1. health and fitness
2. disease

Nephron, 2015, 129(2), 104-108
M235T polymorphism in the AGT gene and A/GI8-83
substitution in the REN gene correlate with end stage renal
disease
Saumya Sarkar1, Vikas Gupta2, Ajay Kumar3, Manoj Chaudhary4, Subhash Diyundi5,
Prabodh K Sehajpal6, Kumarasamy Thangaraj7, Singh Rajender1*
1
Division of Endocrinology, Central Drug Research Institute, Lucknow, India
Department of Biotechnology, DAV College, Amritsar, Punjab, India
3
Immunology Group, International Centre for Genetic Engineering and Biotechnology, New Delhi, India
4
Department of Nephrology, Kidney Hospital, Jalandhar, Punjab, India
5
Apeejay Stya University, Gurgaon, India
6
Department of Molecular Biology and Biochemistry, Guru Nanak Dev University, Amritsar, India
7
Centre for Cellular and Molecular Biology, Hyderabad, India
* Corresponding author, Dr. Singh Rajender, Division of Endocrinology, Central Drug Research Institute,
Lucknow, India, E-mail: [email protected], Phone No. 522-2612411-18 Extn. 4393, Fax: +91-5222771941
Word count: Abstract – 188; Manuscript – 1436
Running title: AGT and REN polymorphisms in ESRD
2
Abstract
Background/Aims
This study aimed at investigating if M235T polymorphism in the AGT gene and A/GI8-83
polymorphism in the REN gene correlate with the end stage renal disease (ESRD).
Methods
We analyzed one hundred and seventy three patients having ESRD and three hundred and
twenty-nine individuals with normal kidney function for differences in the genotype distribution
of AGT-M235T and REN-A/GI8-83 polymorphisms between the two groups. The data for cases
and controls were compared using chi square test.
Results
We found significantly higher levels of serum creatinine and CRP in cases in comparison to
controls (P< 0.0001). Data comparison showed significant association of AGT M235T
substitution with ESRD in dominant model (p = 0.008) and in comparison of heterozygous
substitution against homozygous common genotype (p = 0.005). Similarly, REN A/GI8-83
polymorphism showed a significant difference in the distribution of genotypes between cases and
controls (p= < 0.038) such that heterozygous substitution was significantly more common in the
ESRD cases in comparison to homozygous common genotype (p = 0.023).
Conclusion
We conclude that heterozygous substitutions at AGT M235T and REN A/GI8-83 loci correlate
significantly with ESRD in a north Indian population.
Keywords: End stage renal disease, REN gene, AGT gene, Renin angiotensin system
INTRODUCTION
Epidemiological investigations on nephropathic patients with diabetes and hypertension have
suggested early onset of renal failure and the end stage renal disease (ESRD) [1].Hypertension
and albuminuria are the most potent predictors of bad renal function, which is connected to
Nephron, 2015, 129(2), 104-108
alteredRenin-Angiotensin System (RAS) [2].Angiotensin II,the end product of RAS, is a crucial
modulator of primary systems like blood pressure, sodium metabolism, and renal hemodynamic
function.Hyperglycemia causes microvascular complications in the kidney, and diabetic
nephropathy is the prime causative factor for renal failure and ESRD,which is characterized by
Angiotensin II generation [3].Polymorphisms in the RAS and DNA repair genes may
compromise renal capacity and hence the risk of ESRD.
Angiotensinogen is a glycoprotein produced by liver and encoded by angiotensinogen
gene (AGT). Cleavage of angiotensinogen to produce angiotensin I is mediated by the renin
photolytic enzyme that isencoded by the REN gene. Therefore, the level and activity of
Angiotensin I can be affected by polymorphisms in the AGT and REN genes.M235T is such a
variant of AGT, which results in the substitution of threonine instead of methionine at
235thresidue.Patients homozygous for T allele show significantly higher levels of plasma AGT
than those having other genotypes[4].On the other hand, a common intronic polymorphism in
intron eight of the REN gene,A/GI8-83, has never been investigated in the ESRD patients. In the
present study, we have chosen a commonly studied and a rarely studied polymorphism in the
RAS genes for correlation with ESRD in Indian patients.
MATERIALS AND METHODS
Subject recruitment and sample collection
Cases were recruited from the Guru Nanak Dev Hospital, Amritsar and Kidney Hospital,
Jalandhar, INDIA. Patients included in the study had prolonged high levels of serum
creatinineand had been advised either for dialysis or renal transplant.The final confirmation of
ESRD was based on doctor’s recommendations. One hundred and seventy three patients having
ESRD were identified and peripheral blood samples (2-3 ml) were collected in EDTA coated
vials, before starting of their hemodialysis procedure. Patients’ clinical details were duly filled in
a spreadsheet designed for this purpose.Three hundred and twenty-nine blood samples from
normal individualsresiding in the surrounding areas of Jalandhar and Amritsar were collected to
serveas controls. Non- hypertensive and non-diabetic subjects were included based on a clear
renal function history.The study was presented in front of and approved by the Research Degree
Committee of the Faculty of Life Sciences, Guru Nanak Dev University, Amritsar. Informed
written consent of the participants was obtained.
DNA isolation
DNA was isolated from the peripheral blood samples according to the phenolchloroform-isoamylalcohol protocol illustrated in our earlier study [5]. The concentration of
DNA preparation was determined using spectrophotometric method by reading absorbance at
260 nm, which was followed by preparation of working dilutions (10 ng/μl) in standard TE
buffer. The quality of DNA preparation was evaluated by electrophoresis on 1% agarose gel.
PCR Amplification and Genetic Analysis
The primers for AGT M235T were, forward: 5’CCGTTTGTGCAGGGCCTGGCTCTCT
3’ and reverse: 5’ CAGGGTGCTGTCCACACTGGACCCC 3’ and for REN I8-83 were, forward:
5’ TGAGGTTCGAGTCGGCCCCCT 3’ and reverse: 5’ TGCCCCAAACATGGCCACACAT
3’. PCR composition and temperature conditions are detailed in Supplementary text. The
amplicons were purified using Millipore MultiScreen® PCRµ96 Filter Plates and sequenced
using BigDye chain termination chemistry on a 3730 DNA analyzer (Applied Biosystems, USA).
Nephron, 2015, 129(2), 104-108
Multiple alignment and sequence analyses were done using Auto Assembler Software (Applied
Biosystems, USA).
Statistical analysis
Genotype data for the control group were analyzed for fitness in the Hardy Weinberg
equilibrium using online tool available at http://ihg.gsf.de/cgi-bin/hw/hwa1.pl. All other
statistical analyses were done using the SPSS software (version 11; SPSS Inc, Chicago, Illinois).
Genotypes between cases and controls were compared using 2x3 contingency table. This was
followed by genotype comparison using dominant, recessive and co-dominant models.Two sided
P values of less than 0.05 (95% level of confidence) were considered significant for statistical
inference.
RESULTS
Demographic details of patients and controls
Basic clinical parameters were tabulated and compared between cases and controls
(Supplementary Table1). We found significantly higher levels of serum creatinine and CRPin the
cases in comparison to controls (P<0.0001).
Table 1. Comparison of the AGT M235T genotypes between cases and controls.
Analysis model
Dominant
Recessive
Co-dominant
Genotype
CC
CT+TT
CC+CT
TT
CC
CT
CC
TT
CT
TT
Cases (%)
34 (19.65)
139 (80.35)
131 (75.72)
42(24.28)
34 (19.65)
97 (56.07)
34 (19.65)
42 (24.28)
97 (56.07)
42 (24.28)
Controls (%)
101 (30.70)
228 (69.30)
250 (75.98)
79 (24.01)
101 (30.70)
149 (45.29)
101 (30.70)
79 (24.01)
149 (45.29)
79 (24.01)
Statistical inference
p=0.008
OR=1.81 (1.16-2.81)
p=1.000
OR=1.01 (0.66-1.55)
p=0.005
OR=1.93 (1.21-3.08)
p=0.096
OR=1.58 (0.92-2.71)
p=0.380
OR=0.82 (0.52-1.28)
Genotype comparison
AGT M235T substitution increases the risk of ESRD
The genotype frequency in the control group followed Hardy-Weinberg Equillibrium. Data
comparison using 2x3 contingency table showed a significant difference in the distribution of
genotypes between cases and controls (p= 0.019). The frequency of heterozygous genotype was
relatively higher in cases in comparison to controls (Table 1). Further comparisons using
dominant and recessivemodels showed significant association of this substitution with ESRD in
dominant model (p = 0.008) (Table 1).Data comparison in co-dominant models showed
significant association of heterozygous genotype with ESRD in comparison to homozygous
common genotype (p = 0.005). Therefore, it can be concluded that heterozygous substitution at
AGT M235T correlates with ESRD significantly.
REN G/AI8-83 substitution increases the risk of ESRD
Nephron, 2015, 129(2), 104-108
The genotype frequency in the control group followed the Hardy–Weinberg equilibrium.
Genotype comparison using 2x3 contingency table showed a significant difference in the
distribution of genotypes between cases and controls (p = 0.038); particularly noticeable was a
higher frequency of the heterozygous genotypes in the cases (47.97%) in comparison to controls
(36.4%)(Table 2).Further analyses using dominant, recessive, and co-dominant models showed
that heterozygous substitutionincreased the risk of ESRD in comparison to homozygous
genotypes(P = 0.023) (Table 2). The frequency of heterozygous plus homozygous substitution
was relatively much higher in the cases in comparison to the controls; however, the differences
were not statistically significant (p = 0.066).Therefore, it can be concluded that heterozygous
substitution at REN G/AI8-83 locus is a significant ESRD risk factor in comparison to homozygous
common genotype.
Table 2. Comparison of the REN G/AI8-83 genotypes between cases and controls.
Analysis
model
Dominant
Recessive
Co-dominant
Genotype
Cases (%)
Controls (%)
Statistical inference
GG
GA+AA
GG+GA
AA
GG
80 (46.24)
93 (53.75)
163 (94.2)
10 (5.78)
80 (46.24)
165 (55)
135 (45)
274 (91.4)
26 (8.6)
165 (55)
p=0.066
OR=1.42 (0.97-2.07)
p=0.254
OR=0.64 (0.30-1.37)
GA
83 (47.97)
109 (36.33)
GG
80 (46.24)
165 (55)
AA
10 (5.78)
26 (8.67)
p=0.559
OR=0.79 (0.36-1.72)
GA
AA
83 (47.97)
10 (5.78)
109 (36.33)
26 (8.67)
p=0.083
OR=0.51 (0.23-1.10)
p=0.023
OR=1.57 (1.06-2.32)
DISCUSSION
We found that heterozygous substitutions at both,AGT M235T and REN I8-83, loci were risk
factors for nephropathy and ESRD. Among other studies on AGT M235T polymorphism,an
investigation on Asian non-insulin dependent diabetes mellitus cohort found no difference in
genotypesdistribution of AGT M235T between normal renal function and poor renal function
groups [6].Later, three studies on Chinese populations showed increased risk of diabetic
nephropathy in type-2 diabetes mellitus peoplecarrying TT genotype [7-9].Another Asian study
showed that the frequency of AGT M235T substitution was significantly higher in diabetes
mellitus nephropathy [10].Similarly, astudy on aEuropean population with type-1 diabetes
mellitus found TT genotype to be linked with diabetic nephropathy [11].Investigation on a
Turkish population reported no effect of M235T substitution on the risk of ESRD in diabetic
mellitus patients; however, another study on the same population found significant effect of this
polymorphism on diabetic nephropathy [12, 13].In a Caucasian population, AGT 235T variant
was found to be unrelated to ESRD, but this investigation was undertaken on a small sample size
[14]. A German group also reported lack of association between M235T polymorphism and
ESRD [15].
Nephron, 2015, 129(2), 104-108
An investigation on a fairly large Caucasian cohortreported no correlation of AGT
polymorphism with hypertension, but suggested homozygous rare genotype to be a possible
marker for renal failure [16].Basset et al showed a lack of association between the AGT
polymorphism and high blood pressure in patients at the risk of ESRD [17].Another Korean
study found no association of AGT M235T polymorphism with hypertension towards the onset
of ESRD [18].However, astudy on Hungarian ESRD individuals illustrated asignificant
correlation of MT (CT) genotype in juvenile hypertension patients with ESRD [19]. A recent
meta-analysis suggestedan ethnic specific effect of this polymorphism such thatCaucasians
having T allele or TT genotype were more prone to ESRD than Asians and Africans [20].Since
our study population has close affinity with Caucasians than East Asians, we support the
hypothesis that M235Tsubstitution may show ethnic specific association with ESRD.
REN I8-83 polymorphism has never been investigated in the ESRD cases.We found that REN I8-83
polymorphism correlated with ESRD with a higher risk inthe heterozygous genotypes.Only two
studies have correlated this polymorphism with high blood pressure [21, 22]. Further studies on
different ethnic populations would provide useful data for reaching consensus about its
correlation with ESRD.
We conclude that heterozygous substitutions at both thelociinvestigated in this study increase the
risk of ESRD in an Indo-European population of India. This is the first report on association of
these polymorphisms with ESRD in north Indian population. Literature suggests that M235T
substitution may affect the risk of renal failure, but in an ethnic-specific manner. Similarly,
heterozygous substitution at REN I8-83 locus increases the risk of ESRD, but it would require
further investigations as it has been relatively less investigated.
Acknowledgement:
CSIR-CDRI Communication No. 8880
References
1. Pontremoli R, Ravera M, Viazzi F, Nicolella C, Berruti V, Leoncini G, Giacopelli F,
Bezante GP, Sacchi G, Ravazzolo R, Deferrari G. Genetic polymorphism of the reninangiotensin system and organ damage in essential hypertension. Kidney Int. 2000; 57:
561–569.
2. Parving HH, Osterby R, Ritz E. Diabetic Nephropathy. In The Kidney, 6th Edition,
Brenner BM, Levine S, Eds Philadelphia, WB Saunders, 2000: 1731-1773.
3. Ritz E, Dikow R. Hypertension and antihypertensive treatment of diabetic nephropathy.
Nat ClinPractNephrol. 2006; 2: 562–567.
4. Mehri S, Mahjoub S, Farhati A, Bousaada R, Ben Arab S, Baudin B, Hammami M.
Angiotensinogen gene polymorphism inacute myocardial infarction patients. J Renin
Angiotensin Aldosterone Syst. 2011; 12: 42–47.
Nephron, 2015, 129(2), 104-108
5. Thangaraj K, Joshi M B, Reddy AG, Gupta NJ, Chakravarty B, Singh L. CAG repeat
expansion in the androgen receptor gene is not associated with male infertility in Indian
populations. J Androl. 2002; 23: 815-818.
6. Yoshida H, Kuriyama S, Atsumi Y, Tomonari H, Mitarai T, Hamaguchi A, Kubo H,
Kawaguchi Y, Kon V, Matsuoka K, Ichikawa I, Sakai O.. Angiotensin I converting
enzyme gene polymorphism in non-insulin dependent diabetes mellitus. Kidney Int. 1996;
50: 657–664.
7. Young RP, Chan JC, Critchley JA, Poon E, Nicholls G, Cockram CS. Angiotensinogen
T235 and ACE insertion/deletion polymorphisms associated with albuminuria in Chinese
type 2 diabetic patients. Diabetes Care. 1998; 21: 431–437.
8. Wang J, Zhu X, Yang L, Liu Y, Zhou W, Li H. Relationship between angiotensinogen
gene M235T variant with diabetic nephropathy in Chinese NIDDM. Chin Med J
(Engl). 1999; 112: 797–800.
9. Wu S, Xiang K, Zheng T, Sun D, Weng Q, Zhao H, Li J.. Relationship between the
renin-angiotensin system genes and diabetic nephropathy in the Chinese. Chin Med J
(Engl). 2000; 113: 437–441.
10. Chang HR, Cheng CH, Shu KH, Chen CH, Lian JD, Wu MY. Study of the polymorphism
of angiotensinogen, angiotensin-converting enzyme and angiotensin receptor in type II
diabetes with end-stage renal disease in Taiwan. J Chin Med Assoc. 2003; 66: 51–56.
11. Fogarty DG, Harron JC, Hughes AE, Nevin NC, Doherty CC, Maxwell AP. A Molecular
variant of angiotensinogen is associated with diabetic nephropathy in
IDDM. Diabetes. 1996; 45: 1204-1208.
12. Eroğlu Z, Cetinkalp S, Erdogan M, Kosova B, Karadeniz M, Kutukculer A, Gunduz
C, Tetik A, Topcuoglu N, Ozgen AG, Tuzun M. Association of the angiotensinogen
M235T and angiotensin-converting enzyme insertion/deletion gene polymorphisms in
Turkish type 2 diabetic patients with and without nephropathy. J Diabetes Complications.
2008; 22: 186–190.
13. Reis KA, Ebinç FA, KoçE Demirci H, Erten Y, Güz G, Derici UB, Bali
M, Söylemezoğlu O, Arınsoy T, Sindel S. Association of the angiotensinogen M235T
and APO e gene polymorphisms in turkish type 2 diabetic patients with and without
nephropathy. Ren Fail. 2011; 33: 469–474.
14. Hunley TE, Julian BA, Phillips JA 3rd, Summar ML, Yoshida H, Horn RG, Brown
NJ, Fogo A, Ichikawa I, Kon V. Angiotensin converting enzyme gene polymorphism:
potential silencer motif and impact on progression in IgA nephropathy. Kidney Int. 1996;
49: 571-577.
Nephron, 2015, 129(2), 104-108
15. Schmidt S, Stier E, Hartung R, Stein G, Bahnisch J, Woodroffe AJ, Clarkson AR,
Ponticelli C, Campise M, Mayer G, et al. No association of converting enzyme
insertion/deletion polymorphism with immunoglobulin A glomerulonephritis. Am J
Kidney Dis. 1995; 26: 727-731.
16. Pei Y, Scholey J, Thai K, Suzuki M, Cattran D. Association of angiotensinogen gene
T235 variant with progression of immunoglobinA nephropathy in Caucasian patients. J
Clin Invest. 1997; 100: 814-820.
17. Basset E, Berthoux P, Cecillon S, Deprle C, Thibaudin D, De Filippis JP, Alamartin
E, Berthou F. Hypertension after renal transplantation and polymorphism of genes
involved in essential hypertension: ACE, AGT, AT1 R and ecNOS. ClinNephrol. 2002;
57: 192–200.
18. Lee KB, Kim UK. Angiotensinogen and angiotensin II type 1 receptor gene
polymorphism in patients with autosomal dominant polycystic kidney disease: Effect on
hypertension and ESRD. Yonsei Med J. 2003; 44: 641–647. 19. Papp F, Friedman AL, Bereczki C, Haszon I, Kiss E, Endreffy E, Túri S. Renin–
angiotensin gene polymorphism in children with uremia and essential hypertension.
PediatrNephrol. 2003; 18: 150–154.
20. Zhou TB, Yin SS, Qin YH.Association of angiotensinogen M235T gene polymorphism
with end-stage renal disease risk: a meta-analysis. Mol Bio Rep. 2013; 40: 765-772.
21. Okura T, Kitami Y, Hiwada K. Restriction fragment length polymorphisms of the human
renin gene: association study with a family history of essential hypertension. J Hum
Hypertens. 1993; 7: 457-461.
22. Frossard PM, Lestringant GG, Elshahat YI, John A, Obineche EN. An MboI two-allele
polymorphism may implicate the human renin gene in primary hypertension. Hypertens
Res. 1998; 21: 221–225.