-5 and TNF-α (Cowburn et al., 1999; Reddy et al., 2003), and
hypoxia (Gonsalves and Kalra, 2010). Finally, LTC 4 S expression is upregulated by
lipopolysaccharide (LPS) stimulation in vivo (Schroder et al., 2005).
1.2.2. Leukotriene Transcellular Biosynthesis
As mentioned, 5-LO expression is limited to bone marrow-derived cells (Radmark and
Samuelsson, 2007), and while many of these cells also possess either LTA 4 H or LTC 4 S, few
cells possess all three of the key enzymes in the leukotriene synthesis cascade. For example,
neutrophils, the primary source of LTA 4 generation, do not possess LTC 4 S (Maclouf and
Murphy, 1988; Zarini et al., 2009). This indicates that leukotriene biosynthesis involves
cooperation between multiple cell types. In vitro experiments have shown that red blood cells
are capable of converting exogenously applied LTA 4 into LTB 4 , (Fitzpatrick et al., 1984;
Haeggstrom, 2004), whereas platelets (Edenius et al., 1988; Maclouf and Murphy, 1988) and
mast cells (Dahinden et al., 1985) can produce LTC 4 under similar circumstances. Similarly, coincubation experiments have shown that LTA 4 produced from neutrophils could be converted to
LTB 4 by red blood cells (McGee and Fitzpatrick, 1986) and macrophages (Grimminger et al.,
1991), and to LTC 4 by endothelial cells (Brady and Serhan, 1992; Feinmark and Cannon, 1986)
and platelets (Maclouf and Murphy, 1988). Neutrophil-produced LTA 4 can also be converted to
16
LTC 4 by keratinocytes (Iversen et al., 1994) and both LTB 4 and LTC 4 by chondrocytes (Amat et
al., 1998). Interestingly, different cells possessed different LT production efficiencies – e.g.
platelets have been demonstrated to be much more efficient in the production of LTC 4 compared
to HUVECs (Folco and Murphy, 2006). Furthermore, LTC 4 production in endothelial cells can
be blocked by inactivation of the cell adhesion molecules L-selectin and CD18, indicating that
neutrophil adhesion to endothelial cells affects leukotriene production (Brady and Serhan, 1992).
These findings have also been confirmed in vivo. Initiation of phagocytosis in whole blood
yielded en masse neutrophil production of LTA 4 , and as a result, large amounts of LTB 4 and
LTE 4 (likely via platelet production of LTC 4 ) (Fradin et al., 1989). Murine lung tissue has no
endogenous sources of LTA 4 (Grimminger et al., 1990), but priming the tissue with endotoxin,
followed by stimulation with chemoattractants, resulted in large amounts of LTB 4 and some
LTC 4 production, likely produced by the cell clumps consisting of a neutrophil/platelet core
surrounded by red blood cells also found in the tissue (Voelkel et al., 1992). In contrast,
exogenous application of LTA 4 to the lung resulted in mostly LTC 4 production - likely from
pulmonary endothelial cells (Grimminger et al., 1988). In the isolated heart, neutrophil
adherence to endothelial cells is instrumental to LTC 4 production (Sala et al., 1996; Sala et al.,
1993). In both isolated vessels (Kubes et al., 1991) and animal models of LAD ligation (Sala et
al., 2000), inhibition of cell adhesion reduces leukotriene production. LTB 4 and LTD 4
production occurs in the brain post-neutrophil infusion, and was accompanied by an increase in
edema (Di Gennaro et al., 2004).
17
Finally, work in knockout and chimeric mouse models has confirmed the existence of
leukotriene transcellular biosynthesis. Research has confirmed that neither 5-LO knockout
(Funk et al., 1995) nor LTA 4 H knockout mice (Byrum et al., 1999) are capable of LTB 4
production. However, Fabre et al. (2002) demonstrated that when cell populations from both
these genotypes are combined, LTB 4 production is possible. Thus, a combination of 5-LO
knockout and LTA 4 H knockout leukocytes produced significant levels of LTB 4 upon zymosan
stimulation in vitro, whereas the individual populations could not. In addition, transplantation of
LTA 4 H knockout bone marrow cells into 5-LO knockout mice resulted in significantly increased
ear inflammation and edema in response to arachidonic acid injection (Fabre et al., 2002).
Finally, Zarini et al. (2009) demonstrated that transplantation of bone marrow cells from wildtype, LTA 4 H knockout, or LTC 4 S knockout mice into 5-LO knockout mice was capable of
restoring production capability for both LTB 4 and cysLTs.
1.2.3. Leukotriene B 4
Leukotriene B 4 exerts its effects via two GPCRs, BLT 1 R and BLT 2 R. BLT 1 R expression was
first discovered on phagocytic leukocytes, but later work showed that the receptor was also
present on granulocytes, monocytes, dendritic cells, lymphocytes, as well as non-circulating cell
types such as vascular smooth muscle cells and endothelial cells. In contrast, BLT 2 R is
expressed ubiquitously in humans, with strongest expression levels found in the spleen, liver,
ovary, and circulating leukocytes (Back et al., 2011). LTB 4 stimulation exerts extremely potent
chemotaxtic effects towards neutrophils (Ford-Hutchinson et al., 1980; Malmsten et al., 1980;
Palmblad et al., 1981), eosinophils (Huang et al., 1998; Ng et al., 1991), monocytes (Friedrich et
18
al., 2003; Vaddi and Newton, 1994), and dendritic cells (Shin et al., 2006), as well as lesser
effects on basophils (Tanimoto et al., 1992), T lymphocytes (Goodarzi et al., 2003; Leppert et al.,
1995), and immature mast cells (Weller et al., 2005). In addition to this, LTB 4 stimulation
evokes the release of a host of pro-inflammatory agents from circulating leukocytes, including
IL-1β (Rola-Pleszczynski and Lemaire, 1985), IL-6 (Brach et al., 1992; Rola-Pleszczynski and
Stankova, 1992), MCP-1 (Huang et al., 2004), while enhancing production of IL-1, IL-2, IL-5,
interferon-γ (IFNγ) (Rola-Pleszczynski et al., 1986; Yamaoka and Kolb, 1993), and IL-17 (Chen
et al., 2009) in T lymphocytes. Finally, LTB 4 stimulation promotes the upregulation and
expression of cell adhesion molecules (Gimbrone et al., 1984; Moraes et al., 2010; Vaddi and
Newton, 1994).
LTB 4 activation of neutrophils also elicits the release of bactericidal agents and proteinases,
including lysozymes (Hafstrom et al., 1981), myeloperoxidase (Terawaki et al., 2005),
azurocidin (Di Gennaro et al., 2009), matrix metalloproteinases (MMPs) (Kjeldsen et al., 1992),
and α-defensins (Flamand et al., 2007a). The triggering of these responses require greater
concentrations of LTB 4 than the chemotaxtic response (Serhan et al., 1982). In addition, LTB 4
stimulation of macrophages increases proliferation (Nieves and Moreno, 2006) and Fc receptormediated phagocytosis (Demitsu et al., 1989; Mancuso and Peters-Golden, 2000) but not
efferocytosis (Canetti et al., 2003). Prolonged exposure to LTB 4 also delays apoptosis in
neutrophils (Hebert et al., 1996), but not in eosinophils (Murray et al., 2003). Finally, LTB 4 acts
on smooth muscle cells to induce vasoconstriction, migration, and proliferation (Back et al.,
2004; Sakata et al., 2004). Under basal conditions, LTB 4 has minimal effects on endothelial
cells. However, BLT 1 R has been observed in atherosclerotic arteries, indicating that
19
inflammation results in the promotion of LTB 4 -mediated pathways (Back et al., 2004). Indeed,
both BLT 1 R (LPS and IL-1β) and BLT 2 R (TNFα) are upregulated by pro-inflammatory stimuli
(Qiu et al., 2006b).
1.2.4. Cysteinyl Leukotrienes
The cysteinyl leukotrienes, as previously mentioned, consist of LTC 4 , LTD 4 , and LTE 4 . They
are produced mainly from eosinophils and mast cells, although endothelial cells, fibroblasts,
monocytes and macrophages can also produce cysLTs by transcellular metabolism (Austen,
2005; Carnini et al., 2011; Flamand et al., 2007b; Vannella et al., 2007). Traditionally, LTC 4
and LTD 4 have been considered the active cysLTs, with LTE 4 relegated to an afterthought
because of a perception that LTE 4 did not exert biological effects (Austen et al., 2009).
However, there is a growing body of literature on LTE 4 -mediated mechanisms, and LTE 4 will
receive more attention now that a receptor (GPR99) that binds LTE 4 preferentially has been
identified (Kanaoka et al., 2013). Cysteinyl leukotrienes exert their effects locally following
secretion - their short half-lives, in tandem with the relative impotency of the stable metabolite
LTE 4 , limits their range (Austen et al., 2009) - and can act in a paracrine or autocrine fashion
(Carnini et al., 2011; Flamand et al., 2007b; Vannella et al., 2007).
Unsurprisingly, given their first identity as SRS-A, cysteinyl leukotrienes are very potent at
inducing smooth muscle constriction. CysLT induction of airway smooth muscle constriction is
very well studied, and as a result, anti-leukotriene pharmacological agents have become a
popular asthma treatment option (Dahlen et al., 1980; Okunishi and Peters-Golden, 2011).
20
CysLTs also affect vascular smooth muscle, and can elicit vasoconstriction in both arteries and
veins (Michelassi et al., 1982; Schellenberg and Foster, 1984). Interestingly, cysLTs have been
shown to induce vasoconstriction in atherosclerotic coronary arteries, but not in healthy ones
(Allen et al., 1998) - indicating that pathogenesis may increase the scale and severity of
leukotriene-mediated responses. CysLTs also exert effects on circulating cells and on
endothelial cells. CysLT stimulation induces chemotaxis of monocytes (Hashimoto et al., 2009;
Ichiyama et al., 2005), eosinophils (Fregonese et al., 2002), dendritic cells (Parameswaran et al.,
2004) and CD34+ progenitor cells (Bautz et al., 2001; Boehmler et al., 2009). CysLT stimulation
also upregulates Mac-1 in eosinophils (Fregonese et al., 2002), promotes proliferation in CD34+
progenitor cells (Braccioni et al., 2002), and induces release of the chemokine RANTES from
platelets (Hasegawa et al., 2010). LTC 4 and LTD 4 stimulation of endothelial cells in vitro
results in production of PAF, promotion of neutrophil adhesion (McIntyre et al., 1986), secretion
of von Willebrand factor, and surface expression of P-selectin (Datta et al., 1995). In addition,
cysLT stimulation triggers vascular hyperpermeability in multiple vascular beds (Dahlen et al.,
1981; Hui et al., 2004; Moos et al., 2008). That being said, cysLTs have also been implicated
with an important role in host defense, as attenuated leukotriene synthesis has been linked to
increased susceptibility to infectious disease in both humans and animal models (Flamand et al.,
2007b).
While LTE 4 received its fair share of attention following its discovery, its poor affinity for the
classical cysLT receptors resulted in its fading from the spotlight. However, early studies noted
that LTE 4 potency was 10-fold greater than that of LTC 4 or LTD 4 in guinea pig trachea (Drazen
et al., 1982). LTE 4 was also distinct in its ability to augment contractile response to histamine,
21
something that LTC 4 or LTD 4 stimulation could not do (Lee et al., 1984). LTE 4 was also found
to induce vascular permeability with equal potency as LTC 4 and LTD 4 when injected
intradermally in humans (Soter et al., 1983). These findings suggest that LTE 4 either uniquely
mediates pathways that LTC 4 or LTD 4 do not, or that there are receptors (i.e. GPR99) that favour
LTE 4 as a ligand over LTC 4 and LTD 4 .
1.3. Cysteinyl Leukotriene Receptors
Cysteinyl leukotrienes bind to two G-protein coupled receptors, termed cysteinyl leukotriene
receptor 1 (CysLT 1 R) and cysteinyl leukotriene receptor 2 (CysLT 2 R). Further investigation has
yielded a receptor favouring leukotriene E 4 rather than C 4 and/or D 4 , recently identified as
GPR99 (Kanaoka et al., 2013). In addition to this, the P2Y family of purinergic GPCRs, as well
as other GPCRs, has been linked with leukotriene-binding activation. However, the two most
well investigated receptors remain the CysLT 1 R and CysLT 2 R.
1.3.1. Cysteinyl Leukotriene Receptor 1
The human CysLT 1 R was first characterized in 1999 by two separate groups. It is a 337 amino
acid G-protein coupled receptor that signals predominantly through G q/11 class G proteins,
although it does show limited activation of G i/o pathways (Lynch et al., 1999; Sarau et al., 1999).
The human CysLT 1 R shares only 38% homology with the human CysLT 2 R, and is actually more
similar to the purinoreceptor P2Y 1 (32% homology) than the BLT 1 R (28%) (Heise et al., 2000;
Lynch et al., 1999; Sarau et al., 1999). The rank order for ligand affinity was first reported as
22
LTD 4 > LTE 4 = LTC 4 > LTB 4 in transfected Cos-7 cells (Lynch et al., 1999), and LTD 4 > LTC 4
> LTE 4 > LTB 4 in transfected HEK293 cells (Sarau et al., 1999). In humans, CysLT 1 R is most
highly expressed in spleen and peripheral blood leukocytes, with lower expression in lung,
placenta, small intestine, colon, and thymus (Lynch et al., 1999; Sarau et al., 1999). Later
research would pinpoint human peripheral blood leukocyte CysLT 1 R expression to monocytes,
macrophages, eosinophils, pre-granulocytic CD34+ cells, B lymphocytes (Figueroa et al., 2001),
and mast cells (Mellor et al., 2001).
The murine CysLT 1 R was first characterized in 2001 (Maekawa et al., 2001; Martin et al., 2001).
It shares ~87% sequence homology with the human CysLT 1 R and exists in two isoforms, a short
337 amino acid variant (consisting of exons I and IV) and a long variant (352 aa total, consisting
of exons I, II, III, and IV) that possesses a 13 amino acid extension at the N terminus (Maekawa
et al., 2001; Martin et al., 2001). The long isoform is expressed highest in the lung and skin, and
more weakly in the heart, kidney, stomach, and tongue. Conversely, the short isoform was found
only in lung and skin (Maekawa et al., 2001). Similar to the human receptor, murine CysLT 1 R
ligand affinity rank order was reported as LTD 4 > LTE 4 = LTC 4 > LTB 4 (Maekawa et al., 2001;
Martin et al., 2001). However, the gap in binding affinity between LTD 4 and LTC 4 is much
wider in the mouse, where the EC 50 for LTC 4 is 1,000-fold higher than that of LTD 4 , versus the
human, where the difference is only a 10-fold increase (Maekawa et al., 2001).
CysLT 1 R is regulated transcriptionally by a myriad of pro- and anti-inflammatory factors –
mostly cytokines - depending on the cell type. It is upregulated upon stimulation with IL-4 or
IL-13 in human monocytes and monocyte-derived macrophages (Shirasaki et al., 2007;
23
Thivierge et al., 2001; Woszczek et al., 2005), as well as upon IL-5 stimulation in human
eosinophils (Thivierge et al., 2000). CysLT 1 R levels in B lymphocytes are upregulated
following stimulation by either a combination of IL-4 and activating anti-CD40 antibody, or a
combination of IL-4 and the presence of CD154-transfected fibroblasts (Lamoureux et al., 2006).
IL-13 treatment results in significant upregulation of both CysLT 1 R mRNA and protein levels,
yielding a vulnerability to LTC 4 stimulation-mediated eotaxin production (Chibana et al., 2003).
Individual treatment with TGFβ, IFNγ, and IL-13 (but not IL-4) all resulted in CysLT 1 R
upregulation in human airway smooth muscle cells (Espinosa et al., 2003). IL-1β induces
CysLT 1 R upregulation in human umbilical vein endothelial cells (HUVECs) (Gronert et al.,
2001). Conversely, direct IL-10 treatment downregulates CysLT 1 R levels in monocytes
(Woszczek et al., 2008), and LPS or zymosan treatment results in CysLT 1 R downregulation via
endogenous production of PGE 2 and IL-10 (Thivierge et al., 2006, 2009).
Activation of CysLT 1 R results in mobilization of intracellular Ca2+ via both G q/11 and G i/o
pathway activation (Baud et al., 1987; Lynch et al., 1999). Confirmed secondary messenger
signaling pathways activated include MAPK (Hoshino et al., 1998; Paruchuri et al., 2002), PKC
(Hoshino et al., 1998), ERK1/2 (Jiang et al., 2006; McMahon et al., 2000), and PI3K-AktGSK3β (Kim et al., 2010). Induction of proliferation has been observed in numerous cell lines
following CysLT 1 R activation, including human hematopoietic cells (Braccioni et al., 2002),
epithelial cells (Leikauf et al., 1990; Paruchuri and Sjolander, 2003), smooth muscle cells
(Kaetsu et al., 2007; Panettieri et al., 1998), and astrocytes (Fang et al., 2006; Huang et al.,
2008). In addition, CysLT 1 R activation upregulates pro-inflammatory mediators, including βintegrins (Boehmler et al., 2009; Massoumi and Sjolander, 2001), IL-4 (Bandeira-Melo et al.,
24
2002), IL-5 (Faith et al., 2008; Frieri et al., 2003; Hasegawa et al., 2010), IL-8 (Thompson et al.,
2006), IL-11 (Lee et al., 2007), TGF-β1 (Kato et al., 2005), as well as MIP-1α and MIP-1β
(Ichiyama et al., 2009). Finally, CysLT 1 R pharmacological blockade results in decreased levels
of IL-4, IL-5, IL-8, IL-11, IL-13, TNFα, RANTES, and TGF-β (Henderson et al., 2002;
Kiwamoto et al., 2011; Lee et al., 2007; Ueda et al., 2003).
1.3.2. Cysteinyl Leukotriene Receptor 2
The human CysLT 2 R was first characterized in 2000 by three independent groups (Heise et al.,
2000; Nothacker et al., 2000; Takasaki et al., 2000). It is a 346 aa protein that shares 33%
homology with the orphan receptor GPR17 (and as mentioned before, only 38% homology with
CysLT 1 R) (Heise et al., 2000). CysLT 2 R binds LTD 4 and LTC 4 with equal affinity and signals
through G q/11 (Heise et al., 2000). LTE 4 behaves as a partial agonist, eliciting a calcium response
in transfected HEK293 cells (Nothacker et al., 2000; Takasaki et al., 2000) and Cos-7 cells
(Heise et al., 2000), but LTB 4 does not (Heise et al., 2000; Takasaki et al., 2000). Furthermore,
these responses are unaffected by CysLT 1 R pharmacological antagonism (Heise et al., 2000;
Nothacker et al., 2000; Takasaki et al., 2000). The human CysLT 2 R expression profile is distinct
from that of CysLT 1 R, being found predominantly in the heart (expressed in atria, ventricles, and
Purkinje fibres - but not the aorta), spleen, brain, lymphatic system, placenta, and adrenal gland
(Heise et al., 2000; Nothacker et al., 2000; Takasaki et al., 2000). Indeed, it is the dominant
cysLT receptor in heart and brain (Takasaki et al., 2000), and unlike CysLT 1 R, is not found in
high abundance in the lung (Heise et al., 2000). CysLT 2 R is also expressed by numerous
circulating cells, including eosinophils (Mita et al., 2001), monocytes, macrophages (Heise et al.,
25
2000), mast cells (Mellor et al., 2003) and platelets (Hasegawa et al., 2010), but not neutrophils
(Figueroa et al., 2003). It is also expressed in HUVECs (Lotzer et al., 2003) and coronary artery
SMCs (Kamohara et al., 2001).
The murine CysLT 2 R was characterized in 2001 (Hui et al., 2001) and shares 74% homology
with its human counterpart (Evans, 2003). It is a 309 aa protein primarily expressed in spleen,
thymus, and adrenal gland, with weaker expression in kidney, brain, and peripheral blood
leukocytes. While Northern blot analysis failed to detect CysLT 2 R in the murine heart, the more
sensitive in situ hybridization technique was able to detect CysLT 2 R in murine Purkinje cells and
cardiac endothelial cells (Hui et al., 2001). Apart from this, however, further elucidation of
specific cell types expressing CysLT 2 R in the mouse has been elusive due to lack of a specific
antibody for the receptor. Using a mouse model where LacZ was placed under the Cysltr2
promoter, Moos et al. (2008) was able to detect CysLT 2 R expression in cardiac tissue (Jiang et
al., 2008), as well as microvasculature in brain, bladder, skin, ear, and cremaster muscle. Further
studies demonstrated CysLT 2 R expression in murine neurons of the myenteric and submucosal
plexus in the small intestine, colonic myenteric plexus, dorsal root ganglia, and nodose ganglion
(Barajas-Espinosa et al., 2011), as well as retinal microvasculature and resident pericytes
(Barajas-Espinosa et al., 2012).
CysLT 2 R expression is upregulated by pro-inflammatory cytokines, including IFNγ (Woszczek
et al., 2007), IL-4 (Lotzer et al., 2003), IL-13 (Shirasaki et al., 2007), and IL-18 (Zhou et al.,
2009). Pretreatment with IFNγ enhances responsiveness to cysLT stimulation in endothelial
cells (Woszczek et al., 2007), monocytes, T cells, and B lymphocytes (Early et al., 2007).
26
CysLT 2 R is also upregulated in murine models following ischemia in the heart (Jiang et al.,
2008), retina (Barajas-Espinosa et al., 2012), and brain (Shi et al., 2012b). Interestingly,
CysLT 2 R expression is suppressed by TNFα, LPS, or IL-1β (Sjostrom et al., 2003) - possibly as
a mechanism designed to limit the extent of inflammation.
CysLT 2 R activation results in altered endothelial cell function, as well as cytokine secretion.
Activation of CysLT 2 R in HUVECs leads to increased intracellular calcium concentration,
myosin light chain kinase activation (Carnini et al., 2011; Lotzer et al., 2003), P-selectin surface
expression (Pedersen et al., 1997), and the upregulation of a myriad of pro-inflammatory genes
including CXCL2 (which encodes the MIP-2α protein), SELE (E-selectin), IL-8, EGR1, and
PTGS2 (Uzonyi et al., 2006). In human mast cells, CysLT 2 R activation facilitates IL-8
secretion, but through a pertussis toxin-sensitive pathway (Mellor et al., 2003). In animal
models, a murine dextran sulfate sodium-induced colitis model showed attenuated TNFα
secretion in the absence of functional CysLT 2 R (Barajas-Espinosa et al., 2011), and a murine
model of endothelium-targeted transgenic CysLT 2 R upregulation presented vascular
hyperpermeability in response to stimulation by both leukotrienes or IgE (Hui et al., 2004; Moos
et al., 2008). This mechanism appears to be regulated, at least partially, by Ca2+ signaling and
transendothelial vesicle transport (Moos et al., 2008).
1.3.3. Other Cysteinyl Leukotriene Receptors
In addition to CysLT 1 R and CysLT 2 R, data has implicated cysLT activation of other GPCRs. A
possible third cysLT receptor was first proposed after Mellor et al. (2001) noted that IL-4
27
treatment in mast cells upregulated two receptors: CysLT 1 R and a receptor that could not be
CysLT 2 R based on pharmacological antagonism experiments. Moreover, these cells responded
to both cysLTs and UDP, and as CysLT 1 R activation by UDP was later ruled out (Capra et al.,
2005; Woszczek et al., 2010), this indicated that the unknown receptor had purinergic signaling
capability. Further investigation revealed that GPR17, a receptor structrually and
phylogenetically related to other P2Y receptors and cysLT receptors (Daniele et al., 2011), could
be activated in a specific and dose-dependent manner by both cysLTs and uracil nucleotides
(Ciana et al., 2006; Daniele et al., 2011). In addition, GPR17 heterodimerizes with CysLT 1 R
and acts as a negative regulator of CysLT 1 R without activating any responses of its own or the
need for uracil nucleotide stimulation (Maekawa et al., 2009; Maekawa et al., 2010). However,
GPR17 knockdown abolished LTD 4 -induced effects on cell viability (Daniele et al., 2010).
Thus, the question was: does GPR17 respond directly to cysLT stimulation or act on cysLT
receptors upon activation by uracil nucleotides (Back et al., 2011; Benned-Jensen and
Rosenkilde, 2010)? The answer appears to be both: GPR17 has two binding sites - one for
cysLTs and the other for nucleotides (Parravicini et al., 2010; Parravicini et al., 2008). Receptor
activation via either cysLTs or nucleotides induces a change in conformational state that
enhances functional responsiveness to both sets of agonists. In addition, both sets of agonists
trigger homologous desensitization, but interestingly, while UDP-glucose stimulation
desensitizes GPR17 to LTD 4 -mediated responses, LTD 4 stimulation does not reciprocate, and
has no effect on sensitivity to UDP-glucose-mediated responses (Daniele et al., 2011).
LTE 4 has long been regarded as a biological marker for the production of its more potent
siblings LTC 4 and LTD 4 . However, the stability of LTE 4 also ensures that it is the most
28
abundant cysLT in vivo, and it has been shown to induce smooth muscle contraction and
eosinophilia (Gauvreau et al., 2001; Lee et al., 1984; Lewis et al., 1980). Paruchuri et al. (2008)
reported that LTE 4 mediated prostaglandin D 2 production in human mast cells. Curiously, while
this response was attenuated by the CysLT 1 R antagonist MK-571, it was not affected by
CysLT 1 R genetic knockdown alone, nor could it be triggered by LTD 4 stimulation, suggesting
the existence of a novel LTE 4 -selective receptor. Later work would reveal that this response was
mediated by the purinergic receptor P2Y 12 (Paruchuri et al., 2009). Indeed, Nonaka et al.
(2005), using a computer model, determined that LTE 4 is a potential ligand for P2Y 12 .
However, Foster et al. (2013) reported no signs of P2Y 12 activation in transfected HEK-293
cells. Furthermore, they saw no response in extracted platelets, ruling out that P2Y 12 activation
exerts its effects through heterodimerization with another receptor.
Around the same time as Paruchuri et al., Maekawa et al. (2008) reported that
CysLT 1 R/CysLT 2 R double knockout mice still showed ear vascular leakage post-cysLT
stimulation, and that LTE 4 elicited a much more robust response than LTC 4 or LTD 4 in these
mice. However, the LTE 4 -mediated response reported by Maekawa et al. was only sensitive to
the CysLT 1 R-selective antagonist MK-571 in wild-type mice, and no inhibition was noted when
CysLT 1 R knockout mice were treated with MK-571 (Maekawa et al., 2008). Furthermore,
CysLT 2 R knockout mice treated with MK-571 actually showed elevated permeability relative to
wild-type and CysLT 1 R knockout mice, indicating that this putative receptor - termed CysLT E R
at the time - may be negatively regulated by the classical cysLT receptors (Maekawa et al.,
2008). This receptor has been recently identified as GPR99 (Kanaoka et al., 2013), a receptor
previously believed to be a purinergic receptor before research revealed that it is actually
29
activated by α-ketoglutarate (Abbracchio et al., 2005; He et al., 2004; Qi et al., 2004). Indeed,
the LTE 4 -mediated ear edema observed in CysLT 1 R/CysLT 2 R double knockout mice was
almost completely abolished in GPR99/CysLT 1 R/CysLT 2 R triple knockout mice. Stimulation
with LTC 4 or LTD 4 did elicit a mild response in CysLT 1 R/CysLT 2 R double knockout mice,
indicating that GPR99 can bind LTC 4 or LTD 4 in the absence of the classical cysLT receptors
(Kanaoka et al., 2013).
1.4. Leukotriene Involvement in Pathology
Given their potent pro-inflammatory effects, it is not surprising that leukotrienes have been
linked with pathogenesis for numerous conditions, including inflammatory bowel disease,
cholestasis, hepatic inflammation, arthritis, and atopic dermatitis (Back et al., 2011; Haeggstrom
and Funk, 2011). However, the conditions that have received the most attention are: asthma and
other inflammatory diseases of the respiratory tract, cancers, and ischemic injury in the cerebroand cardiovascular systems.
1.4.1. Asthma/Respiratory Diseases
Leukotrienes were first discovered as mediators of bronchial smooth muscle constriction, so it is
understandable that they are involved in asthma, as well as other pathologies involving
inflammation and/or constriction of the airways. Elevated levels of cysLTs have been measured
in bronchoalveolar lavage (BAL) fluid, urine, and blood from asthmatic adults, and cysLTs are
elevated in BAL fluid taken at night from nocturnal asthmatics (Taylor et al., 1992; Wenzel et
30
al., 1990; Wenzel et al., 1995). LTB 4 also plays a role in asthma: it is elevated in asthmatic
patients (Wenzel et al., 1995) and murine studies show that BLT 1 R plays a vital role in
mediating Th-2 cytokine mediated airway inflammation (Miyahara et al., 2005), whereas
BLT 1 R-expressing T cells are upregulated in allergic asthma patient airways (Islam et al., 2006).
Despite its lack of affinity for the CysLT 1 R and CysLT 2 R, LTE 4 also induces bronchial
contraction with equal potency as LTC 4 and LTD 4 (Davidson et al., 1987), a finding that makes
more sense now following the revelation of the CysLT E R (GPR99). Also interesting was that
asthmatic airways maintained sensitivity to LTE 4 , whereas responses to LTC 4 and LTD 4 were
attenuated compared to equivalent responses in healthy individuals (Adelroth et al., 1986;
O'Hickey et al., 1988; Weiss et al., 1982). LTE 4 , but not LTC 4 and LTD 4 , was also able to
induce hyperresponsiveness to histamine (Lee et al., 1984). Now that a receptor preferential for
LTE 4 has been identified (Kanaoka et al., 2013; Maekawa et al., 2008), the role of CysLT E R
activation in asthma and bronchoconstriction warrants further attention.
As of 2011, there were three CysLT 1 R antagonists and one 5-LO antagonist clinically available
(Okunishi and Peters-Golden, 2011). The lukast family of CysLT 1 R antagonists, all first
discovered in the 1990s, consists of pranlukast (Obata et al., 1992), zafirlukast (Krell et al.,
1990), and montelukast (Jones et al., 1995). Of the three, montelukast is the most widely
available and promoted, whereas pranlukast is only available in Japan and other Asian countries
(Okunishi and Peters-Golden, 2011). There are numerous studies detailing the ability of
CysLT 1 R antagonism to mitigate inflammatory bronchospastic responses in cases of acute
asthma (Dockhorn et al., 2000; Gaddy et al., 1992), persistent asthma (Reiss et al., 1998; Suissa
et al., 1997), aspirin-triggered asthma (Christie et al., 1991; Fischer et al., 1994), and in response
31
to allergens (Taylor et al., 1991). CysLT 1 R blockade also resulted in a marked decreased in
airway histamine and TNF-α levels (Figueroa et al., 2001). However, CysLT 1 R antagonism
failed to abrogate eosinophil recruitment (Diamant et al., 1999). The 5-LO inhibitor zileuton
was discovered in 1991 (Carter et al., 1991), and was considered to have more potential than
cysLT receptor antagonists given its ability to block both cysLT receptor and BLT receptor
signaling. While it has similar anti-bronchoconstriction properties to the CysLT 1 R antagonists
(Israel et al., 1996; Liu et al., 1996; Wenzel et al., 1995), it has not gained widespread use
because of an initial need for four daily doses and the possibility of hepatocellular injury
(Okunishi and Peters-Golden, 2011). Furthermore, there is little evidence to suggest that
zileuton is superior to any of the lukast family members (Israel et al., 1996; Wenzel et al., 2007).
While these compounds do improve lung and airway function while decreasing disease
symptoms, they are still not as efficacious as inhaled corticosteroids in the treatment of asthma
(National Asthma and Prevention, 2007; Wenzel, 2003). A further complication is that there is a
distinct and significant subset of patients who are unresponsive to leukotriene pathway modifiers
(Barnes et al., 2005; Terashima et al., 2002). Despite this, these compounds are effective in
treating other conditions such as aspirin-induced asthma, exercise-induced bronchoconstriction
(Dahlen, 2006), allergic rhinitis, and chronic obstructive pulmonary disease (Back et al., 2011).
They also provide a tested alternative therapy option for individuals unwilling or incapable of
using inhaler devices or inhaled corticosteroids (Okunishi and Peters-Golden, 2011).
1.4.2. Cancer
32
CysLT signaling activates secondary messengers that have been implicated in cell survival and
proliferation. LTD 4 stimulation upregulates COX-2, via activation of ERK1/2, which in turn
activates Bcl-2 signaling, promoting cell survival (Wikstrom et al., 2003). Pharmacological
blockade of COX-2 resulted in increased apoptosis rate, as well as increased pro-apoptotic
pathway signaling. This effect in turn is countered by additional LTD 4 stimulation (Ohd et al.,
2000). Research has also shown that LTC 4 stimulation induces endothelial cell proliferation
(Modat et al., 1987), whereas LTD 4 stimulation encourages hematopoietic progenitor cell
proliferation (Boehmler et al., 2009; Braccioni et al., 2002). In addition, LTB 4 levels are
elevated in human colon (Larre et al., 2008) and pancreatic (Ding et al., 2005) cancers, and LTB 4
stimulation promotes proliferation in colon cancer cell lines (Ihara et al., 2007), pancreatic
cancer cell lines (Tong et al., 2005), as well as in neural (Wada et al., 2006) and hematopoietic
stem cells (Chung et al., 2005). LTB 4 , LTC 4 , and LTD 4 stimulation are pro-angiogenic (Kim et
al., 2009; Tsopanoglou et al., 1994). Inhibition of leukotriene synthesis pathway components has
been implicated to impede cancer progression in some pre-clinical models. Pharmacological
inhibition of 5-LO prevents tumorigenesis in murine lung following treatment with the
carcinogen nicotine-derived nitrosamine ketone (Rioux and Castonguay, 1998), and COX-2 and
5-LO blockers in tandem had additive effects in blocking tumour growth in mice xenografted
with human colon (Ye et al., 2005), esophageal (Chen et al., 2004b), breast (Barry et al., 2009),
and skin (Fegn and Wang, 2009) cancer cells. Blockade of LTA 4 H has been shown to reduce
tumour load in rat esophageal adenocarcinomas (Chen et al., 2003), and LTA 4 H downregulation
inhibited in vitro and in vivo colon cancer cell growth (Jeong et al., 2009).
33
Both BLT receptors (Hennig et al., 2005) and cysLT receptors (Magnusson et al., 2007;
Matsuyama et al., 2007; Ohd et al., 2003) have been found in abundance in cancerous cells and
tissues. Appropriately, BLT receptor blockade has been shown to induce apoptosis in colon
cancer cells (Ihara et al., 2007) and inhibit tumour growth and metastasis in murine pancreas
following implantation with pancreatic cancer cells (Hennig et al., 2005). There is an interesting
dichotomy regarding the cysteinyl leukotriene receptors where CysLT 1 R expression appears to
be deleterious and CysLT 2 R expression beneficial. Indeed, high CysLT 1 R combined with low
CysLT 2 R expression has been associated with increased malignancy and reduced survival.
Conversely, low CysLT 1 R combined with high CysLT 2 R expression has been linked with
increased survival (Magnusson et al., 2007; Magnusson et al., 2011; Matsuyama et al., 2007).
CysLT 1 R signaling promotes cell proliferation via activation of the ERK1/2 signaling pathway
(Paruchuri and Sjolander, 2003), and receptor inhibition reduces tumour burden in a mouse
model of lung cancer (Gunning et al., 2002), and induces apoptosis in prostate cancer cell lines
(Matsuyama et al., 2007). Less is known about the role of CysLT 2 R in tumorigenesis, but there
is evidence that it is involved in promotion of apoptosis and terminal differentiation in colon
caricinoma cell lines (Magnusson et al., 2007).
1.4.3. Ischemic/Cardiovascular Disease
Given the depth and breadth of leukotriene involvement in inflammatory responses, it was only
natural that their potential involvement in cardiovascular disease would be investigated. Indeed,
urinary excretion of LTE 4 is elevated following myocardial infarction, indicating leukotriene
production during the event (Allen et al., 1993; Carry et al., 1992). Murine models also show a
34
similar phenomenon after LAD ligation (Sala et al., 2000). Furthermore, the enzymes involved
in leukotriene production have been found in atherosclerotic plaques, and human coronary
arteries express 5-LO, FLAP, and LTA 4 H and respond to LTC 4 and LTD 4 (Allen et al., 1998).
In addition, 5-LO, FLAP and LTC 4 S are all upregulated in aneurysm thrombi. Gene variants
within the leukotriene synthesis pathway have been associated with increased atherosclerosis,
myocardial infarction, and stroke (Haeggstrom and Funk, 2011). Dwyer et al. (2004) examined a
population of Angelenos and found that individuals possessing variant alleles for ALOX5, the
gene encoding 5-LO, had increased intima-media thickness and elevated plasma levels of the
inflammatory marker C-reactive protein. A study of the Icelandic population then revealed that
polymorphisms in ALOX5AP, the gene encoding FLAP, conferred a greater risk of myocardial
infarction and stroke (Helgadottir et al., 2004) - these findings were then replicated in a Scottish
population (Helgadottir et al., 2005). However, further research has yielded contradictory
results, with some studies confirming that ALOX5AP polymorphisms were associated with
myocardial infarction (Linsel-Nitschke et al., 2008), coronary heart disease, (Huang et al., 2010)
and stroke (Lee et al., 2011; Sharma et al., 2013). Conversely, other studies have failed to
identify any association between ALOX5AP polymorphisms and stroke risk (Barral et al., 2012;
Kostulas et al., 2007; Lemaitre et al., 2009; Zintzaras et al., 2009). LTA4H gene variants have
also been linked with increased myocardial infarction risk (Helgadottir et al., 2006), whereas
LTC4S gene variants have been linked with stroke, but not ischemic heart disease or
atherosclerosis in a Danish population (Freiberg et al., 2009). This association with stroke was
also found in British and Chinese studies (Bevan et al., 2008; Wang et al., 2012).
35
Early studies investigating the role of cysteinyl leukotrienes in CVD were largely optimistic.
Pharmacological inhibition of 5-LO or use of a lipoxygenase/cycloxygenase dual antagonist
resulted in decreased infarction size (Amsterdam et al., 1993; Hashimoto et al., 1990; Ito et al.,
1989). Use of the non-selective peptidoleukotriene receptor antagonist LY171883 or LY203647
yielded mixed results - whereas the former attenuated infarction size following ischemia (Hock
et al., 1992), the latter failed to have any effect on infarction damage (Hahn et al., 1992).
Administration of the CysLT 1 R antagonist pranlukast resulted in significantly reduced infarction
size (Ito et al., 1989; Toki et al., 1988). These studies targeting the cysLTs did not report
reduction in leukocyte recruitment and extravasation following cysLT receptor antagonism
(Hock et al., 1992; Ito et al., 1989; Toki et al., 1988), although 5-LO antagonism, but not
lipoxygenase/cycloxygenase dual antagonism (Amsterdam et al., 1993), was reported to decrease
neutrophil accumulation in the infarcted tissue (Ito et al., 1989; Toki et al., 1988). While most of
these studies reported a beneficial effect following pharmacological antagonism of the
leukotriene synthesis pathway, indicating a clear role for leukotrienes in myocardial infarction
damage, they are somewhat contradictory regarding the mechanisms/actions affected by drug
treatment. Carnini (2011) and Back (2011) have both attributed this to the non-selective nature
of these early pharmacological agents - particularly those targeting the cysLT receptors - and
also posit that the early compounds used may have partial agonist activity or may have not
displayed sufficient potency to compete with elevated amounts of local endogenous ligands at
the site of injury. Indeed, later studies using montelukast have shown that CysLT 1 R antagonism
possesses antiatherogenic effects (Ge et al., 2009; Jawien et al., 2008; Kaetsu et al., 2007).
While both CysLT 1 R and CysLT 2 R are expressed in diseased human arteries (Allen et al., 1998;
Spanbroek et al., 2003), CysLT 2 R is the dominant isoform in the myocardium (Heise et al.,
36
2000) - but the lack of a selective and potent pharmacological agent for the receptor until 2010
(Wunder et al., 2010) has made identifying CysLT 2 R-specific effects difficult. CysLT 2 R is also
upregulated in the heart following ischemia (a finding that is corroborated in other organs such
as the retina and brain (Barajas-Espinosa et al., 2012; Jiang et al., 2008; Shi et al., 2012b). Hui et
al. (2004) generated a transgenic mouse model where seven copies of the human CYSLTR2 gene
under control of the murine Tie2 promoter in order to create an “endothelial-targeted” CysLT 2 R
overexpressing model. These mice showed exacerbated vascular permeability in response to
cysLT stimulation in ear, retina, and cremaster microvasculatures (Barajas-Espinosa et al., 2012;
Hui et al., 2004; Moos et al., 2008), significantly increased infarction damage (that was
abrogated using the non-selective CysLT receptor antagonist Bay-u9773) accompanied by
increased edema, leukocyte extravasation, and elevated expression of adhesion molecules (Jiang
et al., 2008). Also, the CysLT 2 R overexpressing mouse model shows accelerated left ventricular
remodeling at two weeks post-infarction (Jiang et al., 2008).
Ischemic disease, predominantly stroke, occurs in the brain as a result of thrombosis or
hemorrhage. Arachidonic acid is released due to degradation of membrane lipids during
ischemia, and this release is greatest in brain regions most susceptible to ischemia/reperfusion
injury (Katsuki and Okuda, 1995; Westerberg et al., 1987). Indeed, leukotriene production has
been noted in the brain during ischemia, and dramatically increased following reperfusion
(Moskowitz et al., 1984; Rao et al., 1999). Both CysLT 1 R and CysLT 2 R are expressed in the
brain (Heise et al., 2000; Lynch et al., 1999), and both are upregulated following ischemia (Fang
et al., 2007; Shi et al., 2012b; Zhao et al., 2011). CysLT 1 R in the brain is primarily localized to
microvascular endothelial cells, with traumatic injury inducing expression in neurons and glial
37
cells (Zhang et al., 2004). Treatment with CysLT 1 R-selective antagonists results in decreased
ischemic damage and improved neurological function (Fang et al., 2006; Zhang et al., 2002). In
addition, pranlukast treatment also decreased brain cryoinjury extent in mice (Ding et al., 2007),
indicating a possible role for leukotrienes in traumatic brain injury as well. CysLT 2 R is highly
expressed in the central nervous system, including the hypothalamus, thalamus, putamen,
pituitary, and medulla (Heise et al., 2000). In addition, the receptor is also found in the brain
microvasculature (Moos et al., 2008). Di Gennaro et al. (2004) have found that neutrophils are
the source of cysLT synthesis in the brain, and that neutrophil activation results in a brain-blood
barrier disruption that can be prevented with FLAP pharmacological antagonism. In addition,
exogenous addition of LTB 4 did not elicit similar effects as neutrophil activation, and Bay-u9773
was more effective than montelukast in preventing blood-brain barrier disruption - indicating the
involvement of CysLT 2 R. In vitro induction of ischemia in medulla cells resulted in increased
cell death in cells overexpressing CysLT 2 R. Treatment of these cells with LTD 4 induced
apoptosis, which was inhibited by Bay-u9773 but not montelukast (Sheng et al., 2006). In vivo,
use of the CysLT 2 R-selective antagonist HAMI3379 resulted in reduced infarct volume, edema,
and neuronal degredation and neuronal death (Shi et al., 2012a). CysLT stimulation has also
been shown to induce astrocyte proliferation at low concentrations through a CysLT 1 R-mediated
process and astrocyte death at high concentrations through a CysLT 2 R-mediated process (Huang
et al., 2008). In addition, ischemia resulted in upregulation of CysLT 2 R in astrocytes while
inducing cell death via CysLT 2 R-mediated aquaporin 4-upregulation (Qi et al., 2011). Ischemia
results in the acute phase (6-24 hours post-ischemia) upregulation of CysLT 2 R in injured
neurons within the infarction zone, and the late phase (3-28 days) upregulation of CysLT 2 R in
38
microglia and astrocytes, indicating a role for CysLT 2 R in astrogliosis and microgliosis postischemia (Zhao et al., 2011).
1.5. Research Objectives and Hypotheses
Although endothelium-targeted CysLT 2 R overexpression has been linked with increased
myocardial infarction damage and vascular hyperpermeability, the precise mechanisms
underlying these phenomena remain unresolved. Investigation of the role of CysLT 2 R activation
in myocardial infarction injury has been difficult due to the absence of receptor-selective
pharmacological antagonists until very recently. Our aims are thus fourfold: 1) use these novel
pharmacological compounds to examine if CysLT 2 R is the main mediator of the exacerbated
myocardial infarction damage phenotype observed in CysLT 2 R-overexpressing mice; 2)
determine whether CysLT 2 R activation is involved during ischemia, at reperfusion, or during the
inflammatory response following infarction; 3) examine whether the difference in injury
severity in CysLT 2 R-overexpressing mice post-acute ischemia translates into altered cardiac
function long-term; and 4) examine the molecular mechanisms underlying CysLT 2 R regulation
of vascular permeability and leukocyte behaviour. We hypothesize that the exacerbated injury
phenotype observed in CysLT 2 R-overexpressing mice is primarily mediated by CysLT 2 R (rather
than other receptors), and that CysLT 2 R activation most strongly impacts the inflammatory
response post-reperfusion. In addition, we believe that exacerbation of CysLT 2 R-mediated
myocardial damage post-infarction will result in decreased long term cardiac function and
39
pathological cardiac remodeling. Lastly, CysLT 2 R activation likely mediates vascular
permeability via localized leukotriene production and promotion of leukocyte recruitment to the
affected site. By investigating and understanding how CysLT 2 R activation results in
exacerbation of myocardial infarction injury, we hope to establish that CysLT 2 R is a viable
therapeutic target for the treatment of cardiovascular disease.
40
Chapter 2: A selective cysteinyl leukotriene receptor 2 antagonist blocks
myocardial ischemia/reperfusion injury and vascular permeability in mice
41
2.1. Abstract
Cysteinyl leukotrienes (cysLTs) are potent inflammatory mediators that predominantly exert
their effects by binding to cysteinyl leukotriene receptors of the G protein-coupled receptor
family. CysLT receptor 2 (CysLT 2 R), expressed in endothelial cells of some vascular beds, has
been implicated in a variety of cardiovascular functions. Endothelium-specific overexpression of
human CysLT 2 R in transgenic mice (EC) greatly increases myocardial infarction damage.
Investigation of this receptor, however, has been hindered by the lack of selective
pharmacological antagonists. Here, we describe the characterization of 3-(((3carboxycyclohexyl)amino)carbonyl)-4-(3-(4-(4-phenoxybutoxy)phenyl)-propoxy)benzoic acid
(BayCysLT 2 ) and explore the selective effects of this compound in attenuating myocardial
ischemia/reperfusion damage and vascular leakage. Using a recently developed β-galactosidaseβ-arrestin complementation assay for CysLT 2 R activity (Yan et al., 2011), we determined
BayCysLT 2 to be ~20-fold more potent than the nonselective dual cysLT receptor 1
(CysLT 1 R)/CysLT 2 R antagonist 4-(((1R,2E,4E,6Z,9Z)-1-((1S)-4-carboxy-1-hydroxybutyl)2,4,6,9-pentadecatetraen-1-yl)thio)benzoic acid (Bay-u9773) (IC 50 274 nM versus 4.6 μM,
respectively). Intracellular calcium mobilization in response to cysteinyl leukotriene
administration showed that BayCysLT 2 was >500-fold more selective for CysLT 2 R compared
with CysLT 1 R. Intraperitoneal injection of BayCysLT 2 in mice significantly attenuated
leukotriene D 4 -induced Evans blue dye leakage in the murine ear vasculature. BayCysLT 2
administration either before or after ischemia/reperfusion attenuated the aforementioned
increased myocardial infarction damage in EC mice. Finally, decreased neutrophil infiltration
and leukocyte adhesion molecule mRNA expression were observed in mice treated with
42
antagonist compared with untreated controls. In conclusion, we present the characterization of a
potent and selective antagonist for CysLT 2 R that is useful for discerning biological activities of
this receptor.
43
2.2. Introduction
Myocardial infarction is the leading killer of both males and females in the industrialized world
(Yellon and Hausenloy, 2007). The condition is characterized by a cessation of oxygen/nutrient
supply to the myocardium, usually caused by a blockage of the coronary circulation. Although
the only remedy to this problem is timely restoration of blood flow (“reperfusion”), this results in
the en masse formation of reactive oxygen species, creating oxidative stress (Zweier, 1988).
Reactive oxygen species formation, in tandem with chemoattractant release during myocardial
infarction, invokes the innate inflammatory response, resulting in adhesion protein up-regulation,
leukocyte infiltration, and extracellular matrix degradation (Vinten-Johansen, 2004). It is these
post-reperfusion events that contribute the majority of myocardial infarction-induced damage
(Yellon and Hausenloy, 2007).
The cysteinyl leukotrienes (cysLTs), so termed because of the common cysteine moiety in their
structures, are a group of proinflammatory arachidonic acid metabolites consisting of LTC 4 ,
LTD 4 , and LTE 4 . CysLTs exert their effects primarily by binding two characterized G proteincoupled receptors: cysLT receptor 1 (CysLT 1 R) (Lynch et al., 1999) and cysLT receptor 2
(CysLT 2 R) (Heise et al., 2000). CysLTs have also been shown to interact with the putative
cysteinyl leukotriene E receptor (Maekawa et al., 2008), the P2Y 12 receptor (purinergic receptor
P2Y, G protein-coupled, 12) (Nonaka et al., 2005), and G protein-coupled receptor 17 (Ciana et
al., 2006; Maekawa et al., 2009). Of these receptors, CysLT 1 R is the most extensively studied
(Moos and Funk, 2008) and has been shown to mediate bronchoconstriction and airway
inflammation (Funk, 2005). CysLT 2 R has not received as much attention as CysLT 1 R, although
44
there has been a wave of interest concerning this receptor in cardiovascular disease (Funk, 2005).
CysLT 2 R is expressed in multiple organs in the mouse, including the heart (Jiang et al., 2008),
brain, cremaster muscle vasculature (Moos et al., 2008), and myenteric neurons (BarajasEspinosa et al., 2011). In humans, it is found in umbilical cord endothelial cells (Lotzer et al.,
2003; Uzonyi et al., 2006), myocardium, and coronary vessels (Kamohara et al., 2001).
CysLT 2 R mediates vascular endothelium permeability via a vesicular transcytotic mechanism
(Hui et al., 2004; Moos et al., 2008) and is regulated by transcriptional activation of chemokine
secretion (Thompson et al., 2008).
The role of enzymes involved in leukotriene biosynthesis and the cysLT receptors in the
cardiovascular context is being studied extensively. Research has shown that single-nucleotide
polymorphisms in the genes encoding 5-lipoxygenase and leukotriene A 4 hydrolase are linked to
increased risk of myocardial infarction (Helgadottir et al., 2006; Helgadottir et al., 2004). Some
studies have also shown that the 5-lipoxygenase pathway is involved in atherosclerosis (Di
Gennaro et al., 2010; Funk, 2005; Qiu et al., 2006a; Spanbroek et al., 2003). As well, plasma
LTC 4 levels (Takase et al., 1996) and both CysLT 1 R and CysLT 2 R expression (Jiang et al.,
2008) have been shown to increase after myocardial infarction. Previous work by our group has
shown that endothelial-specific overexpression of human CysLT 2 R in transgenic mice resulted
in significantly greater myocardial infarcts after coronary vessel ligation, which was attenuated
by the nonselective cysLT receptor antagonist Bay-u9773 [4-(((1R,2E,4E,6Z,9Z)-1-((1S)-4carboxy-1-hydroxybutyl)-2,4,6,9-pentadecatetraen-1-yl)thio)benzoic acid]. The same study also
showed that overexpression of CysLT 2 R resulted in enhanced adhesion molecule up-regulation
as well as leukocyte infiltration (Jiang et al., 2008). However, because of the absence of a
45
CysLT 2 R-selective antagonist (Moos and Funk, 2008), the precise pathological contributions of
CysLT 1 R and CysLT 2 R could not be dissected (Jiang et al., 2008).
Recent breakthroughs in CysLT 2 R-related pharmacology have allowed the characterization of
both a CysLT 2 R-selective agonist [N-methyl LTC4 (NMLTC 4 )] (Yan et al., 2011) and
antagonist [3-(((3-carboxycyclohexyl)amino)carbonyl)-4-(3-(4-(4(cyclohexyloxy)butoxy)phenyl)propoxy)-benzoic acid (HAMI3379)] (Wunder et al., 2010). In
this article, we characterize the pharmacological properties of another CysLT 2 R-selective
antagonist 3-(((3-carboxycyclohexyl) amino)carbonyl)-4-(3-(4-(4-phenoxybutoxy)phenyl)propoxy)benzoic acid (BayCysLT 2 ) and use it to investigate the specific role of CysLT 2 R in
myocardial injury and vascular leakage. We show that BayCysLT 2 fully attenuates the
exacerbation of myocardial infarction injury seen in mice overexpressing CysLT 2 R and
accomplishes this by reducing leukocyte infiltration.
46
2.3. Materials and Methods
2.3.1. BayCysLT 2 Synthesis
All reagents were purchased from commercial sources and used without further purification.
Column chromatography was carried out using Silica-P Flash silica gel (60 Å, 40–63 μm, 500
m2/g) from Silicycle (Quebec City, Canada). 1H (and 13C) NMR spectra were recorded at 25°C
on a Bruker Avance Spectrometer (Bruker Daltonics, Billerica, MA) at 300 (75) or 400 (100)
MHz. The desired compound, 3-(((3-carboxycyclohexyl)amino)carbonyl)-4-(3-(4-(4phenoxybutoxy)phenyl)-propoxy)benzoic acid (BayCysLT 2 ) is a patented antagonist from Bayer
Pharmaceuticals (Montville, NJ) (Harter et al., 2009) and was synthesized according to the route
in Figure 2-1 from four commercially available starting materials. 3-(4-hydroxyphenyl)
propionic acid (Compound 1 – refer to Figure 2-1), 4-hydroxyisophthalic acid (7), and 3aminocyclohexane-1-carboxylic acid (10) were purchased from TCI America (Portland, OR),
and 4-phenoxy-1-butyl bromide (3) was from Alfa Aesar (Ward Hill, MA).
After 3 h at room temperature, a solution of 1 (1.5 g, 9.02 mmol) in 15 ml of acidified MeOH
(5% final volume with HCl) gave its corresponding methyl ester (2). The solvent was
evaporated, and the residue was dissolved in EtOAc. The solution was washed with saturated
NaHCO3, dried over MgSO 4 , and concentrated in vacuo to give a yellow oil in quantitative
yield. Spectroscopic characterization was consistent with that reported in the literature (Lewin et
al., 2005).
47
Methyl-3-(4-(4-phenoxybutoxy)phenyl) Propanoate (4): a solution of 2 (1 g, 6.012 mmol) and
3 (1.5 g, 6.55 mmol) in 15 ml of acetonitrile was mixed with K 2 CO 3 (2.5 g, 2 mmol) and heated
to reflux for 15 h. Solvent was removed, and the residue was taken up in EtOAc/H 2 O for workup. The aqueous phase was washed with EtOAc and combined. The organic extracts were
washed with brine, dried over MgSO 4 , filtered through a silica plug, and concentrated in vacuo.
The residue was purified with flash chromatography using cyclohexane/EtOAc (19:1) to give 1.5
g of 4 (81% yield). Spectroscopic characterization was consistent with that reported in the
literature (Harter et al., 2009).
3-(4-(phenoxybutoxy)phenyl)-1-propanol (5): LiAlH 4 (1 M in 5 ml of THF) was introduced
dropwise, while stirring, to a solution of 4 (1.3 g, 4.16 mmol) in minimal (~5 ml) THF. The
solution was stirred at room temperature for 30 min. MeOH (1–2 ml) was cautiously added to the
suspension to destroy excess LiAlH4. The mixture was then added to 1 M HCl and extracted
with EtOAc. The organic phase was washed with brine, dried over Na 2 SO 4 , and concentrated to
give 5 in quantitative yield. Spectroscopic characterization was consistent with that reported in
the literature (Harter et al., 2009).
1-(3-bromopropyl)-4-(4-phenoxybutoxy)benzene (6): alcohol 5 (1.4 g, 4.86 mmol) was
dissolved in 10 ml of THF, to which was added triphenylphosphine (1 g, 4 mmol) and
tetrabromomethane (1.2 g, 4 mmol) with stirring. The reaction became cloudy after 5 min and
was complete after 4 h as judged by TLC. The precipitate was filtered off, the filtrate was
concentrated in vacuo, and the residue was subjected to flash chromatography on silica gel with
48
cyclohexane/EtOAc (19:1) to yield 1.23 g (3.39 mmol) of 6 in 69% yield. Spectroscopic
characterization was consistent with that reported in the literature (Harter et al., 2009).
2-hydroxy-5-(methoxycarbonyl)benzoic Acid (8): 4-hydroxyisophthalic acid (7) (1 g, 5.5
mmol) was refluxed in MeOH (10 ml) containing 5% concentrated sulfuric acid (by volume) for
6 h. The mixture was carefully poured into ice water. NaHCO 3 was added to adjust the pH to 8,
and the mixture was filtered retaining both the precipitate and filtrate. The precipitate was
dissolved in EtOAc and purified by silica gel flash chromatography with 19:1
cyclohexane/EtOAc and trace amounts of glacial acetic acid to separate the desired product from
the diester dimethyl 4-hydroxyisophthalate (9), which was the major product at 0.6 g (2.75
mmol). The undesired diester 9 could be converted to the desired monoester by hydrolysis in
wet pyridine (10 ml) at reflux for 18 h. The reaction progress was monitored by TLC and
purified by silica gel flash chromatography (19:1 cyclohexane/EtOAc) after acidification with
HCl, extraction with chloroform, washing with water and NaHCO3, and concentration under
reduced pressure. The combined yield of monoester was 80%. Spectroscopic characterization
was consistent with that reported in the literature (Harter et al., 2009).
Methyl 3-aminocyclohexane-carboxylate Hydrochloride (11): 3-aminocyclohexane-1carboxylic acid hydrochloride (10) (1 g, 7.0 mmol) was stirred together with trimethylsilyl
chloride (2 ml, 0.012 mmol) in 15 ml of MeOH at room temperature overnight to give a viscous
oil, which under vacuum became 0.4 g of a spongy foam in 36% yield. The product was used
immediately in the next synthetic step.
49
Methyl 4-hydroxy-3-((3-(methoxycarbonyl)cyclohexyl)amino)carbonyl Benzoate (12): the
entire yield of 11, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (1 g, 6 mmol) and
hydroxybenzotriazole (0.5 g, 4 mmol) was dissolved in 15 ml of Et 3 N; this mixture was added
dropwise to a solution of 8 in 10 ml of CH 2 Cl 2 . After stirring for 15 h at room temperature, 25
ml of H 2 O was added to the reaction mixture, and the organic phase was extracted. Combined
extracts were washed with brine, dried over MgSO 4 , and concentrated in vacuo. The crude
product was then purified by flash chromatography on silica gel with cyclohexane/EtOAc (4:1)
to yield the product in 63% yield. Spectroscopic characterization was consistent with that
reported in the literature (Harter et al., 2009).
Methyl 3-(((3-(methoxycarbonyl)cyclohexyl)amino)carbonyl)-4-(3-(4-(4-phenoxybutoxy)
phenyl)propoxy) Benzoate (13): the coupling product 12 (0.5 g, 1.50 mmol) was dissolved in
butylnitrile (25 ml), to which K2CO3 (5 g, 36 mmol) was added and the mixture was heated to
reflux. The alkyl bromide 6 (0.6 g, 1.7 mmol) was added over 15 h until 12 was consumed as
judged by TLC. A 5% solution of NaH 2 PO 4 (10 ml) was then added to the reaction mixture, and
the organics were extracted with EtOAc, washed with brine, dried with MgSO4, and purified by
flash chromatography on silica gel with cyclohexane/EtOAc (2:1). Purification yielded 17%.
Spectroscopic characterization was consistent with that reported in the literature (Harter et al.,
2009).
BayCysLT 2 : methyl ester 13 (0.15 g, 2.43 mmol) was dissolved in 15 ml of THF and 8 ml of a
1:1 solution of MeOH and 2 M NaOH. The mixture was heated to 60°C for 4 h and then
acidified with concentrated HCl, extracted with EtOAc, and precipitated with diethyl ether to
50
obtain the product in quantitative yield. Spectroscopic characterization was consistent with that
reported in the literature (Harter et al., 2009). Stock solution (100 mg/ml) was prepared in
DMSO for use in all experiments.
2.3.2. β-Galactosidase-β-Arrestin Assay
The β-galactosidase-β-arrestin complementation assay for CysLT 2 R activation was described
recently (Yan et al., 2011). In brief, Bay-u9773 (Cayman Chemical, Ann Arbor, MI) or
BayCysLT 2 (10 pM to 10 μM final concentration) were preincubated for 15 min with C2C12
myoblast cells expressing modified hCysLT 2 R and β-arrestin-2 (25,000 cells/well in 96-well
plates; 100 μl) at 37°C. Cells were stimulated with LTD 4 (30 or 300 nM, correlating
approximately to the EC 50 and 10× EC 50 values, respectively) (Cayman Chemical) for 1 h after
which 50 μl of Tropix Gal-Screen (Applied Biosystems, Foster City, CA) luminescent reagent
mix was added to each well. The luminescent readout [relative light units (RLU)] was recorded
after incubation at 28°C.
In separate assays, C2C12 cells expressing modified hCysLT 2 R and β-arrestin-2 were
preincubated with BayCysLT 2 at a fixed concentration (100 nM) for 15 min, then stimulated
with varying concentrations of LTD 4 (10 pM to 10 μM) for 1 h. The RLU were recorded after 1h incubation at 28°C.
2.3.3. Measurement of Agonist-Induced Intracellular Calcium Mobilization
51
The coding regions for CysLT 1 R and CysLT 2 R were subcloned into pcDNA3 vectors
(Invitrogen, Carlsbad, CA), and HEK293 cells were stably transfected with Lipofectamine 2000
reagent (Invitrogen) following the manufacturer's instructions. Stably transfected cells were
selected with G418 (Geneticin) (2 mg/ml; Invitrogen) in Dulbecco's modified Eagle's medium
(Millipore Corporation, Billerica, MA) containing 10% fetal bovine serum, 2 mM l-glutamine,
and 100 units/ml penicillin/100 μg/ml streptomycin at 37°C in a humidified atmosphere with 5%
CO 2 .
For confirmation of antagonist specificity, HEK293 cells expressing either CysLT 1 R or
CysLT 2 R were plated onto poly-D-lysine-treated, 3-cm, clear-bottom plates at a density of
25,000 cells/plate. Cells were loaded with 3 mM Fura-2-acetoxymethyl ester dye (Invitrogen)
and 0.03% Pluronic F-127 solution (Invitrogen) and incubated for 45 min at 37°C. The cells
were then washed twice with Hanks' buffered saline solution (Invitrogen) and incubated at 37°C
for 15 min in the presence or absence of 300 nM BayCysLT 2 . All cells were then stimulated
with 300 nM LTD 4 (Cayman Chemical), and fluorescence at the 340- and 380-nm wavelengths
was measured using a Nikon Eclipse TS-100 microscope (Nikon, Melville, NY) and analyzed
using Northern Eclipse 7.0 software (EMPIX Imaging Inc., Mississauga, Canada). At the end of
the assay period, nonselective calcium release indicating cell viability was confirmed via
stimulation with 20 μM cyclopiazonic acid (Sigma-Aldrich, St. Louis, MO).
For generation of an antagonist dose-response curve, HEK293 cells were plated into poly-Dlysine-coated 96-well plates at a density of 25,000 cells/well. The next day, cells were incubated
for 1 h with Fluo-4 Direct calcium assay reagent (Invitrogen) with 2.5 mM probenecid
52
(Invitrogen). Cells were then incubated in varying concentrations of BayCysLT 2 for 15 min and
stimulated with LTD 4 (Cayman Chemical). Maximum fluorescence at 516 nm, indicating the
changes in intracellular calcium concentrations, was then measured using a SpectraMax Gemini
XS Microplate Spectrofluorometer (Molecular Devices, Sunnyvale, CA).
2.3.4. Animal Models
Transgenic human endothelial cell-specific CysLT 2 R overexpressor (EC) mice (Hui et al., 2004)
were described previously. The transgenic mice express seven copies of the human CYSLTR2
gene under the control of the Tie2 promoter/enhancer, integrated in a gene-sparse region of
chromosome 6. Hemizygous mice were continuously backcrossed with C57BL/6 mice to
generate equal numbers of transgenic and littermate wild-type (WT) controls.
2.3.5. Vascular Ear Permeability Assay
A vascular ear permeability assay was conducted as described previously (Hui et al., 2004). In
brief, mice received either 1) 3 mg/kg BayCysLT 2 diluted in 2.5% DMSO and 97.5% 1×
phosphate-buffered saline (PBS) via intraperitoneal injection or 2) no injection 15 min before
anesthesia. Mice were anesthetized intraperitoneally with ketamine/xylazine [150 mg/kg
ketamine (Vetalar) and 10 mg/kg xylazine (Rompun)] and received 200 μl of 2% Evans blue dye
in PBS via intravenous injection through the tail vein once sedated. After 15 min, the right ear
was injected intradermally with 5 ng of NMLTC 4 or 5 ng of LTD 4 , both diluted in saline (0.5%
EtOH final concentration). The left ear was injected with vehicle (0.5% EtOH in saline).
53
Animals were euthanized 15 min later. A 6-mm biopsy was removed from both ears and soaked
in formamide (750 μl) overnight (~18 h) at 55°C, and absorbance of the extracted Evans blue dye
at 610 nm was measured with a Varian Cary 50 spectrophotometer (Agilent Technologies, Santa
Clara, CA). Readouts were averaged for each experimental group, and the relative change was
calculated by comparing ears injected with NMLTC 4 or LTD 4 with vehicle-injected ears.
2.3.6. Ischemia/Reperfusion Surgical Model
Ischemia was induced via ligation of the left anterior descending coronary artery (LAD). In
brief, mice 14 to 18 weeks of age were administered 20 mg/kg tramadol (Ultram) at least 1 h
before surgery. Mice were then anesthetized with 5% isoflurane, intubated, and constantly
ventilated (150 breaths/min) with 1 to 5% isoflurane throughout the procedure. An incision was
made at the fourth intercostal space, with 50 μl of 50% lidocaine/50% bupivicaine injected
subcutaneously along the incision line as an analgesic. The intercostal muscles were cut, and the
pericardium and heart were exposed. The pericardium was pulled apart, and 6-0 silk suture
(Ethicon, Somerville, NJ) was passed underneath the LAD and surrounding myocardium. Thirty
minutes of ischemia was then induced by tightening the suture against a piece of PE-10 tubing
placed on top of the LAD and confirmed by visible paling of the affected myocardium. After
ischemia, the ligature was loosened to allow reperfusion. The ribs, muscle, and skin layers were
closed, isoflurane delivery was stopped, and animals were extubated as soon as they exhibited
signs of consciousness. Extubated animals were given 0.5 to 1.0 ml of warm lactated Ringer's
solution (Baxter, Mississauga, ON) and returned to their cages once fully mobile. The entire
procedure was performed on a heated pad.
54
Mice were divided into three groups: no injection, vehicle injection, and drug injection.
BayCysLT 2 (3 mg/kg) in DMSO was diluted in 1× PBS (final concentration 2.5% DMSO) and
delivered to the mice via intraperitoneal injection either 45 min before ischemia or 45 min after
reperfusion. All surgical procedures and treatment regimens were approved by the University
Animal Care Committee at Queen's University and adhered to the guidelines of the Canadian
Council of Animal Care.
2.3.7. Analysis of Infarct Volume
Mice were euthanized 48 h post-surgery. The heart was fully exposed, the ligature was
retightened, and coronary circulation was perfused with 150 to 200 μl of phthalocyanine blue ink
dye (Liquitex, Cincinnati, OH) via the aorta to mark the nonrisk area. The heart was then rinsed
in ice-cold PBS, blotted dry, wrapped in plastic wrap, frozen for 15 min at −20°C, and cut
transversely along the longitudinal axis into six sections using a 1.0-mm Mouse Heart Slicer
Matrix (Zivic Instruments, Pittsburgh, PA). These sections were then immersed in 1% 2,3,5triphenyltetrazolium chloride (Sigma-Aldrich) for 15 min at 37°C to demarcate viable and
necrotic tissue. Sections were then removed, blotted dry, pressed flat to 1-mm thickness between
two pieces of glass, and immersed in water. Sections were then photographed on both sides
using a digital camera (Q-Color5; Olympus, Tokyo, Japan).
The infarct area (pale white), the area at risk (brick red), the non-risk area (blue), and the total
left ventricular area were calculated for both sides of each section using ImageJ software
55
(National Institutes of Health, Bethesda, MD). The areas for each slice were multiplied by the
thickness of the slice to obtain a measure of volume. The cumulative volume for all sections for
each heart was used for comparisons. As described previously (Jiang et al., 2008), infarct size
was calculated as the ratio of the infarct volume to the volume of the risk area. Animals with
risk volume in the 35 to 70% range of total left ventricle volume were used as inclusion criteria
in the study.
2.3.8. RNA Extraction and Quantitative Real-Time PCR
Total RNA from the risk area of the left ventricle was obtained using guanidinium thiocyanatephenol-chloroform extraction (Jiang et al., 2008). In brief, tissue was manually homogenized
while immersed in TRI reagent (Sigma-Aldrich). Chloroform (Thermo Fisher Scientific,
Ottawa, ON, Canada) was then added, and the suspension was separated into three phases via
centrifugation (10 min, 13,000g, 4°C). The clear upper aqueous layer was isolated, and RNA
was precipitated using isopropranol, pelleted, and resuspended in diethyl pyrocarbonate-treated
double-distilled H 2 O (Invitrogen). RNA quality and quantity were assessed using an Agilent
Bioanalyzer (Agilent Technologies) and Nanodrop N-1000 spectrophotometer (Nanodrop,
Wilmington, DE), respectively. Total RNA was reverse-transcribed to cDNA using the iScript
kit (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer's protocol. Quantitative
real-time PCR was performed using a thermal cycler (Applied Biosystems model 7500) with
SYBR Green PCR master mix (Bio-Rad Laboratories). GAPDH was used as a control
housekeeping gene. Murine Cysltr2 primers were acquired from Invitrogen, and all other
primers were acquired from Eurofins MWG Operon (Huntsville, AL). All primer sequences are
56
listed in Table 2-1. Data were calculated using the 2−ΔΔCT method and are presented as foldinduction of transcripts for target genes normalized to Gapdh, with respect to controls.
2.3.9. Myeloperoxidase Assay
Neutrophil quantification was indirectly assessed by myeloperoxidase (MPO) activity assay. In
brief, mice were subjected to 30 min of ischemia and 48 h of reperfusion as detailed above.
Some mice were administered 3 mg/kg BayCysLT 2 45 min post-reperfusion. At endpoint, the
ventricles were isolated, flash-frozen, and stored at −80°C. All mice were heparinized before
sacrifice. Samples were thawed on ice and placed into 20 mM potassium phosphate (Thermo
Fisher Scientific) buffer, pH 7.4, at a 1 mg/20 μl ratio. Samples were then homogenized
(PowerGen model 125; Thermo Fisher Scientific) and centrifuged at 10,000g for 5 min at 4°C.
The supernatant was discarded, and the pellet was resuspended in 50 mM potassium phosphate
(Thermo Fisher Scientific) buffer, pH 6.0, with 0.5% hexadecyltrimethylammounium bromide
(Sigma-Aldrich), sonicated (Ultrasonic Dismembrator model 500; Thermo Fisher Scientific), and
immersed in a water bath at 60°C for 2 h. Samples were then centrifuged at 10,000g for 5 min at
4°C, and the supernatant was assayed in a 96-well plate by adding 7 μl of resuspended heart
tissue to 200 μl of O-dianosidine buffer [0.5 mM O-dianosidine dihydrochloride (SigmaAldrich), 89.95% double distilled H 2 O, 10% 50 mM potassium phosphate buffer, pH 6.0, and
0.05% H 2 O 2 (Sigma-Aldrich)]. The change in absorbance at 460 nm was measured every 30 s
for 5 min in a 96-well plate reader (FLUOStar Optima, BMG Tech GmbH, Offenburg,
Germany).
57
Gene
Gapdh
Cysltr2
Vcam1
Icam1
Forward Primer (5′ to 3′)
Reverse Primer (5′ to 3′)
Amplicon
(bp)
CATGGCCTTCCGTGTTCCTA
TTCCAGAATCAGGTCCACGTG
TTGGCTGTGACTCCCCTTCTT
ACCACGGAGCCAATTTCTCAT
ATGCCTGCTTCACCACCTTCT
GCAGTTGCATGGTATGGCAGAA
AGAGCTCAACACAAGCGTGGA
TGGAAGATCGAAAGTCCGGAG
106
102
104
110
Table 2-1: Primers used in qualitative real-time PCRs.
Gene names, primer sequences, and amplicon sizes in base pairs (bp) for primers used in this
study are shown.
58
2.3.10. Statistical Analysis
Dose-response curve data were analyzed by nonlinear regression using Prism 5.0 software
(GraphPad Software Inc., San Diego, CA). Two-tailed unpaired Student's t tests were performed
using Prism 5.0 software. All values are given as mean ± SEM. A p value less than 0.05
indicated statistical significance.
59
2.4. Results
2.4.1. Synthesis and chemistry
3-(((3-Carboxycyclohexyl)amino)carbonyl)-4-(3-(4-(4-phenoxybutoxy)phenyl)-propoxy)benzoic
acid, termed BayCysLT 2 , was synthesized (as outlined in Figure 2-1) using a similar protocol to
that used by Harter et al. (2009). In lieu of purchasing it, we synthesized compound 2 via
esterification of 1 as performed by Lewin et al. (2005). Furthermore, in lieu of the literature
(Harter et al., 2009), where 8 was purchased, we generated compound 8 by pyridine hydrolysis
of the intermediate diester 9 according to Coutts et al. (1981). 1H-NMR, 13C-NMR, and highresolution mass spectra, as well as melting point characterization of our BayCysLT 2 , were
consistent with the literature report (Harter et al., 2009).
2.4.2. BayCysLT 2 is more potent than Bay-u9773
A β-galactosidase/β-arrestin assay was used to determine the relative potencies of BayCysLT 2
and the dual CysLT 1 R/CysLT 2 R antagonist Bay-u9773. Cells were preincubated for 15 min
before stimulation with either 30 or 300 nM LTD 4 . The IC 50 value for BayCysLT 2 was
determined to be 53 nM when cells were stimulated with 30 nM LTD 4 (~EC 50 for LTD 4 in this
assay). Increasing the stimulus concentration 10-fold to 300 nM resulted in an increase in the
IC 50 to 274 nM. Comparatively, Bay-u9773 was found to have an IC 50 of 4.6 μM when
stimulated with 300 nM LTD 4 (Figure 2-2A). Thus, BayCysLT 2 is an approximately 20-fold
more potent CysLT 2 R inhibitor, as tested via the β-arrestin assay.
60
Figure 2-1: Chemical synthesis of BayCysLT 2 .
Chemical synthesis of BayCysLT 2 . Compounds are indicated by bold numbers and are described
under Materials and Methods. Reagents, conditions, and percentage yields are indicated as
follows: (a) MeOH, HCl (5%), rt, 3 h, 100%; (b) K 2 CO 3 , MeCN, reflux, 15 h, 81%; (c) LiAlH 4 ,
THF, rt, 30 min, 100%; (d) Ph 3 P, CBr 4 , THF, rt, 4 h, 69%; (e) MeOH, HCl (5%), reflux, 6 h,
30%: 70%; (f) C 5 H 5 N (aq) , reflux, 18 h, 80%; (g) (CH 3 ) 3 SiCl, MeOH, rt, 18 h, 36%; (h) 1-ethyl3-(3-dimethylaminopropyl) carbodiimide, hydroxybenzotriazole, Et 3 N, CH 2 Cl 2 , rt, 15 h, 63%;
(i) K 2 CO 3 , C 5 H 10 N, reflux, 15 h, 17%; (j) NaOH, MeOH, THF, 60°C, 4 h, 100%.
61
We then assessed the competitive nature of BayCysLT 2 inhibition by holding its concentration
constant at 100 nM and stimulating the cells with 10 pM to 10 μM LTD 4 . BayCysLT 2 treatment
resulted in a rightward shift in the dose-response curve. However, the agonist concentrations
used were not potent enough to elicit a plateau response in antagonist-treated cells (preventing
the generation of a Schild plot). LTD 4 stimulation-elicited luminescence increased in a dosedependent manner in the presence of BayCysLT 2 (Figure 2-2B).
2.4.3. BayCysLT 2 is selective for CysLT 2 R in vitro and in vivo
We sought to confirm BayCysLT 2 selectivity for CysLT 2 R compared with CysLT 1 R. We
examined intracellular calcium mobilization in HEK293 cells stably transfected with either
CysLT 1 R or CysLT 2 R in response to LTD 4 stimulation and whether BayCysLT 2 could abrogate
this response. Both CysLT 1 R- and CysLT 2 R-transfected cells responded robustly to challenge
with 300 nM LTD 4 , and although the CysLT 1 R response was transient, the CysLT 2 R response
was relatively sustained (Figure 2-3A and C respectively). Application of 100 nM BayCysLT 2
for 15 min before leukotriene stimulation failed to affect intracellular calcium mobilization in
CysLT 1 R-transfected cells (Figure 2-3B), but virtually eliminated responses in CysLT 2 Rtransfected cells (Figure 2-3D). Cyclopiazonic acid stimulation at the end of each experiment
demonstrated cell viability. Antagonist dose-response curves showed that BayCysLT 2 is ≥500fold more selective for CysLT 2 R than CysLT 1 R in HEK cells stimulated with 300 nM LTD 4
(Fig. 2-4).
62
Figure 2-2: BayCysLT 2 is a more potent antagonist of the human CysLT 2 receptor than
Bay-u9773.
A, RLU response by C2C12 cells (n = 4) expressing modified hCysLT 2 R and β-arrestin-2 to 30
or 300 nM LTD 4 stimulation in the presence of varying concentrations of BayCysLT 2 or Bayu9773. IC 50 values were determined to be 53 nM (30 nM LTD 4 ) and 274 nM (300 nM LTD 4 ) for
BayCysLT 2 and 4.6 μM (300 nM LTD 4 ) for Bay-u9773. B, a constant concentration (100 nM)
of BayCysLT 2 was incubated with increasing concentrations of LTD 4 . Response to LTD 4
increased in a dose-dependent manner in the presence of BayCysLT 2 , but did not reach a plateau
phase (n = 4). Means of duplicates for each sample are shown (with error bars depicting SEM).
63
Figure 2-3: BayCysLT 2 selectively antagonizes the human CysLT 2 receptor calcium
responses.
BayCysLT 2 selectively antagonizes the human CysLT 2 receptor calcium responses. Intracellular
calcium mobilization in HEK cells expressing either CysLT 1 R (HEK-CysLT 1 R) or CysLT 2 R
(HEK-CysLT 2 R) receptor, expressed as the ratio between fluorescence detected at 340 and 380
nm, was elicited via stimulation with 300 nM LTD 4 . Tracings and images depict one cell
representative of its experimental group (n = 10–15). Color coding representative of relative
intracellular calcium concentrations is indicated on the vertical scale bar, with red being highest
and purple the lowest. At the end of each LTD4 stimulation, 20 μM cyclopiazonic acid (CPA)
was added to test for nonselective calcium release. A and B, HEK-CysLT 1 R cells responded to
leukotriene stimulation both in the absence (A) and presence (B) of 100 nM BayCysLT 2 with a
sharp increase in intracellular calcium. C and D, HEK-CysLT 2 R cells responded to leukotriene
stimulation in the absence (C) but not in the presence (D) of 100 nM BayCysLT 2 .
64
Figure 2-4: BayCysLT 2 is ≥500-fold more selective for CysLT 2 R than CysLT 1 R.
Antagonist dose-response curve for HEK-CysLT 2 R (●) cells was constructed by plotting the
fluorescence in response to challenge with 300 nM LTD 4 at each antagonist concentration and
used to determine the IC 50 value. HEK-CysLT 1 R (○) cells did not exhibit significant decrease in
calcium response to leukotriene stimulation even in the presence of 100 μM BayCysLT 2 . Values
are given as mean ± SEM. (n = 3–8).
65
The selectivity of BayCysLT 2 was examined in vivo by examination of vascular leakage in the
ear after agonist stimulation. Evans blue dye was injected into the circulation of anesthetized
WT (C57Bl/6) and EC transgenic mice, and vascular permeability was assessed by the
extravasation of blue dye into the aural tissue in response to cysLT challenge, as measured by
absorbance at 610 nm. In WT mice injected with the CysLT 1 R antagonist MK-571 [(E)-3-(((3(2-(7-chloro-2-quinolinyl)ethenyl)phenyl)((3-(dimethylamino)-3-oxopropyl)thio)methyl)thio)propanoic acid], stimulation with LTD 4 resulted in significantly greater dye extravasation than
vehicle-injected controls (Figure 2-5A). Mice injected with BayCysLT 2 showed significantly
less dye extravasation in both LTD 4 - and NMLTC 4 -treated ears compared with mice treated with
MK-571 (Figure 2-5A). In EC mice, LTD 4 injection resulted in significantly greater dye
extravasation compared with vehicle control, a phenomenon that was almost eradicated when
mice were treated with BayCysLT 2 (Figure 2-5B).
2.4.4. BayCysLT 2 attenuates exacerbation of myocardial damage in EC mice
Given our previous findings (Jiang et al., 2008) using the nonselective cysLT receptor antagonist
Bay-u9773 in a myocardial ischemia/reperfusion (I/R) injury model, as well as more recent in
vitro data with a CysLT 2 R-specific antagonist (Wunder et al., 2010), we sought to determine
whether the exacerbation of myocardial damage after ischemia/reperfusion found in EC
transgenic mice was CysLT 2 R-dependent. In accordance with previous work, there was no
difference in risk volumes between any of the experimental groups (Figure 2-6B). Infarct volume
in EC transgenic mice was significantly greater than in WT controls.
66
Figure 2-5: BayCysLT 2 is a potent selective antagonist at the CysLT 2 receptor in vivo.
Vascular permeability in murine ears in response to intradermal LTD 4 or NMLTC 4 challenge
was measured by quantifying Evans blue dye extravasation and normalizing values against
vehicle-injected controls. A, LTD 4 injection caused increased vascular permeability in wild-type
mice in the presence of the CysLT 1 R antagonist MK-571, but not in mice treated with
BayCysLT 2 . NMLTC 4 injection in BayCysLT 2 -treated mice yielded similar results to LTD 4 injected counterparts. B, LTD 4 injection in EC transgenic mice resulted in increased vascular
permeability compared with vehicle-treated controls, and this phenomenon was attenuated by
BayCysLT 2 pretreatment. * = p < 0.05. Values are given as mean ± SEM. (n = 4–5).
67
However, treatment with BayCysLT 2 (3 mg/kg) in EC mice 45 min before ischemia attenuated
infarct damage. Mice subjected to vehicle injections did not differ in infarction volume
compared with sham counterparts. WT mice injected with BayCysLT 2 did not differ in
infarction volume compared with vehicle or sham groups (Figure 2-6C).
Given that selective CysLT 2 R inhibition in this study and nonselective CysLT 2 R inhibition in a
previous study (Jiang et al., 2008) did not affect infarct volume in wild-type mice and
myocardial infarction damage occurs in two distinct phases (one consisting of
ischemia/reperfusion injury, the second mediated by the inflammatory response to the initial
injury), we propose that CysLT 2 R is involved in the second phase. To evaluate this hypothesis,
we injected EC transgenic mice with 3 mg/kg BayCysLT 2 45 min after reperfusion. Risk
volumes did not differ significantly between experimental groups (Figure 2-6B). However,
infarct volume in this group was significantly reduced compared with transgenic mice that did
not receive BayCysLT 2 (Figure 2-6C).
2.4.5. Upregulation of adhesion molecule gene expression is attenuated by BayCysLT 2
ICAM-1 and VCAM-1 are essential proteins for leukocyte adhesion and subsequent diapedesis.
Indeed, previous work has found both ICAM-1 and VCAM-1 mRNA levels to be significantly
elevated in EC mice 3 h after I/R compared with basal levels (Jiang et al., 2008). We report here
that ICAM-1 mRNA expression is significantly up-regulated in EC transgenic mice at 48 h postI/R relative to basal levels, and application of BayCysLT 2 45 min
68
Figure 2-6: BayCysLT 2 attenuates CysLT 2 R-mediated exacerbation of myocardial
ischemia/reperfusion injury in mice.
A, representative 2,3,5-triphenyltetrazolium chloride-stained ventricular sections from WT
(white bars) and EC mice (black bars) given no injection (ctrl), vehicle injections (veh), 3 mg/kg
BayCysLT 2 45 min before ischemia (drug −45), or 3 mg/kg BayCysLT 2 45 min post-reperfusion
(drug +45) are presented. B and C, morphometric analysis of left ventricle volume at risk (B) and
infarct size (C) in the groups mentioned above showed that infarction volume was significantly
greater in EC mice compared with WT, and administration of BayCysLT 2 either before or after
ischemia/reperfusion attenuated this response. * = p < 0.05; **, p < 0.01. Values are given as
mean ± SEM. (n = 5–7).
69
Post-reperfusion attenuated this response (Figure 2-7A). Concordantly, VCAM-1 mRNA was
also significantly up-regulated in transgenic mice at 48 h post-I/R relative to basal levels.
Application of BayCysLT 2 45 min post-reperfusion also attenuated this response (Figure 2-7B).
MPO activity was quantified as an indirect assessment of neutrophil presence within the
ventricles of mice 48 h post/I/R. MPO activity was significantly increased in EC transgenic mice
after I/R compared with wild-type counterparts. However, transgenic mice treated with
BayCysLT 2 45 min post-reperfusion showed significantly less MPO activity than untreated
transgenic mice (Figure 2-7C).
70
Figure 2-7: BayCysLT 2 attenuates indirect measures of leukocyte recruitment in
ischemia/reperfusion injury-induced diapedesis.
A and B, EC mice showed significantly increased VCAM-1 (A) and ICAM-1 (B) mRNA
expression post-I/R in comparison with non-infarcted controls. Treatment with 3 mg/kg
BayCysLT 2 post-I/R resulted in significant attenuation of VCAM mRNA up-regulation. ICAM
mRNA up-regulation was also reduced, albeit at borderline significant levels. C, infarcted EC
mice also showed significantly increased myeloperoxidase enzyme activity (1 unit is defined as
the amount of MPO required to convert 1 μmol of H 2 O 2 in 1 min) present in the myocardial area
at risk, indicating an increased presence of neutrophils, compared with infarcted WT animals.
Increase in neutrophil presence in the tissue was significantly attenuated by treatment with 3
mg/kg BayCysLT 2 post-I/R. n = 3–4 for mRNA quantification; n = 5 for MPO assay. * = p <
0.05. Values are given as mean ± SEM.
71
2.5. Discussion
We hereby demonstrate the in vitro and in vivo characterization of a CysLT 2 R-selective
pharmacological antagonist and establish its utility in both cell assays and attenuation of
postmyocardial infarction inflammatory response and vascular leakage, respectively.
BayCysLT 2 is one of a new family of CysLT 2 R-selective antagonists to be characterized that
also includes HAMI3379 (Wunder et al., 2010). BayCysLT 2 differs only in one ring structure
from HAMI3379 (benzyl versus cyclohexyl ring). BayCysLT 2 is ~10-fold less potent than
HAMI3379 [IC 50 50 to 4.3 nM, respectively, in response to 30 nM LTD 4 (Harter et al., 2009)],
but is ~20-fold more potent than the dual antagonist Bay-u9773. In addition, unlike Bay-u9773,
BayCysLT 2 does not show partial agonist properties, because intracellular calcium mobilization
was not observed during antagonist incubation. Both BayCysLT 2 and HAMI3379 are highly
selective for CysLT 2 R, with HAMI3379 showing more than 10,000-fold affinity for CysLT 2 R
versus CysLT 1 R (Wunder et al., 2010). Our data indicate that BayCysLT 2 is at least 500-fold
more selective for CysLT 2 R and seems to show competitive inhibition, as does HAMI3379
(Wunder et al., 2010).
Previous work has shown that the cysLTs mediate vascular permeability in peripheral
vasculature and this effect is exacerbated in transgenic CysLT 2 R-overexpressing mice and
abolished in CysLT 2 R knockout mice (Hui et al., 2004; Moos et al., 2008). We have confirmed,
pharmacologically, that CysLT 2 R mediates this vascular permeability response, because
BayCysLT 2 treatment attenuated Evans blue dye extravasation in both WT and EC transgenic
animals. The mechanism seems to result from calcium signaling, which in turn regulates
72
transendothelial endocytosis/exocytosis of caveolae-generated vesicles (Moos and Funk, 2008).
It was also noted that CysLT 2 R blockage with Bay-u9773 resulted in attenuation of exocytosis
but not endocytosis in the vascular endothelium, although this phenomenon may potentially be
attributed to the partial agonist properties of Bay-u9773 (Moos et al., 2008).
Transgenic overexpression of CysLT 2 R in endothelium has been shown to result in a significant
exacerbation of damage after myocardial infarction, as well as increased CD45+ cell infiltration,
intermyofibral erythrocyte accumulation, and fluid extravasation (Jiang et al., 2008). Previous
work has also noted that basal left ventricular function is unaffected by overexpression of
CysLT 2 R in the uninjured myocardium, but post-infarction (2 weeks) remodeling was
accelerated in the EC heart (Jiang et al., 2008). In this study, we determined that selective
blockade of CysLT 2 R with BayCysLT 2 is capable of abrogating the damage observed in EC
transgenic mice. Although the mechanism underlying this effect is not fully clear, our data
indicate that it probably involves alterations in the post-reperfusion inflammatory response.
Myocardial infarction damage can be loosely separated into three phases: ischemic, reperfusion,
and inflammatory (Yellon and Hausenloy, 2007). Ischemic damage occurs during the presence
of the coronary circulation blockage and is generally characterized by cellular necrosis.
Reperfusion damage occurs at the immediate time when circulation is restored to the
myocardium and is characterized by oxidative stress, triggering of pro-apoptotic pathways, and
myocardial stunning (Yellon and Hausenloy, 2007). Finally, the damage to the tissue caused by
the aforementioned two phases initiates the innate immune response, characterized by increased
73
expression of cell-adhesion molecules, as well as leukocyte recruitment and migration (Yellon
and Hausenloy, 2007).
Our previous studies observed no reduction in cardiac damage after infarction in mice lacking
CysLT 2 R or mice lacking 5-lipoxygenase, the enzyme responsible for leukotriene synthesis,
compared with wild-type controls (Jiang et al., 2008). In the current study, BayCysLT 2
treatment attenuated increased infarction damage when applied either before ischemia or after
reperfusion. Finally, treatment with BayCysLT 2 prevented the increases in cell-adhesion
molecule gene expression and leukocyte infiltration (as measured by MPO assay) into the
myocardium that is characteristic of the inflammatory response after acute myocardial infarction.
These findings indicate that the cysLTs and their receptors do not play a role in the initial
ischemia and/or reperfusion components of the acute myocardial infarction injury response, but
rather mediate post-I/R inflammation.
Given this evidence, we propose a pathological mechanism where CysLT 2 R activation results in
heightened facilitation of diapedesis, which in turn enhances the magnitude of the inflammatory
response and results in additional damage to the site of injury. CysLTs required for CysLT 2 R
activation can be produced via a transcellular mechanism (Zarini et al., 2009). In the
myocardium, cysLT production also probably occurs transcellularly with neutrophils (the first
inflammatory cells arriving after reperfusion) being the main LTA 4 source and other cell types
(e.g., endothelial cells) converting neutrophil-donated LTA 4 into cysLTs. As such,
ischemia/reperfusion tissue damage may result in a positive feedback loop resulting in
uncontrolled inflammation. Certainly, endothelial or heterogeneous CysLT 2 R activation has
74
been shown to result in the activation of transcription factors and chemokine genes (Thompson et
al., 2008; Uzonyi et al., 2006). Prevention of CysLT 2 R activation via pharmacological
antagonism would thus be protective by preventing this positive feedback.
Although we have proposed a potential mechanism for CysLT 2 R-mediated exacerbation of the
inflammatory response here and from our past studies (Jiang et al., 2008), many questions
remain to be investigated and there are limitations to our findings. Precisely how does activation
of CysLT 2 R in endothelial cells facilitate this up-regulation of pro-leukocyte adhesion genes?
What is the exact interplay between endothelium and infiltrating leukocytes to cysLT generation
and activation of the receptor? It is possible that other reactive oxygen species are altered under
stress conditions upon CysLT 2 R activation. How does the overexpression of CysLT 2 R in the
transgenic model used here translate to human myocardial infarction injury? Future endeavors
should be made to determine the long-term effects of CysLT 2 R blockade on cardiac function and
remodeling postinfarction in our model and to move beyond mice to humans.
In summary, we have characterized, both in vitro and in vivo, a CysLT 2 R-selective
pharmacological antagonist, BayCysLT 2 . Along with NMLTC 4 , a novel CysLT 2 R agonist (Yan
et al., 2011) and HAMI3379 (Wunder et al., 2010), we now have the required pharmacological
tools to fully exploit CysLT 2 R biological signaling in health and disease.
75
2.6. Acknowledgements
We thank Matthew Crerar and Christie DeVille for assistance with the calcium imaging
experiments; Graham E. Garrett for assistance with the NMR and mass spectrometry analysis;
Dr. Yiqun Hui for EC mice; Dr. Alastair V. Ferguson for use of his calcium imaging equipment;
and Dr. Michael E. Nesheim for use of his plate reader.
This work was supported by the Canadian Institutes of Health Research [Grants MOP-79459,
MOP-93689] (to C.D.F.); and a Natural Sciences and Engineering Research Council grant (to
D.A.P.). C.D.F. holds a Tier I Canada Research Chair in Molecular, Cellular and Physiological
Medicine and is recipient of a Career Investigator award from the Heart and Stroke Foundation
of Ontario. D.A.P. holds a Tier II Canada Research Chair in Free Radical Chemistry.
76
Chapter 3: Long-term myocardial remodeling post-ischemia/reperfusion
injury is mildly impaired by CysLT 2 R antagonism.
77
3.1. Abstract
Cardiovascular disease is a prevalent cause of death today. Cysteinyl leukotrienes (cysLTs) are
potent inflammatory mediators involved in cardiovascular disease pathogenesis and severity. In
particular, the CysLT receptor 2 (CysLT 2 R) is a mediator of myocardial infarction (MI) injury,
as mice with endothelial-targeted CysLT 2 R-overexpression (EC) demonstrate increased damage
at 48 hours post-MI. However, the long-term effects of CysLT 2 R activation post-MI are
unknown. We examined the effects of CysLT 2 R-overexpression and antagonism on cardiac
remodeling in mice following ischemia/reperfusion (I/R) injury. Echocardiography images were
used to evaluate dimensional and functional properties of mouse hearts at 2 weeks, 4 weeks, and
12 weeks post-I/R. We observed no major differences in heart dimensions or functional
properties between wild-type (WT) or EC mice. However, WT and EC mice treated with the
CysLT 2 R-selective antagonist BayCysLT 2 displayed mild ventricular dilatation, increased
ventricular mass (WT: 101.9 ± 5.6 mg treated vs. 98.8 ± 4.4 mg untreated; EC: 125.9 ± 6.4 mg
treated vs. 106.5 ± 3.7 mg untreated), diminished ejection fraction (WT: 47.8 ± 2.0% treated vs.
56.2 ± 5.1% untreated; EC: 46.1 ± 1.7% treated vs. 55.0 ± 1.7% untreated), and decreased
fractional shortening (WT: 23.9 ± 1.1% treated vs. 29.6 ± 3.4% untreated; EC: 22.8 ± 1.0%
treated vs. 28.2 ± 1.1% untreated), versus untreated counterparts. Stroke volume, cardiac output,
and heart rate were unaffected. These findings indicate that CysLT 2 R antagonism is mildly
deleterious to long-term cardiac function post-infarction, despite apparently attenuating acute
myocardial injury. This may indicate a necessity for CysLT 2 R signaling for proper wound
healing. Further investigation is required to fully understand the role of CysLT 2 R signaling in
myocardial injury and remodeling.
78
3.2. Introduction
Cardiovascular disease (CVD) is a leading cause of death among both males and females in the
industrialized world, and is becoming an increasing problem in the developing world as well.
The majority of CVD cases involve myocardial infarction, a condition characterized by blockage
of the coronary circulation, resulting in cessation of oxygen and nutrient delivery to the
myocardium, leading to tissue death (Yellon and Hausenloy, 2007). Acute treatment entails
rapid reperfusion of the myocardium, but that induces a series of responses that result in
additional injury to the myocardium - a phenomenon termed "reperfusion injury." Reperfusion
injury, in turn, triggers a series of pro-inflammatory responses that facilitate debris removal and
proper wound healing if properly regulated (Kempf et al., 2012). However, exacerbation of this
inflammatory response results in infarct expansion, resulting in increased myocardial damage
(Vanhoutte et al., 2007). In addition, complete attenuation or inactivation of pro-inflammatory
mechanisms following ischemic insult leads to deleterious remodeling (Heymans et al., 1999).
Thus, understanding and regulating the post-myocardial infarction inflammatory response is
critical to maximizing wound healing and preserving cardiac function.
Leukotrienes (LTs) are potent pro-inflammatory lipid mediators that are most well-known as
mediators of airway smooth muscle constriction (Moos and Funk, 2008). They are synthesized
from arachidonic acid and secreted primarily by leukocytes, although leukotriene production can
occur in other cell types as well (Folco and Murphy, 2006). The leukotrienes consist of the
precursor LTA 4 , the pro-chemotaxtic LTB 4 , and the pro-inflammatory LTC 4 , D 4 , and E 4 termed "cysteinyl leukotrienes" (cysLTs) because of a shared cysteine moiety common to all
79
three molecules (Moos and Funk, 2008). The cysLTs bind to three known receptors, the well
characterized cysteinyl leukotriene receptor 1 (CysLT 1 R) and receptor 2 (CysLT 2 R), as well as
the recently discovered cysteinyl leukotriene E receptor (GPR99) (Heise et al., 2000; Kanaoka et
al., 2013; Lynch et al., 1999). LTC 4 and LTD 4 are agonists for CysLT 1 R and CysLT 2 R, while
LTE 4 , the most abundant and stable of the cysLTs, possesses little affinity (Heise et al., 2000;
Lynch et al., 1999). However, the situation is reversed for GPR99, which binds LTE 4 with much
greater affinity than LTC 4 and LTD 4 (Kanaoka et al., 2013).
Research has implicated leukotrienes with a role in cardiovascular disease. Indeed, elevated
urinary LTE 4 has been found in individuals post-MI (Carry et al., 1992), and leukotriene
synthesis pathway enzymes are expressed in atherosclerotic plaques (Allen et al., 1998). In
addition, polymorphisms in the genes encoding 5-lipoxygenase (5-LO), 5-LO activating protein
(FLAP), LTA 4 hydrolase (LTA 4 H), and LTC 4 synthase (LTC 4 S) have been linked with
increased risk of myocardial infarction and/or stroke (Dwyer et al., 2004; Helgadottir et al.,
2006; Helgadottir et al., 2004; Wang et al., 2012). The CysLT 2 R is the predominant isoform
expressed in the heart (Heise et al., 2000), and is upregulated following oxygen deprivation in
heart, retina, and brain (Barajas-Espinosa et al., 2012; Jiang et al., 2008; Shi et al., 2012a). Mice
possessing endothelium-targeted CysLT 2 R-overexpression exhibit damage exacerbation
following ischemia/reperfusion, as well as elevated myocardial edema and leukocyte infiltration
compared to control mice (Jiang et al., 2008). These effects are attenuated by application of the
CysLT 2 R-selective antagonist BayCysLT 2 either prior to ischemia onset or after reperfusion,
indicating that CysLT 2 R mediates exacerbation of myocardial infarction damage by regulating
the post-ischemia/reperfusion inflammatory response (Ni et al., 2011).
80
Despite our previous work implicating the CysLT 2 R as a mediator of myocardial damage
following ischemia, we have very little information on how CysLT 2 R-mediated inflammatory
response regulation affects cardiac remodeling and long-term cardiac function. Jiang et al.
(2008) demonstrated evidence of accelerated remodeling at 2 weeks post-infarction in the
endothelium-targeted CysLT 2 R overexpressing mouse model, but did not investigate longer term
effects or whether the phenomenon could be attenuated via CysLT 2 R pharmacological
antagonism. As such, we investigate herein the effects of CysLT 2 R overexpression, as well as
CysLT 2 R-selective antagonism, on cardiac remodeling and function post-myocardial infarction.
81
3.3. Materials and Methods
3.3.1. Mouse Models
All mouse models were generated from a C57/Bl6 genetic background. Transgenic endothelial
cell-specific human CysLT 2 R overexpressing mice (EC) were described previously (Hui et al.,
2004). These mice express seven copies of the human CYSLTR2 gene under the control of the
Tie2 promoter/enhancer, integrated in a gene-sparse region of chromosome 6.
3.3.2. Myocardial Infarction Induction
As previously outlined (Jiang et al., 2008), myocardial infarction was induced using in vivo
transient surgical ligation of the left anterior descending coronary artery (LAD). Mice were
administered 20 mg/kg tramadol (Ultram) at least 1 h before surgery. Mice were then
anesthetized with 5% isoflurane, intubated, and constantly ventilated (150 breaths/min) with 1 to
5% isoflurane throughout the procedure. An incision was made at the fourth intercostal space,
with 50 μl of 50% lidocaine/50% bupivicaine injected subcutaneously along the incision line as
an analgesic. The intercostal muscles were cut, and the pericardium and heart were exposed.
The pericardium was pulled apart, and 6-0 silk suture (Ethicon, Somerville, NJ) was passed
underneath the LAD and surrounding myocardium. Ischemia was then induced for 30 minutes
by tightening the suture against a piece of PE-10 tubing placed on top of the LAD and confirmed
by visible paling of the affected myocardium. Following ischemia, the ligature was loosened to
facilitate reperfusion. The ribs, muscle, and skin layers were closed, isoflurane delivery was
82
stopped, and animals were extubated as soon as they exhibited signs of consciousness.
Extubated animals were given 0.5 to 1.0 ml of warm lactated Ringer's solution (Baxter,
Mississauga, ON) via subcutaneous injection and returned to their cages once fully ambulatory.
The entire procedure was performed on a heated pad. Selected mice were administered 3 mg/kg
of BayCysLT 2 via intraperitoneal injection 45 minutes post-reperfusion. All surgical procedures
and treatment regimens were approved by the University Animal Care Committee at Queen's
University and adhered to the guidelines of the Canadian Council of Animal Care.
3.3.3. Echocardiography
Echocardiography was performed using two-dimensional and Doppler ultrasound using a Vevo
770 in vivo micro-imaging system (VisualSonics, Toronto, ON, Canada). Echocardiograms were
obtained from mice at two, four, and twelve weeks post-I/R. In addition, mice treated with
BayCysLT 2 were subjected to echocardiography one week prior to induction of I/R. Mice were
anaesthetized using 1% isoflurane delivered via nose cone. Hair was removed using a
combination of mechanical shaving and chemical depilation, and mice were placed on a heated
pad in a supine position. Ventricular dimension measurements were taken using B- and M-mode
images obtained at the midpapillary level in the parasternal long- and short-axis views (Figure 31). IVS (interventricular septum), LVID (left ventricular internal dimension), LVPW (left
ventricular posterior wall), LVOD (left ventricular outer dimension), apical region wall
thickness, and left ventricular volume were measured directly at both systole and diastole (Figure
3-1). Ejection fraction, fractional shortening, left ventricular volume (systole and diastole),
83
Figure 3-1: Echocardiography imaging and left ventricular dimensional measurement
methodology.
Left ventricular dimensions were measured using images captured via echocardiography. The
heart was visualized along both the parasternal long axis and short axis in brightness (B) mode,
which was used to obtain measurements of apical ventricular wall thickness. Motion (M) mode
images were obtained at the mid-papillary region of the left ventricle, and used to measure the
dimensions of the interventricular septum (IVS), left ventricular internal dimension (LVID), and
left ventricular posterior wall (LVPW). These measurements were then used in formulae in
order to calculate functional parameters of cardiac function.
84
stroke volume, cardiac output, and left ventricular mass were calculated from these
measurements (see Appendix I for formulae). Multiple measurements were made for each
parameter, with an average of 3-5 cardiac cycles used for all calculations.
3.3.4. Statistical Analysis
Data was analyzed by two-way analysis of variance with post-hoc Student's T-test using Prism
5.0 software (GraphPad Software Inc., La Jolla, CA). A p value < 0.05 was determined as
statistically significant. All values, unless otherwise mentioned, are presented as mean ± SEM.
Due to lack of availability of appropriate pre-I/R echocardiography data for all experimental
groups, the 2 week post-surgery timepoint was regarded as baseline for the analysis of changes
over time.
85
3.4. Results
3.4.1. Age-related weight gain post-ischemia/reperfusion is unaltered by overexpression of
endothelial CysLT 2 R or by BayCysLT 2 treatment.
We monitored body weight as a general indicator of health in mice following
ischemia/reperfusion injury. At 2 weeks post-I/R, all mice had recovered weight lost due
surgical intervention. By 4 weeks, WT mice not treated with BayCysLT 2 (p < 0.05), as well as
EC mice treated with BayCysLT 2 (p < 0.01) were significantly heavier than their body weights
at the time of surgery. By 12 weeks, all groups were significantly heavier compared to their
initial weight prior to LAD ligation (p < 0.01). No differences in body weight were noted
between experimental groups at any of the timepoints (Table 3-1).
3.4.2. Post-ischemia/reperfusion pathological cardiac hypertrophy is exacerbated in animals
treated with BayCysLT 2 .
Myocardial injury, if sufficiently deleterious, results in pathological cardiac hypertrophy and
ventricular dilatation either in an attempt to compensate for an inability to respond adequately to
increased pressure and/or volume load (Frey et al., 2004). Pathological cardiac hypertrophy can
manifest as thickening of the interventricular septum (IVS) and left ventricular posterior wall
(LVPW) (pressure overload -mediated) or as thinning of the IVS and LVPW with the
enlargement of the left ventricular internal dimension (LVID) (volume overload-mediated). In
both cases, pathological cardiac remodeling leads to gradual decrease and loss of cardiac
86
Pre-I/R
2 Weeks
4 Weeks
12 Weeks
WT
25.0 ± 1.3
25.1 ± 1.2
26.2 ± 1.1#
33.5 ± 1.2##
EC
25.1 ± 1.1
25.3 ± 1.5
25.8 ± 1.6
30.7 ± 2.1##
WT-BayCysLT 2
24.9 ± 1.4
25.2 ± 1.5
26.1 ± 1.6
32.6 ± 2.2##
EC-BayCysLT 2
26.6 ± 1.4
26.7 ± 1.5
28.8 ± 1.9##
36.1 ± 3.0##
Table 3-1: Body weights of mice prior to and following ischemia/reperfusion injury at time
of echocardiography.
Mouse body weight (in grams) was measured prior to LAD ligation, and again prior to each
echocardiography session. Mice in all groups gained significant amounts of weight with age, but
no significant differences were noted between groups. # = p < 0.05, ## = p < 0.01 versus pre-I/R
timepoint. Values are mean ± SEM, n = 6-10.
87
function (McMullen and Jennings, 2007). We noted no changes in IVS thickness over the time
course of the experiment, nor any differences between experimental groups. Likewise, we
noticed minimal change in LVPW thickness over time or between experimental groups (Table 32, Figure 3-2). However, LVID at diastole was significantly increased post-I/R over time in EC
mice treated with BayCysLT 2 . LVID at systole was significantly increased post-I/R over time in
EC, EC-BayCysLT 2 , and WT-BayCysLT 2 groups. In addition to this, EC-BayCysLT 2 mice
showed significantly increased LVID during diastole versus untreated EC counterparts at 4 and
12 weeks post-I/R, and both WT-BayCysLT 2 and EC-BayCysLT 2 mice showed significantly
increased LVID during systole versus untreated counterparts at 4 and 12 weeks post-I/R. LVOD
significantly increased over time during both diastole and systole in EC-BayCysLT 2 mice (but
no other groups), and was significantly larger in the EC-BayCysLT 2 group than WT-BayCysLT 2
mice during both diastole and systole as well (Table 3-3) (Figure 3-2). Finally, apical wall
thickness was significantly decreased over time during diastole and systole in untreated mice
(WT and EC), unchanged in the WT-BayCysLT 2 group, and significantly increased in the ECBayCysLT 2 group. Apical wall thickness at 4 and 12 weeks was also significantly greater in
mice treated with BayCysLT 2 versus untreated counterparts. However, no difference was
observed between genotypes (Table 3-4). Combined, these results indicate that a mild
ventricular dilatation is present in mice treated with BayCysLT 2 (but not untreated mice) - one
that is slightly more severe in EC mice than WT mice. However, BayCysLT 2 treatment appears
to maintain the acute cardioprotective properties previously detailed (Ni et al., 2011), given that
apical region (the region with the highest proportion of area at risk during LAD ligation) wall
thickness was significantly increased relative to mice that did not receive BayCysLT 2 .
88
Figure 3-2: Representative images of left ventricular remodeling post-myocardial
infarction.
Representative M-mode images obtained via echocardiography from untreated WT and EC mice
(leftmost two columns) and BayCysLT 2 -treated mice (rightmost two columns) at 2 weeks, 4
weeks, and 12 weeks post-myocardial infarction are presented here, with the left ventricular
internal dimension highlighted by white arrows.
89
Pre-I/R
2 Weeks
4 Weeks
12 Weeks
IVS diastole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
0.70 ± 0.03
0.78 ± 0.04
0.76 ± 0.06
0.76 ± 0.02
0.76 ± 0.03
0.74 ± 0.02
0.73 ± 0.02
0.80 ± 0.03
0.73 ± 0.02
0.78 ± 0.01
0.75 ± 0.03
0.77 ± 0.03
0.71 ± 0.02
0.81 ± 0.03
IVS systole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
0.96 ± 0.03
1.02 ± 0.04
1.01 ± 0.06
1.00 ± 0.02
0.97 ± 0.05
0.98 ± 0.02
0.98 ± 0.03
1.04 ± 0.03
0.95 ± 0.03
1.01 ± 0.02
1.01 ± 0.05
1.00 ± 0.04
0.88 ± 0.04
1.03 ± 0.04
LVPW diastole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
0.78 ± 0.04
0.82 ± 0.08
0.71 ± 0.03
0.82 ± 0.04†
0.77 ± 0.03
0.82 ± 0.03
0.72 ± 0.02
0.74 ± 0.03
0.68 ± 0.02
0.75 ± 0.02
0.77 ± 0.04
0.76 ± 0.02
0.73 ± 0.03
0.79 ± 0.02
-
1.08 ± 0.07
1.14 ± 0.06
1.08 ± 0.03
1.11 ± 0.03
1.09 ± 0.05
1.08 ± 0.03
1.03 ± 0.04
1.16 ± 0.07
1.00 ± 0.03
1.10 ± 0.04
0.91 ± 0.03*
1.03 ± 0.03
0.99 ± 0.04
1.02 ± 0.04
LVPW systole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
Table 3-2: Left ventricular wall measurements of mice post-I/R injury.
Interventricular septum (IVS) and left ventricular posterior wall (LVPW) dimensions at diastole
and systole were determined from echocardiography at 2, 4, and 12 weeks following
ischemia/reperfusion injury. * = p < 0.05 versus non-drug treated counterparts of the same
genotype. † = p < 0.05 versus wild-type counterparts receiving the same drug injection regimen.
Values are mean ± SEM, n = 6-10.
90
Pre-I/R
2 Weeks
4 Weeks
12 Weeks
LVID diastole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
3.73 ± 0.08
3.70 ± 0.08
3.77 ± 0.04
3.85 ± 0.05
3.89 ± 0.08
3.73 ± 0.05
3.67 ± 0.04
3.80 ± 0.06
3.92 ± 0.13
4.08 ± 0.07*###
3.74 ± 0.04
3.90 ± 0.07
4.00 ± 0.11
4.16 ± 0.20*###
LVID systole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
2.70 ± 0.11
2.56 ± 0.14
2.56 ± 0.11
2.59 ± 0.07
2.79 ± 0.12
2.61 ± 0.05
2.51 ± 0.07
2.65 ± 0.15
2.54 ± 0.04
2.81 ± 0.07##
2.94 ± 0.12**
3.04 ± 0.08*#
3.06 ± 0.08***### 3.21 ± 0.17**###
-
5.30 ± 0.04
5.27 ± 0.05
5.35 ± 0.07
EC
WT-BayCysLT 2
EC-BayCysLT 2
5.17 ± 0.08
5.37 ± 0.11
5.47 ± 0.08
5.31 ± 0.07
5.34 ± 0.07
5.47 ± 0.15
5.30 ± 0.11
5.58 ± 0.07##
5.50 ± 0.05
5.40 ± 0.12
5.73 ± 0.09†##
LVOD systole (mm)
WT
EC
WT-BayCysLT 2
-
4.64 ± 0.06
4.81 ± 0.08
4.67 ± 0.06
4.67 ± 0.13
4.83 ± 0.04
4.92 ± 0.06
4.66 ± 0.08
4.74 ± 0.12
4.70 ± 0.08
4.77 ± 0.05
4.77 ± 0.08
5.02 ± 0.07**#
4.87 ± 0.10
5.18 ± 0.08†###
LVOD diastole (mm)
WT
EC-BayCysLT 2
Table 3-3: Left ventricular dimensions of mice post-I/R injury.
Left ventricular internal dimension (LVID) and outer dimension (LVOD) sizes at diastole and
systole were determined from echocardiography at 2, 4, and 12 weeks following
ischemia/reperfusion injury. * = p < 0.05, ** = p < 0.01, *** = p < 0.001 versus non-drug
treated counterparts of the same genotype. † = p < 0.05 versus wild-type counterparts receiving
the same drug injection regimen. # = p < 0.05, ## = p < 0.01, ### = p < 0.001 versus 2 week
timepoint. Values are mean ± SEM, n = 6-10
91
0 Weeks
2 Weeks
4 Weeks
12 Weeks
Apex diastole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
0.51 ± 0.02
0.52 ± 0.03
0.53 ± 0.02
0.51 ± 0.04
0.49 ± 0.01
0.47 ± 0.01
0.36 ± 0.03##
0.41 ± 0.03
0.49 ± 0.03**
0.49 ± 0.01*
0.41 ± 0.03#
0.36 ± 0.02#
0.56 ± 0.02***
0.54 ± 0.02***#
Apex systole (mm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
0.56 ± 0.02
0.58 ± 0.04
0.59 ± 0.06
0.48 ± 0.05
0.61 ± 0.04
0.53 ± 0.02
0.38 ± 0.02##
0.41 ± 0.05
0.56 ± 0.02***
0.58 ± 0.02***
0.45 ± 0.02#
0.34 ± 0.02#
0.62 ± 0.04**
0.61 ± 0.02***#
Table 3-4: Apex wall thickness measurements of mice post-I/R injury.
Wall thickness in the apical region of the heart at diastole and systole were determined from
echocardiography at 2, 4, and 12 weeks following ischemia/reperfusion injury. * = p < 0.05, **
= p < 0.01, *** = p < 0.001 versus non-drug treated counterparts of the same genotype. # = p <
0.05, ## = p < 0.01 versus 2-week timepoint. Values are mean ± SEM, n = 6-10.
92
3.4.3. Mice treated with BayCysLT 2 show mildly decreased cardiac function.
We calculated values for cardiac functional parameters using dimensional measurement data
obtained from echocardiography images. Ejection fraction (EF) and fractional shortening (FS)
were both significantly decreased in the EC-BayCysLT 2 group versus untreated counterparts. In
addition, the WT-BayCysLT 2 group also showed lower EF and FS values than untreated
counterparts, although this trend was only significant at the 4 week timepoint. Similarly, while
no differences in EF or FS between the experimental groups were observed 2 weeks after
infarction, EC-BayCysLT 2 mice showed a significant decline in EF and FS by 4 weeks post-I/R
versus 2 week timepoint values, and this continued at the 12 week timepoint. WT-BayCysLT 2
mice showed similar (albeit non-significant) declines in EF and FS over time. No differences
were observed between groups or over time in stroke volumes, cardiac outputs, or heart rate
(Table 3-5). As such, any maladaptation appears to be relatively mild, as decreases in ejection
fraction and fractional shortening have not translated to decreased stroke volume or cardiac
output.
3.4.4. Left ventricular volume and mass are increased in BayCysLT 2 -treated mice postischemia/reperfusion injury.
We also examined left ventricular volume and mass. No differences between groups were
identified at the 2 week timepoint, but the EC-BayCysLT 2 group showed significantly larger LV
volume during diastole and systole by the 4 week timepoint, and this trend persisted at the 12
week timepoint. Likewise, untreated EC mice and the WT-BayCysLT 2 group also showed
93
Group
0 Weeks
2 Weeks
4 Weeks
12 Weeks
Ejection Fraction (%)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
54.1 ± 2.3
59.5 ± 4.0
56.3 ± 4.8
61.9 ± 1.7
55.8 ± 2.8
57.7 ± 1.8
60.1 ± 1.6
62.6 ± 0.8
50.8 ± 3.3*
49.7 ± 2.4**#
56.2 ± 5.1
55.0 ± 1.7
47.8 ± 2.0
46.1 ± 1.7*##
Fractional Shortening (%)
WT
EC
27.6 ± 1.5
WT-BayCysLT 2
31.5 ± 2.7
EC-BayCysLT 2
29.6 ± 3.4
33.0 ± 1.2
29.1 ± 1.8
30.2 ± 1.3
31.6 ± 1.1
33.4 ± 0.59
25.7 ± 2.0*
25.2 ± 1.6**#
29.6 ± 3.4
28.2 ± 1.1
23.9 ± 1.1
22.8 ± 1.0##
34.59 ± 2.59
38.22 ± 1.44
36.85 ± 1.53
35.33 ± 1.97
35.7 ± 0.5
36.2 ± 2.3
35.5 ± 3.3
37.0 ± 2.3
34.7 ± 2.4
37.3 ± 1.9
34.9 ± 2.3
36.9 ± 2.1
14.2 ± 1.4
15.0 ± 0.9
15.5 ± 0.3
14.8 ± 1.4
15.6 ± 1.5
15.7 ± 1.3
15.8 ± 0.7
15.6 ± 1.0
14.9 ± 1.3
16.2 ± 1.4
14.6 ± 0.9
15.3 ± 0.8
417 ± 13
391 ± 18
434 ± 15
444 ± 6
437 ± 9
411 ± 18
427 ± 6
439 ± 15
448 ± 13
423 ± 17
416 ± 10
419 ± 14
Stroke Volume (μl)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
30.9 ± 1.7
36.0 ± 2.1
Cardiac Output (ml/min)
WT
EC
WT-BayCysLT 2
12.8 ± 1.1
EC-BayCysLT 2
15.7 ± 1.3
Heart Rate (bpm)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
414 ± 20
436 ± 17
Table 3-5: Evaluation of functional measurements in mice post-I/R injury.
Ejection fraction, fractional shortening, stroke volume, and cardiac output values were measured
determined from echocardiography images obtained at 2, 4, and 12 weeks following
ischemia/reperfusion injury according to formulae listed in the Materials and Methods. Heart
rate measurements were obtained at the time of echocardiography. * = p < 0.05, ** = p < 0.01,
*** = p < 0.001 versus non-drug treated counterparts of the same genotype. # = p < 0.05, ## = p
< 0.01 versus 2-week timepoint. Values are mean ± SEM, n = 6-10.
94
significantly increased LV volume during systole at the 12 week timepoint. EC mice treated
with BayCysLT 2 presented significantly larger LV volumes (during both diastole and systole)
than untreated EC counterparts, and the WT-BayCysLT 2 group showed significantly larger LV
volume during systole than untreated WT counterparts. Finally, LV volume during systole was
significantly higher in the EC-BayCysLT 2 group versus the WT-BayCysLT 2 group. Left
ventricular mass was significantly elevated in the EC-BayCysLT 2 group at the 4 and 12 week
timepoints, but none of the other groups showed any significant change over time. The ECBayCysLT 2 group also showed significantly higher LV mass compared to untreated EC
counterparts or the WT-BayCysLT 2 group at 4 and 12 weeks post-I/R (Table 3-6).
95
Group
0 Weeks
2 Weeks
4 Weeks
12 Weeks
LV volume diastole (μl)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
59.1 ± 3.2
59.2 ± 2.8
59.9 ± 1.6
63.6 ± 2.1
66.0 ± 3.1
60.0 ± 2.3
57.7 ± 1.1
61.6 ± 2.4
67.6 ± 4.8
73.6 ± 2.9**###
60.4 ± 1.6
66.6 ± 2.7
70.9 ± 4.3
77.3 ± 2.7*###
27.4 ± 2.7
24.5 ± 3.3
26.2 ± 2.7
24.4 ± 1.7
30.0 ± 2.9
25.4 ± 1.2
23.3 ± 1.2
23.2 ± 1.0
33.5 ± 3.3*
37.5 ± 1.9***†###
26.0 ± 3.6
30.1 ± 1.7##
36.5 ± 2.5*#
41.7 ± 1.7***†###
94.3 ± 5.4
105.0 ± 8.6
96.0 ± 4.9
106.7 ± 4.5
104.2 ± 4.3
101.5 ± 4.0
88.0 ± 2.3
101.2 ± 2.5
96.8 ± 5.1
113.7 ± 3.3**†###
98.8 ± 4.4
106.5 ± 3.7
101.9 ± 5.6
125.9 ± 6.4**††###
LV volume systole (μl)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
LV mass (mg)
WT
EC
WT-BayCysLT 2
EC-BayCysLT 2
Table 3-6: Left ventricular volume and mass measurements in mice post-I/R injury.
LV volume at diastole and systole, as well as LV mass, was determined from echocardiography
at 2, 4, and 12 weeks following ischemia/reperfusion injury. * = p < 0.05, ** = p < 0.01, *** = p
< 0.001 versus non-drug treated counterparts of the same genotype. † = p < 0.05, †† = p < 0.01
versus wild-type counterparts receiving the same drug injection regimen. ### = p < 0.001 versus
2-week timepoint. Values are mean ± SEM, n = 6-10.
96
2
rm cardiac function via pathological remodeling, thus increasing
susceptibility for other conditions such as congestive heart failure (Roger et al., 2012). We have
previously outlined a role for CysLT 2 R activation as a mediator of myocardial infarction damage
(Ni et al., 2011), and herein present results from the first investigation of long-term effects on the
heart following myocardial infarction in CysLT 2 R-altered murine models. Contrary to
expectations, we noted very few differences in cardiac size and functional properties between
wild-type mice and mice with endothelial-targeted CysLT 2 R overexpression. EC mice had
slightly larger (but non-significant) LVID and LVOD sizes versus WT mice, but no differences
were noted in IVS or LVPW size, or the functional parameters EF, FS, CO, and SV. This
contrasts with previous work by Jiang et al. (2008), where non-significant increases in LVID and
significant septal thinning and posterior wall thickening in EC mice were noted. However, this
study did not demonstrate significant differences between WT and EC mice in terms of cardiac
dimension alterations pre-I/R to post-I/R at two weeks post-myocardial infarction. In addition,
the anaesthetic, as well as the method of delivery used during the surgical intervention here,
differs from that used by Jiang et al. (2008), which may lead to minor alterations that might have
affected our results. Indeed, there is some evidence that tramadol and isoflurane may have mild
cardioprotective effects during acute myocardial infarction (Belhomme et al., 1999; Bilir et al.,
2007; Zhang and Guo, 2009), and we previously noted that average acute infarct size in EC
97
mice, when using our current surgical protocol, was 47% of area at risk (Ni et al., 2011) whereas
Jiang et al. (2008), presented an average infarct size of 56%. This difference may account for the
discrepancies in cardiac remodeling noted between our investigation and previous findings.
Also, Jiang et al. (2008) only investigated remodeling for a 2 week timeframe post-I/R, so the
possibility exists that the differences between WT and EC mice observed in that study may not
persist beyond that timeframe.
Interestingly, however, we noted that mice treated with the CysLT 2 R-selective antagonist
BayCysLT 2 actually presented indicators of maladaptive remodeling following
ischemia/reperfusion injury. WT mice treated with BayCysLT 2 show significantly increased
LVID and LV volume during systole, and display a trend towards decreased ejection fraction and
fractional shortening. The phenomenon is more pronounced in EC mice treated with
BayCysLT 2 , which showed increased LVID, LVOD, and LV size during both diastole and
systole, along with decreased ejection fraction and fractional shortening post-I/R. Paradoxically,
BayCysLT 2 appears to have maintained its ability to reduce infarction size, as the ventricular
wall thickness in the apical region (which is most severely affected by LAD ligation-induced
ischemia) is significantly greater in mice treated with BayCysLT 2 than untreated counterparts.
3.5.2. Why does CysLT 2 R overexpression not result in a worse long-term outcome?
The first question that requires addressing is why do EC mice not present more exacerbated signs
of cardiac dysfunction and adverse remodeling post-I/R, given the exacerbation of myocardial
damage previously observed in this genotype (Jiang et al., 2008; Ni et al., 2011)? A possible
98
answer may be that cardiac damage suffered during 30 minutes of transient ischemia, as
delivered in our model, may not be sufficiently deleterious to evoke the full extent of the
remodeling response, and this is masking any differences in damage susceptibility between WT
and EC mice. Certainly, the absence of septal or posterior wall thinning (two hallmarks of
pathological cardiac dilatation (McMullen and Jennings, 2007)) indicates that the adverse
remodeling response is mild at best, and the lack of significant changes in cardiac output and
stroke volume supports that as well. Indeed, studies employing permanent LAD ligation to
induce ischemia report ventricular wall fibrosis far more severe than anything observed in our
studies using transient ischemia (Song et al., 2012; Takemura et al., 2009). Little is known about
the resolution pathways for CysLT 2 R-mediated inflammation, and there is some evidence that
increased leukocyte influx into the site of injury is not always deleterious. In particular, aged
animals and humans both present significantly elevated levels of neutrophil and macrophage
infiltration post-injury. However, wound healing in these subjects occurs with significantly less
scar tissue formation than in younger counterparts (Eming et al., 2007). Additional investigation
is clearly required to further our understanding of how CysLT 2 R affects the post-I/R injury
inflammatory response, and how that translates to long-term wound healing and cardiac function.
3.5.3. Why does CysLT 2 R blockade result in an apparently worse long-term outcome?
The finding that BayCysLT 2 treated mice presented increased cardiac dilatation appears highly
counterintuitive - how and why does the abrogation of infarction damage result in increased
pathological hypertrophy? The most likely hypothesis is that CysLT 2 R antagonism, through
some unknown mechanism, impedes the wound healing pathways that are required for proper
99
injury resolution. While inhibition of some pro-inflammatory cytokines such as TNFα or IFNγ
have been shown to result in accelerated wound healing, inactivation of others, such as MCP-1
and IL-6, result in impairment of the repair mechanism (Eming et al., 2007). In addition,
depletion of macrophages or neutrophils resulted in exacerbation of injury and delayed wound
repair (Nishio et al., 2008; van Amerongen et al., 2007). Indeed, monocytes and macrophages
are integral to proper extracellular matrix remodeling post-infarction (Frantz et al., 2013). The
CysLT 2 R expression profile in murine circulatory cells is unknown, but receptor expression has
been confirmed on eosinophils, monocytes, macrophages, and platelets (Hasegawa et al., 2010;
Heise et al., 2000). However, there has been no investigation as to whether CysLT 2 R is
expressed on pro-induction inflammatory or pro-resolution inflammatory cells. This is
particularly important with respect to monocytes and macrophages, which display distinct proinflammatory (e.g. Ly-6Chi monocytes (in mice), CD14hi/CD16- monocytes (in humans), and M1
macrophages) and anti-inflammatory phenotypes (e.g. Ly-6Clo monocytes (in mice),
CD14lo/CD16hi monocytes (in humans), and M2 macrophages) (Mosser and Edwards, 2008;
Nahrendorf et al., 2007).
In conclusion, we present here that CysLT 2 R antagonism post-ischemia/reperfusion injury
results in mild deleterious pathological remodeling versus untreated counterparts. Further
investigation is required to explain why attenuation of myocardial infarction injury results in an
adverse remodeling phenotype, but these findings indicate that there may be a role for CysLT 2 R
activation in facilitating the healing response as well.
100
3.6. Acknowledgements
The authors would like to thank Ms. Kristiina Aase for her expertise and guidance in obtaining
echocardiography images. We would also like to thank Drs. Raveen Pal and Amer Johri at
Kingston General Hospital for their assistance in interpretation of the echocardiography images.
This work was funded by the Canadian Institute for Health Research MOP-68930. C.D.F. holds
a Tier I Canada Research Chair in Molecular, Cellular and Physiological Medicine and is
recipient of a Career Investigator award from the Heart and Stroke Foundation of Ontario.
101
Chapter 4: Multiple-site activation of the cysteinyl leukotriene receptor 2 is
required for exacerbation of ischemia/reperfusion injury
102
4.1. Abstract
Transgenic overexpression of the human cysteinyl leukotriene receptor 2 (CysLT 2 R) in murine
endothelium exacerbates vascular permeability and ischemia/reperfusion injury. Here, we seek
to uncover the underlying mechanisms of CysLT 2 R activation-mediated inflammation and
delineate the relative contributions of endogenous murine CysLT 2 R and the transgene-derived
receptor. We created a novel mouse (EC/KO) by crossing endothelium-targeted overexpression
mice (EC) with CysLT 2 R knockout mice (KO) to isolate the role of endothelial CysLT 2 R in
tissue injury. Surprisingly, we discovered that myocardial damage in EC/KO mice was not
elevated (24 ± 3% vs. 47 ± 2% EC) following ischemia/reperfusion. To examine potential
mechanisms for this finding, we studied vascular permeability and leukocyte recruitment/rolling
responses in cremaster vasculature following cysteinyl leukotriene (cysLT) stimulation. Mice
possessing transgenic endothelial CysLT 2 R overexpression (EC or EC/KO), when stimulated
with cysLTs, exhibited vascular hyperpermeability, decreased leukocyte flux, and transient
increase in slow-rolling leukocyte fraction. Mice lacking endogenous CysLT 2 R (both KO (20 ±
3 cells/min) and EC/KO (24 ± 3)) showed lower rolling leukocyte flux than WT (38 ± 6) and EC
(35 ± 6) mice under unstimulated conditions. EC/KO mice differed from EC counterparts in that
vascular hyperpermeability was not present in the absence of exogenous cysLTs. These results
indicate that endothelial and “non-endothelial” CysLT 2 R niches have separate important roles in
mediating inflammatory responses. Endothelial receptor activation results in increased vascular
permeability and leukocyte slow-rolling, facilitating leukocyte transmigration. Other receptors –
likely located on resident/circulating leukocytes – facilitate endothelial receptor activation and
103
modulate leukocyte transit. Activation of both receptor location subsets facilitates injury
exacerbation.
104
4.2. Introduction
Myocardial infarction (MI) is one of the leading killers in the Western world today, and everincreasing obesity rates in the industrialized world makes cardiovascular disease a growing threat
to public health (White and Chew, 2008). MI is characterized by a blockage of the coronary
circulation, usually caused by atherosclerotic plaque rupture, leading to cessation of oxygen and
nutrient delivery to the myocardium. Timely restoration of flow to the affected area, reperfusion,
is paramount. However, this treatment method is also a double-edged sword, while necessary to
salvage cardiac function, it also evokes "reperfusion damage," a combination of oxidative stress
and inflammation that results in additional myocardial injury (Yellon and Hausenloy, 2007).
Leukotrienes are potent pro-inflammatory lipid mediators synthesized from arachidonic acid via
the actions of 5-lipoxygenase and 5-lipoxygenase-activating protein. Cysteinyl leukotrienes
(cysLTs) are a subfamily of leukotriene molecules, so termed due to a common cysteine moiety
in their respective structures. The cysLTs, leukotriene C 4 , D 4 , and E 4 , exert their effects by
binding to G-protein coupled receptors: cysteinyl leukotriene receptor 1 (CysLT 1 R), cysteinyl
leukotriene receptor 2 (CysLT 2 R), and a novel CysLT E receptor GPR99 (Kanaoka et al., 2013).
CysLT 1 R binds LTD 4 preferentially to LTC 4 , whereas CysLT 2 R binds LTC 4 and LTD 4 with
equal affinity. Both receptors bind LTE 4 , the most stable and abundant cysLT, with weak
affinity (Maekawa et al., 2008). In contrast, CysLT E R displays preferential binding affinity for
LTE 4 , with weak affinity for LTC 4 and LTD 4 (Kanaoka et al., 2013).
105
CysLT 1 R has been studied extensively and is involved in airway inflammation. Indeed,
CysLT 1 R pharmacological antagonists are popular anti-asthma treatment options. CysLT 2 R, in
humans, is expressed in umbilical vein endothelial cells, macrophages (Lotzer et al., 2007;
Sjostrom et al., 2003), platelets (Hasegawa et al., 2010), the cardiac Purkinje system (Heise et
al., 2000), and coronary endothelial cells (Hui et al., 2001). CysLT 2 R research had been
previously hampered by a lack of selective pharmacological agents (Moos and Funk, 2008) – the
majority of work instead using the non-selective CysLT antagonist/partial agonist Bay-u9773
(Jiang et al., 2008). However, recent studies have characterized two novel CysLT 2 R-selective
antagonists: HAMI3379 (Wunder et al., 2010) and BayCysLT 2 (Carnini et al., 2011; Ni et al.,
2011; Qi et al., 2011), that are beginning to prove useful as tools for eicosanoid-related research.
There is some evidence linking cysLTs to cardiovascular and inflammatory disease. Expression
of components of the leukotriene synthesis pathway is found in human atherosclerotic lesions
(Spanbroek et al., 2003). Furthermore, genetic polymorphisms in 5-lipoxygenase pathway genes
have been correlated to increased MI and stroke risk in some populations (Helgadottir et al.,
2005) but not all (Bisoendial et al., 2012; Maznyczka et al., 2008). CysLT 2 R can mediate
vascular permeability (Hui et al., 2004; Moos et al., 2008), susceptibility to gastrointestinal tract
inflammation (Barajas-Espinosa et al., 2011), and increased vulnerability to ischemic injury in
the heart (Jiang et al., 2008) and brain (Qi et al., 2011; Shi et al., 2012b). CysLT 2 R expression is
increased following hypoxic/ischemic stress (Barajas-Espinosa et al., 2012; Fang et al., 2007;
Jiang et al., 2008; Shi et al., 2012b). Previous work from our laboratory has shown that
CysLT 2 R-selective antagonism can abrogate myocardial ischemia/reperfusion injury in
transgenic mice overexpressing the human CysLT 2 R receptor in vascular endothelium (EC).
106
However, we were unable to delineate the relative roles of the transgenic endothelial CysLT 2 R
versus endogenous murine CysLT 2 R present on various cell types.
In order to study this, we have created a novel mouse model by crossing CysLT 2 R knockout
mice with EC mice, resulting in a model with selective endothelial CysLT 2 R expression. Using
these novel mice, we examine how CysLT 2 R mediates post-ischemic myocardial injury and
vascular inflammatory responses.
107
4.3. Materials and Methods
4.3.1. Mouse Models
All mice used in this study were on a C57Bl/6 genetic background. EC transgenic mice were
previously described (Hui et al., 2004). Briefly, these mice possess 7 copies of the human
CYSLTR2 coding region placed under the control of the Tie2 promoter/enhancer for endothelialtargeted CysLT 2 R overexpression. LacZ-CysLT 2 R knockout (KO) mice (Moos et al., 2008)
contain a LacZ cassette under control of the Cysltr2 promoter with Cysltr2 disruption. X-Gal
staining can be used as a reporter for native sites of CysLT 2 R expression (Moos et al., 2008).
These two strains were crossed to generate a whole-body (including endogenous endothelial
expression) CysLT 2 R knockout mouse that possesses endothelium-targeted overexpression of
the human CysLT 2 R. This mouse is referred to as EC/KO. Details of the endogenous and
transgenic CysLT 2 R expression profile of each genotype utilized can be found in Table 4-1.
4.3.2. Myocardial Ischemia/Reperfusion
Myocardial infarction was induced via non-permanent left anterior descending coronary arterial
ligation, as previously outlined (Ni et al., 2011). Briefly, analgesia was administered (20 mg/kg
tramadol (Ultram; Chiron AS, Trondheim, Norway)) at least 1 h prior to surgery in mice 14-18
weeks of age. Mice were then anesthetized with 5% isoflurane, intubated, and constantly
ventilated (150 breaths/min) with 1 to 5% isoflurane throughout the procedure. An incision was
made at the fourth intercostal space, with 50 μl of 50% lidocaine/50% bupivicaine injected
108
Genotype
Endothelial Expression
Non-Endothelial Expression
WT
mCysLT 2 R +
mCysLT 2 R +
EC
mCysLT 2 R +
hCysLT 2 R +++
mCysLT 2 R +
KO
None
None
EC/KO
hCysLT 2 R +++
None
Table 4-1: CysLT 2 R expression profile in featured mouse genotypes.
Expression levels (denoted by + signs) of endogenous murine and transgenic human CysLT 2 R in
endothelial and non-endothelial cells in various murine genotypes.
109
subcutaneously along the incision line as an analgesic. The intercostal muscles were cut in order
to expose the heart. The pericardium was pulled apart, and 6-0 silk suture (Ethicon, Somerville,
NJ) passed underneath the LAD and surrounding myocardium. Ischemia was induced for 30
minutes by tightening the suture against a piece of PE-10 tubing placed on top of the LAD and
confirmed by visible paling of the affected myocardium and/or visibly altered ventricular
contraction rhythm. Removal of the tubing and loosening of the ligature allowed reperfusion.
The surgical site was closed and mice were extubated as soon as they exhibited signs of
consciousness, followed by subcutaneous administration of 0.5 to 1.0 ml of warm lactated
Ringer's solution (Baxter, Mississauga, ON), and returned to their cages once fully mobile. The
entire procedure was performed on a heated pad. All surgical procedures and treatment regimens
were approved by the University Animal Care Committee at Queen's University and adhered to
the guidelines of the Canadian Council of Animal Care.
4.3.3. Analysis of Infarct Volume
Infarct volume was analyzed 48 hours post surgery as previously described (Ni et al., 2011). The
heart was excised and retrogradely perfused via the aorta with phthalocyanine blue ink dye
(Liquitex, Cincinnati, OH) following suture re-tightening in order to demarcate the non-risk
region. The heart was then rinsed in ice-cold PBS, blotted dry, frozen in plastic wrap at -20°C
for 15 minutes, and cut transversely into six 1.0 mm sections. Sections were immersed in 2,3,5triphenyltetrazolium chloride (1%; Sigma-Aldrich) for 15 min at 37°C to demarcate viable and
necrotic tissue. Stained sections were photographed on both sides using a digital camera (QColor5; Olympus, Tokyo, Japan). The infarct area (pale white), the area at risk (brick red), the
110
non-risk area (blue), and the total left ventricular area were calculated for both sides of each
section using ImageJ software (National Institutes of Health, Bethesda, MD). As described
previously (Jiang et al., 2008; Ni et al., 2011), infarct size was calculated as the ratio of the
infarct volume to the volume at risk. Animals with risk volume in the 35 to 70% range of total
left ventricle volume were used as inclusion criteria in the study.
4.3.4. Intravital Microscopy of the Cremaster Vasculature
Vascular permeability and leukocyte recruitment were observed using intravital confocal
microscopy. Male mice 12-16 weeks of age were anaesthetized with ketamine (150 mg/kg) and
xylazine (10 mg/kg). A catheter was placed in the right jugular vein for experiments that
required intravenous fluorescein isothiocyanate (FITC)-labeled albumin injection. The cremaster
muscle was then exposed as described previously (McCafferty et al., 2002). Post-capillary
venules (20-50 μm) were visualized using a Quorum WaveFX-X1 spinning disk confocal system
(Quorum Technologies Inc., Guelph, ON, Canada). Recordings were taken with a Hamamatsu
EM-CCD camera (model 09100-13; Hamamatsu Photonics, Hamamatsu, Japan) using
MetaMorph software (Molecular Devices, Sunnyvale, CA).
In order to assess vascular permeability, FITC-labeled albumin (25 mg/kg body weight) was
injected via the jugular catheter, and fluorescence intensity in the preparation was recorded for 1
minute. At this point, cysLTs (5 μmol/L each LTC 4 and LTD 4 ) were administered to the
superfused vessel – following which fluorescence readings were recorded for a further 14
minutes.
111
To evaluate leukocyte flux in the cremaster vasculature, mice were prepared as above without
catheterization. Bright-field images were recorded for 2 min prior to cysLT administration,
following which bright-field segments were recorded at 5, 10, and 15 minutes post-cysLTs for 2
min. No difference in vessel diameter was noted between experimental groups (data not shown).
4.3.5. Analysis of Vascular Permeability
Vascular permeability was assessed by measuring FITC-albumin extravasation from the
vasculature into the surrounding tissue. Fluorescence intensity, ranging from 0 to 65536
arbitrary units, was measured at five 1000 μm2 sites surrounding the post-capillary venule using
MetaMorph software. The absolute fluorescence intensity was recorded every 5 frames, with
measurement areas manually adjusted to account for field-of-view drift. The first derivative of
the absolute fluorescence intensity was calculated to determine the fluorescence intensity rate of
change (a measurement previously termed LIFT – leakage intensity factor for tissues (Moos et
al., 2008)).
4.3.6. Analysis of Vascular Leukocytes
Bright-field recordings of post-capillary venules (20-50 μm) in the cremaster muscle were taken
pre/post-leukotriene stimulation. Two min sequences were recorded prior to leukotriene
stimulation and at 5, 10, and 15 min following stimulation. Rolling leukocyte flux, defined as
the number of rolling leukocytes/min in the observed vessel (Ley, 1994), was visually analyzed
112
by three observers blinded to the study group using VirtualDub version 1.9.9. Leukocyte
velocity of 15-30 randomly selected cells was measured by tracking individual
leukocytes/mouse/time point using Image-Pro Plus (Media Cybernetics Inc., Rockville, MD).
Median leukocyte velocity was used as a representative indicator of flow speed, as average
velocity would be improperly skewed by loosely adherent fast rolling leukocytes. Rolling
leukocyte speed distribution was analyzed and presented using histograms (Jung and Ley, 1999).
4.3.7. Complete Blood Count
Blood was extracted from mice using a heparinized 25G needle via cardiac puncture
immediately following CO 2 -asphyxiation and was stored in 1.5 ml eppendorf tubes. Samples
were kept on ice until analysis using a scil Vet abc machine (scil Vet Novations; Barrie, ON,
Canada).
4.3.8. Statistical Analysis
For each experimental group, the mean and standard error were calculated. To compare groups
at a single timepoint, we performed a two-tailed unpaired Student’s t-test. To compare
timepoints within a single group, we performed a two-tailed paired Student’s t-test. To compare
groups over multiple time-points, we performed one way analysis of variance with post hoc
Newman-Keuls t-tests. Comparison of rolling leukocyte velocity between groups was done
using a nonparametric Kruskal-Wallis one-way ANOVA to determine significant differences,
followed by Dunn's test for multiple comparisons. All statistical analysis was carried out using
113
Prism 5.0 (GraphPad Software Inc., San Diego, CA). p < 0.05 was considered a statistically
significant difference.
114
4.4. Results
4.4.1. Endothelium-targeted CysLT 2 R overexpression does not exacerbate infarction damage in
the absence of endogenous CysLT 2 R
Our previous findings established that transgenic CysLT 2 R overexpression in the endothelium,
in the presence of endogenous murine CysLT 2 R expression, results in significantly increased
infarction volume following myocardial ischemia/reperfusion in mice (Jiang et al., 2008; Ni et
al., 2011). However, transgenic mice without endogenous CysLT 2 R expression (EC/KO) did not
show this phenomenon (Figure 4-1). Indeed, both WT (23.2 ± 2.2%, n = 13) and EC/KO (24.0 ±
3.0%, n = 14) groups showed significantly lower infarction volumes than EC mice (47.2 ± 1.9%,
n = 12; p < 0.001 against both groups). These findings were unexpected because endogenous
CysLT 2 R expression is significantly less than transgene expression (Hui et al., 2004). Volume at
risk did not vary between any of the experimental groups (Figure 4-1B). We also found that
CysLT 2 R knockout mice (17.8 ± 2.2%, n = 12) trended towards lower infarction volumes than
WT and EC/KO groups (Figure 1C; p = 0.096 vs. WT, p = 0.11 vs. EC/KO). These results
indicate that exacerbation of CysLT 2 R-mediated myocardial ischemia/reperfusion injury is not
solely mediated by transgene-targeted CysLT 2 R.
4.4.2. Vascular permeability responses in EC/KO mice differ from those in EC mice
115
Given that CysLT 2 R-mediated myocardial injury appears not to be exclusively mediated by the
endothelium-overexpressed CysLT 2 R transgene, we sought to investigate how and to what
extent
116
Figure 4-1: Myocardial injury is not elevated in EC/KO mice following
ischemia/reperfusion.
(A) Representative tetrazolium chloride-stained ventricular sections from wild-type (WT),
Endothelium-targeted CysLT 2 R-overexpressing (EC), CysLT 2 R-knockout (KO), and EC/KO
mice. Morphometric analysis of (B) LV volume at risk (C) and infarct size in the groups
mentioned above showed that infarction volume was significantly greater in EC mice compared
to WT. However, this phenomenon was not seen in EC/KO mice. * = p < 0.05; ** = p < 0.01;
values given as mean ± SEM, n = 12-14.
117
knockout of endogenous CysLT 2 R would affect endothelial/vascular permeability. This is
especially pertinent as based on previous work (Jiang et al., 2008; Ni et al., 2011) CysLT 2 Rmediated endothelial permeability facilitates tissue injury by permitting leukocyte extravasation,
inflammation, and edema. We examined FITC-albumin extravasation from post-capillary
venules in the cremaster muscle both before and after exogenous leukotriene stimulation.
Minimal extravascular fluorescence accumulation prior to leukotriene stimulation was observed
in WT, KO, and EC/KO mice. However, EC mice showed significantly higher absolute
fluorescence accumulation (Figure 4-2B) and rate of fluorescence accumulation (Figure 4-2C) as
previously determined, which we surmised was due to surgery-induced cysLT release from
resident tissue macrophages/mast cells activating high numbers of endothelial cell-expressed
CysLT 2 Rs (Moos et al., 2008).
Administration of cysLTs resulted in an increase in absolute FITC-albumin extravasation in all
experimental groups (Figure 4-3A). EC and EC/KO groups demonstrated increased total leakage
and rate of leakage versus the WT group post-cysLTs, while cysLT-challenged KO mice showed
significantly less FITC-albumin extravasation compared to WT mice (Figures 4-3B and 3C).
Interestingly, EC/KO mice, despite possessing identical transgenic overexpression of CysLT 2 R
in the endothelium as EC mice, only showed elevated extravascular FITC-albumin accumulation
versus WT mice following cysLT stimulation. This is in contrast to EC mice, which showed
increased FITC-albumin extravasation compared to WT mice both prior to and after cysLT
stimulation.
118
Figure 4-2: Vascular permeability post-surgical intervention (“basal”) is elevated in EC
mice, but not in EC/KO mice.
(A) Intravital microscopy recordings of vascular leakage in cremaster post-capillary venules.
Representative images of cremaster preparations from mice possessing (from left to right)
normal (WT), endothelium-elevated (EC), no (KO), or endothelium-only (EC/KO) CysLT 2 R
expression is depicted. Upper panels show fluorescence recordings at the start of the experiment
(t = 0); lower panels show fluorescence recordings 1 min later. Scale bar = 50 μm. (B) Absolute
change and (C) rate of change in extravascular fluorescence were elevated in EC mice. * = p <
0.05; values given as mean ± SEM, n = 6-7.
119
Figure 4-3: CysLT 2 R activation mediates vascular hyperpermeability.
(A) Intravital microscopy recordings of vascular leakage in cremaster post-capillary venules
following administration of 5 μmol/L cysLTs. Representative images of cremaster preparations
from mice possessing (from left to right) normal (WT), endothelium-elevated (EC), no (KO), or
endothelium-only (EC/KO) CysLT 2 R expression is depicted. Upper panels show fluorescence
recordings at the start of the experiment (t = 120 seconds); lower panels show fluorescence
recordings at the end of the experiment (t = 840 seconds). Scale bar = 50 μm. (B)
Representative measurements of absolute fluorescence intensity in cremaster muscle
preparations from WT, EC, KO, and EC/KO mice used to calculate FITC-albumin leakage. (C)
Rate of extravascular fluorescence accumulation was elevated in all mice following cysLT
stimulation, but EC and EC/KO mice showed the greatest increase. * = p < 0.05; ** = p < 0.01;
values given as mean ± SEM, n = 5-7.
120
4.4.3. Genetic knockout of endogenous CysLT 2 R reduces basal rolling leukocyte flux in
cremaster vasculature.
The endothelium also plays a large role in regulating leukocyte capture and transmigration
during inflammatory responses (Rao et al., 2007), and we have previously reported increased
leukocyte adhesion molecule mRNA expression in EC mice following ischemia/reperfusion
injury (Jiang et al., 2008; Ni et al., 2011). In order to examine whether CysLT 2 R expression
modulation affects leukocyte recruitment and behaviour, we examined leukocyte flux under
basal and cysLT-stimulated conditions in the cremaster vasculature. Rolling leukocyte flux (the
number of rolling leukocytes passing through the vasculature/minute) was higher in mice
expressing endogenous CysLT 2 R (WT: 38 ± 6 cells/min, n = 12; EC: 35 ± 6, n = 16) than mice
lacking endogenous receptor (KO: 20 ± 3, n = 16, p < 0.01 vs. WT, p < 0.05 vs. EC; EC/KO: 24
± 3, n = 14, p < 0.05 vs. WT) mice under basal conditions (Figure 4-4). Mice that possessed
transgenic endothelium-targeted CysLT 2 R overexpression did not show significantly altered
rolling leukocyte counts versus non-transgenic counterparts. Complete blood counts for all
genotypes were undertaken and no significant differences in baseline leukocyte numbers or
differential counts were detected.
4.4.4. Endothelial-targeted CysLT 2 R overexpression results in diminishing leukocyte flux in
cremaster vasculature following leukotriene stimulation
Next, we investigated the effects of cysLT stimulation on rolling leukocyte flux in murine
cremaster post-capillary venules. Following cysLT stimulation, WT mice (n = 6) showed a non-
121
Figure 4-4: Basal rolling leukocyte flux is mediated by endogenous CysLT 2 R.
Number of rolling leukocytes/min was counted in WT, EC, KO, and EC/KO mice. WT and EC
mice showed significantly elevated rolling leukocyte flux compared to KO and EC/KO
counterparts. * = p < 0.05; ** = p < 0.01; values given as mean ± SEM, n = 12-16.
122
significant increase in rolling leukocytes after 5 min (+13 ± 5 cells/min, p = 0.07 vs. start), and
this was maintained until the end of the experiment at 15 minutes (+12 ± 5, p = 0.07 vs. start).
CysLT-stimulated KO mice cremaster preparations (n = 6) did not show significant changes in
rolling leukocytes throughout the duration of the experiment. However, cysLT stimulation of the
cremaster vasculature in mice possessing transgenic endothelial CysLT 2 R overexpression
resulted in a decrease in rolling leukocytes. Rolling leukocyte count per minute dropped in EC
mice (n = 9) by 5 min (-8 ± 5), and had significantly decreased by the 15 minute timepoint (-13 ±
6, p = 0.04 vs. start). Rolling leukocyte flux in EC/KO mice (n = 7) was not changed at 5 min (2 ± 2), but showed a significant decline by 15 min (-10 ± 3, p = 0.002 vs. start). Change in
rolling leukocyte flux in EC and EC/KO mice were statistically significant versus WT mice
(Figure 4-5). These results indicate that endothelial CysLT 2 R overexpression significantly alters
rolling leukocyte flux counts post-leukotriene stimulation.
4.4.5. Cysteinyl leukotriene stimulation results in increased leukocyte slow rolling fraction in
cremaster vasculature in mice expressing endothelial CysLT 2 R.
Prior to firm adhesion and transmigration, leukocytes undergo “slow rolling,” which is
characterized by leukocyte velocity decreasing to less than 10 μm/s. Slow rolling is mediated by
E-selectin/CD18 binding, and is triggered by pro-inflammatory cytokines (Jung and Ley, 1999;
Jung et al., 1998). We examined rolling leukocyte velocity in cremaster venules in the absence
and presence of cysteinyl leukotriene stimulation. Rolling leukocyte velocity distribution in the
unstimulated cremaster muscle did not differ significantly between the four genotypes.
However, WT (n = 6 mice, 58%  79%), EC (n = 8 mice, 65%  78%), and EC/KO (n = 7
123
Figure 4-5: Rolling leukocyte flux diminishes in mice expressing elevated endothelial
CysLT 2 R post-leukotriene stimulation.
(A) Representative images of rolling leukocyte flux in cremaster post-capillary venules of WT,
EC, KO, and EC/KO mice prior to (left) and 15 min after 5 μmol/L cysLT stimulation (right).
(B) Average change in rolling leukocyte flux in mice post-stimulation with 5 μmol/L cysLTs.
WT mice show increased numbers of rolling leukocytes, whereas EC and EC/KO mice show
significant decline in leukocyte flux. * = p < 0.05; ** = p < 0.01; values given as mean ± SEM,
n = 6-9.
124
mice, 59%  70%) groups all presented a significant shift in rolling leukocyte velocity
distribution towards increased proportions of slow-rolling cells at 5 min post-cysLT stimulation
(Figure 4-6). KO mice (n = 6 mice, 61  64%) did not display this trend. The presence of this
phenomenon in EC/KO mice indicates that it is the endothelial CysLT 2 R niche that drives
promotion of slow-rolling leukocytes. Interestingly, while WT mice showed a significantly
increased proportion of slow-rolling leukocytes through all three post-stimulation timepoints,
both EC and EC/KO mice saw slow-rolling cell fraction return to pre-stimulation levels by 10
min (Figure 4-6).
Median rolling leukocyte velocity in the unstimulated cremaster muscle did not differ
significantly between the four genotypes. However, median rolling leukocyte velocity in WT,
EC, and EC/KO mice all decreased significantly at 5 min post-leukotriene stimulation. This
phenomenon persisted in WT and EC mice at 10 and 15 min (albeit non-significantly in the latter
group), but was transient in EC/KO mice. In addition, median velocity in EC mice was
significantly lower than EC/KO mice at 10 min post-cysLT stimulation, and both WT and EC
mice showed significantly lower median velocity compared to EC/KO mice at 15 min poststimulation (Figure 4-7). This indicates that activation of CysLT 2 R in other locations apart from
the endothelium may also play a role in mediating/sustaining leukocyte slow-rolling.
125
Figure 4-6: Rolling leukocyte velocity distributions in mice before and after cysteinyl
leukotriene stimulation.
Histograms of rolling leukocyte velocities in murine cremaster vasculature prior to and following
application of 5 μmol/L cysLTs. Velocity of individual leukocytes from 6-9 mice (roughly equal
numbers of leukocytes were tracked in each mouse) were calculated and the results compiled (n
values indicate total number of cells tracked). WT (A-D) mice showed persistent and significant
increase in slow-rolling (≤10 μm/s) leukocyte fraction following cysLT application. EC (E-H)
and EC/KO (M-P) mice showed a significant increase in slow-rolling leukocyte fraction at 5
minutes that disappeared by the 10 minute mark. KO (I-L) mice did not show any significant
change in leukocyte rolling velocity distribution. ** = p < 0.01; *** = p < 0.001 versus
untreated.
126
Figure 4-7: Rolling leukocyte velocity medians in mice before and after cysteinyl
leukotriene stimulation.
Boxplot shows median (heavy line), 25th and 75th percentiles (top and bottom of box
respectively), and range of measured velocities (5th to 95th percentile), excluding calculated
outliers and extremes (whiskers). Median velocity was significantly decreased in WT (A), EC
(B), and EC/KO (D) mice post-leukotriene stimulation. While this phenomenon persisted for the
duration of the experiment in WT mice (A), EC mice showed non-significantly decreased
median velocity relative to 0 min at 10 and 15 min (B). EC/KO mice showed a return to prestimulation leukocyte median velocity at 10 and 15 min post-stimulation (D). No change in
median velocity was noticed in KO mice (C). In addition, significant differences in median
velocity were noted between genotypes as well. ** = p < 0.01; *** = p < 0.001 vs. 0 min, # = p <
0.05; ## = p < 0.01 vs. EC group, † = p < 0.05; †† = p < 0.01 vs. WT group.
127
4.5. Discussion
4.5.1. Endothelial CysLT 2 R is not the sole mediator of CysLT 2 R-mediated ischemia/reperfusion
injury exacerbation
Endothelial expression of functionally-relevant CysLT 2 Rs has been well established for almost a
decade now (Hui et al., 2004; Spanbroek et al., 2003), and endothelial-targeted overexpression of
CysLT 2 R results in exacerbation of vascular permeability (Hui et al., 2004; Moos et al., 2008),
edema (Jiang et al., 2008), upregulation of cell adhesion molecules (Jiang et al., 2008; Ni et al.,
2011) and myocardial infarction damage (Jiang et al., 2008; Ni et al., 2011). The ability of
CysLT 2 R pharmacological antagonism to abolish these phenomena (Moos et al., 2008; Ni et al.,
2011) lent support to the idea that endothelial-expressed CysLT 2 R was the principal mediator of
these effects. Given the disparity in levels between endogenous murine CysLT 2 R expression
and the overexpressed endothelial-targeted hCysLT 2 R transgene (Hui et al., 2004), it was also
logical to believe that these biological responses were endothelium-driven.
However, our experiments utilizing a novel Tie2-expressing cell-restricted CysLT 2 R
overexpressing mouse model indicate that CysLT 2 R-mediated exacerbation of inflammation is
only partially driven by endothelial cell-expressed receptors, and that other CysLT 2 R receptor
niches may play a vital role in initiating and mediating the inflammatory response. Despite
possessing the same overexpression of endothelial hCysLT 2 R as the EC model, EC/KO mice
suffer significantly less severe myocardial damage following ischemia/reperfusion. As
transgenic CysLT 2 Rs account for the vast majority of endothelial CysLT 2 R in EC mice (Hui et
128
al., 2004), it was not expected that removal of endogenous murine endothelial CysLT 2 R would
affect endothelial CysLT 2 R-mediated mechanisms. Thus, our findings indicate that the
endothelial CysLT 2 R population is not the only mediator of increased I/R injury in EC mice.
We also note for the first time that KO mice show a tendency for reduced I/R damage versus WT
counterparts. The reason that the difference between damage in KO and WT mice is relatively
small compared to that between WT and EC mice is that basal CysLT 2 R expression in murine
cardiac vasculature is quite low (Hui et al., 2001). However, basal human CysLT 2 R expression
is higher (Heise et al., 2000), and leukotriene production and leukotriene receptor expression is
elevated in pathological states (Carry et al., 1992; Jiang et al., 2008; Shi et al., 2012a), indicating
that our EC model more closely represents human CysLT 2 R expression levels.
Explaining our results required closer examination of the various pro-inflammatory mechanisms
stemming from CysLT 2 R activation. We show here that basal rolling leukocyte flux is
significantly higher in mice that possess endogenous “non-endothelial” CysLT 2 R (WT and EC
groups) compared to mice that do not (KO and EC/KO groups), regardless of presence or
absence of transgenic endothelial CysLT 2 R. While leukocyte recruitment to injured tissue is a
key component of tissue repair (Jung et al., 2013; Kolaczkowska and Kubes, 2013), exacerbated
leukocyte recruitment and improper resolution of the inflammatory response can result in
additional injury (Kolaczkowska and Kubes, 2013). We have previously shown that transgenic
overexpression of endothelial CysLT 2 R results in vascular hyperpermeability (Moos et al.,
2008), and our EC/KO model was in agreement with this finding, showing significantly elevated
extravascular FITC-albumin accumulation following cysLT stimulation. The extent and
129
magnitude of the vascular permeability response in EC/KO mice was comparable to that seen in
EC mice, indicating that “non-endothelial” CysLT 2 R does not play a significant role in
CysLT 2 R-mediated vascular hyperpermeability.
The presence of rolling leukocytes does not automatically translate into leukocyte
transmigration. Indeed, the presence of a patrolling vascular leukocyte reservoir consisting
primarily of rolling or crawling monocytes that do not extravasate until following exposure to
irritants and/or injury has been characterized in the mesenteric and coronary vasculature (Auffray
et al., 2007; Jung et al., 2013). However, we saw a significant decrease in rolling leukocyte flux,
as well as a transient, but significant, increase in slow-rolling leukocyte proportion in EC and
EC/KO mice following cysLT stimulation. These findings, in combination with the
aforementioned cysLT-induced hyperpermeability response in EC and EC/KO mice, support a
mechanism where CysLT 2 R activation results in increased rolling leukocyte flux, decreased
rolling leukocyte velocity, and vascular hyperpermeability, resulting in the elevated edema and
leukocyte extravasation into the injured myocardium which have been shown to be hallmarks of
exacerbated CysLT 2 R-mediated I/R injury (Jiang et al., 2008; Ni et al., 2011).
However, while post-capillary cremaster venules in EC mice showed leakage in the absence of
exogenous cysLT stimulation, vessels in EC/KO mice did not. Moos et al. (2008) attributed the
phenomenon in EC mice to small amounts of leukotrienes liberated during the surgical exposure
of the cremaster muscle taking advantage of an increased abundance of endothelial CysLT 2 R. If
this is the case, why do these liberated leukotrienes not exert a similar effect on vessels in
EC/KO mice? The answer may be that leukotrienes released during tissue injury do not directly
130
activate endothelial CysLT 2 R. Rather, trauma results in localized leukotriene production/release
(Allen et al., 1993; Carry et al., 1992) and the subsequent activation of CysLT 2 Rs in sites other
than the endothelium. This in turn results in cysLT production in close proximity to endothelial
cells – a vital feature given the short half-lives of LTC 4 and LTD 4 – resulting in the activation of
endothelial CysLT 2 R and autocrine cysLT production mechanisms. Sufficient leukotriene
presence (i.e. exogenous application) would be able to bypass the “non-endothelial” step and
directly activate endothelial receptors - explaining how EC/KO mice can still present
hyperpermeability after exogenous stimulation. The exact cellular identity of these “nonendothelial” CysLT 2 R niches being activated in mice has yet to be determined, but leukocytes
and other circulatory cells are leading candidates as CysLT 2 R is expressed by monocytes,
macrophages, eosinophils (Heise et al., 2000), and platelets (Hasegawa et al., 2010) in humans.
Eosinophils (Carnini et al., 2011), mast cells, macrophages (Funk, 2001), and parenchymal cells
(Zarini et al., 2009) are capable of producing cysLTs, and neutrophils and monocytes produce
the cysLT precursor LTA 4 (Di Gennaro et al., 2004; Folco and Murphy, 2006), which is
converted to LTC 4 by endothelial cells and/or platelets (Folco and Murphy, 2006). Endothelial
cells can produce LTC 4 in an autocrine manner upon CysLT 2 R activation in the presence of
LTA 4 (Carnini et al., 2011).
A limitation of the study is using the cremaster vasculature to extrapolate findings to the
coronary circulation, given the known physiological and anatomical heterogeneity amongst
microvascular beds (Aird, 2007). However, the observations in the cremaster vasculature do not
contradict the post-I/R injury damage phenotypes detected in the myocardium. A novel and nonobtrusive method of real-time cardiac intravital microscopy imaging has just been realized (Jung
131
et al., 2013), affording an opportunity to examine the similarities and differences in response to
cysLT-stimulation directly when this technique becomes more widely available. Furthermore,
while the Tie2 promoter, used in our transgenic mice, specifies endothelial-targeted gene
expression, it may also lead to expression in a small subset of monocytes, termed Tie2expressing monocytes (TEMs) (De Palma et al., 2005). These monocytes are highly angiogenic
and are vital to tumor neovascularization, but also are mobilized following ischemia for the
revascularization of ischemic tissue (Patel et al., 2013). Indeed, the majority of Tie2+ monocytes
in mice are "resident" CD11b+Gr-1low/neg monocytes (Venneri et al., 2007), thought to be
instrumental to inflammatory response resolution (Nahrendorf et al., 2010), so it will be
interesting to investigate the role of CysLT 2 R activation/overexpression in this cell population in
future studies. However, we do not propose that Tie2+ myeloid cells play a large role in the
mechanisms explored herein, because overexpression of CysLT 2 R on Tie2+ myeloid cells would
be common to both EC and ECKO mice, and thus would not explain the differences presented
between the two genotypes.
4.5.2. Various tissue-specific CysLT 2 R niches play divergent, yet synergistic, roles in mediating
exacerbation of CysLT 2 R-mediated ischemia/reperfusion injury.
We previously proposed a mechanism where CysLT 2 R activation following
ischemia/reperfusion injury resulted in elevated leukocyte extravasation and increased
inflammation, resulting in increased tissue injury (Ni et al., 2011). Our present findings indicate
that leukotriene release following injury/ischemia activates CysLT 2 R niches – likely circulating
leukocytes – and that this facilitates leukocyte recruitment to the site of injury and activation of
132
endothelial CysLT 2 R (possibly via localized cysLT production). Endothelial CysLT 2 R
activation results in vascular hyperpermeability – leading to edema – and an increase in the
proportion of slow-rolling leukocytes, promoting leukocyte extravasation. Activation of both
endothelial and “non-endothelial” CysLT 2 Rs likely yields a synergistic effect. Insufficient
endothelial CysLT 2 R activation would result in higher numbers of rolling leukocytes that would
not extravasate en masse (observed in WT mice), whereas absence of activation in locations
other than the endothelium would result in limited rolling leukocyte flux (observed in EC/KO
mice), and thus decreased leukocyte migration to the surrounding tissue regardless of vascular
permeability level (Figure 4-8).
In conclusion, we have used a novel endothelium-limited CysLT 2 R overexpressing mouse model
to delineate the differing roles that endothelial and “non-endothelial” CysLT 2 R niches play in
mediating post-injury inflammatory responses. We show that “non-endothelial” CysLT 2 R
niches are vital to leukocyte recruitment and endothelial CysLT 2 R activation, whereas
endothelial CysLT 2 R activation mediates extent of vascular permeability. While further work is
required to clarify the precise molecular mechanisms underlying these phenotypes (i.e. cytokine
release profile or induction of angiogenesis), as well as any involvement by other cell types (i.e.
adipose tissue (Horrillo et al., 2010)) in close proximity to the vasculature, the revelation that
endothelial CysLT 2 R activation alone does not govern CysLT 2 R-mediated pro-inflammatory
responses indicates that more attention should be devoted to the role of CysLT 2 R expression in
sites other than the endothelium in cardiovascular injury.
133
Figure 4-8: Proposed schematic for CysLT 2 R inflammatory response modulation.
Injury or pro-inflammatory stimuli results in the synthesis and release of leukotrienes, which in
turn activate CysLT 2 Rs present on resident and/or circulating cells – most likely leukocytes such
as monocytes, macrophages, mast cells, and/or neutrophils. Activation of these CysLT 2 Rs
results in increased leukocyte rolling flux, and promotes localized cysLT production, likely via
supplying LTA 4 to endothelial cells and/or platelets. This results in activation of endothelial
CysLT 2 Rs, causing increased slow rolling leukocyte fractions and vascular hyperpermeability –
the latter contributing to edema in the affected tissue. These factors, in combination with the
aforementioned increased leukocyte rolling flux, promote leukocyte transmigration into the
surrounding tissue, resulting in exacerbation of the inflammatory response and elevated tissue
damage.
134
4.6. Acknowledgements
The authors would like to thank Professor Satoshi Ishii for providing LacZ-CysLT 2 R KO mice
and Ms. Deborah Harrington for assistance with murine blood counts.
This work was funded by the Canadian Institute for Health Research MOP-68930. C.D.F. holds
a Tier 1 Canada Research Chair and is a Career Investigator of the Heart and Stroke Foundation
of Ontario (Canada).
135
Chapter 5: General Discussion
Although leukotrienes were first identified for their ability to induce smooth muscle contraction,
research has since revealed that they are powerful inflammatory mediators as well. Much
research has centered around CysLT 1 R-mediated effects in asthma and other respiratory tract
diseases, and it was only recently that the role of cysteinyl leukotriene receptors in other
inflammatory pathologies, especially cardiovascular disease, became a subject of discussion.
This has brought the CysLT 2 R more into the spotlight, as it is the dominant isoform in the
myocardium and coronary vasculature. However, gathering insight on pathways and
mechanisms mediated by CysLT 2 R activation has been difficult due to a lack of CysLT 2 Rselective pharmacological agents in the past. In addition, while mouse models possessing altered
CysLT 2 R expression levels do exist, drawing direct comparisons between endogenous human
and murine CysLT 2 R expression profiles on a cellular level is also difficult due to a lack of
murine-selective CysLT 2 R antibodies, resulting in an inability to localize CysLT 2 R expression
to specific cell types. In an attempt to improve these situations, we have characterized a novel
CysLT 2 R-selective antagonist both in vitro and in vivo, and used it to determine that CysLT 2 R is
the sole cysteinyl leukotriene receptor mediating post-myocardial infarction responses in a
murine model of CysLT 2 R overexpression. We have determined that exacerbation of CysLT 2 Rmediated myocardial infarction damage is due to enhanced activation of the postischemia/reperfusion inflammatory response, and that CysLT 2 R plays a minimal role during the
ischemic phase or at the point of reperfusion. We have also uncovered that CysLT 2 Rs in
different locations have varying roles in CysLT 2 R-mediated leukocyte recruitment and vascular
hyperpermeability, and that “non-endothelial” CysLT 2 R activation may be required to trigger the
hyperpermeability response via activation of endothelial receptors. Finally, we have explored
136
the effects of CysLT 2 R overexpression and CysLT 2 R blockade on long-term cardiac remodeling
and heart function post-myocardial infarction.
5.1. Characterization of a Novel CysLT 2 R-Selective Antagonist
Prior to 2010, the pharmacological agent most utilized in CysLT 2 R investigations was Bayu9773, a LTE 4 analogue that antagonized LTC 4 and LTD 4 -stimulated smooth muscle
contraction in a dose-dependent manner (Tudhope et al., 1994). Bay-u9773 has equal affinity for
CysLT 1 R and CysLT 2 R (Tudhope et al., 1994), but was also identified as a partial agonist for
CysLT 2 R (Nothacker et al., 2000). Despite these drawbacks, Bay-u9773 remained the main
pharmacological agent used in CysLT 2 R antagonism experiments until Wunder et al. (2010)
published the first report of a CysLT 2 R-selective antagonist, dubbed HAMI3379. We have
followed their work by characterizing the potency of a sister compound, termed BayCysLT 2 , in
both cellular systems and murine models of pathology. HAMI3379 and BayCysLT 2 differ in
molecular structure by one double bond (a cyclohexyl radical for the former, benzyl for the
latter). Both are far more selective for CysLT 2 R versus CysLT 1 R, with HAMI3379 showing
more than 10,000-fold selectivity for CysLT 2 R (Wunder et al., 2010) and BayCysLT 2 being at
least 500-fold more selective for CysLT 2 R. In addition, HAMI3379 was found to be ~550-times
more potent than the dual antagonist/partial agonist Bay-u9773 in blocking LTD 4 -mediated
CysLT 2 R activation (Wunder et al., 2010). Unlike Bay-u9773, neither HAMI3379 nor
BayCysLT 2 have partial agonist properties, determined by the lack of calcium release in
CysLT 2 R or CysLT 1 R transfected cells during antagonist incubation periods (Wunder et al.,
2010). IC 50 values determined from in vitro assays indicate that HAMI3379 is ~10-fold more
137
potent than BayCysLT 2 . However, experiments conducted with HAMI3379 by our laboratory
have not corroborated this claim (Nassiri et al., unpublished data). One reason for this may be
that we are using racemic mixtures of HAMI3379, whereas Wunder et al. may have
experimented only with selected HAMI3379 stereoisomers. This would indicate that different
stereoisomers of HAMI3379 have differing affinities for the CysLT 2 R, and also gives
precedence that a similar phenomenon may apply to BayCysLT 2 as well. Additional
experimentation is required to examine whether selected BayCysLT 2 stereoisomers in isolation
have greater affinity than the racemic mixture used here. These discrepancies are unlikely to
become a greater problem though, as both BayCysLT 2 and HAMI3379 are now commercially
available, which standardizes the properties of the compound used by different research groups
and prevents introduction of an additional variable.
Our in vivo experimentation showed that BayCysLT 2 treatment abrogated exacerbation of
CysLT 2 R overexpression-mediated myocardial infarction damage. However, more work is
required in order to determine the pharmacokinetics and pharmacotoxicity of the compound.
Carnini et al. (2011) have confirmed our findings that BayCysLT 2 is selective for CysLT 2 R in
vitro, while Huang et al. (2008) and Qi et al. (2011) demonstrated BayCysLT 2 activity in
cultured cells, but no other study to date has shed any light on the bioavailability, metabolism, or
excretion of the compound. Similarly, HAMI3397 has been utilized in several studies since it
was first characterized in vitro (Wunder et al., 2010), and its efficacy in cultured cells and in vivo
is well established (Shi et al., 2012a; Zhang et al., 2013). However, as with BayCysLT 2 , little
information is available regarding the pharmacokinetics and pharmacotoxicity of HAMI3379.
Investigation of the pharmacological properties of BayCysLT 2 and HAMI3379 will be integral
138
to regulation of CysLT 2 R activity during pathological processes to identify when CysLT 2 R
signaling is most critical.
5.2. Identification of CysLT 2 R-Mediated Mechanisms Post-Myocardial Infarction
5.2.1. CysLT 2 R is the main cysteinyl leukotriene receptor involved in myocardial infarction
responses
Jiang et al. (2008) have previously established that endothelial-targeted CysLT 2 R overexpression
results in exacerbated myocardial damage following ischemia/reperfusion. However, the
underlying mechanisms of this phenomenon remained unclear. At the time, the only CysLT 2 R
antagonist available was the non-selective dual cysLTR antagonist Bay-u9773, which also had
partial agonist properties against CysLT 2 R (Nothacker et al., 2000). While treatment with Bayu9773 attenuated exacerbation of myocardial infarction damage in EC mice, it also yielded
ambiguity regarding whether CysLT 2 R was the sole mediator of the phenomenon, or whether
CysLT 1 R was involved in some capacity. The synthesis of BayCysLT 2 has allowed us to isolate
the role of CysLT 2 R in myocardial infarction damage exacerbation, and our results indicate that
the phenomenon observed by Jiang et al. (2008) in EC mice is mainly mediated by CysLT 2 R,
and that other leukotriene receptors play minimal roles (Ni et al., 2011). This finding fits given
that CysLT 2 R is by far the dominant leukotriene receptor in human myocardium and endothelial
cells (Heise et al., 2000; Lotzer et al., 2003).
139
One question that was raised (Moos and Funk, 2008) following the initial investigation by Jiang
et al. (2008), and remains, is why does CysLT 2 R antagonism not reduce infarction size in wildtype mice? On the same note, why do CysLT 2 R KO mice not present significantly decreased
infarct size compared to wild-type counterparts as well? While preliminary investigations by
Jiang et al. (2008) indicated that KO mice did not show any reduction in infarction size versus
wild-type counterparts, more in-depth study detailed here indicates that KO mice do indeed show
slightly (but statistically non-significant) diminished myocardial damage following
ischemia/reperfusion injury. Nonetheless, how CysLT 2 R expression affects infarction size
presents a distinctly different pattern than how CysLT 2 R expression affects vascular
permeability, where both receptor antagonism and genetic inactivation results in significantly
decreased vascular permeability (Moos et al., 2008). One potential explanation is that
endogenous CysLT 2 R expression in the heart and coronary circulation is very low. In contrast to
the expression profile in humans (Heise et al., 2000), Hui et al. (2001) could not detect cardiac
CysLT 2 R expression using Northern blot, and only identified endothelial CysLT 2 R expression
on coronary vessels using the more sensitive in situ hybridization technique. As such, CysLT 2 R
makes minimal or insignificant contributions to ischemia/reperfusion injury in mice under
endogenous conditions. However, this does not mean that the findings observed in EC mice are
merely the products of a contrived system. Even in mice, CysLT 2 R is physiologically
upregulated in vasculature following ischemic stress: this has been observed in the heart and
retina (Barajas-Espinosa et al., 2012; Jiang et al., 2008). Furthermore, leukotriene receptors are
upregulated in pathological conditions, including atherosclerosis and cancer (Allen et al., 1998;
Magnusson et al., 2007). As such, the EC mouse model is physiologically relevant, and is
140
important for the study of the effects of overstimulation of the post-infarction inflammatory
response.
5.2.2. CysLT 2 R activation results in promotion of cell adhesion and vascular hyperpermeability
Although we have identified the CysLT 2 R as the principle mediator of exacerbated myocardial
infarction damage in EC mice, the underlying mechanisms triggered by CysLT 2 R activation
remain unclear. We have pinpointed the CysLT 2 R as a mediator of post-ischemia/reperfusion
inflammatory responses, based on the ability of CysLT 2 R-selective antagonist treatment to
abrogate exacerbation of myocardial infarction injury even when delivered 45 minutes following
reperfusion of the myocardium - a timepoint too late for administration of BayCysLT 2 to affect
pathways triggered by ischemia, or prime the heart against acute reperfusion injury. Previous
research shows that EC mice present increased myocardial leukocyte counts, as well as elevated
red blood cell extravasation and myocardial edema following ischemia/reperfusion injury.
Indeed, the ability of CysLT 2 R activation via exogenous leukotriene application to induce potent
vascular leakage and edema is well known, and this response is also exacerbated in CysLT 2 R
overexpressing mice (Hui et al., 2004; Moos et al., 2008). We confirm the finding of Jiang et al.
by presenting evidence of elevated neutrophil extravasation into the myocardium following
infarction (Ni et al., 2011). Furthermore, we show that CysLT 2 R antagonism can attenuate this
effect, indicating that the leukocyte extravasation observed previously and the neutrophil
presence presented here are likely CysLT 2 R-activation mediated. In addition to this, previous
research shows that the genes encoding the cell adhesion molecules VCAM-1 and ICAM are
upregulated following myocardial infarction, and that this upregulation is significantly elevated
141
in EC mice (Jiang et al., 2008). Our work here shows that these alterations in gene regulation are
also attenuated via CysLT 2 R blockade, indicating that CysLT 2 R activation not only facilitates
extravasation via induction of vascular permeability, but also by promoting leukocyte rolling and
adhesion as well.
These findings in the pathological heart are supported by investigations of CysLT 2 R-mediated
phenomena in the peripheral cremaster microvasculature. While the cremaster vascular bed is
not a perfect mimic of the coronary vasculature, it (or the similarly dissimilar mesenteric
vascular bed) remains the main readily accessible site for real-time observation of vascular
responses in vivo. Recent work has demonstrated that real-time intravital microscopy can be
performed on a rapidly mobile tissue such as the heart, but the technology and apparatus required
is not sufficiently available or affordable (Jung et al., 2013; Li et al., 2012). Moos et al. (2008)
noted that cremaster post-capillary venule permeability was significantly reduced in CysLT 2 R
KO mice and significantly elevated in EC mice. We have confirmed these findings and report
that leukotriene stimulation of post-capillary venules results in increased leukocyte rolling flux
over time, as well as an elevated proportion of E-selectin-mediated slow-rolling (Kunkel and
Ley, 1996) leukocytes in wild-type mice. Neither of these phenomena was observed in
CysLT 2 R KO mice, indicating that CysLT 2 R activation results in promotion of leukocyte
recruitment and transmigration. Interestingly, EC mice showed steadily decreasing leukocyte
rolling flux and a transient increase in the proportion of slow-rolling leukocytes. These results
can likely be explained as a consequence of the aforementioned CysLT 2 R-mediated vascular
hyperpermeability response facilitating elevated leukocyte transmigration - the number of cells
leaving the vasculature exceeds the number being recruited, resulting in a net decrease in
142
vascular leukocyte flux and fewer slow-rolling (as opposed to fast-rolling or transmigrated)
leukocytes. Further investigation is required to confirm that leukocyte diapedesis and
transmigration is occurring following leukotriene stimulation, but these findings provide
rationale for the elevated leukocyte presence observed in the myocardium following
ischemia/reperfusion injury in EC mice.
5.2.3. CysLT 2 R activation on different cell types mediate distinct and separate responses
While we were able to establish several pro-inflammatory pathways triggered by CysLT 2 R
activation post-ischemia/reperfusion, we were unable to isolate the specific role played by
receptors present on endothelial cells versus those on other cell types. To investigate this, we
crossed CysLT 2 R KO mice with endothelial CysLT 2 R overexpressing mice, yielding a mouse
model (EC/KO) that does not express endogenous murine CysLT 2 R, but does expresses the
human CysLT 2 R in the vascular endothelium (as well as a small subset of Tie2+ leukocytes) in
comparable abundance to EC mice. Transgenic CysLT 2 R expression is significantly higher than
endogenous CysLT 2 R expression in EC mice (Hui et al., 2004), and as a result, we anticipated
that removing endogenous murine endothelial receptors would not impair any endothelial cell
CysLT 2 R-mediated response. In addition, because the responses (i.e. vascular permeability and
ICAM-1/VCAM expression) outlined in the previous section were largely endothelium
mediated, we hypothesized that removing non-endothelial endogenous CysLT 2 R would not alter
the myocardial infarction injury exacerbation phenomenon observed in EC mice. Surprisingly,
EC/KO mice did not show exacerbated myocardial damage following ischemia/reperfusion
143
injury, indicating that the endothelial CysLT 2 R population was not the sole mediator of
CysLT 2 R-mediated injury exacerbation.
Further investigation of EC/KO mice showed that this genotype differed from EC mice in several
ways. First, while cremaster muscle post-capillary venule hyperpermeability was present in
EC/KO mice, it was only present when the muscle vasculature was stimulated with exogenous
cysLTs. This is in contrast to EC mice, which show significantly elevated vascular permeability
post-surgery prior to exogenous cysLT application. This phenomenon was attributed to
CysLT 2 R activation by leukotrienes released from the tissue during the surgical preparation of
the cremaster muscle for imaging (Moos et al., 2008). However, the finding that this can be
abolished in EC/KO mice indicates that if there are leukotrienes being released during the
surgical preparation of the cremaster muscle, they are not directly activating endothelial
CysLT 2 R. Rather, it is perhaps more plausible that physical trauma to the cremaster muscle
during surgical preparation releases leukotrienes, which may activate circulating leukocytes via
CysLT 2 R binding, in turn resulting in further leukotriene production either by or in close
proximity to endothelial cells. There is a lack of evidence indicating that cysLT receptor
activation directly results in leukotriene formation, but both CysLT 1 R and CysLT 2 R activation
results in increased intracellular Ca2+ concentrations (Lotzer et al., 2003; Lynch et al., 1999),
which may serve to promote cPLAα2 and 5-LO translocation (Glover et al., 1995; Rouzer et al.,
1985). In addition, there is ample evidence suggesting cysLT receptor activation promotes
leukocyte recruitment and adhesion (Datta et al., 1995; Fregonese et al., 2002; McIntyre et al.,
1986; Pedersen et al., 1997). This in turn may promote transcellular production of cysteinyl
144
leukotrienes, as leukocytes, which possess LTA 4 H, are brought into close proximity to
endothelial cells and platelets, which possess LTC 4 S (Zarini et al., 2009).
An alternative possibility is that removal of non-endothelial CysLT 2 R has increased the
activation threshold for endothelial CysLT 2 R in some manner, and the limited amount of LTs
released by surgical trauma can no longer activate endothelial receptors. CysLT receptors, like
other GPCRs, do form hetero- and homodimers for the purposes of self-regulation. Indeed, in
CysLT 1 R/CysLT 2 R heterodimers, activation of CysLT 2 R serves as a negative regulator of
CysLT 1 R-mediated pathways (Jiang et al., 2007). CysLT receptors can also form heterodimers
with GPR17 (Maekawa et al., 2009), and there is putative evidence for cross-talk between the
classical cysLT receptors and the newly identified CysLT E R (GPR99) (Kanaoka et al., 2013).
However, there are no reports thus far of cysLT receptor conformation and/or ligand affinities
being altered via cell-cell interactions as opposed to cross-talk between receptors located on the
same cell, and there is little evidence to support that cell-cell cysLT receptor modulation takes
place.
We also noted that leukocyte rolling flux counts under basal conditions are significantly
diminished in mice lacking non-endothelial CysLT 2 R (KO and EC/KO genotypes) compared to
mice that do express endogenous receptors (WT and EC genotypes). No significant differences
were noted between WT and EC or KO and EC/KO groups, indicating that the presence/absence
of endothelial CysLT 2 R overexpression did not play a role in this phenomenon. Furthermore,
rolling leukocyte median velocity at 15 minutes post-LT stimulation was also significantly faster
in KO and EC/KO mice versus WT and EC counterparts. These findings indicate that activation
145
of non-endothelial CysLT 2 Rs plays a role in facilitating and/or promoting leukocyte rolling
under both endogenous and pro-inflammatory conditions. It is unclear how CysLT 2 R activation
is accomplishing this, but cysLTs are well established as mediators of leukocyte chemotaxis
(Fregonese et al., 2002; Hashimoto et al., 2009; Ichiyama et al., 2005) and promoters of
leukocyte rolling/adhesion (Datta et al., 1995; McIntyre et al., 1986). There is ample evidence
that these phenomena can be regulated by CysLT 1 R activation (Back et al., 2011; Boehmler et
al., 2009), but that does not rule out a role for CysLT 2 R. Certainly, the lack of a selective
CysLT 2 R antagonist until recently (Wunder et al., 2010) likely contributes to the disparity in
information available about CysLT 1 R versus CysLT 2 R in mediating cysteinyl leukotrienetriggered chemotactic responses.
Although experimental data from the EC/KO mouse model revealed that endothelial CysLT 2 R
activation did not play as significant a role as previously anticipated, the receptor niche is still a
vital component in exacerbation of CysLT 2 R-mediated damage. EC/KO mice are still capable of
presenting significantly elevated vascular permeability upon leukotriene stimulation - indeed,
vascular leakage seen in EC/KO mice is on par with EC counterparts and significantly higher
than that observed in wild-type mice. We also observed that mice possessing endothelial
CysLT 2 R overexpression (both EC and EC/KO groups) showed a decline in rolling leukocyte
flux following LT stimulation. Finally, EC and EC/KO mice both show a significant increase in
slow-rolling leukocyte proportion following leukotriene stimulation. In combination, these
results indicate that endothelial CysLT 2 R activation mediates vascular hyperpermeability in
tandem with promoting E-selectin mediated leukocyte slow-rolling. These two factors most
likely facilitate increased leukocyte transmigration into the extravascular tissue, and this provides
146
an explanation for the steady decrease in rolling leukocyte flux post-LT stimulation observed in
mice possessing elevated endothelial CysLT 2 R expression. The steady decrease in rolling
leukocyte flux also provides an explanation for the transient nature of the increase in slow-rolling
leukocyte proportion observed in EC and EC/KO mice. The extravasating cells would largely be
drawn from the slow-rolling cell population, thus reducing the proportion of slow-rolling
leukocytes present.
Vascular hyperpermeability, leukocyte recruitment, and facilitation of leukocyte-slow rolling
combine to create a scenario that greatly promotes and facilitates leukocyte extravasation to the
extravascular milieu. This elevated leukocyte presence in the injured tissue would then lead to
exacerbation of pro-inflammatory responses, leading to increased tissue damage and death.
Indeed, neutrophil depletion (Romson et al., 1983), as well as genetic knockout of P-selectin and
ICAM-1 (Briaud et al., 2001) has been linked to decreased acute myocardial injury.
Furthermore, neutrophil depletion and inhibition of neutrophil adherence to endothelium both
resulted in attenuation of I/R-induced vascular permeability (Hernandez et al., 1987).
Based on this model, CysLT 2 Rs located on the endothelium and elsewhere both play important
roles in exacerbation of CysLT 2 R-mediated injury. If “non-endothelial” receptors are not
activated, then fewer rolling leukocytes are present in the circulation, resulting in lower
extravasation despite the presence of a hyperpermeability response (as observed in EC/KO)
mice. If endothelial CysLT 2 Rs are not expressed in sufficient quantities, then activation fails to
yield a hyperpermeability response, resulting in increased vascular leukocyte rolling flux, but
lower extravasation as the cells are unable to transmigrate (as observed in WT mice). If neither
147
CysLT 2 R subset is activated, then myocardial infarction damage is reduced (as seen in KO
mice). Only when both receptor subsets are activated - and endothelial CysLT 2 R is present in
significant quantities - do we observe exacerbation of injury (as seen in EC mice).
5.2.4. The CysLT 2 R picture is far from complete
Several outstanding questions do remain however within this framework. First, what is the
source of leukotrienes for CysLT 2 R activation in either leukocytes or endothelial cells? There is
evidence for leukotriene release/production during ischemia/reperfusion injury (Carry et al.,
1992; Takase et al., 1996). However, there is little information regarding the where and the
when. Where are leukotrienes being released - in close enough proximity to relevant cells in
order to exert their effects prior to conversion to LTE 4 ? When are they being released? Our
experiments using BayCysLT 2 indicate that CysLT 2 R activation occurs predominantly postreperfusion, but the precise timeframe of LT release during and after MI remains unclear. It is
also important to investigate cell-cell interactions that may arise prior to or upon CysLT 2 R
activation. Given the prevalence of transcellular LT production, are certain cell-cell interactions
(i.e. neutrophil-endothelial cell) required for the generation of sufficient quantities of LTs to
activate CysLT 2 Rs? Conversely, could initial CysLT 2 R activation promote cell-cell interactions,
resulting in additional local LT production and enhanced CysLT 2 R activation?
Second, aside from endothelial cells, where is CysLT 2 R endogenously expressed in the murine
model? In humans, CysLT 2 R is expressed by macrophages, eosinophils, mast cells, monocytes,
and platelets (Hasegawa et al., 2010; Heise et al., 2000; Mellor et al., 2003; Mita et al., 2001),
148
but as previously mentioned, cell-specific localization has been difficult due to absence of a
commercially available murine-specific antibody, as well as lower endogenous receptor
expression (Hui et al., 2001). We generate our hypotheses and models working under the
assumption that murine and human CysLT 2 R expression profiles are relatively similar. Data
from when the human and murine receptor sequences were first identified indicate that this is the
case, at least at the organ-level. Both human and mouse showed strongest CysLT 2 R expression
in myeloid cell containing tissues (i.e. spleen, thymus, and lymph nodes), and found lesser
expression in peripheral blood leukocytes, brain, and heart. The main difference though was that
relative expression of CysLT 2 R in the mouse brain, heart, and leukocytes was significantly lower
versus organs of high expression (i.e. spleen) compared to human equivalents (Heise et al., 2000;
Hui et al., 2001). Assuming that mice, like humans, express CysLT 2 R on circulating leukocytes,
one question is whether CysLT 2 R is expressed on pro-inflammatory leukocytes, or whether the
receptor is present on anti-inflammatory cells, such as M2 macrophages, Ly-6Clo monocytes, or
regulatory T cells (Hofmann et al., 2012; Nahrendorf et al., 2007). Aside from circulating
leukocytes, another cell type that is a candidate for CysLT 2 R expression and can modulate
endothelial function is the pericyte. Pericytes are mural cells that share a basement membrane
with endothelial cells and are vital to the regulation of vascular function (Armulik et al., 2005).
They can interact directly with multiple endothelial cells simultaneously and are present in the
microvasculature, as well as large arteries and veins. Pericyte activation regulates
vasoconstriction and vasodilation in vascular beds, and play a critical role in maintenance of the
blood-brain barrier (Bergers and Song, 2005). Barajas-Espinosa et al. (2012) reported CysLT 2 R
expression on vascular pericytes in the retina, and given their role in regulation of vascular
149
function, it is possible that they may play a role in mediating leukotriene-induced
hyperpermeability responses.
Third, how does CysLT 2 R activation on peripheral cells result in endothelial CysLT 2 R
activation? The most likely hypothesis is that CysLT 2 R activation results in leukotriene
production by circulating leukocytes. Whether this occurs due to direct targeting of leukotriene
production pathway enzymes or occurs indirectly as a by-product of a combination of increased
intracellular Ca2+ and the formation of a pro-inflammatory environment is unknown. The
leukotriene produced would likely be LTA 4 , which would then lead to cysLT production via
transcellular biosynthesis. As outlined in the introduction, cysLTs can be produced by platelets
and endothelial cells in humans using donor LTA 4 from other cell types (Maclouf and Murphy,
1988; Sjostrom et al., 2001). This phenomenon has also been confirmed in murine models,
although the exact donor and production cell types are unclear (Zarini et al., 2009). There is
evidence that cysteinyl leukotrienes can exert autocrine effects in endothelial cells (Carnini et al.,
2011), fibrocytes (Vannella et al., 2007), and eosinophils (Lee et al., 2000), so it is possible that
endothelial cell LT production in our model exacerbates vascular permeability through autocrine
activation of elevated numbers of endothelial CysLT 2 Rs. However, further work is certainly
required to pinpoint the specific details of the in vivo mechanism upon ischemic injury.
Finally, is CysLT 2 R activation always deleterious – i.e. will inactivation of CysLT 2 R signaling
as part of a course of CVD treatment prove to be ultimately detrimental? The large body of work
investigating the pathological implications of CysLT 2 R activation far overshadows the number
of investigations regarding the normal endogenous function of this receptor. Studies show that
150
IL-4 plays a role in promoting CysLT 2 R activation, either via receptor upregulation (Lotzer et
al., 2003) or by priming cells expressing CysLT 2 R (Mellor et al., 2003). This may indicate that
CysLT 2 R activation is part of host defense, as IL-4 facilitates Th-2 effector cell-mediated
counter-mechanisms against parasitic worm invasion (Chen et al., 2004a). Certainly, as
mentioned in the introductory chapter of this manuscript, CysLT 2 R activation has been shown to
facilitate upregulation and secretion of IL-8, a potent stimulator of neutrophil chemotaxis
(Thompson et al., 2008). The fact that CysLT 2 R expression in HUVECs is rapidly
downregulated by pro-inflammatory stimuli (i.e. LPS, TNF-α) (Sjostrom et al., 2003) indicates
that CysLT 2 R-mediated inflammatory mechanisms are designed to be transient, and that
pathology likely arises from uncontrolled increases in either stimuli or an inability to shut off
inflammatory mechanisms. Research has also shown that CysLT 2 R activation promotes cell
proliferation (Huang et al., 2008; Vannella et al., 2007). Conversely, there is also evidence that
CysLT 2 R may suppress cell proliferation. High CysLT 2 R expression, in conjunction with low
CysLT 1 R expression, has been associated with decreased disease severity and improved
prognosis in colorectal cancer patients, indicating that in this situation, CysLT 2 R signaling may
be impeding CysLT 1 R-mediated cell survival/proliferation pathways (Magnusson et al., 2007).
However, these studies were conducted in pathological models, which do not clarify the role of
CysLT 2 R in mediating cell proliferation/differentiation under basal conditions, but do imply that
CysLT 2 R activation may regulate the cell cycle. There is also the possibility that CysLT 2 R may
also serve as a negative regulator of CysLT 1 R or CysLT E R. Indeed, aside from the above
mentioned example in colorectal cancer cells, CysLT 2 R knockdown results in increased
CysLT 1 R-mediated mast cell proliferation and the enhancement of cysLT-mediated ERK
phosphorylation (Jiang et al., 2007). Furthermore, knockout of CysLT 1 R and CysLT 2 R in mice
151
resulted in increased vascular ear edema in response to LTE 4 stimulation compared to wild-type
animals, indicating that the presence of those two receptors served to dampen the proinflammatory activity of the CysLT E R (Kanaoka et al., 2013). Certainly, further investigation is
warranted in comparing and contrasting CysLT 2 R-mediated responses in physiological and
pathological conditions.
5.3. CysLT 2 R Antagonism Post-Reperfusion Impedes Long-Term Ventricular Remodeling
While we have proposed a putative mechanism for exacerbation of CysLT 2 R-mediated acute
myocardial injury, how CysLT 2 R activation affects long-term cardiac function postischemia/reperfusion injury remains unclear. We investigated long-term cardiac function
indirectly in WT and EC mice following myocardial infarction and surprisingly observed no
prominent differences between the two groups, despite the disparity in acute myocardial injury.
Furthermore, and even more surprisingly, we found that BayCysLT 2 treatment in both WT and
EC mice actually results in decreased cardiac function versus untreated counterparts, despite
apparently limiting acute myocardial infarction damage based on the significantly greater apical
region ventricular wall thickness observed in BayCysLT 2 treated mice.
These findings are certainly puzzling, and yet perhaps not inherently contradictory. Little is
known about the role of CysLT 2 R in inflammatory resolution, so it is possible that CysLT 2 R
antagonism exerts both beneficial (prevention of elevated inflammatory response) and
deleterious (inhibition of proper debris clearance and wound healing) effects on the infarcted
heart. Certainly, any discrepancy in CysLT 2 R expression levels between pro-inflammatory (e.g.
152
Ly-6Chi monocytes and M1 macrophages) and anti-inflammatory leukocyte subsets (e.g. Ly-6Clo
monocytes and M2 macrophages) is worthy of investigation. Furthermore, there is evidence that
in certain systems, CysLT 2 R mediates beneficial pathways. For example, CysLT 2 R activation
has been shown to negatively regulate CysLT 1 R-mediated responses in mast cells, and CysLT 2 R
knockdown results in increased CysLT 1 R expression (Jiang et al., 2007). In addition, elevated
CysLT 2 R expression has been associated with cell differentiation in colorectal cancer
(Magnusson et al., 2007) and positive prognosis in breast cancer (Magnusson et al., 2011) and
prostate cancer (Matsuyama et al., 2007). It must be noted that while these studies indicate a role
for CysLT 2 R as a counter-balance to CysLT 1 R, we do not believe that CysLT 1 R plays a
significant role in myocardial infarction injury, given the paucity of the receptor in the heart.
However, these examples do serve to illustrate the possibility of a CysLT 2 R-mediated
mechanism that is beneficial to cardiac function post-injury.
Another possible explanation for our findings is that our transient ischemia/reperfusion may not
sufficiently damage the myocardium to evoke noticeable cardiac remodeling in our model, and
this is masking CysLT 2 R-mediated changes to long-term cardiac function. While the literature
presents many examples of studies utilizing transient ischemia/reperfusion demonstrating
significant differences between experimental groups (Arslan et al., 2013; Eguchi et al., 2012;
Toldo et al., 2012), there is a study that rejected animals suffering under 30% infarction size
under the rationale that they "did not show typical LV remodeling" (Harada et al., 1999). In
addition, the literature available would be biased towards cases where I/R induced significant
changes versus cases where no significant changes were noted, given the difficulty in publishing
“negative results.” One possible remedy for this is to use a model of permanent LAD ligation in
153
order to induce ischemia - certainly, studies that utilize permanent ligation present much more
pronounced wall thinning and ventricular dilatation than that observed in our investigation
(Patten et al., 1998; Song et al., 2012; Zhang et al., 2005). In addition, studies (albeit those using
permanent LAD ligation) have also noted dilatation in the right ventricle, as well as the left postMI, and that was something not investigated in the present study (Patten et al., 1998; Yang et al.,
2002). However, this technique is not without its own drawbacks, as it ostensibly bypasses
reperfusion injury and the subsequent inflammatory response. Certainly, the role of CysLT 2 R
activation in long-term cardiac remodeling and function warrants further and more in-depth
attention.
5.4. Potential for the CysLT 2 R as a Therapeutic Target
While CysLT 1 R is well-known as a target in the treatment of asthma and other inflammatory
airway diseases, CysLT 2 R has only recently gained attention as a potential therapeutic target in
cardiovascular disease treatment. Although we have characterized a novel CysLT 2 R-selective
antagonist, and firmly established a role for CysLT 2 R activation-mediated mechanisms in the
exacerbation of acute myocardial infarction injury, much work remains to be done. No
information is currently available regarding the pharmacological properties of BayCysLT 2 , and
no side effects of systemic administration of the compound have been reported to this date. In
addition, very little is known about the bioavailability or metabolism of HAMI3379 or
BayCysLT 2 . Another important issue is that although murine models are highly useful due to
the ability to manipulate genetic expression of targets of investigation, the endogenous CysLT 2 R
expression profile in the murine cardiovascular system does not fully mimic that in humans. In
154
particular, low endogenous expression of CysLT 2 R in the heart and coronary vasculature makes
it difficult to examine CysLT 2 R-specific effects and mechanisms without genetic manipulation.
In conclusion, while CysLT 2 R has been investigated for almost 15 years now, our understanding
of the receptor and its effects is very much still in its infancy. Understanding how leukotriene
stimulation activates and regulates inflammatory responses post-injury is not only vital to
improving patient outcome post-myocardial infarction, it may also provide a novel approach to
treating inflammation, both chronic and acute, caused by other pathologies including
atherosclerosis and stroke. Certainly, persistent cysLT receptor antagonism would be a novel
way to treat deleterious gene upregulation present during chronic pathologies (i.e. proinflammatory genes upregulated by leukotriene stimulation (Back et al., 2011; Eaton et al., 2012;
Uzonyi et al., 2006) or provide a counter-measure to upregulation of CysLT receptors present
during atherosclerosis and stenosis (Allen et al., 1998; Nagy et al., 2011). While much more
investigation into the precise mechanisms of CysLT 2 R activation post-myocardial infarction is
clearly required, the advent of proper pharmacological tools capable of isolating CysLT 2 Rmediated effects makes clarifying the role of CysLT 2 R in cardiovascular pathogenesis much
easier, and will hopefully lead to treatment strategies targeting cardiovascular disease and
inflammation.
155
References
Abbracchio, M.P., Burnstock, G., Boeynaems, J.M., Barnard, E.A., Boyer, J.L., Kennedy, C.,
Miras-Portugal, M.T., King, B.F., Gachet, C., Jacobson, K.A., et al. (2005). The recently
deorphanized GPR80 (GPR99) proposed to be the P2Y15 receptor is not a genuine P2Y receptor.
Trends in pharmacological sciences 26, 8-9.
Abramovitz, M., Wong, E., Cox, M.E., Richardson, C.D., Li, C., and Vickers, P.J. (1993). 5lipoxygenase-activating protein stimulates the utilization of arachidonic acid by 5-lipoxygenase.
European journal of biochemistry / FEBS 215, 105-111.
Adelroth, E., Morris, M.M., Hargreave, F.E., and O'Byrne, P.M. (1986). Airway responsiveness
to leukotrienes C4 and D4 and to methacholine in patients with asthma and normal controls. The
New England journal of medicine 315, 480-484.
Ahn, J., and Kim, J. (2012). Mechanisms and consequences of inflammatory signaling in the
myocardium. Current hypertension reports 14, 510-516.
Aird, W.C. (2007). Phenotypic heterogeneity of the endothelium: II. Representative vascular
beds. Circulation research 100, 174-190.
Albelda, S.M., Smith, C.W., and Ward, P.A. (1994). Adhesion molecules and inflammatory
injury. FASEB journal : official publication of the Federation of American Societies for
Experimental Biology 8, 504-512.
Allen, S., Dashwood, M., Morrison, K., and Yacoub, M. (1998). Differential leukotriene
constrictor responses in human atherosclerotic coronary arteries. Circulation 97, 2406-2413.
Allen, S.P., Sampson, A.P., Piper, P.J., Chester, A.H., Ohri, S.K., and Yacoub, M.H. (1993).
Enhanced excretion of urinary leukotriene E4 in coronary artery disease and after coronary artery
bypass surgery. Coronary artery disease 4, 899-904.
Amat, M., Diaz, C., and Vila, L. (1998). Leukotriene A4 hydrolase and leukotriene C4 synthase
activities in human chondrocytes: transcellular biosynthesis of Leukotrienes during granulocytechondrocyte interaction. Arthritis and rheumatism 41, 1645-1651.
Amsterdam, E.A., Pan, H.L., Rendig, S.V., Symons, J.D., Fletcher, M.P., and Longhurst, J.C.
(1993). Limitation of myocardial infarct size in pigs with a dual lipoxygenase-cyclooxygenase
blocking agent by inhibition of neutrophil activity without reduction of neutrophil migration.
Journal of the American College of Cardiology 22, 1738-1744.
Armulik, A., Abramsson, A., and Betsholtz, C. (2005). Endothelial/pericyte interactions.
Circulation research 97, 512-523.
Arslan, F., Lai, R.C., Smeets, M.B., Akeroyd, L., Choo, A., Aguor, E.N., Timmers, L., van
Rijen, H.V., Doevendans, P.A., Pasterkamp, G., et al. (2013). Mesenchymal stem cell-derived
exosomes increase ATP levels, decrease oxidative stress and activate PI3K/Akt pathway to
156
enhance myocardial viability and prevent adverse remodeling after myocardial
ischemia/reperfusion injury. Stem cell research 10, 301-312.
Auffray, C., Fogg, D., Garfa, M., Elain, G., Join-Lambert, O., Kayal, S., Sarnacki, S., Cumano,
A., Lauvau, G., and Geissmann, F. (2007). Monitoring of blood vessels and tissues by a
population of monocytes with patrolling behavior. Science 317, 666-670.
Austen, K.F. (2005). The mast cell and the cysteinyl leukotrienes. Novartis Foundation
symposium 271, 166-175; discussion 176-168, 198-169.
Austen, K.F., Maekawa, A., Kanaoka, Y., and Boyce, J.A. (2009). The leukotriene E4 puzzle:
finding the missing pieces and revealing the pathobiologic implications. The Journal of allergy
and clinical immunology 124, 406-414; quiz 415-406.
Back, M., Dahlen, S.E., Drazen, J.M., Evans, J.F., Serhan, C.N., Shimizu, T., Yokomizo, T., and
Rovati, G.E. (2011). International Union of Basic and Clinical Pharmacology. LXXXIV:
leukotriene receptor nomenclature, distribution, and pathophysiological functions.
Pharmacological reviews 63, 539-584.
Back, M., Qiu, H., Haeggstrom, J.Z., and Sakata, K. (2004). Leukotriene B4 is an indirectly
acting vasoconstrictor in guinea pig aorta via an inducible type of BLT receptor. American
journal of physiology Heart and circulatory physiology 287, H419-424.
Bandeira-Melo, C., Hall, J.C., Penrose, J.F., and Weller, P.F. (2002). Cysteinyl leukotrienes
induce IL-4 release from cord blood-derived human eosinophils. The Journal of allergy and
clinical immunology 109, 975-979.
Barajas-Espinosa, A., Ni, N.C., Yan, D., Zarini, S., Murphy, R.C., and Funk, C.D. (2012). The
cysteinyl leukotriene 2 receptor mediates retinal edema and pathological neovascularization in a
murine model of oxygen-induced retinopathy. FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 26, 1100-1109.
Barajas-Espinosa, A., Ochoa-Cortes, F., Moos, M.P., Ramirez, F.D., Vanner, S.J., and Funk,
C.D. (2011). Characterization of the cysteinyl leukotriene 2 receptor in novel expression sites of
the gastrointestinal tract. The American journal of pathology 178, 2682-2689.
Barnes, N., Thomas, M., Price, D., and Tate, H. (2005). The national montelukast survey. The
Journal of allergy and clinical immunology 115, 47-54.
Barral, S., Fernandez-Cadenas, I., Bis, J.C., Montaner, J., Ikram, A.M., Launer, L.J., Fornage,
M., Schmidt, H., Brickman, A.M., Seshadri, S., et al. (2012). No association of ALOX5AP
polymorphisms with risk of MRI-defined brain infarcts. Neurobiology of aging 33, 629 e621623.
Barry, M., Cahill, R.A., Roche-Nagle, G., Neilan, T.G., Treumann, A., Harmey, J.H., and
Bouchier-Hayes, D.J. (2009). Neoplasms escape selective COX-2 inhibition in an animal model
of breast cancer. Irish journal of medical science 178, 201-208.
157
Baud, L., Goetzl, E.J., and Koo, C.H. (1987). Stimulation by leukotriene D4 of increases in the
cytosolic concentration of calcium in dimethylsulfoxide-differentiated HL-60 cells. The Journal
of clinical investigation 80, 983-991.
Bautz, F., Denzlinger, C., Kanz, L., and Mohle, R. (2001). Chemotaxis and transendothelial
migration of CD34(+) hematopoietic progenitor cells induced by the inflammatory mediator
leukotriene D4 are mediated by the 7-transmembrane receptor CysLT1. Blood 97, 3433-3440.
Belhomme, D., Peynet, J., Louzy, M., Launay, J.M., Kitakaze, M., and Menasche, P. (1999).
Evidence for preconditioning by isoflurane in coronary artery bypass graft surgery. Circulation
100, II340-344.
Benned-Jensen, T., and Rosenkilde, M.M. (2010). Distinct expression and ligand-binding
profiles of two constitutively active GPR17 splice variants. British journal of pharmacology 159,
1092-1105.
Bergers, G., and Song, S. (2005). The role of pericytes in blood-vessel formation and
maintenance. Neuro-oncology 7, 452-464.
Bernstrom, K., and Hammarstrom, S. (1981). Metabolism of leukotriene D by porcine kidney.
The Journal of biological chemistry 256, 9579-9582.
Bevan, S., Dichgans, M., Wiechmann, H.E., Gschwendtner, A., Meitinger, T., and Markus, H.S.
(2008). Genetic variation in members of the leukotriene biosynthesis pathway confer an
increased risk of ischemic stroke: a replication study in two independent populations. Stroke; a
journal of cerebral circulation 39, 1109-1114.
Bilir, A., Erkasap, N., Koken, T., Gulec, S., Kaygisiz, Z., Tanriverdi, B., and Kurt, I. (2007).
Effects of tramadol on myocardial ischemia-reperfusion injury. Scandinavian cardiovascular
journal : SCJ 41, 242-247.
Birdsall, H.H., Green, D.M., Trial, J., Youker, K.A., Burns, A.R., MacKay, C.R., LaRosa, G.J.,
Hawkins, H.K., Smith, C.W., Michael, L.H., et al. (1997). Complement C5a, TGF-beta 1, and
MCP-1, in sequence, induce migration of monocytes into ischemic canine myocardium within
the first one to five hours after reperfusion. Circulation 95, 684-692.
Bisoendial, R.J., Tanck, M.W., Golledge, J., Broekhuizen, L.N., Legemate, D.A., Stroes, E.S.,
and Norman, P.E. (2012). The association between the gene encoding 5-lipoxygenase activating
protein and abdominal aortic aneurysms. Atherosclerosis 220, 425-428.
Boehmler, A.M., Drost, A., Jaggy, L., Seitz, G., Wiesner, T., Denzlinger, C., Kanz, L., and
Mohle, R. (2009). The CysLT1 ligand leukotriene D4 supports alpha4beta1- and alpha5beta1mediated adhesion and proliferation of CD34+ hematopoietic progenitor cells. Journal of
immunology 182, 6789-6798.
Borgeat, P., Hamberg, M., and Samuelsson, B. (1976). Transformation of arachidonic acid and
homo-gamma-linolenic acid by rabbit polymorphonuclear leukocytes. Monohydroxy acids from
novel lipoxygenases. The Journal of biological chemistry 251, 7816-7820.
158
Borgeat, P., and Samuelsson, B. (1979a). Arachidonic acid metabolism in polymorphonuclear
leukocytes: effects of ionophore A23187. Proceedings of the National Academy of Sciences of
the United States of America 76, 2148-2152.
Borgeat, P., and Samuelsson, B. (1979b). Arachidonic acid metabolism in polymorphonuclear
leukocytes: unstable intermediate in formation of dihydroxy acids. Proceedings of the National
Academy of Sciences of the United States of America 76, 3213-3217.
Braccioni, F., Dorman, S.C., O'Byrne P, M., Inman, M.D., Denburg, J.A., Parameswaran, K.,
Baatjes, A.J., Foley, R., and Gauvreau, G.M. (2002). The effect of cysteinyl leukotrienes on
growth of eosinophil progenitors from peripheral blood and bone marrow of atopic subjects. The
Journal of allergy and clinical immunology 110, 96-101.
Brach, M.A., de Vos, S., Arnold, C., Gruss, H.J., Mertelsmann, R., and Herrmann, F. (1992).
Leukotriene B4 transcriptionally activates interleukin-6 expression involving NK-chi B and NFIL6. European journal of immunology 22, 2705-2711.
Brady, H.R., and Serhan, C.N. (1992). Adhesion promotes transcellular leukotriene biosynthesis
during neutrophil-glomerular endothelial cell interactions: inhibition by antibodies against CD18
and L-selectin. Biochemical and biophysical research communications 186, 1307-1314.
Briaud, S.A., Ding, Z.M., Michael, L.H., Entman, M.L., Daniel, S., and Ballantyne, C.M. (2001).
Leukocyte trafficking and myocardial reperfusion injury in ICAM-1/P-selectin-knockout mice.
American journal of physiology Heart and circulatory physiology 280, H60-67.
Brock, T.G., McNish, R.W., Bailie, M.B., and Peters-Golden, M. (1997). Rapid import of
cytosolic 5-lipoxygenase into the nucleus of neutrophils after in vivo recruitment and in vitro
adherence. The Journal of biological chemistry 272, 8276-8280.
Brocklehurst, W.E. (1960). The release of histamine and formation of a slow-reacting substance
(SRS-A) during anaphylactic shock. The Journal of physiology 151, 416-435.
Buja, L.M. (2005). Myocardial ischemia and reperfusion injury. Cardiovascular pathology : the
official journal of the Society for Cardiovascular Pathology 14, 170-175.
Byrum, R.S., Goulet, J.L., Snouwaert, J.N., Griffiths, R.J., and Koller, B.H. (1999).
Determination of the contribution of cysteinyl leukotrienes and leukotriene B4 in acute
inflammatory responses using 5-lipoxygenase- and leukotriene A4 hydrolase-deficient mice.
Journal of immunology 163, 6810-6819.
Canetti, C., Hu, B., Curtis, J.L., and Peters-Golden, M. (2003). Syk activation is a leukotriene
B4-regulated event involved in macrophage phagocytosis of IgG-coated targets but not apoptotic
cells. Blood 102, 1877-1883.
Capra, V., Ravasi, S., Accomazzo, M.R., Citro, S., Grimoldi, M., Abbracchio, M.P., and Rovati,
G.E. (2005). CysLT1 receptor is a target for extracellular nucleotide-induced heterologous
desensitization: a possible feedback mechanism in inflammation. Journal of cell science 118,
5625-5636.
159
Carden, D.L., and Granger, D.N. (2000). Pathophysiology of ischaemia-reperfusion injury. The
Journal of pathology 190, 255-266.
Carnini, C., Accomazzo, M.R., Borroni, E., Vitellaro-Zuccarello, L., Durand, T., Folco, G.,
Rovati, G.E., Capra, V., and Sala, A. (2011). Synthesis of cysteinyl leukotrienes in human
endothelial cells: subcellular localization and autocrine signaling through the CysLT2 receptor.
FASEB journal : official publication of the Federation of American Societies for Experimental
Biology 25, 3519-3528.
Carry, M., Korley, V., Willerson, J.T., Weigelt, L., Ford-Hutchinson, A.W., and Tagari, P.
(1992). Increased urinary leukotriene excretion in patients with cardiac ischemia. In vivo
evidence for 5-lipoxygenase activation. Circulation 85, 230-236.
Carter, G.W., Young, P.R., Albert, D.H., Bouska, J., Dyer, R., Bell, R.L., Summers, J.B., and
Brooks, D.W. (1991). 5-lipoxygenase inhibitory activity of zileuton. The Journal of
pharmacology and experimental therapeutics 256, 929-937.
Chen, H., Qin, J., Wei, P., Zhang, J., Li, Q., Fu, L., Li, S., Ma, C., and Cong, B. (2009). Effects
of leukotriene B4 and prostaglandin E2 on the differentiation of murine Foxp3+ T regulatory
cells and Th17 cells. Prostaglandins, leukotrienes, and essential fatty acids 80, 195-200.
Chen, L., Grabowski, K.A., Xin, J.P., Coleman, J., Huang, Z., Espiritu, B., Alkan, S., Xie, H.B.,
Zhu, Y., White, F.A., et al. (2004a). IL-4 induces differentiation and expansion of Th2 cytokineproducing eosinophils. Journal of immunology 172, 2059-2066.
Chen, X., Li, N., Wang, S., Wu, N., Hong, J., Jiao, X., Krasna, M.J., Beer, D.G., and Yang, C.S.
(2003). Leukotriene A4 hydrolase in rat and human esophageal adenocarcinomas and inhibitory
effects of bestatin. Journal of the National Cancer Institute 95, 1053-1061.
Chen, X., Wang, S., Wu, N., Sood, S., Wang, P., Jin, Z., Beer, D.G., Giordano, T.J., Lin, Y.,
Shih, W.C., et al. (2004b). Overexpression of 5-lipoxygenase in rat and human esophageal
adenocarcinoma and inhibitory effects of zileuton and celecoxib on carcinogenesis. Clinical
cancer research : an official journal of the American Association for Cancer Research 10, 67036709.
Chen, Z., Siu, B., Ho, Y.S., Vincent, R., Chua, C.C., Hamdy, R.C., and Chua, B.H. (1998).
Overexpression of MnSOD protects against myocardial ischemia/reperfusion injury in transgenic
mice. Journal of molecular and cellular cardiology 30, 2281-2289.
Chibana, K., Ishii, Y., Asakura, T., and Fukuda, T. (2003). Up-regulation of cysteinyl
leukotriene 1 receptor by IL-13 enables human lung fibroblasts to respond to leukotriene C4 and
produce eotaxin. Journal of immunology 170, 4290-4295.
Chong, A.J., Shimamoto, A., Hampton, C.R., Takayama, H., Spring, D.J., Rothnie, C.L., Yada,
M., Pohlman, T.H., and Verrier, E.D. (2004). Toll-like receptor 4 mediates ischemia/reperfusion
injury of the heart. The Journal of thoracic and cardiovascular surgery 128, 170-179.
160
Christie, P.E., Smith, C.M., and Lee, T.H. (1991). The potent and selective sulfidopeptide
leukotriene antagonist, SK&F 104353, inhibits aspirin-induced asthma. The American review of
respiratory disease 144, 957-958.
Christmas, P., Weber, B.M., McKee, M., Brown, D., and Soberman, R.J. (2002). Membrane
localization and topology of leukotriene C4 synthase. The Journal of biological chemistry 277,
28902-28908.
Chung, J.W., Kim, G.Y., Mun, Y.C., Ahn, J.Y., Seong, C.M., and Kim, J.H. (2005). Leukotriene
B4 pathway regulates the fate of the hematopoietic stem cells. Experimental & molecular
medicine 37, 45-50.
Ciana, P., Fumagalli, M., Trincavelli, M.L., Verderio, C., Rosa, P., Lecca, D., Ferrario, S.,
Parravicini, C., Capra, V., Gelosa, P., et al. (2006). The orphan receptor GPR17 identified as a
new dual uracil nucleotides/cysteinyl-leukotrienes receptor. The EMBO journal 25, 4615-4627.
Clark, J.D., Schievella, A.R., Nalefski, E.A., and Lin, L.L. (1995). Cytosolic phospholipase A2.
Journal of lipid mediators and cell signalling 12, 83-117.
Coutts, I.G.C., Edwards, M., and Richards, D.J. (1981). Mild selective hydrolysis of the methyl
esters of some ortho-substituted aromatic carboxylic acids. Synthesis 1981, 487–489.
Covin, R.B., Brock, T.G., Bailie, M.B., and Peters-Golden, M. (1998). Altered expression and
localization of 5-lipoxygenase accompany macrophage differentiation in the lung. The American
journal of physiology 275, L303-310.
Cowburn, A.S., Holgate, S.T., and Sampson, A.P. (1999). IL-5 increases expression of 5lipoxygenase-activating protein and translocates 5-lipoxygenase to the nucleus in human blood
eosinophils. Journal of immunology 163, 456-465.
Dahinden, C.A., Clancy, R.M., Gross, M., Chiller, J.M., and Hugli, T.E. (1985). Leukotriene C4
production by murine mast cells: evidence of a role for extracellular leukotriene A4. Proceedings
of the National Academy of Sciences of the United States of America 82, 6632-6636.
Dahlen, S.E. (2006). Treatment of asthma with antileukotrienes: first line or last resort therapy?
European journal of pharmacology 533, 40-56.
Dahlen, S.E., Bjork, J., Hedqvist, P., Arfors, K.E., Hammarstrom, S., Lindgren, J.A., and
Samuelsson, B. (1981). Leukotrienes promote plasma leakage and leukocyte adhesion in
postcapillary venules: in vivo effects with relevance to the acute inflammatory response.
Proceedings of the National Academy of Sciences of the United States of America 78, 38873891.
Dahlen, S.E., Hedqvist, P., Hammarstrom, S., and Samuelsson, B. (1980). Leukotrienes are
potent constrictors of human bronchi. Nature 288, 484-486.
161
Daniele, S., Lecca, D., Trincavelli, M.L., Ciampi, O., Abbracchio, M.P., and Martini, C. (2010).
Regulation of PC12 cell survival and differentiation by the new P2Y-like receptor GPR17.
Cellular signalling 22, 697-706.
Daniele, S., Trincavelli, M.L., Gabelloni, P., Lecca, D., Rosa, P., Abbracchio, M.P., and Martini,
C. (2011). Agonist-induced desensitization/resensitization of human G protein-coupled receptor
17: a functional cross-talk between purinergic and cysteinyl-leukotriene ligands. The Journal of
pharmacology and experimental therapeutics 338, 559-567.
Datta, Y.H., Romano, M., Jacobson, B.C., Golan, D.E., Serhan, C.N., and Ewenstein, B.M.
(1995). Peptido-leukotrienes are potent agonists of von Willebrand factor secretion and Pselectin surface expression in human umbilical vein endothelial cells. Circulation 92, 3304-3311.
Davidson, A.B., Lee, T.H., Scanlon, P.D., Solway, J., McFadden, E.R., Jr., Ingram, R.H., Jr.,
Corey, E.J., Austen, K.F., and Drazen, J.M. (1987). Bronchoconstrictor effects of leukotriene E4
in normal and asthmatic subjects. The American review of respiratory disease 135, 333-337.
Davies, M.J., Woolf, N., and Robertson, W.B. (1976). Pathology of acute myocardial infarction
with particular reference to occlusive coronary thrombi. British heart journal 38, 659-664.
De Palma, M., Venneri, M.A., Galli, R., Sergi Sergi, L., Politi, L.S., Sampaolesi, M., and
Naldini, L. (2005). Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required
for tumor vessel formation and a mesenchymal population of pericyte progenitors. Cancer cell 8,
211-226.
Demitsu, T., Katayama, H., Saito-Taki, T., Yaoita, H., and Nakano, M. (1989). Phagocytosis and
bactericidal action of mouse peritoneal macrophages treated with leukotriene B4. International
journal of immunopharmacology 11, 801-808.
Di Gennaro, A., Carnini, C., Buccellati, C., Ballerio, R., Zarini, S., Fumagalli, F., Viappiani, S.,
Librizzi, L., Hernandez, A., Murphy, R.C., et al. (2004). Cysteinyl-leukotrienes receptor
activation in brain inflammatory reactions and cerebral edema formation: a role for transcellular
biosynthesis of cysteinyl-leukotrienes. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 18, 842-844.
Di Gennaro, A., Kenne, E., Wan, M., Soehnlein, O., Lindbom, L., and Haeggstrom, J.Z. (2009).
Leukotriene B4-induced changes in vascular permeability are mediated by neutrophil release of
heparin-binding protein (HBP/CAP37/azurocidin). FASEB journal : official publication of the
Federation of American Societies for Experimental Biology 23, 1750-1757.
Di Gennaro, A., Wagsater, D., Mayranpaa, M.I., Gabrielsen, A., Swedenborg, J., Hamsten, A.,
Samuelsson, B., Eriksson, P., and Haeggstrom, J.Z. (2010). Increased expression of leukotriene
C4 synthase and predominant formation of cysteinyl-leukotrienes in human abdominal aortic
aneurysm. Proceedings of the National Academy of Sciences of the United States of America
107, 21093-21097.
Di Lisa, F., and Bernardi, P. (2006). Mitochondria and ischemia-reperfusion injury of the heart:
fixing a hole. Cardiovascular research 70, 191-199.
162
Diamant, Z., Grootendorst, D.C., Veselic-Charvat, M., Timmers, M.C., De Smet, M., Leff, J.A.,
Seidenberg, B.C., Zwinderman, A.H., Peszek, I., and Sterk, P.J. (1999). The effect of
montelukast (MK-0476), a cysteinyl leukotriene receptor antagonist, on allergen-induced airway
responses and sputum cell counts in asthma. Clinical and experimental allergy : journal of the
British Society for Allergy and Clinical Immunology 29, 42-51.
Ding, Q., Fang, S.H., Zhou, Y., Zhang, L.H., Zhang, W.P., Chen, Z., and Wei, E.Q. (2007).
Cysteinyl leukotriene receptor 1 partially mediates brain cryoinjury in mice. Acta
pharmacologica Sinica 28, 945-952.
Ding, X.Z., Talamonti, M.S., Bell, R.H., Jr., and Adrian, T.E. (2005). A novel anti-pancreatic
cancer agent, LY293111. Anti-cancer drugs 16, 467-473.
Dixon, R.A., Diehl, R.E., Opas, E., Rands, E., Vickers, P.J., Evans, J.F., Gillard, J.W., and
Miller, D.K. (1990). Requirement of a 5-lipoxygenase-activating protein for leukotriene
synthesis. Nature 343, 282-284.
Dockhorn, R.J., Baumgartner, R.A., Leff, J.A., Noonan, M., Vandormael, K., Stricker, W.,
Weinland, D.E., and Reiss, T.F. (2000). Comparison of the effects of intravenous and oral
montelukast on airway function: a double blind, placebo controlled, three period, crossover study
in asthmatic patients. Thorax 55, 260-265.
Drazen, J.M., Venugopalan, C.S., Austen, K.F., Brion, F., and Corey, E.J. (1982). Effects of
leukotriene E on pulmonary mechanics in the guinea pig. The American review of respiratory
disease 125, 290-294.
Dwyer, J.H., Allayee, H., Dwyer, K.M., Fan, J., Wu, H., Mar, R., Lusis, A.J., and Mehrabian, M.
(2004). Arachidonate 5-lipoxygenase promoter genotype, dietary arachidonic acid, and
atherosclerosis. The New England journal of medicine 350, 29-37.
Early, S.B., Barekzi, E., Negri, J., Hise, K., Borish, L., and Steinke, J.W. (2007). Concordant
modulation of cysteinyl leukotriene receptor expression by IL-4 and IFN-gamma on peripheral
immune cells. American journal of respiratory cell and molecular biology 36, 715-720.
Eaton, A., Nagy, E., Pacault, M., Fauconnier, J., and Back, M. (2012). Cysteinyl leukotriene
signaling through perinuclear CysLT(1) receptors on vascular smooth muscle cells transduces
nuclear calcium signaling and alterations of gene expression. Journal of molecular medicine 90,
1223-1231.
Edenius, C., Heidvall, K., and Lindgren, J.A. (1988). Novel transcellular interaction: conversion
of granulocyte-derived leukotriene A4 to cysteinyl-containing leukotrienes by human platelets.
European journal of biochemistry / FEBS 178, 81-86.
Eguchi, M., Kim, Y.H., Kang, K.W., Shim, C.Y., Jang, Y., Dorval, T., Kim, K.J., and Sweeney,
G. (2012). Ischemia-reperfusion injury leads to distinct temporal cardiac remodeling in normal
versus diabetic mice. PloS one 7, e30450.
163
Eming, S.A., Krieg, T., and Davidson, J.M. (2007). Inflammation in wound repair: molecular
and cellular mechanisms. The Journal of investigative dermatology 127, 514-525.
Entman, M.L., Youker, K., Shoji, T., Kukielka, G., Shappell, S.B., Taylor, A.A., and Smith,
C.W. (1992). Neutrophil induced oxidative injury of cardiac myocytes. A compartmented system
requiring CD11b/CD18-ICAM-1 adherence. The Journal of clinical investigation 90, 1335-1345.
Espinosa, K., Bosse, Y., Stankova, J., and Rola-Pleszczynski, M. (2003). CysLT1 receptor
upregulation by TGF-beta and IL-13 is associated with bronchial smooth muscle cell
proliferation in response to LTD4. The Journal of allergy and clinical immunology 111, 10321040.
Evans, J.F. (2003). The cysteinyl leukotriene receptors. Prostaglandins, leukotrienes, and
essential fatty acids 69, 117-122.
Fabre, J.E., Goulet, J.L., Riche, E., Nguyen, M., Coggins, K., Offenbacher, S., and Koller, B.H.
(2002). Transcellular biosynthesis contributes to the production of leukotrienes during
inflammatory responses in vivo. The Journal of clinical investigation 109, 1373-1380.
Faith, A., Fernandez, M.H., Caulfield, J., Loke, T.K., Corrigan, C., O'Connor, B., Lee, T.H., and
Hawrylowicz, C.M. (2008). Role of cysteinyl leukotrienes in human allergen-specific Th2
responses induced by granulocyte macrophage-colony stimulating factor. Allergy 63, 168-175.
Fang, S.H., Wei, E.Q., Zhou, Y., Wang, M.L., Zhang, W.P., Yu, G.L., Chu, L.S., and Chen, Z.
(2006). Increased expression of cysteinyl leukotriene receptor-1 in the brain mediates neuronal
damage and astrogliosis after focal cerebral ischemia in rats. Neuroscience 140, 969-979.
Fang, S.H., Zhou, Y., Chu, L.S., Zhang, W.P., Wang, M.L., Yu, G.L., Peng, F., and Wei, E.Q.
(2007). Spatio-temporal expression of cysteinyl leukotriene receptor-2 mRNA in rat brain after
focal cerebral ischemia. Neuroscience letters 412, 78-83.
Fegn, L., and Wang, Z. (2009). Topical chemoprevention of skin cancer in mice, using combined
inhibitors of 5-lipoxygenase and cyclo-oxygenase-2. The Journal of laryngology and otology
123, 880-884.
Feinmark, S.J., and Cannon, P.J. (1986). Endothelial cell leukotriene C4 synthesis results from
intercellular transfer of leukotriene A4 synthesized by polymorphonuclear leukocytes. The
Journal of biological chemistry 261, 16466-16472.
Feldberg, W., Holden, H.F., and Kellaway, C.H. (1938). The formation of lysocithin and of a
muscle-stimulating substance by snake venoms. The Journal of physiology 94, 232-248.
Figueroa, D.J., Borish, L., Baramki, D., Philip, G., Austin, C.P., and Evans, J.F. (2003).
Expression of cysteinyl leukotriene synthetic and signalling proteins in inflammatory cells in
active seasonal allergic rhinitis. Clinical and experimental allergy : journal of the British Society
for Allergy and Clinical Immunology 33, 1380-1388.
164
Figueroa, D.J., Breyer, R.M., Defoe, S.K., Kargman, S., Daugherty, B.L., Waldburger, K., Liu,
Q., Clements, M., Zeng, Z., O'Neill, G.P., et al. (2001). Expression of the cysteinyl leukotriene 1
receptor in normal human lung and peripheral blood leukocytes. American journal of respiratory
and critical care medicine 163, 226-233.
Fischer, A.R., Rosenberg, M.A., Lilly, C.M., Callery, J.C., Rubin, P., Cohn, J., White, M.V.,
Igarashi, Y., Kaliner, M.A., Drazen, J.M., et al. (1994). Direct evidence for a role of the mast cell
in the nasal response to aspirin in aspirin-sensitive asthma. The Journal of allergy and clinical
immunology 94, 1046-1056.
Fitzpatrick, F., Liggett, W., McGee, J., Bunting, S., Morton, D., and Samuelsson, B. (1984).
Metabolism of leukotriene A4 by human erythrocytes. A novel cellular source of leukotriene B4.
The Journal of biological chemistry 259, 11403-11407.
Flamand, L., Tremblay, M.J., and Borgeat, P. (2007a). Leukotriene B4 triggers the in vitro and in
vivo release of potent antimicrobial agents. Journal of immunology 178, 8036-8045.
Flamand, N., Lefebvre, J., Surette, M.E., Picard, S., and Borgeat, P. (2006). Arachidonic acid
regulates the translocation of 5-lipoxygenase to the nuclear membranes in human neutrophils.
The Journal of biological chemistry 281, 129-136.
Flamand, N., Mancuso, P., Serezani, C.H., and Brock, T.G. (2007b). Leukotrienes: mediators
that have been typecast as villains. Cellular and molecular life sciences : CMLS 64, 2657-2670.
Folco, G., and Murphy, R.C. (2006). Eicosanoid transcellular biosynthesis: from cell-cell
interactions to in vivo tissue responses. Pharmacological reviews 58, 375-388.
Ford-Hutchinson, A.W., Bray, M.A., Doig, M.V., Shipley, M.E., and Smith, M.J. (1980).
Leukotriene B, a potent chemokinetic and aggregating substance released from
polymorphonuclear leukocytes. Nature 286, 264-265.
Foster, H.R., Fuerst, E., Lee, T.H., Cousins, D.J., and Woszczek, G. (2013). Characterisation of
P2Y(12) receptor responsiveness to cysteinyl leukotrienes. PloS one 8, e58305.
Fradin, A., Zirrolli, J.A., Maclouf, J., Vausbinder, L., Henson, P.M., and Murphy, R.C. (1989).
Platelet-activating factor and leukotriene biosynthesis in whole blood. A model for the study of
transcellular arachidonate metabolism. Journal of immunology 143, 3680-3685.
Frangogiannis, N.G. (2012). Regulation of the inflammatory response in cardiac repair.
Circulation research 110, 159-173.
Frangogiannis, N.G., Smith, C.W., and Entman, M.L. (2002). The inflammatory response in
myocardial infarction. Cardiovascular research 53, 31-47.
Frantz, S., Hofmann, U., Fraccarollo, D., Schafer, A., Kranepuhl, S., Hagedorn, I., Nieswandt,
B., Nahrendorf, M., Wagner, H., Bayer, B., et al. (2013). Monocytes/macrophages prevent
healing defects and left ventricular thrombus formation after myocardial infarction. FASEB
165
journal : official publication of the Federation of American Societies for Experimental Biology
27, 871-881.
Fregonese, L., Silvestri, M., Sabatini, F., and Rossi, G.A. (2002). Cysteinyl leukotrienes induce
human eosinophil locomotion and adhesion molecule expression via a CysLT1 receptormediated mechanism. Clinical and experimental allergy : journal of the British Society for
Allergy and Clinical Immunology 32, 745-750.
Freiberg, J.J., Dahl, M., Tybjaerg-Hansen, A., Grande, P., and Nordestgaard, B.G. (2009).
Leukotriene C4 synthase and ischemic cardiovascular disease and obstructive pulmonary disease
in 13,000 individuals. Journal of molecular and cellular cardiology 46, 579-586.
Frey, N., Katus, H.A., Olson, E.N., and Hill, J.A. (2004). Hypertrophy of the heart: a new
therapeutic target? Circulation 109, 1580-1589.
Friedrich, E.B., Tager, A.M., Liu, E., Pettersson, A., Owman, C., Munn, L., Luster, A.D., and
Gerszten, R.E. (2003). Mechanisms of leukotriene B4--triggered monocyte adhesion.
Arteriosclerosis, thrombosis, and vascular biology 23, 1761-1767.
Frieri, M., Therattil, J., Wang, S.F., Huang, C.Y., and Wang, Y.C. (2003). Montelukast inhibits
interleukin-5 mRNA expression and cysteinyl leukotriene production in ragweed and mitestimulated peripheral blood mononuclear cells from patients with asthma. Allergy and asthma
proceedings : the official journal of regional and state allergy societies 24, 359-366.
Funk, C.D. (2001). Prostaglandins and leukotrienes: advances in eicosanoid biology. Science
294, 1871-1875.
Funk, C.D. (2005). Leukotriene modifiers as potential therapeutics for cardiovascular disease.
Nature reviews Drug discovery 4, 664-672.
Funk, C.D., Chen, X.S., Kurre, U., and Griffis, G. (1995). Leukotriene-deficient mice generated
by targeted disruption of the 5-lipoxygenase gene. Advances in prostaglandin, thromboxane, and
leukotriene research 23, 145-150.
Gaddy, J.N., Margolskee, D.J., Bush, R.K., Williams, V.C., and Busse, W.W. (1992).
Bronchodilation with a potent and selective leukotriene D4 (LTD4) receptor antagonist (MK571) in patients with asthma. The American review of respiratory disease 146, 358-363.
Gauvreau, G.M., Parameswaran, K.N., Watson, R.M., and O'Byrne, P.M. (2001). Inhaled
leukotriene E(4), but not leukotriene D(4), increased airway inflammatory cells in subjects with
atopic asthma. American journal of respiratory and critical care medicine 164, 1495-1500.
Ge, S., Zhou, G., Cheng, S., Liu, D., Xu, J., Xu, G., and Liu, X. (2009). Anti-atherogenic effects
of montelukast associated with reduced MCP-1 expression in a rabbit carotid balloon injury
model. Atherosclerosis 205, 74-79.
166
Gimbrone, M.A., Jr., Brock, A.F., and Schafer, A.I. (1984). Leukotriene B4 stimulates
polymorphonuclear leukocyte adhesion to cultured vascular endothelial cells. The Journal of
clinical investigation 74, 1552-1555.
Glover, S., de Carvalho, M.S., Bayburt, T., Jonas, M., Chi, E., Leslie, C.C., and Gelb, M.H.
(1995). Translocation of the 85-kDa phospholipase A2 from cytosol to the nuclear envelope in
rat basophilic leukemia cells stimulated with calcium ionophore or IgE/antigen. The Journal of
biological chemistry 270, 15359-15367.
Gonsalves, C.S., and Kalra, V.K. (2010). Hypoxia-mediated expression of 5-lipoxygenaseactivating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p.
Journal of immunology 184, 3878-3888.
Goodarzi, K., Goodarzi, M., Tager, A.M., Luster, A.D., and von Andrian, U.H. (2003).
Leukotriene B4 and BLT1 control cytotoxic effector T cell recruitment to inflamed tissues.
Nature immunology 4, 965-973.
Graham, I., Atar, D., Borch-Johnsen, K., Boysen, G., Burell, G., Cifkova, R., Dallongeville, J.,
De Backer, G., Ebrahim, S., Gjelsvik, B., et al. (2007). European guidelines on cardiovascular
disease prevention in clinical practice: executive summary: Fourth Joint Task Force of the
European Society of Cardiology and Other Societies on Cardiovascular Disease Prevention in
Clinical Practice (Constituted by representatives of nine societies and by invited experts).
European heart journal 28, 2375-2414.
Grimminger, F., Kreusler, B., Schneider, U., Becker, G., and Seeger, W. (1990). Influence of
microvascular adherence on neutrophil leukotriene generation. Evidence for cooperative
eicosanoid synthesis. Journal of immunology 144, 1866-1872.
Grimminger, F., Menger, M., Becker, G., and Seeger, W. (1988). Potentiation of leukotriene
production following sequestration of neutrophils in isolated lungs: indirect evidence for
intercellular leukotriene A4 transfer. Blood 72, 1687-1692.
Grimminger, F., Sibelius, U., and Seeger, W. (1991). Amplification of LTB4 generation in AMPMN cocultures: transcellular 5-lipoxygenase metabolism. The American journal of physiology
261, L195-203.
Gronert, K., Martinsson-Niskanen, T., Ravasi, S., Chiang, N., and Serhan, C.N. (2001).
Selectivity of recombinant human leukotriene D(4), leukotriene B(4), and lipoxin A(4) receptors
with aspirin-triggered 15-epi-LXA(4) and regulation of vascular and inflammatory responses.
The American journal of pathology 158, 3-9.
Gunning, W.T., Kramer, P.M., Steele, V.E., and Pereira, M.A. (2002). Chemoprevention by
lipoxygenase and leukotriene pathway inhibitors of vinyl carbamate-induced lung tumors in
mice. Cancer research 62, 4199-4201.
Haeggstrom, J.Z. (2004). Leukotriene A4 hydrolase/aminopeptidase, the gatekeeper of
chemotactic leukotriene B4 biosynthesis. The Journal of biological chemistry 279, 50639-50642.
167
Haeggstrom, J.Z., and Funk, C.D. (2011). Lipoxygenase and leukotriene pathways:
biochemistry, biology, and roles in disease. Chemical reviews 111, 5866-5898.
Hafstrom, I., Palmblad, J., Malmsten, C.L., Radmark, O., and Samuelsson, B. (1981).
Leukotriene B4--a stereospecific stimulator for release of lysosomal enzymes from neutrophils.
FEBS letters 130, 146-148.
Hahn, R.A., MacDonald, B.R., Morgan, E., Potts, B.D., Parli, C.J., Rinkema, L.E., Whitesitt,
C.A., and Marshall, W.S. (1992). Evaluation of LY203647 on cardiovascular leukotriene D4
receptors and myocardial reperfusion injury. The Journal of pharmacology and experimental
therapeutics 260, 979-989.
Halestrap, A.P., Clarke, S.J., and Javadov, S.A. (2004). Mitochondrial permeability transition
pore opening during myocardial reperfusion--a target for cardioprotection. Cardiovascular
research 61, 372-385.
Harada, K., Sugaya, T., Murakami, K., Yazaki, Y., and Komuro, I. (1999). Angiotensin II type
1A receptor knockout mice display less left ventricular remodeling and improved survival after
myocardial infarction. Circulation 100, 2093-2099.
Harter, M., Erguden, J., Wunder, F., Tinel, H., Kobberling, J., Becker, E.M., Munter, K.,
Schlemmer, K.H., Kast, R., Kolkhof, P., et al. (2009). Isophthalic acid derivatives (United
States: Bayer Healthcare AG).
Hasegawa, S., Ichiyama, T., Hashimoto, K., Suzuki, Y., Hirano, R., Fukano, R., and Furukawa,
S. (2010). Functional expression of cysteinyl leukotriene receptors on human platelets. Platelets
21, 253-259.
Hashimoto, H., Miyazawa, K., Hagiwara, M., Miyasaka, K., and Nakashima, M. (1990).
Beneficial effects of a new 5-lipoxygenase inhibitor on occlusion- and occlusion-reperfusioninduced myocardial injury. Arzneimittel-Forschung 40, 126-129.
Hashimoto, K., Ichiyama, T., Hasegawa, M., Hasegawa, S., Matsubara, T., and Furukawa, S.
(2009). Cysteinyl leukotrienes induce monocyte chemoattractant protein-1 in human
monocyte/macrophages via mitogen-activated protein kinase and nuclear factor-kappaB
pathways. International archives of allergy and immunology 149, 275-282.
He, W., Miao, F.J., Lin, D.C., Schwandner, R.T., Wang, Z., Gao, J., Chen, J.L., Tian, H., and
Ling, L. (2004). Citric acid cycle intermediates as ligands for orphan G-protein-coupled
receptors. Nature 429, 188-193.
Hebert, M.J., Takano, T., Holthofer, H., and Brady, H.R. (1996). Sequential morphologic events
during apoptosis of human neutrophils. Modulation by lipoxygenase-derived eicosanoids.
Journal of immunology 157, 3105-3115.
Heidenreich, P.A., Trogdon, J.G., Khavjou, O.A., Butler, J., Dracup, K., Ezekowitz, M.D.,
Finkelstein, E.A., Hong, Y., Johnston, S.C., Khera, A., et al. (2011). Forecasting the future of
168
cardiovascular disease in the United States: a policy statement from the American Heart
Association. Circulation 123, 933-944.
Heise, C.E., O'Dowd, B.F., Figueroa, D.J., Sawyer, N., Nguyen, T., Im, D.S., Stocco, R.,
Bellefeuille, J.N., Abramovitz, M., Cheng, R., et al. (2000). Characterization of the human
cysteinyl leukotriene 2 receptor. The Journal of biological chemistry 275, 30531-30536.
Helgadottir, A., Gretarsdottir, S., St Clair, D., Manolescu, A., Cheung, J., Thorleifsson, G.,
Pasdar, A., Grant, S.F., Whalley, L.J., Hakonarson, H., et al. (2005). Association between the
gene encoding 5-lipoxygenase-activating protein and stroke replicated in a Scottish population.
American journal of human genetics 76, 505-509.
Helgadottir, A., Manolescu, A., Helgason, A., Thorleifsson, G., Thorsteinsdottir, U.,
Gudbjartsson, D.F., Gretarsdottir, S., Magnusson, K.P., Gudmundsson, G., Hicks, A., et al.
(2006). A variant of the gene encoding leukotriene A4 hydrolase confers ethnicity-specific risk
of myocardial infarction. Nature genetics 38, 68-74.
Helgadottir, A., Manolescu, A., Thorleifsson, G., Gretarsdottir, S., Jonsdottir, H.,
Thorsteinsdottir, U., Samani, N.J., Gudmundsson, G., Grant, S.F., Thorgeirsson, G., et al.
(2004). The gene encoding 5-lipoxygenase activating protein confers risk of myocardial
infarction and stroke. Nature genetics 36, 233-239.
Henderson, W.R., Jr., Tang, L.O., Chu, S.J., Tsao, S.M., Chiang, G.K., Jones, F., Jonas, M., Pae,
C., Wang, H., and Chi, E.Y. (2002). A role for cysteinyl leukotrienes in airway remodeling in a
mouse asthma model. American journal of respiratory and critical care medicine 165, 108-116.
Hennig, R., Ventura, J., Segersvard, R., Ward, E., Ding, X.Z., Rao, S.M., Jovanovic, B.D.,
Iwamura, T., Talamonti, M.S., Bell, R.H., Jr., et al. (2005). LY293111 improves efficacy of
gemcitabine therapy on pancreatic cancer in a fluorescent orthotopic model in athymic mice.
Neoplasia 7, 417-425.
Hernandez, L.A., Grisham, M.B., Twohig, B., Arfors, K.E., Harlan, J.M., and Granger, D.N.
(1987). Role of neutrophils in ischemia-reperfusion-induced microvascular injury. The American
journal of physiology 253, H699-703.
Heymans, S., Luttun, A., Nuyens, D., Theilmeier, G., Creemers, E., Moons, L., Dyspersin, G.D.,
Cleutjens, J.P., Shipley, M., Angellilo, A., et al. (1999). Inhibition of plasminogen activators or
matrix metalloproteinases prevents cardiac rupture but impairs therapeutic angiogenesis and
causes cardiac failure. Nature medicine 5, 1135-1142.
Hirabayashi, T., Murayama, T., and Shimizu, T. (2004). Regulatory mechanism and
physiological role of cytosolic phospholipase A2. Biological & pharmaceutical bulletin 27,
1168-1173.
Hock, C.E., Beck, L.D., and Papa, L.A. (1992). Peptide leukotriene receptor antagonism in
myocardial ischaemia and reperfusion. Cardiovascular research 26, 1206-1211.
169
Hofmann, U., Beyersdorf, N., Weirather, J., Podolskaya, A., Bauersachs, J., Ertl, G., Kerkau, T.,
and Frantz, S. (2012). Activation of CD4+ T lymphocytes improves wound healing and survival
after experimental myocardial infarction in mice. Circulation 125, 1652-1663.
Horrillo, R., Gonzalez-Periz, A., Martinez-Clemente, M., Lopez-Parra, M., Ferre, N., Titos, E.,
Moran-Salvador, E., Deulofeu, R., Arroyo, V., and Claria, J. (2010). 5-lipoxygenase activating
protein signals adipose tissue inflammation and lipid dysfunction in experimental obesity.
Journal of immunology 184, 3978-3987.
Hoshino, M., Izumi, T., and Shimizu, T. (1998). Leukotriene D4 activates mitogen-activated
protein kinase through a protein kinase Calpha-Raf-1-dependent pathway in human monocytic
leukemia THP-1 cells. The Journal of biological chemistry 273, 4878-4882.
Huang, H., Zeng, Z., Li, J., Zhang, L., and Chen, Y. (2010). Variants of arachidonate 5lipoxygenase-activating protein (ALOX5AP) gene and risk of coronary heart disease: A metaanalysis. Archives of medical research 41, 634-641.
Huang, L., Zhao, A., Wong, F., Ayala, J.M., Struthers, M., Ujjainwalla, F., Wright, S.D.,
Springer, M.S., Evans, J., and Cui, J. (2004). Leukotriene B4 strongly increases monocyte
chemoattractant protein-1 in human monocytes. Arteriosclerosis, thrombosis, and vascular
biology 24, 1783-1788.
Huang, W.W., Garcia-Zepeda, E.A., Sauty, A., Oettgen, H.C., Rothenberg, M.E., and Luster,
A.D. (1998). Molecular and biological characterization of the murine leukotriene B4 receptor
expressed on eosinophils. The Journal of experimental medicine 188, 1063-1074.
Huang, X.J., Zhang, W.P., Li, C.T., Shi, W.Z., Fang, S.H., Lu, Y.B., Chen, Z., and Wei, E.Q.
(2008). Activation of CysLT receptors induces astrocyte proliferation and death after oxygenglucose deprivation. Glia 56, 27-37.
Hui, Y., Cheng, Y., Smalera, I., Jian, W., Goldhahn, L., Fitzgerald, G.A., and Funk, C.D. (2004).
Directed vascular expression of human cysteinyl leukotriene 2 receptor modulates endothelial
permeability and systemic blood pressure. Circulation 110, 3360-3366.
Hui, Y., Yang, G., Galczenski, H., Figueroa, D.J., Austin, C.P., Copeland, N.G., Gilbert, D.J.,
Jenkins, N.A., and Funk, C.D. (2001). The murine cysteinyl leukotriene 2 (CysLT2) receptor.
cDNA and genomic cloning, alternative splicing, and in vitro characterization. The Journal of
biological chemistry 276, 47489-47495.
Ichiyama, T., Hasegawa, M., Hashimoto, K., Matsushige, T., Hirano, R., and Furukawa, S.
(2009). Cysteinyl leukotrienes induce macrophage inflammatory protein-1 in human
monocytes/macrophages. International archives of allergy and immunology 148, 147-153.
Ichiyama, T., Hasegawa, M., Ueno, Y., Makata, H., Matsubara, T., and Furukawa, S. (2005).
Cysteinyl leukotrienes induce monocyte chemoattractant protein 1 in human
monocytes/macrophages. Clinical and experimental allergy : journal of the British Society for
Allergy and Clinical Immunology 35, 1214-1219.
170
Ihara, A., Wada, K., Yoneda, M., Fujisawa, N., Takahashi, H., and Nakajima, A. (2007).
Blockade of leukotriene B4 signaling pathway induces apoptosis and suppresses cell
proliferation in colon cancer. Journal of pharmacological sciences 103, 24-32.
Islam, S.A., Thomas, S.Y., Hess, C., Medoff, B.D., Means, T.K., Brander, C., Lilly, C.M., Tager,
A.M., and Luster, A.D. (2006). The leukotriene B4 lipid chemoattractant receptor BLT1 defines
antigen-primed T cells in humans. Blood 107, 444-453.
Israel, E., Cohn, J., Dube, L., and Drazen, J.M. (1996). Effect of treatment with zileuton, a 5lipoxygenase inhibitor, in patients with asthma. A randomized controlled trial. Zileuton Clinical
Trial Group. JAMA : the journal of the American Medical Association 275, 931-936.
Ito, T., Toki, Y., Hieda, N., Okumura, K., Hashimoto, H., Ogawa, K., and Satake, T. (1989).
Protective effects of a thromboxane synthetase inhibitor, a thromboxane antagonist, a
lipoxygenase inhibitor and a leukotriene C4, D4 antagonist on myocardial injury caused by acute
myocardial infarction in the canine heart. Japanese circulation journal 53, 1115-1121.
Iversen, L., Kristensen, P., Gron, B., Ziboh, V.A., and Kragballe, K. (1994). Human epidermis
transforms exogenous leukotriene A4 into peptide leukotrienes: possible role in transcellular
metabolism. Archives of dermatological research 286, 261-266.
Jawien, J., Gajda, M., Wolkow, P., Zuranska, J., Olszanecki, R., and Korbut, R. (2008). The
effect of montelukast on atherogenesis in apoE/LDLR-double knockout mice. Journal of
physiology and pharmacology : an official journal of the Polish Physiological Society 59, 633639.
Jeong, C.H., Bode, A.M., Pugliese, A., Cho, Y.Y., Kim, H.G., Shim, J.H., Jeon, Y.J., Li, H.,
Jiang, H., and Dong, Z. (2009). [6]-Gingerol suppresses colon cancer growth by targeting
leukotriene A4 hydrolase. Cancer research 69, 5584-5591.
Jiang, W., Hall, S.R., Moos, M.P., Cao, R.Y., Ishii, S., Ogunyankin, K.O., Melo, L.G., and Funk,
C.D. (2008). Endothelial cysteinyl leukotriene 2 receptor expression mediates myocardial
ischemia-reperfusion injury. The American journal of pathology 172, 592-602.
Jiang, Y., Borrelli, L.A., Kanaoka, Y., Bacskai, B.J., and Boyce, J.A. (2007). CysLT2 receptors
interact with CysLT1 receptors and down-modulate cysteinyl leukotriene dependent mitogenic
responses of mast cells. Blood 110, 3263-3270.
Jiang, Y., Kanaoka, Y., Feng, C., Nocka, K., Rao, S., and Boyce, J.A. (2006). Cutting edge:
Interleukin 4-dependent mast cell proliferation requires autocrine/intracrine cysteinyl
leukotriene-induced signaling. Journal of immunology 177, 2755-2759.
Jolly, S.R., Kane, W.J., Bailie, M.B., Abrams, G.D., and Lucchesi, B.R. (1984). Canine
myocardial reperfusion injury. Its reduction by the combined administration of superoxide
dismutase and catalase. Circulation research 54, 277-285.
Jones, T.R., Labelle, M., Belley, M., Champion, E., Charette, L., Evans, J., Ford-Hutchinson,
A.W., Gauthier, J.Y., Lord, A., Masson, P., et al. (1995). Pharmacology of montelukast sodium
171
(Singulair), a potent and selective leukotriene D4 receptor antagonist. Canadian journal of
physiology and pharmacology 73, 191-201.
Jung, K., Kim, P., Leuschner, F., Gorbatov, R., Kim, J.K., Ueno, T., Nahrendorf, M., and Yun,
S.H. (2013). Endoscopic time-lapse imaging of immune cells in infarcted mouse hearts.
Circulation research 112, 891-899.
Jung, U., and Ley, K. (1999). Mice lacking two or all three selectins demonstrate overlapping
and distinct functions for each selectin. Journal of immunology 162, 6755-6762.
Jung, U., Norman, K.E., Scharffetter-Kochanek, K., Beaudet, A.L., and Ley, K. (1998). Transit
time of leukocytes rolling through venules controls cytokine-induced inflammatory cell
recruitment in vivo. The Journal of clinical investigation 102, 1526-1533.
Kaetsu, Y., Yamamoto, Y., Sugihara, S., Matsuura, T., Igawa, G., Matsubara, K., Igawa, O.,
Shigemasa, C., and Hisatome, I. (2007). Role of cysteinyl leukotrienes in the proliferation and
the migration of murine vascular smooth muscle cells in vivo and in vitro. Cardiovascular
research 76, 160-166.
Kamohara, M., Takasaki, J., Matsumoto, M., Matsumoto, S., Saito, T., Soga, T., Matsushime, H.,
and Furuichi, K. (2001). Functional characterization of cysteinyl leukotriene CysLT(2) receptor
on human coronary artery smooth muscle cells. Biochemical and biophysical research
communications 287, 1088-1092.
Kanaoka, Y., Maekawa, A., and Austen, K.F. (2013). Identification of GPR99 Protein as a
Potential Third Cysteinyl Leukotriene Receptor with a Preference for Leukotriene E4 Ligand.
The Journal of biological chemistry 288, 10967-10972.
Kanaoka, Y., Maekawa, A., Penrose, J.F., Austen, K.F., and Lam, B.K. (2001). Attenuated
zymosan-induced peritoneal vascular permeability and IgE-dependent passive cutaneous
anaphylaxis in mice lacking leukotriene C4 synthase. The Journal of biological chemistry 276,
22608-22613.
Kato, Y., Fujisawa, T., Nishimori, H., Katsumata, H., Atsuta, J., Iguchi, K., and Kamiya, H.
(2005). Leukotriene D4 induces production of transforming growth factor-beta1 by eosinophils.
International archives of allergy and immunology 137 Suppl 1, 17-20.
Katsuki, H., and Okuda, S. (1995). Arachidonic acid as a neurotoxic and neurotrophic substance.
Progress in neurobiology 46, 607-636.
Kellaway, C.H., and Trethewie, E.R. (1940). The liberation of a slow-reacting smooth musclestimulating substance in anaphylaxis. Experimental Physiology 30, 121-145.
Kempf, T., Zarbock, A., Vestweber, D., and Wollert, K.C. (2012). Anti-inflammatory
mechanisms and therapeutic opportunities in myocardial infarct healing. Journal of molecular
medicine 90, 361-369.
172
Kim, G.Y., Lee, J.W., Cho, S.H., Seo, J.M., and Kim, J.H. (2009). Role of the low-affinity
leukotriene B4 receptor BLT2 in VEGF-induced angiogenesis. Arteriosclerosis, thrombosis, and
vascular biology 29, 915-920.
Kim, M.H., Lee, Y.J., Kim, M.O., Kim, J.S., and Han, H.J. (2010). Effect of leukotriene D4 on
mouse embryonic stem cell migration and proliferation: involvement of PI3K/Akt as well as
GSK-3beta/beta-catenin signaling pathways. Journal of cellular biochemistry 111, 686-698.
Kiwamoto, T., Ishii, Y., Morishima, Y., Yoh, K., Kikuchi, N., Haraguchi, N., Masuko, H.,
Kawaguchi, M., Nomura, A., Sakamoto, T., et al. (2011). Blockade of cysteinyl leukotriene-1
receptors suppresses airway remodelling in mice overexpressing GATA-3. Clinical and
experimental allergy : journal of the British Society for Allergy and Clinical Immunology 41,
116-128.
Kjeldsen, L., Bjerrum, O.W., Askaa, J., and Borregaard, N. (1992). Subcellular localization and
release of human neutrophil gelatinase, confirming the existence of separate gelatinasecontaining granules. The Biochemical journal 287 ( Pt 2), 603-610.
Kleikers, P.W., Wingler, K., Hermans, J.J., Diebold, I., Altenhofer, S., Radermacher, K.A.,
Janssen, B., Gorlach, A., and Schmidt, H.H. (2012). NADPH oxidases as a source of oxidative
stress and molecular target in ischemia/reperfusion injury. Journal of molecular medicine 90,
1391-1406.
Kloner, R.A., and Jennings, R.B. (2001). Consequences of brief ischemia: stunning,
preconditioning, and their clinical implications: part 1. Circulation 104, 2981-2989.
Kolaczkowska, E., and Kubes, P. (2013). Neutrophil recruitment and function in health and
inflammation. Nature reviews Immunology 13, 159-175.
Kostulas, K., Gretarsdottir, S., Kostulas, V., Manolescu, A., Helgadottir, A., Thorleifsson, G.,
Gudmundsson, L.J., Thorsteinsdottir, U., Gulcher, J.R., Stefansson, K., et al. (2007). PDE4D and
ALOX5AP genetic variants and risk for Ischemic Cerebrovascular Disease in Sweden. Journal of
the neurological sciences 263, 113-117.
Krell, R.D., Aharony, D., Buckner, C.K., Keith, R.A., Kusner, E.J., Snyder, D.W., Bernstein,
P.R., Matassa, V.G., Yee, Y.K., Brown, F.J., et al. (1990). The preclinical pharmacology of ICI
204,219. A peptide leukotriene antagonist. The American review of respiratory disease 141, 978987.
Kruh, G.D., and Belinsky, M.G. (2003). The MRP family of drug efflux pumps. Oncogene 22,
7537-7552.
Kubes, P., Suzuki, M., and Granger, D.N. (1991). Nitric oxide: an endogenous modulator of
leukocyte adhesion. Proceedings of the National Academy of Sciences of the United States of
America 88, 4651-4655.
Kumar, A.G., Ballantyne, C.M., Michael, L.H., Kukielka, G.L., Youker, K.A., Lindsey, M.L.,
Hawkins, H.K., Birdsall, H.H., MacKay, C.R., LaRosa, G.J., et al. (1997). Induction of
173
monocyte chemoattractant protein-1 in the small veins of the ischemic and reperfused canine
myocardium. Circulation 95, 693-700.
Kunkel, E.J., and Ley, K. (1996). Distinct phenotype of E-selectin-deficient mice. E-selectin is
required for slow leukocyte rolling in vivo. Circulation research 79, 1196-1204.
Ladilov, Y.V., Siegmund, B., and Piper, H.M. (1995). Protection of reoxygenated
cardiomyocytes against hypercontracture by inhibition of Na+/H+ exchange. The American
journal of physiology 268, H1531-1539.
Lam, B.K., Penrose, J.F., Xu, K., and Austen, K.F. (1995). Leukotriene C4 synthase. Journal of
lipid mediators and cell signalling 12, 333-341.
Lamoureux, J., Stankova, J., and Rola-Pleszczynski, M. (2006). Leukotriene D4 enhances
immunoglobulin production in CD40-activated human B lymphocytes. The Journal of allergy
and clinical immunology 117, 924-930.
Larre, S., Tran, N., Fan, C., Hamadeh, H., Champigneulles, J., Azzouzi, R., Cussenot, O.,
Mangin, P., and Olivier, J.L. (2008). PGE2 and LTB4 tissue levels in benign and cancerous
prostates. Prostaglandins & other lipid mediators 87, 14-19.
Lee, E., Robertson, T., Smith, J., and Kilfeather, S. (2000). Leukotriene receptor antagonists and
synthesis inhibitors reverse survival in eosinophils of asthmatic individuals. American journal of
respiratory and critical care medicine 161, 1881-1886.
Lee, J.D., Lee, T.H., Huang, Y.C., Chang, Y.J., Chang, C.H., Hsu, H.L., Lin, Y.H., Wu, C.Y.,
Lee, M., Huang, Y.C., et al. (2011). ALOX5AP genetic variants and risk of atherothrombotic
stroke in the Taiwanese population. Journal of clinical neuroscience : official journal of the
Neurosurgical Society of Australasia 18, 1634-1638.
Lee, K.S., Kim, S.R., Park, H.S., Park, S.J., Min, K.H., Lee, K.Y., Jin, S.M., and Lee, Y.C.
(2007). Cysteinyl leukotriene upregulates IL-11 expression in allergic airway disease of mice.
The Journal of allergy and clinical immunology 119, 141-149.
Lee, T.H., Austen, K.F., Corey, E.J., and Drazen, J.M. (1984). Leukotriene E4-induced airway
hyperresponsiveness of guinea pig tracheal smooth muscle to histamine and evidence for three
separate sulfidopeptide leukotriene receptors. Proceedings of the National Academy of Sciences
of the United States of America 81, 4922-4925.
Leier, I., Jedlitschky, G., Buchholz, U., Cole, S.P., Deeley, R.G., and Keppler, D. (1994). The
MRP gene encodes an ATP-dependent export pump for leukotriene C4 and structurally related
conjugates. The Journal of biological chemistry 269, 27807-27810.
Leikauf, G.D., Claesson, H.E., Doupnik, C.A., Hybbinette, S., and Grafstrom, R.C. (1990).
Cysteinyl leukotrienes enhance growth of human airway epithelial cells. The American journal
of physiology 259, L255-261.
174
Lemaitre, R.N., Rice, K., Marciante, K., Bis, J.C., Lumley, T.S., Wiggins, K.L., Smith, N.L.,
Heckbert, S.R., and Psaty, B.M. (2009). Variation in eicosanoid genes, non-fatal myocardial
infarction and ischemic stroke. Atherosclerosis 204, e58-63.
Leppert, D., Hauser, S.L., Kishiyama, J.L., An, S., Zeng, L., and Goetzl, E.J. (1995). Stimulation
of matrix metalloproteinase-dependent migration of T cells by eicosanoids. FASEB journal :
official publication of the Federation of American Societies for Experimental Biology 9, 14731481.
Lewin, A.H., Szewczyk, J., Wilson, J.W., and Carroll, F.I. (2005). Galanthamine analogs: 6Hbenzofuro[3a,3,2,-e,f][1]benzazepine and 6H-benzofuro[3a,3,2-e,f][3]benzazepine. Tetrahedron
61, 7144-7152.
Lewis, R.A., Drazen, J.M., Austen, K.F., Clark, D.A., and Corey, E.J. (1980). Identification of
the C(6)-S-conjugate of leukotriene A with cysteine as a naturally occurring slow reacting
substance of anaphylaxis (SRS-A). Importance of the 11-cis-geometry for biological activity.
Biochemical and biophysical research communications 96, 271-277.
Ley, K. (1994). Histamine can induce leukocyte rolling in rat mesenteric venules. The American
journal of physiology 267, H1017-1023.
Li, W., Nava, R.G., Bribriesco, A.C., Zinselmeyer, B.H., Spahn, J.H., Gelman, A.E., Krupnick,
A.S., Miller, M.J., and Kreisel, D. (2012). Intravital 2-photon imaging of leukocyte trafficking in
beating heart. The Journal of clinical investigation 122, 2499-2508.
Linsel-Nitschke, P., Gotz, A., Medack, A., Konig, I.R., Bruse, P., Lieb, W., Mayer, B., Stark, K.,
Hengstenberg, C., Fischer, M., et al. (2008). Genetic variation in the arachidonate 5lipoxygenase-activating protein (ALOX5AP) is associated with myocardial infarction in the
German population. Clinical science 115, 309-315.
Liu, M.C., Dube, L.M., and Lancaster, J. (1996). Acute and chronic effects of a 5-lipoxygenase
inhibitor in asthma: a 6-month randomized multicenter trial. Zileuton Study Group. The Journal
of allergy and clinical immunology 98, 859-871.
Lorico, A., Rappa, G., Finch, R.A., Yang, D., Flavell, R.A., and Sartorelli, A.C. (1997).
Disruption of the murine MRP (multidrug resistance protein) gene leads to increased sensitivity
to etoposide (VP-16) and increased levels of glutathione. Cancer research 57, 5238-5242.
Lotzer, K., Jahn, S., Kramer, C., Hildner, M., Nusing, R., Funk, C.D., and Habenicht, A.J.
(2007). 5-Lipoxygenase/cyclooxygenase-2 cross-talk through cysteinyl leukotriene receptor 2 in
endothelial cells. Prostaglandins & other lipid mediators 84, 108-115.
Lotzer, K., Spanbroek, R., Hildner, M., Urbach, A., Heller, R., Bretschneider, E., Galczenski, H.,
Evans, J.F., and Habenicht, A.J. (2003). Differential leukotriene receptor expression and calcium
responses in endothelial cells and macrophages indicate 5-lipoxygenase-dependent circuits of
inflammation and atherogenesis. Arterioscler Thromb Vasc Biol 23, e32-36.
175
Luo, M., Jones, S.M., Flamand, N., Aronoff, D.M., Peters-Golden, M., and Brock, T.G. (2005).
Phosphorylation by protein kinase a inhibits nuclear import of 5-lipoxygenase. The Journal of
biological chemistry 280, 40609-40616.
Luo, M., Jones, S.M., Peters-Golden, M., and Brock, T.G. (2003). Nuclear localization of 5lipoxygenase as a determinant of leukotriene B4 synthetic capacity. Proceedings of the National
Academy of Sciences of the United States of America 100, 12165-12170.
Luo, M., Jones, S.M., Phare, S.M., Coffey, M.J., Peters-Golden, M., and Brock, T.G. (2004).
Protein kinase A inhibits leukotriene synthesis by phosphorylation of 5-lipoxygenase on serine
523. The Journal of biological chemistry 279, 41512-41520.
Lynch, K.R., O'Neill, G.P., Liu, Q., Im, D.S., Sawyer, N., Metters, K.M., Coulombe, N.,
Abramovitz, M., Figueroa, D.J., Zeng, Z., et al. (1999). Characterization of the human cysteinyl
leukotriene CysLT1 receptor. Nature 399, 789-793.
Maclouf, J.A., and Murphy, R.C. (1988). Transcellular metabolism of neutrophil-derived
leukotriene A4 by human platelets. A potential cellular source of leukotriene C4. The Journal of
biological chemistry 263, 174-181.
Maekawa, A., Balestrieri, B., Austen, K.F., and Kanaoka, Y. (2009). GPR17 is a negative
regulator of the cysteinyl leukotriene 1 receptor response to leukotriene D4. Proceedings of the
National Academy of Sciences of the United States of America 106, 11685-11690.
Maekawa, A., Kanaoka, Y., Lam, B.K., and Austen, K.F. (2001). Identification in mice of two
isoforms of the cysteinyl leukotriene 1 receptor that result from alternative splicing. Proceedings
of the National Academy of Sciences of the United States of America 98, 2256-2261.
Maekawa, A., Kanaoka, Y., Xing, W., and Austen, K.F. (2008). Functional recognition of a
distinct receptor preferential for leukotriene E4 in mice lacking the cysteinyl leukotriene 1 and 2
receptors. Proceedings of the National Academy of Sciences of the United States of America
105, 16695-16700.
Maekawa, A., Xing, W., Austen, K.F., and Kanaoka, Y. (2010). GPR17 regulates immune
pulmonary inflammation induced by house dust mites. Journal of immunology 185, 1846-1854.
Magnusson, C., Ehrnstrom, R., Olsen, J., and Sjolander, A. (2007). An increased expression of
cysteinyl leukotriene 2 receptor in colorectal adenocarcinomas correlates with high
differentiation. Cancer research 67, 9190-9198.
Magnusson, C., Liu, J., Ehrnstrom, R., Manjer, J., Jirstrom, K., Andersson, T., and Sjolander, A.
(2011). Cysteinyl leukotriene receptor expression pattern affects migration of breast cancer cells
and survival of breast cancer patients. International journal of cancer Journal international du
cancer 129, 9-22.
Malmsten, C.L., Palmblad, J., Uden, A.M., Radmark, O., Engstedt, L., and Samuelsson, B.
(1980). Leukotriene B4: a highly potent and stereospecific factor stimulating migration of
polymorphonuclear leukocytes. Acta physiologica Scandinavica 110, 449-451.
176
Mancuso, P., and Peters-Golden, M. (2000). Modulation of alveolar macrophage phagocytosis
by leukotrienes is Fc receptor-mediated and protein kinase C-dependent. American journal of
respiratory cell and molecular biology 23, 727-733.
Marchant, D.J., Boyd, J.H., Lin, D.C., Granville, D.J., Garmaroudi, F.S., and McManus, B.M.
(2012). Inflammation in myocardial diseases. Circulation research 110, 126-144.
Martin, V., Sawyer, N., Stocco, R., Unett, D., Lerner, M.R., Abramovitz, M., and Funk, C.D.
(2001). Molecular cloning and functional characterization of murine cysteinyl-leukotriene 1
(CysLT(1)) receptors. Biochemical pharmacology 62, 1193-1200.
Massoumi, R., and Sjolander, A. (2001). Leukotriene D(4) affects localisation of vinculin in
intestinal epithelial cells via distinct tyrosine kinase and protein kinase C controlled events.
Journal of cell science 114, 1925-1934.
Matsuyama, M., Hayama, T., Funao, K., Kawahito, Y., Sano, H., Takemoto, Y., Nakatani, T.,
and Yoshimura, R. (2007). Overexpression of cysteinyl LT1 receptor in prostate cancer and
CysLT1R antagonist inhibits prostate cancer cell growth through apoptosis. Oncology reports 18,
99-104.
Maznyczka, A., Braund, P., Mangino, M., and Samani, N.J. (2008). Arachidonate 5lipoxygenase (5-LO) promoter genotype and risk of myocardial infarction: a case-control study.
Atherosclerosis 199, 328-332.
McCafferty, D.M., Craig, A.W., Senis, Y.A., and Greer, P.A. (2002). Absence of Fer proteintyrosine kinase exacerbates leukocyte recruitment in response to endotoxin. Journal of
immunology 168, 4930-4935.
McGee, J.E., and Fitzpatrick, F.A. (1986). Erythrocyte-neutrophil interactions: formation of
leukotriene B4 by transcellular biosynthesis. Proceedings of the National Academy of Sciences
of the United States of America 83, 1349-1353.
McIntyre, T.M., Zimmerman, G.A., and Prescott, S.M. (1986). Leukotrienes C4 and D4
stimulate human endothelial cells to synthesize platelet-activating factor and bind neutrophils.
Proceedings of the National Academy of Sciences of the United States of America 83, 22042208.
McMahon, B., Stenson, C., McPhillips, F., Fanning, A., Brady, H.R., and Godson, C. (2000).
Lipoxin A4 antagonizes the mitogenic effects of leukotriene D4 in human renal mesangial cells.
Differential activation of MAP kinases through distinct receptors. The Journal of biological
chemistry 275, 27566-27575.
McMullen, J.R., and Jennings, G.L. (2007). Differences between pathological and physiological
cardiac hypertrophy: novel therapeutic strategies to treat heart failure. Clinical and experimental
pharmacology & physiology 34, 255-262.
Mellor, E.A., Frank, N., Soler, D., Hodge, M.R., Lora, J.M., Austen, K.F., and Boyce, J.A.
(2003). Expression of the type 2 receptor for cysteinyl leukotrienes (CysLT2R) by human mast
177
cells: Functional distinction from CysLT1R. Proceedings of the National Academy of Sciences
of the United States of America 100, 11589-11593.
Mellor, E.A., Maekawa, A., Austen, K.F., and Boyce, J.A. (2001). Cysteinyl leukotriene receptor
1 is also a pyrimidinergic receptor and is expressed by human mast cells. Proceedings of the
National Academy of Sciences of the United States of America 98, 7964-7969.
Michelassi, F., Landa, L., Hill, R.D., Lowenstein, E., Watkins, W.D., Petkau, A.J., and Zapol,
W.M. (1982). Leukotriene D4: a potent coronary artery vasoconstrictor associated with impaired
ventricular contraction. Science 217, 841-843.
Mita, H., Hasegawa, M., Saito, H., and Akiyama, K. (2001). Levels of cysteinyl leukotriene
receptor mRNA in human peripheral leucocytes: significantly higher expression of cysteinyl
leukotriene receptor 2 mRNA in eosinophils. Clinical and experimental allergy : journal of the
British Society for Allergy and Clinical Immunology 31, 1714-1723.
Miyahara, N., Takeda, K., Miyahara, S., Matsubara, S., Koya, T., Joetham, A., Krishnan, E.,
Dakhama, A., Haribabu, B., and Gelfand, E.W. (2005). Requirement for leukotriene B4 receptor
1 in allergen-induced airway hyperresponsiveness. American journal of respiratory and critical
care medicine 172, 161-167.
Modat, G., Muller, A., Mary, A., Gregoire, C., and Bonne, C. (1987). Differential effects of
leukotrienes B4 and C4 on bovine aortic endothelial cell proliferation in vitro. Prostaglandins 33,
531-538.
Moos, M.P., and Funk, C.D. (2008). Endothelial cysteinyl leukotriene 2 receptor expression and
myocardial ischemia/reperfusion injury. Trends in cardiovascular medicine 18, 268-273.
Moos, M.P., Mewburn, J.D., Kan, F.W., Ishii, S., Abe, M., Sakimura, K., Noguchi, K., Shimizu,
T., and Funk, C.D. (2008). Cysteinyl leukotriene 2 receptor-mediated vascular permeability via
transendothelial vesicle transport. FASEB journal : official publication of the Federation of
American Societies for Experimental Biology 22, 4352-4362.
Moraes, J., Assreuy, J., Canetti, C., and Barja-Fidalgo, C. (2010). Leukotriene B4 mediates
vascular smooth muscle cell migration through alphavbeta3 integrin transactivation.
Atherosclerosis 212, 406-413.
Moskowitz, M.A., Kiwak, K.J., Hekimian, K., and Levine, L. (1984). Synthesis of compounds
with properties of leukotrienes C4 and D4 in gerbil brains after ischemia and reperfusion.
Science 224, 886-889.
Mosser, D.M., and Edwards, J.P. (2008). Exploring the full spectrum of macrophage activation.
Nature reviews Immunology 8, 958-969.
Murphy, R.C., and Gijon, M.A. (2007). Biosynthesis and metabolism of leukotrienes. The
Biochemical journal 405, 379-395.
178
Murphy, R.C., Hammarstrom, S., and Samuelsson, B. (1979). Leukotriene C: a slow-reacting
substance from murine mastocytoma cells. Proceedings of the National Academy of Sciences of
the United States of America 76, 4275-4279.
Murray, J., Ward, C., O'Flaherty, J.T., Dransfield, I., Haslett, C., Chilvers, E.R., and Rossi, A.G.
(2003). Role of leukotrienes in the regulation of human granulocyte behaviour: dissociation
between agonist-induced activation and retardation of apoptosis. British journal of pharmacology
139, 388-398.
Nabel, E.G., and Braunwald, E. (2012). A tale of coronary artery disease and myocardial
infarction. The New England journal of medicine 366, 54-63.
Nagy, E., Andersson, D.C., Caidahl, K., Eriksson, M.J., Eriksson, P., Franco-Cereceda, A.,
Hansson, G.K., and Back, M. (2011). Upregulation of the 5-lipoxygenase pathway in human
aortic valves correlates with severity of stenosis and leads to leukotriene-induced effects on
valvular myofibroblasts. Circulation 123, 1316-1325.
Nahrendorf, M., Pittet, M.J., and Swirski, F.K. (2010). Monocytes: protagonists of infarct
inflammation and repair after myocardial infarction. Circulation 121, 2437-2445.
Nahrendorf, M., Swirski, F.K., Aikawa, E., Stangenberg, L., Wurdinger, T., Figueiredo, J.L.,
Libby, P., Weissleder, R., and Pittet, M.J. (2007). The healing myocardium sequentially
mobilizes two monocyte subsets with divergent and complementary functions. The Journal of
experimental medicine 204, 3037-3047.
National Asthma, E., and Prevention, P. (2007). Expert Panel Report 3 (EPR-3): Guidelines for
the Diagnosis and Management of Asthma-Summary Report 2007. The Journal of allergy and
clinical immunology 120, S94-138.
Ng, C.F., Sun, F.F., Taylor, B.M., Wolin, M.S., and Wong, P.Y. (1991). Functional properties of
guinea pig eosinophil leukotriene B4 receptor. Journal of immunology 147, 3096-3103.
Ni, N.C., Yan, D., Ballantyne, L.L., Barajas-Espinosa, A., St Amand, T., Pratt, D.A., and Funk,
C.D. (2011). A selective cysteinyl leukotriene receptor 2 antagonist blocks myocardial
ischemia/reperfusion injury and vascular permeability in mice. The Journal of pharmacology and
experimental therapeutics 339, 768-778.
Nieves, D., and Moreno, J.J. (2006). Role of 5-lipoxygenase pathway in the regulation of RAW
264.7 macrophage proliferation. Biochemical pharmacology 72, 1022-1030.
Nishio, N., Okawa, Y., Sakurai, H., and Isobe, K. (2008). Neutrophil depletion delays wound
repair in aged mice. Age 30, 11-19.
Nonaka, Y., Hiramoto, T., and Fujita, N. (2005). Identification of endogenous surrogate ligands
for human P2Y12 receptors by in silico and in vitro methods. Biochemical and biophysical
research communications 337, 281-288.
179
Nothacker, H.P., Wang, Z., Zhu, Y., Reinscheid, R.K., Lin, S.H., and Civelli, O. (2000).
Molecular cloning and characterization of a second human cysteinyl leukotriene receptor:
discovery of a subtype selective agonist. Molecular pharmacology 58, 1601-1608.
O'Hickey, S.P., Arm, J.P., Rees, P.J., Spur, B.W., and Lee, T.H. (1988). The relative
responsiveness to inhaled leukotriene E4, methacholine and histamine in normal and asthmatic
subjects. The European respiratory journal 1, 913-917.
Obata, T., Kobayashi, T., Okada, Y., Nakagawa, N., Terawaki, T., and Aishita, H. (1992). Effect
of a peptide leukotriene antagonist, ONO-1078 on antigen-induced airway microvascular leakage
in actively sensitized guinea pigs. Life sciences 51, 1577-1583.
Ock, S., Ahn, J., Lee, S.H., Park, H., Son, J.W., Oh, J.G., Yang, D.K., Lee, W.S., Kim, H.S.,
Rho, J., et al. (2012). Receptor activator of nuclear factor-kappaB ligand is a novel inducer of
myocardial inflammation. Cardiovascular research 94, 105-114.
Ohd, J.F., Nielsen, C.K., Campbell, J., Landberg, G., Lofberg, H., and Sjolander, A. (2003).
Expression of the leukotriene D4 receptor CysLT1, COX-2, and other cell survival factors in
colorectal adenocarcinomas. Gastroenterology 124, 57-70.
Ohd, J.F., Wikstrom, K., and Sjolander, A. (2000). Leukotrienes induce cell-survival signaling in
intestinal epithelial cells. Gastroenterology 119, 1007-1018.
Okunishi, K., and Peters-Golden, M. (2011). Leukotrienes and airway inflammation. Biochimica
et biophysica acta 1810, 1096-1102.
Orning, L., Hammarstrom, S., and Samuelsson, B. (1980). Leukotriene D: a slow reacting
substance from rat basophilic leukemia cells. Proceedings of the National Academy of Sciences
of the United States of America 77, 2014-2017.
Palmblad, J., Malmsten, C.L., Uden, A.M., Radmark, O., Engstedt, L., and Samuelsson, B.
(1981). Leukotriene B4 is a potent and stereospecific stimulator of neutrophil chemotaxis and
adherence. Blood 58, 658-661.
Panettieri, R.A., Tan, E.M., Ciocca, V., Luttmann, M.A., Leonard, T.B., and Hay, D.W. (1998).
Effects of LTD4 on human airway smooth muscle cell proliferation, matrix expression, and
contraction In vitro: differential sensitivity to cysteinyl leukotriene receptor antagonists.
American journal of respiratory cell and molecular biology 19, 453-461.
Parameswaran, K., Liang, H., Fanat, A., Watson, R., Snider, D.P., and O'Byrne, P.M. (2004).
Role for cysteinyl leukotrienes in allergen-induced change in circulating dendritic cell number in
asthma. The Journal of allergy and clinical immunology 114, 73-79.
Parravicini, C., Abbracchio, M.P., Fantucci, P., and Ranghino, G. (2010). Forced unbinding of
GPR17 ligands from wild type and R255I mutant receptor models through a computational
approach. BMC structural biology 10, 8.
180
Parravicini, C., Ranghino, G., Abbracchio, M.P., and Fantucci, P. (2008). GPR17: molecular
modeling and dynamics studies of the 3-D structure and purinergic ligand binding features in
comparison with P2Y receptors. BMC bioinformatics 9, 263.
Paruchuri, S., Hallberg, B., Juhas, M., Larsson, C., and Sjolander, A. (2002). Leukotriene D(4)
activates MAPK through a Ras-independent but PKCepsilon-dependent pathway in intestinal
epithelial cells. Journal of cell science 115, 1883-1893.
Paruchuri, S., Jiang, Y., Feng, C., Francis, S.A., Plutzky, J., and Boyce, J.A. (2008). Leukotriene
E4 activates peroxisome proliferator-activated receptor gamma and induces prostaglandin D2
generation by human mast cells. The Journal of biological chemistry 283, 16477-16487.
Paruchuri, S., and Sjolander, A. (2003). Leukotriene D4 mediates survival and proliferation via
separate but parallel pathways in the human intestinal epithelial cell line Int 407. The Journal of
biological chemistry 278, 45577-45585.
Paruchuri, S., Tashimo, H., Feng, C., Maekawa, A., Xing, W., Jiang, Y., Kanaoka, Y., Conley,
P., and Boyce, J.A. (2009). Leukotriene E4-induced pulmonary inflammation is mediated by the
P2Y12 receptor. The Journal of experimental medicine 206, 2543-2555.
Patel, A.S., Smith, A., Nucera, S., Biziato, D., Saha, P., Attia, R.Q., Humphries, J., Mattock, K.,
Grover, S.P., Lyons, O.T., et al. (2013). TIE2-expressing monocytes/macrophages regulate
revascularization of the ischemic limb. EMBO molecular medicine.
Patten, R.D., Aronovitz, M.J., Deras-Mejia, L., Pandian, N.G., Hanak, G.G., Smith, J.J.,
Mendelsohn, M.E., and Konstam, M.A. (1998). Ventricular remodeling in a mouse model of
myocardial infarction. The American journal of physiology 274, H1812-1820.
Pedersen, K.E., Bochner, B.S., and Undem, B.J. (1997). Cysteinyl leukotrienes induce P-selectin
expression in human endothelial cells via a non-CysLT1 receptor-mediated mechanism. The
Journal of pharmacology and experimental therapeutics 281, 655-662.
Penrose, J.F. (1999). LTC4 synthase. Enzymology, biochemistry, and molecular
characterization. Clinical reviews in allergy & immunology 17, 133-152.
Poeckel, D., and Funk, C.D. (2010). The 5-lipoxygenase/leukotriene pathway in preclinical
models of cardiovascular disease. Cardiovascular research 86, 243-253.
Pouliot, M., McDonald, P.P., Borgeat, P., and McColl, S.R. (1994). Granulocyte/macrophage
colony-stimulating factor stimulates the expression of the 5-lipoxygenase-activating protein
(FLAP) in human neutrophils. The Journal of experimental medicine 179, 1225-1232.
Pueringer, R.J., Bahns, C.C., and Hunninghake, G.W. (1992). Alveolar macrophages have
greater amounts of the enzyme 5-lipoxygenase than do monocytes. Journal of applied physiology
73, 781-786.
Qi, A.D., Harden, T.K., and Nicholas, R.A. (2004). GPR80/99, proposed to be the P2Y(15)
receptor activated by adenosine and AMP, is not a P2Y receptor. Purinergic signalling 1, 67-74.
181
Qi, L.L., Fang, S.H., Shi, W.Z., Huang, X.Q., Zhang, X.Y., Lu, Y.B., Zhang, W.P., and Wei,
E.Q. (2011). CysLT2 receptor-mediated AQP4 up-regulation is involved in ischemic-like injury
through activation of ERK and p38 MAPK in rat astrocytes. Life sciences 88, 50-56.
Qiu, H., Gabrielsen, A., Agardh, H.E., Wan, M., Wetterholm, A., Wong, C.H., Hedin, U.,
Swedenborg, J., Hansson, G.K., Samuelsson, B., et al. (2006a). Expression of 5-lipoxygenase
and leukotriene A4 hydrolase in human atherosclerotic lesions correlates with symptoms of
plaque instability. Proceedings of the National Academy of Sciences of the United States of
America 103, 8161-8166.
Qiu, H., Johansson, A.S., Sjostrom, M., Wan, M., Schroder, O., Palmblad, J., and Haeggstrom,
J.Z. (2006b). Differential induction of BLT receptor expression on human endothelial cells by
lipopolysaccharide, cytokines, and leukotriene B4. Proceedings of the National Academy of
Sciences of the United States of America 103, 6913-6918.
Radmark, O., and Samuelsson, B. (2007). 5-lipoxygenase: regulation and possible involvement
in atherosclerosis. Prostaglandins & other lipid mediators 83, 162-174.
Radmark, O., Werz, O., Steinhilber, D., and Samuelsson, B. (2007). 5-Lipoxygenase: regulation
of expression and enzyme activity. Trends in biochemical sciences 32, 332-341.
Raedschelders, K., Ansley, D.M., and Chen, D.D. (2012). The cellular and molecular origin of
reactive oxygen species generation during myocardial ischemia and reperfusion. Pharmacology
& therapeutics 133, 230-255.
Rao, A.M., Hatcher, J.F., Kindy, M.S., and Dempsey, R.J. (1999). Arachidonic acid and
leukotriene C4: role in transient cerebral ischemia of gerbils. Neurochemical research 24, 12251232.
Rao, R.M., Yang, L., Garcia-Cardena, G., and Luscinskas, F.W. (2007). Endothelial-dependent
mechanisms of leukocyte recruitment to the vascular wall. Circulation research 101, 234-247.
Reddy, K.V., Serio, K.J., Hodulik, C.R., and Bigby, T.D. (2003). 5-lipoxygenase-activating
protein gene expression. Key role of CCAAT/enhancer-binding proteins (C/EBP) in constitutive
and tumor necrosis factor (TNF) alpha-induced expression in THP-1 cells. The Journal of
biological chemistry 278, 13810-13818.
Reiss, T.F., Chervinsky, P., Dockhorn, R.J., Shingo, S., Seidenberg, B., and Edwards, T.B.
(1998). Montelukast, a once-daily leukotriene receptor antagonist, in the treatment of chronic
asthma: a multicenter, randomized, double-blind trial. Montelukast Clinical Research Study
Group. Archives of internal medicine 158, 1213-1220.
Rioux, N., and Castonguay, A. (1998). Inhibitors of lipoxygenase: a new class of cancer
chemopreventive agents. Carcinogenesis 19, 1393-1400.
Rius, M., Hummel-Eisenbeiss, J., and Keppler, D. (2008). ATP-dependent transport of
leukotrienes B4 and C4 by the multidrug resistance protein ABCC4 (MRP4). The Journal of
pharmacology and experimental therapeutics 324, 86-94.
182
Roger, V.L., Go, A.S., Lloyd-Jones, D.M., Benjamin, E.J., Berry, J.D., Borden, W.B., Bravata,
D.M., Dai, S., Ford, E.S., Fox, C.S., et al. (2012). Heart disease and stroke statistics--2012
update: a report from the American Heart Association. Circulation 125, e2-e220.
Rola-Pleszczynski, M., Chavaillaz, P.A., and Lemaire, I. (1986). Stimulation of interleukin 2 and
interferon gamma production by leukotriene B4 in human lymphocyte cultures. Prostaglandins,
leukotrienes, and medicine 23, 207-210.
Rola-Pleszczynski, M., and Lemaire, I. (1985). Leukotrienes augment interleukin 1 production
by human monocytes. Journal of immunology 135, 3958-3961.
Rola-Pleszczynski, M., and Stankova, J. (1992). Leukotriene B4 enhances interleukin-6 (IL-6)
production and IL-6 messenger RNA accumulation in human monocytes in vitro: transcriptional
and posttranscriptional mechanisms. Blood 80, 1004-1011.
Romson, J.L., Hook, B.G., Kunkel, S.L., Abrams, G.D., Schork, M.A., and Lucchesi, B.R.
(1983). Reduction of the extent of ischemic myocardial injury by neutrophil depletion in the dog.
Circulation 67, 1016-1023.
Rouzer, C.A., and Samuelsson, B. (1985). On the nature of the 5-lipoxygenase reaction in human
leukocytes: enzyme purification and requirement for multiple stimulatory factors. Proceedings of
the National Academy of Sciences of the United States of America 82, 6040-6044.
Rouzer, C.A., Shimizu, T., and Samuelsson, B. (1985). On the nature of the 5-lipoxygenase
reaction in human leukocytes: characterization of a membrane-associated stimulatory factor.
Proceedings of the National Academy of Sciences of the United States of America 82, 75057509.
Rovetto, M.J., Lamberton, W.F., and Neely, J.R. (1975). Mechanisms of glycolytic inhibition in
ischemic rat hearts. Circulation research 37, 742-751.
Sakata, K., Dahlen, S.E., and Back, M. (2004). The contractile action of leukotriene B4 in the
guinea-pig lung involves a vascular component. British journal of pharmacology 141, 449-456.
Sala, A., Bolla, M., Zarini, S., Muller-Peddinghaus, R., and Folco, G. (1996). Release of
leukotriene A4 versus leukotriene B4 from human polymorphonuclear leukocytes. The Journal
of biological chemistry 271, 17944-17948.
Sala, A., Rossoni, G., Berti, F., Buccellati, C., Bonazzi, A., Maclouf, J., and Folco, G. (2000).
Monoclonal anti-CD18 antibody prevents transcellular biosynthesis of cysteinyl leukotrienes in
vitro and in vivo and protects against leukotriene-dependent increase in coronary vascular
resistance and myocardial stiffness. Circulation 101, 1436-1440.
Sala, A., Rossoni, G., Buccellati, C., Berti, F., Folco, G., and Maclouf, J. (1993). Formation of
sulphidopeptide-leukotrienes by cell-cell interaction causes coronary vasoconstriction in isolated,
cell-perfused heart of rabbit. British journal of pharmacology 110, 1206-1212.
183
Samuelsson, B. (1983). Leukotrienes: mediators of immediate hypersensitivity reactions and
inflammation. Science 220, 568-575.
Sarau, H.M., Ames, R.S., Chambers, J., Ellis, C., Elshourbagy, N., Foley, J.J., Schmidt, D.B.,
Muccitelli, R.M., Jenkins, O., Murdock, P.R., et al. (1999). Identification, molecular cloning,
expression, and characterization of a cysteinyl leukotriene receptor. Molecular pharmacology 56,
657-663.
Schafer, C., Ladilov, Y., Inserte, J., Schafer, M., Haffner, S., Garcia-Dorado, D., and Piper, H.M.
(2001). Role of the reverse mode of the Na+/Ca2+ exchanger in reoxygenation-induced
cardiomyocyte injury. Cardiovascular research 51, 241-250.
Schellenberg, R.R., and Foster, A. (1984). Differential activity of leukotrienes upon human
pulmonary vein and artery. Prostaglandins 27, 475-482.
Schievella, A.R., Regier, M.K., Smith, W.L., and Lin, L.L. (1995). Calcium-mediated
translocation of cytosolic phospholipase A2 to the nuclear envelope and endoplasmic reticulum.
The Journal of biological chemistry 270, 30749-30754.
Schroder, O., Sjostrom, M., Qiu, H., Jakobsson, P.J., and Haeggstrom, J.Z. (2005). Microsomal
glutathione S-transferases: selective up-regulation of leukotriene C4 synthase during
lipopolysaccharide-induced pyresis. Cellular and molecular life sciences : CMLS 62, 87-94.
Scoggan, K.A., Jakobsson, P.J., and Ford-Hutchinson, A.W. (1997). Production of leukotriene
C4 in different human tissues is attributable to distinct membrane bound biosynthetic enzymes.
The Journal of biological chemistry 272, 10182-10187.
Serhan, C.N., Radin, A., Smolen, J.E., Korchak, H., Samuelsson, B., and Weissmann, G. (1982).
Leukotriene B4 is a complete secretagogue in human neutrophils: a kinetic analysis. Biochemical
and biophysical research communications 107, 1006-1012.
Sharma, V., Dadheech, S., Kaul, S., Jyothy, A., and Munshi, A. (2013). Association of
ALOX5AP1 SG13S114T/A variant with ischemic stroke, stroke subtypes and aspirin resistance.
Journal of the neurological sciences 331, 108-113.
Sheng, W.W., Li, C.T., Zhang, W.P., Yuan, Y.M., Hu, H., Fang, S.H., Zhang, L., and Wei, E.Q.
(2006). Distinct roles of CysLT1 and CysLT2 receptors in oxygen glucose deprivation-induced
PC12 cell death. Biochemical and biophysical research communications 346, 19-25.
Shi, Q.J., Xiao, L., Zhao, B., Zhang, X.Y., Wang, X.R., Xu, D.M., Yu, S.Y., Fang, S.H., Lu,
Y.B., Zhang, W.P., et al. (2012a). Intracerebroventricular injection of HAMI 3379, a selective
cysteinyl leukotriene receptor 2 antagonist, protects against acute brain injury after focal cerebral
ischemia in rats. Brain research 1484, 57-67.
Shi, W.Z., Zhao, C.Z., Zhao, B., Shi, Q.J., Zhang, L.H., Wang, Y.F., Fang, S.H., Lu, Y.B.,
Zhang, W.P., and Wei, E.Q. (2012b). Aggravated inflammation and increased expression of
cysteinyl leukotriene receptors in the brain after focal cerebral ischemia in AQP4-deficient mice.
Neuroscience bulletin 28, 680-692.
184
Shin, E.H., Lee, H.Y., and Bae, Y.S. (2006). Leukotriene B4 stimulates human monocytederived dendritic cell chemotaxis. Biochemical and biophysical research communications 348,
606-611.
Shirasaki, H., Seki, N., Fujita, M., Kikuchi, M., Kanaizumi, E., Watanabe, K., and Himi, T.
(2007). Agonist- and T(H)2 cytokine-induced up-regulation of cysteinyl leukotriene receptor
messenger RNA in human monocytes. Annals of allergy, asthma & immunology : official
publication of the American College of Allergy, Asthma, & Immunology 99, 340-347.
Shishido, T., Nozaki, N., Yamaguchi, S., Shibata, Y., Nitobe, J., Miyamoto, T., Takahashi, H.,
Arimoto, T., Maeda, K., Yamakawa, M., et al. (2003). Toll-like receptor-2 modulates ventricular
remodeling after myocardial infarction. Circulation 108, 2905-2910.
Sjostrom, M., Jakobsson, P.J., Heimburger, M., Palmblad, J., and Haeggstrom, J.Z. (2001).
Human umbilical vein endothelial cells generate leukotriene C4 via microsomal glutathione Stransferase type 2 and express the CysLT(1) receptor. European journal of biochemistry / FEBS
268, 2578-2586.
Sjostrom, M., Johansson, A.S., Schroder, O., Qiu, H., Palmblad, J., and Haeggstrom, J.Z. (2003).
Dominant expression of the CysLT2 receptor accounts for calcium signaling by cysteinyl
leukotrienes in human umbilical vein endothelial cells. Arteriosclerosis, thrombosis, and vascular
biology 23, e37-41.
Smith, S.C., Jr., Allen, J., Blair, S.N., Bonow, R.O., Brass, L.M., Fonarow, G.C., Grundy, S.M.,
Hiratzka, L., Jones, D., Krumholz, H.M., et al. (2006). AHA/ACC guidelines for secondary
prevention for patients with coronary and other atherosclerotic vascular disease: 2006 update:
endorsed by the National Heart, Lung, and Blood Institute. Circulation 113, 2363-2372.
Smyth, E.M., Grosser, T., Wang, M., Yu, Y., and FitzGerald, G.A. (2009). Prostanoids in health
and disease. Journal of lipid research 50 Suppl, S423-428.
Song, K., Nam, Y.J., Luo, X., Qi, X., Tan, W., Huang, G.N., Acharya, A., Smith, C.L., Tallquist,
M.D., Neilson, E.G., et al. (2012). Heart repair by reprogramming non-myocytes with cardiac
transcription factors. Nature 485, 599-604.
Soter, N.A., Lewis, R.A., Corey, E.J., and Austen, K.F. (1983). Local effects of synthetic
leukotrienes (LTC4, LTD4, LTE4, and LTB4) in human skin. The Journal of investigative
dermatology 80, 115-119.
Spanbroek, R., Grabner, R., Lotzer, K., Hildner, M., Urbach, A., Ruhling, K., Moos, M.P.,
Kaiser, B., Cohnert, T.U., Wahlers, T., et al. (2003). Expanding expression of the 5-lipoxygenase
pathway within the arterial wall during human atherogenesis. Proceedings of the National
Academy of Sciences of the United States of America 100, 1238-1243.
Steffens, S., Montecucco, F., and Mach, F. (2009). The inflammatory response as a target to
reduce myocardial ischaemia and reperfusion injury. Thrombosis and haemostasis 102, 240-247.
185
Suissa, S., Dennis, R., Ernst, P., Sheehy, O., and Wood-Dauphinee, S. (1997). Effectiveness of
the leukotriene receptor antagonist zafirlukast for mild-to-moderate asthma. A randomized,
double-blind, placebo-controlled trial. Annals of internal medicine 126, 177-183.
Tada, M., Kuzuya, T., Hoshida, S., and Nishida, M. (1988). Arachidonate metabolism in
myocardial ischemia and reperfusion. Journal of molecular and cellular cardiology 20 Suppl 2,
135-143.
Takasaki, J., Kamohara, M., Matsumoto, M., Saito, T., Sugimoto, T., Ohishi, T., Ishii, H., Ota,
T., Nishikawa, T., Kawai, Y., et al. (2000). The molecular characterization and tissue
distribution of the human cysteinyl leukotriene CysLT(2) receptor. Biochemical and biophysical
research communications 274, 316-322.
Takase, B., Kurita, A., Maruyama, T., Uehata, A., Nishioka, T., Mizuno, K., Nakamura, H.,
Katsura, K., and Kanda, Y. (1996). Change of plasma leukotriene C4 during myocardial
ischemia in humans. Clinical cardiology 19, 198-204.
Takemura, G., Nakagawa, M., Kanamori, H., Minatoguchi, S., and Fujiwara, H. (2009). Benefits
of reperfusion beyond infarct size limitation. Cardiovascular research 83, 269-276.
Tanimoto, Y., Takahashi, K., and Kimura, I. (1992). Effects of cytokines on human basophil
chemotaxis. Clinical and experimental allergy : journal of the British Society for Allergy and
Clinical Immunology 22, 1020-1025.
Taylor, I.K., O'Shaughnessy, K.M., Fuller, R.W., and Dollery, C.T. (1991). Effect of cysteinylleukotriene receptor antagonist ICI 204.219 on allergen-induced bronchoconstriction and airway
hyperreactivity in atopic subjects. Lancet 337, 690-694.
Taylor, I.K., Wellings, R., Taylor, G.W., and Fuller, R.W. (1992). Urinary leukotriene E4
excretion in exercise-induced asthma. Journal of applied physiology 73, 743-748.
Terashima, T., Amakawa, K., Matsumaru, A., and Yamaguchi, K. (2002). Correlation between
cysteinyl leukotriene release from leukocytes and clinical response to a leukotriene inhibitor.
Chest 122, 1566-1570.
Terawaki, K., Yokomizo, T., Nagase, T., Toda, A., Taniguchi, M., Hashizume, K., Yagi, T., and
Shimizu, T. (2005). Absence of leukotriene B4 receptor 1 confers resistance to airway
hyperresponsiveness and Th2-type immune responses. Journal of immunology 175, 4217-4225.
Thivierge, M., Doty, M., Johnson, J., Stankova, J., and Rola-Pleszczynski, M. (2000). IL-5 upregulates cysteinyl leukotriene 1 receptor expression in HL-60 cells differentiated into
eosinophils. Journal of immunology 165, 5221-5226.
Thivierge, M., Stankova, J., and Rola-Pleszczynski, M. (2001). IL-13 and IL-4 up-regulate
cysteinyl leukotriene 1 receptor expression in human monocytes and macrophages. Journal of
immunology 167, 2855-2860.
186
Thivierge, M., Stankova, J., and Rola-Pleszczynski, M. (2006). Toll-like receptor agonists
differentially regulate cysteinyl-leukotriene receptor 1 expression and function in human
dendritic cells. The Journal of allergy and clinical immunology 117, 1155-1162.
Thivierge, M., Stankova, J., and Rola-Pleszczynski, M. (2009). Cysteinyl-leukotriene receptor
type 1 expression and function is down-regulated during monocyte-derived dendritic cell
maturation with zymosan: involvement of IL-10 and prostaglandins. Journal of immunology 183,
6778-6787.
Thompson, C., Cloutier, A., Bosse, Y., Poisson, C., Larivee, P., McDonald, P.P., Stankova, J.,
and Rola-Pleszczynski, M. (2008). Signaling by the cysteinyl-leukotriene receptor 2.
Involvement in chemokine gene transcription. The Journal of biological chemistry 283, 19741984.
Thompson, C., Cloutier, A., Bosse, Y., Thivierge, M., Gouill, C.L., Larivee, P., McDonald, P.P.,
Stankova, J., and Rola-Pleszczynski, M. (2006). CysLT1 receptor engagement induces activator
protein-1- and NF-kappaB-dependent IL-8 expression. American journal of respiratory cell and
molecular biology 35, 697-704.
Toki, Y., Hieda, N., Torii, T., Hashimoto, H., Ito, T., Ogawa, K., and Satake, T. (1988). The
effects of lipoxygenase inhibitor and peptidoleukotriene antagonist on myocardial injury in a
canine coronary occlusion-reperfusion model. Prostaglandins 35, 555-571.
Toldo, S., Breckenridge, D.G., Mezzaroma, E., Van Tassell, B.W., Shryock, J., Kannan, H.,
Phan, D., Budas, G., Farkas, D., Lesnefsky, E., et al. (2012). Inhibition of apoptosis signalregulating kinase 1 reduces myocardial ischemia-reperfusion injury in the mouse. Journal of the
American Heart Association 1, e002360.
Tong, W.G., Ding, X.Z., Talamonti, M.S., Bell, R.H., and Adrian, T.E. (2005). LTB4 stimulates
growth of human pancreatic cancer cells via MAPK and PI-3 kinase pathways. Biochemical and
biophysical research communications 335, 949-956.
Tsopanoglou, N.E., Pipili-Synetos, E., and Maragoudakis, M.E. (1994). Leukotrienes C4 and D4
promote angiogenesis via a receptor-mediated interaction. European journal of pharmacology
258, 151-154.
Tudhope, S.R., Cuthbert, N.J., Abram, T.S., Jennings, M.A., Maxey, R.J., Thompson, A.M.,
Norman, P., and Gardiner, P.J. (1994). BAY u9773, a novel antagonist of cysteinyl-leukotrienes
with activity against two receptor subtypes. European journal of pharmacology 264, 317-323.
Ueda, T., Takeno, S., Furukido, K., Hirakawa, K., and Yajin, K. (2003). Leukotriene receptor
antagonist pranlukast suppresses eosinophil infiltration and cytokine production in human nasal
mucosa of perennial allergic rhinitis. The Annals of otology, rhinology, and laryngology 112,
955-961.
Uzonyi, B., Lotzer, K., Jahn, S., Kramer, C., Hildner, M., Bretschneider, E., Radke, D., Beer, M.,
Vollandt, R., Evans, J.F., et al. (2006). Cysteinyl leukotriene 2 receptor and protease-activated
187
receptor 1 activate strongly correlated early genes in human endothelial cells. Proceedings of the
National Academy of Sciences of the United States of America 103, 6326-6331.
Vaddi, K., and Newton, R.C. (1994). Regulation of monocyte integrin expression by beta-family
chemokines. Journal of immunology 153, 4721-4732.
Vakeva, A.P., Agah, A., Rollins, S.A., Matis, L.A., Li, L., and Stahl, G.L. (1998). Myocardial
infarction and apoptosis after myocardial ischemia and reperfusion: role of the terminal
complement components and inhibition by anti-C5 therapy. Circulation 97, 2259-2267.
van Amerongen, M.J., Harmsen, M.C., van Rooijen, N., Petersen, A.H., and van Luyn, M.J.
(2007). Macrophage depletion impairs wound healing and increases left ventricular remodeling
after myocardial injury in mice. The American journal of pathology 170, 818-829.
Van de Werf, F., Bax, J., Betriu, A., Blomstrom-Lundqvist, C., Crea, F., Falk, V., Filippatos, G.,
Fox, K., Huber, K., Kastrati, A., et al. (2008). Management of acute myocardial infarction in
patients presenting with persistent ST-segment elevation: the Task Force on the Management of
ST-Segment Elevation Acute Myocardial Infarction of the European Society of Cardiology.
European heart journal 29, 2909-2945.
Vandervelde, S., van Luyn, M.J., Rozenbaum, M.H., Petersen, A.H., Tio, R.A., and Harmsen,
M.C. (2007). Stem cell-related cardiac gene expression early after murine myocardial infarction.
Cardiovascular research 73, 783-793.
Vanhoutte, D., Schellings, M.W., Gotte, M., Swinnen, M., Herias, V., Wild, M.K., Vestweber,
D., Chorianopoulos, E., Cortes, V., Rigotti, A., et al. (2007). Increased expression of syndecan-1
protects against cardiac dilatation and dysfunction after myocardial infarction. Circulation 115,
475-482.
Vannella, K.M., McMillan, T.R., Charbeneau, R.P., Wilke, C.A., Thomas, P.E., Toews, G.B.,
Peters-Golden, M., and Moore, B.B. (2007). Cysteinyl leukotrienes are autocrine and paracrine
regulators of fibrocyte function. J Immunol 179, 7883-7890.
Venneri, M.A., De Palma, M., Ponzoni, M., Pucci, F., Scielzo, C., Zonari, E., Mazzieri, R.,
Doglioni, C., and Naldini, L. (2007). Identification of proangiogenic TIE2-expressing monocytes
(TEMs) in human peripheral blood and cancer. Blood 109, 5276-5285.
Vinten-Johansen, J. (2004). Involvement of neutrophils in the pathogenesis of lethal myocardial
reperfusion injury. Cardiovascular research 61, 481-497.
Voelkel, N.F., Czartolomna, J., Simpson, J., and Murphy, R.C. (1992). FMLP causes eicosanoiddependent vasoconstriction and edema in lungs from endotoxin-primed rats. The American
review of respiratory disease 145, 701-711.
Wada, K., Arita, M., Nakajima, A., Katayama, K., Kudo, C., Kamisaki, Y., and Serhan, C.N.
(2006). Leukotriene B4 and lipoxin A4 are regulatory signals for neural stem cell proliferation
and differentiation. FASEB journal : official publication of the Federation of American Societies
for Experimental Biology 20, 1785-1792.
188
Wang, G., Zhang, J., Sun, H., Cao, W., Zhang, J., Wang, Y., and Xiao, H. (2012). Genetic
variation in members of the leukotrienes biosynthesis pathway confers risk of ischemic stroke in
Eastern Han Chinese. Prostaglandins, leukotrienes, and essential fatty acids 87, 169-175.
Wang, P., Chen, H., Qin, H., Sankarapandi, S., Becher, M.W., Wong, P.C., and Zweier, J.L.
(1998). Overexpression of human copper, zinc-superoxide dismutase (SOD1) prevents
postischemic injury. Proceedings of the National Academy of Sciences of the United States of
America 95, 4556-4560.
Weiss, J.W., Drazen, J.M., Coles, N., McFadden, E.R., Jr., Weller, P.F., Corey, E.J., Lewis,
R.A., and Austen, K.F. (1982). Bronchoconstrictor effects of leukotriene C in humans. Science
216, 196-198.
Weller, C.L., Collington, S.J., Brown, J.K., Miller, H.R., Al-Kashi, A., Clark, P., Jose, P.J.,
Hartnell, A., and Williams, T.J. (2005). Leukotriene B4, an activation product of mast cells, is a
chemoattractant for their progenitors. The Journal of experimental medicine 201, 1961-1971.
Wenzel, S., Busse, W., Calhoun, W., Panettieri, R., Jr., Peters-Golden, M., Dube, L., WaltonBowen, K., Russell, H., and Harris, J. (2007). The safety and efficacy of zileuton controlledrelease tablets as adjunctive therapy to usual care in the treatment of moderate persistent asthma:
a 6-month randomized controlled study. The Journal of asthma : official journal of the
Association for the Care of Asthma 44, 305-310.
Wenzel, S.E. (2003). The role of leukotrienes in asthma. Prostaglandins, leukotrienes, and
essential fatty acids 69, 145-155.
Wenzel, S.E., Larsen, G.L., Johnston, K., Voelkel, N.F., and Westcott, J.Y. (1990). Elevated
levels of leukotriene C4 in bronchoalveolar lavage fluid from atopic asthmatics after
endobronchial allergen challenge. The American review of respiratory disease 142, 112-119.
Wenzel, S.E., Trudeau, J.B., Kaminsky, D.A., Cohn, J., Martin, R.J., and Westcott, J.Y. (1995).
Effect of 5-lipoxygenase inhibition on bronchoconstriction and airway inflammation in nocturnal
asthma. American journal of respiratory and critical care medicine 152, 897-905.
Werz, O., Burkert, E., Fischer, L., Szellas, D., Dishart, D., Samuelsson, B., Radmark, O., and
Steinhilber, D. (2002). Extracellular signal-regulated kinases phosphorylate 5-lipoxygenase and
stimulate 5-lipoxygenase product formation in leukocytes. FASEB journal : official publication
of the Federation of American Societies for Experimental Biology 16, 1441-1443.
Werz, O., Klemm, J., Samuelsson, B., and Radmark, O. (2000). 5-lipoxygenase is
phosphorylated by p38 kinase-dependent MAPKAP kinases. Proceedings of the National
Academy of Sciences of the United States of America 97, 5261-5266.
Westerberg, E., Deshpande, J.K., and Wieloch, T. (1987). Regional differences in arachidonic
acid release in rat hippocampal CA1 and CA3 regions during cerebral ischemia. Journal of
cerebral blood flow and metabolism : official journal of the International Society of Cerebral
Blood Flow and Metabolism 7, 189-192.
189
White, H.D., and Chew, D.P. (2008). Acute myocardial infarction. Lancet 372, 570-584.
Wikstrom, K., Ohd, J.F., and Sjolander, A. (2003). Regulation of leukotriene-dependent
induction of cyclooxygenase-2 and Bcl-2. Biochemical and biophysical research
communications 302, 330-335.
Woods, J.W., Coffey, M.J., Brock, T.G., Singer, II, and Peters-Golden, M. (1995). 5Lipoxygenase is located in the euchromatin of the nucleus in resting human alveolar
macrophages and translocates to the nuclear envelope upon cell activation. The Journal of
clinical investigation 95, 2035-2046.
Woszczek, G., Chen, L.Y., Alsaaty, S., Nagineni, S., and Shelhamer, J.H. (2010). Concentrationdependent noncysteinyl leukotriene type 1 receptor-mediated inhibitory activity of leukotriene
receptor antagonists. Journal of immunology 184, 2219-2225.
Woszczek, G., Chen, L.Y., Nagineni, S., Alsaaty, S., Harry, A., Logun, C., Pawliczak, R., and
Shelhamer, J.H. (2007). IFN-gamma induces cysteinyl leukotriene receptor 2 expression and
enhances the responsiveness of human endothelial cells to cysteinyl leukotrienes. Journal of
immunology 178, 5262-5270.
Woszczek, G., Chen, L.Y., Nagineni, S., and Shelhamer, J.H. (2008). IL-10 inhibits cysteinyl
leukotriene-induced activation of human monocytes and monocyte-derived dendritic cells.
Journal of immunology 180, 7597-7603.
Woszczek, G., Pawliczak, R., Qi, H.Y., Nagineni, S., Alsaaty, S., Logun, C., and Shelhamer, J.H.
(2005). Functional characterization of human cysteinyl leukotriene 1 receptor gene structure.
Journal of immunology 175, 5152-5159.
Wunder, F., Tinel, H., Kast, R., Geerts, A., Becker, E.M., Kolkhof, P., Hutter, J., Erguden, J.,
and Harter, M. (2010). Pharmacological characterization of the first potent and selective
antagonist at the cysteinyl leukotriene 2 (CysLT(2)) receptor. British journal of pharmacology
160, 399-409.
Yamaoka, K.A., and Kolb, J.P. (1993). Leukotriene B4 induces interleukin 5 generation from
human T lymphocytes. European journal of immunology 23, 2392-2398.
Yan, D., Stocco, R., Sawyer, N., Nesheim, M.E., Abramovitz, M., and Funk, C.D. (2011).
Differential signaling of cysteinyl leukotrienes and a novel cysteinyl leukotriene receptor 2
(CysLT(2)) agonist, N-methyl-leukotriene C(4), in calcium reporter and beta arrestin assays.
Molecular pharmacology 79, 270-278.
Yang, F., Liu, Y.H., Yang, X.P., Xu, J., Kapke, A., and Carretero, O.A. (2002). Myocardial
infarction and cardiac remodelling in mice. Exp Physiol 87, 547-555.
Yasojima, K., Schwab, C., McGeer, E.G., and McGeer, P.L. (1998). Human heart generates
complement proteins that are upregulated and activated after myocardial infarction. Circulation
research 83, 860-869.
190
Ye, Y.N., Wu, W.K., Shin, V.Y., Bruce, I.C., Wong, B.C., and Cho, C.H. (2005). Dual inhibition
of 5-LOX and COX-2 suppresses colon cancer formation promoted by cigarette smoke.
Carcinogenesis 26, 827-834.
Yellon, D.M., and Hausenloy, D.J. (2007). Myocardial reperfusion injury. The New England
journal of medicine 357, 1121-1135.
Zarini, S., Gijon, M.A., Ransome, A.E., Murphy, R.C., and Sala, A. (2009). Transcellular
biosynthesis of cysteinyl leukotrienes in vivo during mouse peritoneal inflammation.
Proceedings of the National Academy of Sciences of the United States of America 106, 82968301.
Zhang, L.Z., and Guo, Z. (2009). Tramadol reduces myocardial infarct size and expression and
activation of nuclear factor kappa B in acute myocardial infarction in rats. European journal of
anaesthesiology 26, 1048-1055.
Zhang, R., Khoo, M.S., Wu, Y., Yang, Y., Grueter, C.E., Ni, G., Price, E.E., Jr., Thiel, W.,
Guatimosim, S., Song, L.S., et al. (2005). Calmodulin kinase II inhibition protects against
structural heart disease. Nature medicine 11, 409-417.
Zhang, W.P., Hu, H., Zhang, L., Ding, W., Yao, H.T., Chen, K.D., Sheng, W.W., Chen, Z., and
Wei, E.Q. (2004). Expression of cysteinyl leukotriene receptor 1 in human traumatic brain injury
and brain tumors. Neuroscience letters 363, 247-251.
Zhang, W.P., Wei, E.Q., Mei, R.H., Zhu, C.Y., and Zhao, M.H. (2002). Neuroprotective effect of
ONO-1078, a leukotriene receptor antagonist, on focal cerebral ischemia in rats. Acta
pharmacologica Sinica 23, 871-877.
Zhang, X.Y., Wang, X.R., Xu, D.M., Yu, S.Y., Shi, Q.J., Zhang, L.H., Chen, L., Fang, S.H., Lu,
Y.B., Zhang, W.P., et al. (2013). HAMI 3379, a CysLT2 receptor antagonist, attenuates
ischemia-like neuronal injury by inhibiting microglial activation. The Journal of pharmacology
and experimental therapeutics.
Zhao, C.Z., Zhao, B., Zhang, X.Y., Huang, X.Q., Shi, W.Z., Liu, H.L., Fang, S.H., Lu, Y.B.,
Zhang, W.P., Tang, F.D., et al. (2011). Cysteinyl leukotriene receptor 2 is spatiotemporally
involved in neuron injury, astrocytosis and microgliosis after focal cerebral ischemia in rats.
Neuroscience 189, 1-11.
Zhou, G., Zhou, Z., Ge, S., Liu, D., Zhang, R., Xu, G., Zhu, W., Yin, Q., Chen, A.F., and Liu, X.
(2009). IL-18 accelerates the cell apoptosis by up-regulating cysteinyl leukotriene 2 receptor
expression in human umbilical vein endothelial cells at the early stage of administration.
Vascular pharmacology 50, 171-177.
Ziegler-Heitbrock, L. (2007). The CD14+ CD16+ blood monocytes: their role in infection and
inflammation. Journal of leukocyte biology 81, 584-592.
191
Zintzaras, E., Rodopoulou, P., and Sakellaridis, N. (2009). Variants of the arachidonate 5lipoxygenase-activating protein (ALOX5AP) gene and risk of stroke: a HuGE gene-disease
association review and meta-analysis. American journal of epidemiology 169, 523-532.
Zweier, J.L. (1988). Measurement of superoxide-derived free radicals in the reperfused heart.
Evidence for a free radical mechanism of reperfusion injury. The Journal of biological chemistry
263, 1353-1357.
192
Appendix
Formulae Used to Calculate Cardiac Function from Echocardiography Images
Left ventricular volume, diastole (LV Vol;d)
= ((7.0 / (2.4 + LVID;d)) * LVID;d3
P
Left ventricular volume, systole (LV Vol;s)
= ((7.0 / (2.4 + LVID;s)) * LVID;s3
P
Ejection fraction
= 100 * ((LV Vol;d – LV Vol;s) / LV Vol;d)
Fractional shortening
= 100 * ((LVID;d – LVID;s) / LVID;d)
Stroke volume (SV)
= LV Vol;d – LV Vol;s
Cardiac output
= SV/HR
Left ventricular mass
= 1.053 * ((LVID;d + LVPW;d + IVS;d)3– LVID;d3
P
P
P
Abbreviations: LVID; left ventricular internal dimension, LVPW; left ventricular posterior wall,
IVS; interventricular septum, HR; heart rate, d; diastole, s; systole
193