1. No category

Molecular Basis of Cell and
Developmental Biology:
IL-6 induces keratin expression in
intestinal epithelial cells: Potential role of
keratin-8 in IL-6 induced barrier function
alterations
Lixin Wang, Shanthi Srinivasan, Arianne
Theiss, Didier Merlin and Shanthi V.
Sitaraman
J. Biol. Chem. published online January 9, 2007
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
• When this article is cited
• When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/early/2007/01/09/jbc.M604068200.citation.full.html#ref-list-1
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Access the most updated version of this article at doi: 10.1074/jbc.M604068200
JBC Papers in Press. Published on January 9, 2007 as Manuscript M604068200
The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M604068200
IL-6 INDUCES KERATIN EXPRESSION IN INTESTINAL EPITHELIAL CELLS:
POTENTIAL ROLE OF KERATIN-8 IN IL-6 INDUCED BARRIER FUNCTION
ALTERATIONS
Lixin Wang, Shanthi Srinivasan, Arianne Theiss, Didier Merlin, Shanthi V. Sitaraman#
Division of Digestive Diseases, Department of Medicine, Emory University, Atlanta, GA.
# Address correspondence to: Shanthi V. Sitaraman, Division of Digestive Diseases,
Room 201-F, 615, Michael Street, Whitehead Research Building, Emory University, Atlanta,
GA, 30322. Phone: 404-727-2430, Fax: 404-727-5767, email [email protected]
Running title: IL-6 induces keratin expression
wherein barrier dysfunction underlies the
inflammatory response.
INTRODUCTION
Keratins are a family of structural proteins that
form the intermediate filaments of the
cytoskeleton in epithelial cells (1,2). They are
among the most abundant cytoskeletal proteins
and constitute up to 5% of total cellular proteins in
the intestinal epithelium. At least 49 keratins
subtypes have been identified so far (3). These
proteins are encoded by a large mutigene family,
whose individual members can be divided into
type I (acidic) and type II (neutral and basic)
classes on the basis of their sequence. The
prototype structure of all intermediate filament
proteins, including keratins, consists of a
structurally conserved central coiled-coil -helix
termed the "rod" that is flanked by non-helical Nterminal "head" and C-terminal "tail" domains (4).
Most of the structural heterogeneity of the
different keratins resides in their head and tail
domains, which also contain all of the known
phosphorylation sites (1,5). The type I and type II
keratins are regulated in a pair-wise and tissuespecific pattern in epithelial tissues of various
types including the intestine (6). Epithelial cells
express keratin pairs that are assembled as obligate
heteropolymers of type I (Keratins K9-K20) and
type II (K1-K8) keratin (1,2,4,7). Thus all
epithelial cells express at least one type I and one
type II keratin in an overall 1:1 stoichometry. Each
keratin pair has a specific and characteristic tissue
distribution pattern. For example, the thick
external barrier such as the skin express primarily
1
Copyright 2007 by The American Society for Biochemistry and Molecular Biology, Inc.
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
ABSTRACT
Keratin 8 (K8) and keratin-18 (K18) are the
major intermediate filament proteins in the
intestinal epithelia. The regulation and function
of keratin in the intestinal epithelia is largely
unknown. In this study we addressed the role
and regulation of K8 and K18 expression by IL6. Caco2-BBE cell line and IL-6 null mice were
used to study the effect of IL-6 on keratin
expression. Keratin expression was studied by
Northern blot, Western blot and confocal
microscopy. Paracellular permeability was
assessed by apical-to-basal transport of a FITC
dextran probe (FD-4). K8 was silenced using
siRNA approach. IL-6 significantly upregulated
mRNA and protein levels of K8 and K18.
Confocal microscopy showed a reticular
pattern of intracellular keratin localized to the
sub-apical region after IL-6 treatment. IL-6
also induced serine phosphorylation of K8. IL-6
decreased paracellular flux of FD-4 compared
to vehicle treated monolayers. K8 silencing
abolished the decrease in paracellular
permeability induced by IL-6. Administration
of dextran sodium sulfate (DSS) significantly
increased intestinal permeability in IL-6-/- mice
compared to WT mice given DSS. Collectively,
our data demonstrate that IL-6 regulates the
colonic expression of K8 and K18 and K8/K18
mediates barrier protection by IL-6 under
conditions where intestinal barrier is
compromised. Thus our data uncover a novel
function of these abundant cytoskeletal proteins
which may have implications in intestinal
disorders such as inflammatory bowel disease
Materials and Methods
Reagents and antibodies:
All tissue culture supplies were obtained from
GIBCO (Grand Island, NY). Reagents for SDSPAGE and nitrocellulose membranes were from
Bio-Rad (Hercules, Ca). Anti-K18 monoclonal
antibody was obtained from Santa Cruz
Biotechnology (Santa Cruz, Ca). Rabbit
polyclonal antibodies (used for confocal
microscopy at 1:400 dilution) were a kind gift
from Dr. Bishr Omary (31). Anti-K8/18 mouse
monoclonal antibody (used for Western blot at
1:1000 dilution) and anti-phospho-K8 ser431
and ser73 was obtained from Labvision (1:100
dilution) and anti-tubulin mouse monoclonal
antibody was from Sigma (St. Louis, Mo).
Phosphatase inhibitor cocktail and fluorescein
isothio-cyanate-dextran -FD 4, were from Sigma
(St. Louis, Mo). The One-step RT-PCR kit was
obtained
from
Qiagen
(Valencia,
CA).
Oligofectamin and Lipofectamine 2000 are from
Invitrogen Life Technologies (Carlsbad, Ca).
Human K8 RNAi was from Invitrogen (Carlsbad,
2
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
epithelial injury that characterize these diseases
(19,20). Cytokines play a central role in regulating
epithelial barrier function during inflammation.
We have previously shown that interleukin-6 (IL6) plays a protective role in epithelial barrier
function (21) in contrast to interferon-γ or tumor
necrosis factor-α, which decrease barrier function
(22). IL-6 is a potent immunoregulatory cytokine
with pro- and anti-inflammatory properties. Its
expression, under physiological conditions, is
important for the host response to a number of
infections and under pathological states, excessive
secretion of IL-6 may play a major role in the
pathogenesis of many diseases including IBD (2325). In addition to its effect on immune cells, we
and others have shown that intestinal epithelial
cells are an important source of IL-6 (26) and
intestinal epithelial cells express IL-6 receptors at
the same density or higher than monocytes (2730). IL-6 acts on epithelial cells in an autocrine or
paracrine fashion to activate the classical STAT
signaling pathway as well as NF-kB signaling
pathway (29). In this study we addressed the role
and regulation of intestinal epithelial keratins, K8
and K18 by IL-6 and IL-6-mediated barrier
function alterations.
K1 and K5 (type II) and K10 and K14 (type I)
while the internal epithelia such as the intestine
express principally K8 (type II) and K18 (type I)
and with variable levels of K7, K19 and K20
depending on the cell type (1,8,9).
One clearly delineated function of keratins
in many tissues is to protect cells from mechanical
and non-mechanical forms of injury (1,10,11).
Impressive progress have been made over the past
decade or so in linking at least 14 of the keratins to
a number of skin, oral, esophageal, and liver
diseases (6,12). However, a full appreciation of
keratin function in the intestine has been lagging.
Recent studies have reported K8 missense
mutation in a subset of patients with inflammatory
bowel disease (IBD). These mutations have been
shown to result in incompetent keratin
polymerization that may lead to increased
epithelial fragility (13,14). Based on these
observations, K8 might play a pathogenetic role in
IBD. This is substantiated by animal data obtained
from K8 or K18 null mice. For example, the
phenotype resulting from K8 deletion has
demonstrated an important role for keratins in
epithelial barrier integrity and inflammation
(15,16). K8 null mice in C57BL/6 background die
in utero predominantly due to placental barrier
dysfunction mediated by TNF-α (17). On the other
hand, K8 null mice in FVB/N background survive
to adulthood but develop colonic hyperplasia,
rectal prolapse and Th-2 mediated colitis that is
amenable to antibiotic treatment (15). Although
the mechanism by which K8 null mice develop
barrier dysfunction or colitis is not known, it is
hypothesized that absence of K8 leads to
mistargeting of cellular proteins (such as anionexchanger 1,2), altered susceptibility to injury and
antigen processing culminating in a mucosal
inflammatory response (15,18). This model
underscores the importance of intestinal epithelial
keratin in injury and inflammation.
Loss of barrier function provided by
epithelial cells is thought to be the initial inciting
event that underlies injury and inflammation in
many intestinal disorders including shock, trauma,
sepsis and IBD. Such barrier defects results in the
migration of antigenic material, previously
confined to the intestinal lumen, into the submucosa exposing lamina propria immune cells to
naïve antigens eliciting inflammatory response and
solubilizing cells for 10 min at 4 °C with buffer
containing 1% Triton X-100, 5 mM EDTA, and a
protease
inhibitor
mix
(1
mM
phenylmethylsulfonyl fluoride, 10 µM leupeptin,
10 µM pepstatin, and 25 µg/ml aprotinin) in
phosphate buffered saline (PBS, pH 7.4) followed
by centrifugation (16,000 x g, 10 min). The
supernatant was collected as the soluble fraction.
The pellet was homogenized in 1 ml of 10 mM
Tris-HCl, pH 7.6, 140 mM NaCl, 1.5 M KCl, 5
mM EDTA, 0.5% Triton X-100, and the protease
inhibitor mix. After 30 min (4 °C), the
homogenate was pelleted (16,000 x g; 10 min),
and the pellet (insoluble fraction) was rehomogenized with 5 mM EDTA in PBS, pH 7.4
and dissolved in Laemmli sample buffer
containing 1% β-mercaptoethanol, sonicated, and
boiled for 5 min (35). The samples were separated
on 7.5 or 10% polyacrylamide gels according to
the method of Laemmli (35). Proteins were
electrotransferred to nitrocellulose membranes and
probed with primary antibody (anti K8/18,
1/1000). The membranes were incubated with
corresponding
peroxidase-linked
secondary
antibody
diluted
1:2000,
washed,
and
subsequently incubated with ECL reagents
(Amersham Pharmacia Biotech, Piscataway, NJ)
before
exposure
to
high-performance
chemiluminescence films (Amersham Pharmacia
Biotech). For Mr determination, polyacrylamide
gels were calibrated using standard proteins (BioRad) with Mr markers within the range 10-250
KD. Immunonoprecipitation was performed as
described (36,37). Briefly, cells were solubilized in
lysis buffer. After pelleting (16,000 x g; 15 min),
K8 was immunoprecipitated from the supernatant
using an anti-K8 antibody coupled to protein A/GSepharose. The beads were washed once with lysis
buffer and twice with PBS (3 mM EDTA).
Proteins were solubilized in 3x Laemmli sample
buffer and then immunoblotted as described above
with the relevant antibodies.
Plasmid and transient transfection:
For RNAi studies, Caco2-BBE cells grown on
0.45 cm2 filters were transfected with K8 specific
stealth RNAi duplex oligoribonucleotides (siRNA)
(UGGACACCUUGUAGGACUUCUGGGU) for
most effective knockdown of K8. Stealth RNAi
oligos are a chemically modified blunt-ended 25bp
RNA duplex that elicits the RNAi response in
cells.
It delivers highly specific, effective
3
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Ca). Recombinant IL-6 was obtained from R&D
Systems (Minneapolis, MN) and used at 100 ng/ml
added to the basolateral medium (29,32). This dose
of IL-6 was chosen based on our previous data
with respect to signaling as well as functional
responses of IL-6 in Caco2-BBE cells (26,29,32).
Cell culture:
Caco2-BBE cells
were grown as confluent
monolayers in Dulbecco’s Vogt modified Eagle’s
medium supplemented with 40mg/L penicillin,
90mg/liter streptomycin and 10% newborn calf
serum. Confluent stock monolayers were
subcultured by trypsinization. Experiments were
performed on cells plated for 8-10 days on
permeable supports of 0.33 cm2 or 4.5 cm2 inserts
(Costar, Cambridge, MA). Inserts (0.4-µm pore
size, Costar, Cambridge, MA) rested in wells
containing media until steady-state resistance was
achieved (29,32).
Northern blot:
Northern blot was performed as described
previously (29). Briefly, total RNA was extracted
from cells with Tri-reagent (Molecular Research
Center,
Cincinnati,
OH)
according
to
manufacturer’s protocol. Total RNA (20 µg) was
separated on 1% formaldehyde agarose gel and
transferred to Gene Screen Plus membranes (NEN
Life Science Products, Boston, MA). After
fixation under calibrated UV light, the membranes
were hybridized with -32P-labeled K8, K18 or
GAPDH
cDNA
and
visualized
by
autoradiography. The probe for K8 cDNA was
generated by RT-PCR using K8 specific primers
5'-atgtccatcagggtgaccca-3’'
and
5'tgttcacttgggcaggacgtcag-3’ (1454-bp product) and
ligated into PCR2.1 vector. Sequence was verified
by DNA sequencing (Emory DNA Core Facility).
Hind III was used to excise the probe.
Complementary cDNA clones encoding K18 and
GAPDH were purchased from Research Genetics
(Huntsville, AL).
SDS-PAGE, Western blot and immunoprecipitation:
For Western blot analysis, colonic tissues were
homogenized and extracted with lysis buffer.
Samples were then centrifuged at 12,000 rpm for
10 minutes at 4°C and the resulting supernatant
was used for assays. Keratin-enriched cytoskeletal
preparations from Caco2-BBE cells were made as
described (33,34). Briefly, Triton X-100-soluble or
Triton X-100-insoluble fractions were prepared by
subtract background, the threshold of each channel
was set at the value obtained for background. The
average pixel intensity +1 standard deviation was
measured for the thresholded images. The data is
presented as the mean (± SEM.).
Colon tissue from WT and IL-6 -/- mice embedded
in paraffin or optimal cutting media (OCT) were
obtained as described by Castaneda et al (39). The
sections were rehydrated using graded alcohols.
Sections were treated with 0.5% Triton-X 100 +
0.08% saponin in PBS at room temperature for 35
min. The sections were rinsed in PBS and
incubated with rhodamine-phalloidin (1:60)
diluted in PBS for 40 min at room temperature.
Sections were subsequently blocked with 2% BSA
for 1 hour at room temperature. Sections were
incubated with primary antibody, K8/K18
(Chemicon; 15µg/ ml in 2% BSA in PBS solution)
or rabbit IgG (Sigma, control) or anti-actin
(Sigma; 1:50,000 in 2%BSA) for 1 hour at room
temperature. After washing three times with PBS
they were incubated with FITC conjugated
secondary antibody (BioRad; 1:100 in 2% BSA in
PBS solution) or rhodamine conjugated antimouse secondary antibody (BioRad; 1:100 in 2%
BSA in PBS solution), for 45 minutes at room
temperature and then mounted with Slow Fade
(Molecular Probes, Eugene, OR) mounting
medium and examined using Zeiss LSM
microscope.
Measurement of macromolecular permeability:
Paracellular permeability was determined by
measuring apical to basolateral flux of
fluoresceinated dextran (FD-4, MW 4 kDa; Sigma,
St. Louis, Mo) using a modification of previously
described method (40).
Briefly, confluent
epithelial monolayers on 0.33-cm2 0.4 µm pore
size permeable supports were washed twice with
Hank's balanced salt solution containing calcium
chloride and magnesium sulfate (HBSS+) and
maintained at 37°C on a shaking, warm plate. FD4, 1 mg/mL, was added apically at time 0, and 50µL samples were removed from the basolateral
compartment at 30-minute intervals from 0 to 120
minutes, inclusive. Fluorescence intensity of each
sample was measured (excitation, 492 nm;
emission, 525 nm; Cytofluor 2300; Millipore
Corp., Waters Chromatography, Bedford, MA)
4
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
knockdown with greater stability compared to
unmodified siRNA molecules. Only the antisense
strand can participate in RNAi, avoiding unwanted
off-target effects, allowing effective knockdown
only of the targeted gene. Stealth RNAi’s chemical
modification minimizes the induction of nonspecific cellular stress response pathways.
BLOCK-iT Fluorescent Oligo (Invitrogen,
Carlsbad, Ca) as well as scrambled K8 RNAi were
used as control. BLOCK-iT is a fluorescentlabeled, double-stranded RNA duplex with the
same length, charge, and configuration as standard
siRNA. The sequence of the BLOCK-iT
Flouresecnt Oligo is not homologous to any
known gene, ensuring against induction of nonspecific cellular events caused by introduction of
the oligo into cells (38). Cells were transfected
with appropriate vectors using lipofectamine 2000
(Invitrogen, Carlsbad, Ca) according to
manufacturer’s protocol. 48 hours after
transfection, cells were stimulated with IL-6 and
permeability to FITC dextran (4 kDa) was
performed as described below. Total cell lysates
were collected for K8 expression.
Confocal microscopy:
Monolayers of Caco2-BBE cells were washed in
HBSS, fixed in buffered 3.7% paraformaldehyde
for 20 min, incubated overnight with primary
antibody (anti K8/18 rabbit polycloncal antibody,
1:400) in a humidity chamber, washed with PBS,
and subsequently incubated with fluorosceinated
secondary antibodies (Jackson ImmunoResearch
Laboratories, West Grove, PA). Monolayers were
also counterstained with rhodamine-phalloidin to
visualize actin. Monolayers, mounted in pphenylenediamine glycerol (1:1) were analyzed by
confocal microscopy (Zeiss dual laser confocal
microscope; Zeiss, Oberkochen, Germany) as
described previously (36). Using actin staining, the
apical most surface of the cell was marked as 0 µm
and basolateral surface was marked at the level of
actin stress fiber (18.7 µm from the top of the cell).
xy sections were taken at 1.2 µm from the top
(above the level of tight junction) and at the level
of actin stress fiber. Quantitation of confocal
images were performed on unprocessed images
using Metamorph Imaging System Software
(Universal Imaging Corp., West Chester, PA) as
described (36). The average grayscale pixel
intensity +1 standard deviation of a small region
was measured and defined as background. To
observed daily and evaluated for changes in body
weight.
RESULTS
IL-6 increases the expression of K8/K18: To
determine if IL-6 modulates keratin expression,
Caco2-BBE cells, grown in tissue culture inserts,
were stimulated via the basal surface with IL-6
(100 ng/ml). Cells were lysed at various times
after IL-6 stimulation and mRNA and protein
expression of K8/K18 was determined by
Northern blot and Western blot respectively as
described in Methods section. As seen in Figure
1A, small amount of K8 mRNA was detected at
baseline. However, K8 mRNA was significantly
increased at 2h and was maximal at 4h. Similar
results were obtained with K18. Like K8, IL-6
induced mRNA expression of K18 at 2 hours and
maximal at 4 hours. K18 mRNA levels returned to
baseline at 8 hours after IL-6 stimulation. Protein
expression of K8 and K18 reflected mRNA
expression (Figure 1B). K8 expression was seen
at 4 hours and K8 protein level was maximal 1224 hours after IL-6 stimulation. K18 protein
expression also increased at 4 hours and was
maximal at 24 hours.
We next examined the distribution of
K8/K18 in Caco2-BBE cells. To localize keratin,
immunofluorescence staining was performed using
anti-K8/K18 antibody. Cells were treated with
vehicle or IL-6 (24 hours), fixed with
paraformaldehyde and keratin distribution was
examined by confocal microscopy (Figure 2).
Reticular pattern of keratin was seen at the
periphery of control cells. IL-6 significantly
increased the expression of K8/K18, which was
most prominent in the subapical region as seen in
xz computer reconstructed images. The en face (xy
plane) images of Caco2-BBE epithelia were taken
at the subapical region (1.2 µM from the top of the
cell, at the level of apical junctional complex). To
quantitate the expression of K8/K18, the pixel
intensity of the confocal images taken at the
subapical surface was measured as described in
the methods section. IL-6 treatment increased the
expression of K8/K18:β-actin by 2.5 fold
compared to vehicle treatment (p<0.001).
Experimental animals:
The Animal Care Committee of the Emory
University, Atlanta approved all procedures
performed on animals and was in accordance with
the Guide for the Care and Use of Laboratory
Animals, published by the U.S. Public Health
Service. IL-6-/- mice (C57/B6 background) were
purchased from Jackson Laboratories. The
homozygous IL-6 deficient mice used were
progeny of heterozygous breeding pairs of C57/B6
background with disruption of the IL-6 gene that
were backcrossed for more than six generations.
These mice developed normally and were fertile.
Age and sex matched WT and IL-6-/- littermates
used in the study were between 6 and 8 weeks old
at the beginning of the experimental protocol and
were maintained under conditions as described
previously (39). Mice were given DSS (ICN
Biomedicals, Aurora, OH) at 3% (wt/vol) in tap
water ad libitum for 4 days. Age-matched male
and female wild type and IL-6-/- littermates
receiving tap water served as control. Mice were
IL-6 induces the expression of keratin in the
cytoskeletal fraction: Most of the keratin is
distributed in the detergent-insoluble fraction.
5
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
and FITC-dextran concentrations were determined
from standard curves generated by serial dilution
of FITC-dextran. Paracellular flux was calculated
by linear regression of sample fluorescence (Excel
5.0, Microsoft WA, Power Macintosh 7200).
In vivo permeability assay to assess barrier
function was performed using a FITC-labeled
dextran method as described (41). Briefly, 6-8
week old WT and IL-6-/- mice were used. Food
and water were withdrawn for fours hours and
mice were gavaged with permeability tracer (60
mg/100 g body weight of FITC-labeled dextran,
FD-4, mol wt 4,000 Sigma, St. Louis, Mo). Serum
was collected retro-orbitally four hours after FD-4
gavage and fluorescence intensity of each sample
was measured (excitation, 492 nm; emission, 525
nm; Cytofluor 2300; Millipore Corp., Waters
Chromatography, Bedford, MA) and FITC-dextran
concentrations were determined from standard
curves generated by serial dilution of FITCdextran. Permeability was calculated by linear
regression of sample fluorescence (Excel 5.0,
Microsoft Office).
Data analysis
Results were analyzed using Student’s t test.
Differences were considered significant at the p <
0.05 level.
IL-6 induced barrier protective function is
mediated by K8: We next determined the effect of
K8 on IL-6 induced barrier protection. Caco2BBE monolayers were pretreated with IL-6 for 24
hours and paracellular permeability was
determined using 4 kDa (FD-4) molecular weight
FITC-dextran as described in Methods section. As
seen in Figure 4A, IL-6 treatment (100 ng/ml)
resulted in a decrease in FD-4 transepithelial flux
(vehicle: 6.4 ± 0.5, IL-6 3.9 ± 0.6 µM.cm-2.h-1
respectively; 38 ± 3% decrease compared to
vehicle treated monolayer, p<0.01). In order to
study the role of IL-6-induced K8 in its barrier
protective function, we used RNAi strategy to
achieve down regulation of K8 expression. We
chose K8 because it is the only type II keratin
present in Caco2-BBE cells (9). Since keratins are
obligate heterodimers requiring one type II partner,
the down-regulation of K8 would have a more
complete effect on the overall amount of keratins
than the manipulation of either type I keratin (K18
or K19). Accordingly, Caco2-BBE cells plated on
filters were transfected with K8-specific siRNA or
scrambled siRNA. After transfection (48 hours),
cells were stimulated with IL-6 for 24 hours.
Permeability was measured with FD-4 as
described in Methods section. As seen in Figure
4B, IL-6 treatment resulted in decreased
permeability in cells transfected with scrambled
siRNA (vehicle: 15.1 ± 1.6, IL-6: 9.81 ± 0.6 µM.
cm-2.h-1 respectively, p<0.04; 36 ± 6.1% decrease
compared to vehicle). Cells transfected with K8
siRNA showed no change in baseline permeability
compared to scrambled siRNA transfected cells
(14.9 ± 1.1 µM.cm-2.h-1). In contrast, there was a
loss of IL-6-mediated barrier protection in cells
with knock down of K8 (18.8 ± 1.2 µM.cm-2.h-1;
25% increase compared to K8 siRNA transfected
and treated with vehicle). K8/K18 protein was
significantly downregulated by K8 siRNA (Figure
4C). Together, these data suggest that K8 is
required for the barrier protective function of IL-6.
K8/K18 is involved in IL-6 mediated barrier
protection in vivo: We used IL-6-/- mice to
determine the effect of IL-6 in mediating barrier
protection in vivo. In order to determine
paracellular permeability in vivo, mice were
administered FITC-dextran by gavage and
fluorescence was quantitated in the serum as
described in Methods section. As shown in Figure
5, there was no difference in serum FD-4 level in
IL-6 increases keratin phosphorylation: An
important aspect of keratin function involves
phosphorylation at specific serine residues (33,4245). For example, phosphorylation at Ser-431
increases during mitosis or upon exposure to
epidermal growth factor in association with
filament reorganization (45). During a variety of
cellular stresses, including heat and drug exposure,
Ser-73 is phosphorylated, whereas under normal
conditions, it remains dephosphorylated. In order
to
determine
if
IL-6
induces
serine
phosphorylation of K8, cell were treated with
vehicle or IL-6 for 24 hours and cell lysates were
subjected to immunoblotting using K8 phosphospecific antibodies. As shown in Figure 3B, IL-6
induced K8 phosphorylation at p431 and p73
suggesting post-translational modification of
keratin in response to IL-6. Although baseline
phosphorylation levels of K8-p431 or p73
differed, the time course of phosphorylation in
response to IL-6 was similar. The IL-6-induced K8
phosphorylation was maximal at 12 hours (4.5 fold
increase of K8 p431:β-tubulin) and decreased at
24 hours (Figure 3B). Immunoflorescence images
using phospho serine 431 K8 were consistent with
results obtained by Western blot (Figure 3C).
6
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
However, under some conditions the solubility of
keratin may be increased by post-translational
modification such as phosphorylation (5). Such
modification is thought to contribute to protective
effects of keratin by altering its distribution or
association with other proteins (33,42-44). We
therefore determined the distribution of keratin
between detergent-soluble and –insoluble fractions
following IL-6 treatment. Caco2-BBE cells were
treated with IL-6 for varying times and cell lysates
were separated into Triton-X-100 –soluble and insoluble fraction as described in Methods section.
As seen in Figure 3A, the majority of K8 was
found in the insoluble fraction and a smaller
proportion of keratin was detected in the detergent
soluble fraction in the vehicle treated controls. IL6 treatment increased K8 expression in both
soluble (~three-fold) and insoluble fraction (~four
fold) compared to unstimulated cells. However,
the distribution of K8 was similar to the control
cells in that the majority of K8/K18 were in the
detergent-insoluble fraction.
Keratin overexpression under some conditions
such as cerulein-induced pancreatitis was shown to
be associated with NF-kB activation suggesting a
role for NF-kB in the transcriptional regulation of
keratin expression (51). Although the signaling
pathway of keratin induction by IL-6 is not
known, IL-6 is known to directly or indirectly
induce Sp1 (52,53) as well as activate NF-kB (29)
and hence activation of Sp1 and/or NF-kB may
potentially be involved in IL-6 mediated keratin
expression in Caco2-BBE cells.
Interestingly, there was a dramatic
decrease in K8/K18 expression in IL-6-/- mice,
suggesting that IL-6 may regulate baseline
expression of K8/K18 in colonic epithelial cells.
This finding was rather surprising as baseline
expression of IL-6 is low. Nevertheless, we and
others have demonstrated that human intestinal
epithelial cells secrete IL-6, albeit small quantities
(26) and possess IL-6 receptor at the same density
or higher than monocytes under basal
physiological conditions (27-29). Additionally,
pericrypal fibroblasts that are in intimate contact
with intestinal epithelial cells secrete IL-6 at
baseline physiological conditions (28). Since IL-6
receptors are abundantly expressed by intestinal
epithelial cells, they can respond to IL-6 in
autocrine or paracrine manner and regulate gene
expression. It is also possible that other factors in
IL-6-/- mice contribute indirectly to decreased
K8/K18 expression. Regardless, together our in
vitro and in vivo data demonstrate that IL-6 plays
an important role in the regulation of K8/K18
expression. Our observation opens new avenues
for further investigation of keratin expression in
the colon and other tissues that contain simpletype epithelia which express K8 and K18.
We show that keratin intermediate
filaments exhibit strong peripheral staining in
intestinal epithelial cell line, native human as well
as mice colonic epithelia. In response to IL-6,
K8/K18 is expresson is induced and is
concentrated under the apical domain in cells
treated with IL-6. The subapical localization of
keratins at the level of the apical junctional
complex prompted us to examine the role of
keratins in epithelial barrier function. In this
context, we observed that IL-6 decreases
paracellular permeability of FD-4 suggesting a
barrier protective function by IL-6. Among the
factors that mediate barrier dysfunction during
DISCUSSION
In this study, we demonstrate that K8 and K18
intermediate filaments of intestinal epithelial cells
are regulated by IL-6. Our data show that IL-6
induces upregulation of these keratins in the
colonic epithelial cell line, Caco2-BBE while IL-6
null mice show decreased expression of K8/K18.
With the exception of TNF-α, which has been
shown to induce K6 expression in the epidermal
tissue in the context of cell proliferation (46), to
our knowledge, our study is the first demonstration
of transcriptional/translational-mediated induction
of epithelial keratin by an immunoregulatory
cytokine. Identification and characterization of cis
and trans regulatory elements of keratin genes and
transcription factors that bind to regulatory factors
in the keratin promoter have been examined for
some keratin genes including K8, K18 and K19.
Among the transcriptional factors, Sp1 and KLF-4
regulate the expression of K8 and K18 (47-50).
7
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
untreated WT and IL-6-/- mice (0.76 ± 0.1 and 0.78
± 0.02 mg FD-4/µg protein in WT and IL-6-/mice respectively). However, administration of
DSS to IL-6-/- mice resulted in significantly
increased FITC translocation compared to WT
mice given DSS (Figure 5). These data
demonstrate that IL-6 is barrier protective under
conditions where barrier function is compromised.
In order to understand the role of K8/K18 in IL-6induced barrier protection in vivo, we next
determined K8/K18 expression in WT and IL-6-/mice. Colonic lysates and frozen tissue sections
from WT or IL-6-/- mice were obtained as
described in Methods section. Western blot and
confocal imaging was performed using antiK8/K18 antibody. Stat-3 and β-tubulin were used
as loading controls in Western blot. Surprisingly
and interestingly, K8 levels were significantly
downregulated in IL-6-/- mice as compared to WT
mice at baseline conditions as evidenced by
Western blot and confocal imaging (Figure 6A and
6B). Together, these data are in agreement with
our in vitro observation that IL-6 is barrier
protective and K18/K18 mediates IL-6-induced
barrier protection under conditions of intestinal
stress known to cause barrier dysfunction. In
addition, these data support an important role for
IL-6 in the regulation of K8/K18 expression in the
colon.
barrier function. These observations are similar to
those made in Caco2BBE cells using anti-sense
K18 as well as in vivo in K8 null mice (9,18). On
the other hand, our data demonstrate that K8 is
required to mediate barrier protection under
conditions where the epithelial barrier function is
challenged. This is consistent with the data on K8
null mice in C57B/6 background where the
absence of K8 affected placental barrier function
only in the presence of TNF-α, a proinflammatory cytokine known to decrease barrier
function (17). Together with the data that K8 is
required for IL-6-mediated barrier protection,
these data underscore the importance of K8 in
maintaining barrier function in the presence of
luminal insults such as DSS which initiates
inflammatory response through direct damage to
epithelial barrier.
There are many possibilities by which
K8/K18 may regulate barrier function during
stress. The localization of K8 in the sub-apical
region of intestinal epithelial cells in response to
IL-6 raises the possibility of association of K8
with proteins in the apical junctional complex
(tight junction or adherens junction) thereby
stabilizing the junctional complex. Such a scenario
is described in breast cancer cells wherein the
direct or indirect association of K18 with
desmosomal protein and/or E-cadherins was
thought to contribute to cell adhesion and
inhibition of invasive potential of K18
overexpressing breast cancer cells (64). Another
possible mechanism by which K8 may regulate
barrier function is through modulation of signal
transduction
pathways
by
phospho-K8.
Phosphorylation is the major posttranslational
modification of keratins and it plays a role in
regulating keratin filament organization, solubility
as well as its function (5,43). Keratins are
phosphorylated preferentially in the serine
residues in the head and tail region of the subunits,
and three human K8 (S73, S431, S23) and two
human K18 (S33, S52) major in vivo
phosphorylation sites have been characterized
(5,43). K8/K18 phosphorylation regulates several
keratin functions in a site-specific fashion,
including binding to other proteins (43,45,65-67)
or serving as a phosphate "sponge" for some
stress-activated kinases (68). IL-6 induces serine
phosphorylation of K8, which might be involved
in the modulation of kinases that regulate apical
8
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
inflammatory conditions are nitric oxide, plateletactivating factor, and importantly, T-lymphocyte–
generated cytokines such as interferon-gamma and
tumor necrosis factor (TNF)-alpha, all of which
decrease epithelial barrier function. An additional
cytokine that has been proposed to cause
alterations in permeability is IL-6. The role of IL-6
in the regulation of barrier function is less clear
than that for other cytokines. Some studies have
shown that intestinal permeability is preserved in
IL-6 knock out mice during ischemic injury.
However, no differences in permeability were
seen at baseline, and IL-6 knock out mice, indeed,
had worse inflammation compared to their wild
type counterparts (54,55). These data were taken
to suggest that IL-6 may contribute to the decrease
in barrier function under some conditions. In
contrast, several other studies have shown a barrier
protective function of IL-6. For example, IL-6 has
been shown to be required for maintenance of
blood brain barrier function during and following
injury and IL-6 has been shown to decrease
vascular permeability in bacterial meningitis (5658). Results from some experiments even suggest
that IL-6 may protect the intestinal mucosa from
the consequences of systemic inflammation
including permeability alterations. For example,
oral administration of IL-6 to mice decreased
permeability and reduced bacterial invasion
through the GI tract (59-62). Our data is consistent
with the latter studies that demonstrate barrier
protective function for IL-6.
Intermediate filaments including keratins
have traditionally been regarded as purely
mechanical components of the cytoskeleton.
However, recent observations of spontaneous
mucosal inflammation in K8 null mice in an
FVB/N background and placental barrier
dysfunction in C57B/6 K8 null mice (15,17,63)
challenge this notion and highlight the existence of
poorly understood mechanisms in the regulation of
intestinal function by keratin. Based on these
results, we hypothesized that K8/K18 may have an
effect on the epithelial barrier, the loss of which
forms the basis of the inflammatory response in
colitis. Both our in vitro (K8 downregulation using
siRNA did not affect baseline permeability in
Caco2-BBE cells) as well as our in vivo data
(decreased K8 expression in IL-6 null mice did not
affect baseline permeability) demonstrate that K8
may be dispensable for the maintenance of normal
junctional complex though will require further
testing.
In summary, we demonstrate that IL-6 is
an important regulator of K8/18 expression in
colonic epithelial cells. Exogenous IL-6 induces
the expression of K8/K18 while lack of IL-6
results in diminished baseline expression of K8/18
in the colonic epithelia. Although K8 is
dispensable to maintain normal barrier function, it
is required to mediate barrier protection by
cytokines such as IL-6 during challenges that
compromise barrier function. Thus our data have
implications for understanding the role of keratin
in barrier function and suggest a potential novel
role for these abundant cytoskeletal proteins that
extend to intestinal disorders such as inflammatory
bowel disease wherein barrier dysfunction
underlies the inflammatory response.
ACKNOWLEDGEMENTS
This work was supported by National Institute of
Diabetes and Digestive and Kidney Diseases Grant
DK06411 and Crohn’s and Colitis Foundation of
American Senior Award (S.V.S), DK 02831
(D.M), DK 067045 (S.S) and Digestive Disease
Research Center grant 5R24DK064399-02. We
thank Dr. Bishr Omary (Stanford University) for
providing us with K8/K18 antibodies and helpful
insights.
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
9
REFERENCES
1.
2.
3.
4.
5.
6.
8.
9.
10.
11.
12.
13.
14.
15.
16.
Coulombe, P. A., and Omary, M. B.
(2002) Curr Opin Cell Biol 14, 110122
Moll, R., and Franke, W. W. (1982)
Pathol Res Pract 175, 146-161
Hesse, M., Magin, T. M., and Weber,
K. (2001) J Cell Sci 114, 2569-2575
Herrmann, H., and Aebi, U. (2000)
Curr Opin Cell Biol 12, 79-90
Omary, M. B., Ku, N. O., Liao, J., and
Price, D. (1998) Subcell Biochem 31,
105-140
Omary, M. B., Coulombe, P. A., and
McLean, W. H. (2004) N Engl J Med
351, 2087-2100
Moll, R., Franke, W. W., Schiller, D.
L., Geiger, B., and Krepler, R. (1982)
Cell 31, 11-24
Wald, F. A., Oriolo, A. S., Casanova,
M. L., and Salas, P. J. (2005) Mol Biol
Cell 16, 4096-4107
Salas, P. J., Rodriguez, M. L., Viciana,
A. L., Vega-Salas, D. E., and Hauri, H.
P. (1997) J Cell Biol 137, 359-375
Fuchs, E., and Cleveland, D. W.
(1998) Science 279, 514-519
Lane, E. B., and McLean, W. H.
(2004) J Pathol 204, 355-366
McLean, W. H., and Lane, E. B.
(1995) Curr Opin Cell Biol 7, 118-125
Owens, D. W., and Lane, E. B. (2004)
J Pathol 204, 377-385
Owens, D. W., Wilson, N. J., Hill, A.
J., Rugg, E. L., Porter, R. M.,
Hutcheson, A. M., Quinlan, R. A., van
Heel, D., Parkes, M., Jewell, D. P.,
Campbell, S. S., Ghosh, S., Satsangi,
J., and Lane, E. B. (2004) J Cell Sci
117, 1989-1999
Habtezion, A., Toivola, D. M.,
Butcher, E. C., and Omary, M. B.
(2005) J Cell Sci 118, 1971-1980
Baribault, H., Penner, J., Iozzo, R. V.,
and Wilson-Heiner, M. (1994) Genes
Dev 8, 2964-2973
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
10
Jaquemar, D., Kupriyanov, S.,
Wankell, M., Avis, J., Benirschke, K.,
Baribault, H., and Oshima, R. G.
(2003) J Cell Biol 161, 749-756
Toivola, D. M., Krishnan, S., Binder,
H. J., Singh, S. K., and Omary, M. B.
(2004) J Cell Biol 164, 911-921
Shen, L., and Turner, J. R. (2006) Am
J Physiol Gastrointest Liver Physiol
290, G577-582
Dignass, A. U., Baumgart, D. C., and
Sturm, A. (2004) Aliment Pharmacol
Ther 20 Suppl 4, 9-17
Wang LX, K. V., Srinivasan S, Merlin
D and Sitaraman SV. (2005)
GASTROENTEROLOGY 124, A659
Clayburgh, D. R., Shen, L., and
Turner, J. R. (2004) Lab Invest 84,
282-291
Atreya, R., Mudter, J., Finotto, S.,
Mullberg, J., Jostock, T., Wirtz, S.,
Schutz, M., Bartsch, B., Holtmann, M.,
Becker, C., Strand, D., Czaja, J.,
Schlaak, J. F., Lehr, H. A.,
Autschbach, F., Schurmann, G.,
Nishimoto, N., Yoshizaki, K., Ito, H.,
Kishimoto, T., Galle, P. R., Rose-John,
S., and Neurath, M. F. (2000) Nat Med
6, 583-588
Yamamoto, M., Yoshizaki, K.,
Kishimoto, T., and Ito, H. (2000) J
Immunol 164, 4878-4882
Dube, P. H., Handley, S. A., Lewis, J.,
and Miller, V. L. (2004) Infect Immun
72, 3561-3570
Sitaraman, S. V., Merlin, D., Wang,
L., Wong, M., Gewirtz, A. T., SiTahar, M., and Madara, J. L. (2001) J
Clin Invest 107, 861-869
Panja, A., Goldberg, S., Eckmann, L.,
Krishen, P., and Mayer, L. (1998) J
Immunol 161, 3675-3684
Rockman, S. P., Demmler, K., Roczo,
N., Cosgriff, A., Phillips, W. A.,
Thomas, R. J., and Whitehead, R. H.
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
7.
17.
29.
30.
31.
32.
34.
35.
36.
37.
38.
39.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
11
Leonard, M., Creed, E., Brayden, D.,
and Baird, A. W. (2000) Pharm Res
17, 1181-1188
Furuta, G. T., Turner, J. R., Taylor, C.
T., Hershberg, R. M., Comerford, K.,
Narravula, S., Podolsky, D. K., and
Colgan, S. P. (2001) J Exp Med 193,
1027-1034
Liao, J., and Omary, M. B. (1996) J
Cell Biol 133, 345-357
Ku, N. O., Michie, S. A., Soetikno, R.
M., Resurreccion, E. Z., Broome, R.
L., and Omary, M. B. (1998) J Cell
Biol 143, 2023-2032
Toivola, D. M., Ku, N. O.,
Resurreccion, E. Z., Nelson, D. R.,
Wright, T. L., and Omary, M. B.
(2004) Hepatology 40, 459-466
Tao, G. Z., Toivola, D. M., Zhou, Q.,
Strnad, P., Xu, B., Michie, S. A., and
Omary, M. B. (2006) J Cell Sci 119,
1425-1432
Komine, M., Rao, L. S., Kaneko, T.,
Tomic-Canic, M., Tamaki, K.,
Freedberg, I. M., and Blumenberg, M.
(2000) J Biol Chem 275, 32077-32088
Casanova, L., Bravo, A., Were, F.,
Ramirez, A., Jorcano, J. J., and Vidal,
M. (1995) J Cell Sci 108 ( Pt 2), 811820
Pankov, R., Neznanov, N., Umezawa,
A., and Oshima, R. G. (1994) Mol Cell
Biol 14, 7744-7757
Chen, X., Whitney, E. M., Gao, S. Y.,
and Yang, V. W. (2003) J Mol Biol
326, 665-677
Brembeck, F. H., Schreiber, F. S.,
Deramaudt, T. B., Craig, L., Rhoades,
B., Swain, G., Grippo, P., Stoffers, D.
A., Silberg, D. G., and Rustgi, A. K.
(2003) Cancer Res 63, 2005-2009
Zhong, B., Zhou, Q., Toivola, D. M.,
Tao, G. Z., Resurreccion, E. Z., and
Omary, M. B. (2004) J Cell Sci 117,
1709-1719
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
33.
40.
(2001) J Gastroenterol Hepatol 16,
991-1000
Wang, L., Walia, B., Evans, J.,
Gewirtz, A. T., Merlin, D., and
Sitaraman, S. V. (2003) J Immunol
171, 3194-3201
Molmenti, E. P., Ziambaras, T., and
Perlmutter, D. H. (1993) J Biol Chem
268, 14116-14124
Ku, N. O., Toivola, D. M., Zhou, Q.,
Tao, G. Z., Zhong, B., and Omary, M.
B. (2004) Methods Cell Biol 78, 489517
Walia, B., Wang, L., Merlin, D., and
Sitaraman, S. V. (2003) Faseb J 17,
2130-2132
Ridge, K. M., Linz, L., Flitney, F. W.,
Kuczmarski, E. R., Chou, Y. H.,
Omary, M. B., Sznajder, J. I., and
Goldman, R. D. (2005) J Biol Chem
280, 30400-30405
Herrmann, H., Kreplak, L., and Aebi,
U. (2004) Methods Cell Biol 78, 3-24
Laemmli, U. K. (1970) Nature 227,
680-685
Sitaraman, S. V., Wang, L., Wong, M.,
Bruewer, M., Hobert, M., Yun, C. H.,
Merlin, D., and Madara, J. L. (2002) J
Biol Chem 277, 33188-33195
Wang, L., Kolachala, V., Walia, B.,
Balasubramanian, S., Hall, R. A.,
Merlin, D., and Sitaraman, S. V.
(2004) Am J Physiol Gastrointest Liver
Physiol 287, G1100-1107
Kim, D. H., Behlke, M. A., Rose, S.
D., Chang, M. S., Choi, S., and Rossi,
J. J. (2005) Nat Biotechnol 23, 222226
Castaneda, F. E., Walia, B., VijayKumar, M., Patel, N. R., Roser, S.,
Kolachala, V. L., Rojas, M., Wang, L.,
Oprea, G., Garg, P., Gewirtz, A. T.,
Roman, J., Merlin, D., and Sitaraman,
S. V. (2005) Gastroenterology 129,
1991-2008
52.
53.
54.
55.
56.
58.
59.
60.
61.
62.
63.
64.
66.
67.
68.
Ku, N. O., Michie, S., Oshima, R. G.,
and Omary, M. B. (1995) J Cell Biol
131, 1303-1314
Ku, N. O., Soetikno, R. M., and
Omary, M. B. (2003) Hepatology 37,
1006-1014
Ku, N. O., and Omary, M. B. (2000) J
Cell Biol 149, 547-552
Ku, N. O., and Omary, M. B. (2006) J
Cell Biol 174, 115-125
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
57.
65.
Ray, A., Schatten, H., and Ray, B. K.
(1999) J Biol Chem 274, 4300-4308
Mangan, J. K., Tantravahi, R. V.,
Rane, S. G., and Reddy, E. P. (2006)
Oncogene
Wang, Q., Sun, X., Pritts, T. A.,
Wong, H. R., and Hasselgren, P. O.
(2000) Clin Sci (Lond) 99, 489-496
Yang, R., Han, X., Uchiyama, T.,
Watkins, S. K., Yaguchi, A., Delude,
R. L., and Fink, M. P. (2003) Am J
Physiol Gastrointest Liver Physiol
285, G621-629
Paul, R., Koedel, U., Winkler, F.,
Kieseier, B. C., Fontana, A., Kopf, M.,
Hartung, H. P., and Pfister, H. W.
(2003) Brain 126, 1873-1882
Krizanac-Bengez, L., Kapural, M.,
Parkinson, F., Cucullo, L., Hossain,
M., Mayberg, M. R., and Janigro, D.
(2003) Brain Res 977, 239-246
Wang, X. P., Schunck, M., Kallen, K.
J., Neumann, C., Trautwein, C., RoseJohn, S., and Proksch, E. (2004) J
Invest Dermatol 123, 124-131
Rollwagen, F. M., Li, Y. Y., Pacheco,
N. D., and Baqar, S. (1997) Mil Med
162, 366-370
Rollwagen, F. M., Li, Y. Y., Pacheco,
N. D., and Nielsen, T. B. (1996)
Cytokine 8, 121-129
Kimizuka, K., Nakao, A., Nalesnik, M.
A., Demetris, A. J., Uchiyama, T.,
Ruppert, K., Fink, M. P., Stolz, D. B.,
and Murase, N. (2004) Am J
Transplant 4, 482-494
Riedemann, N. C., Neff, T. A., Guo, R.
F., Bernacki, K. D., Laudes, I. J.,
Sarma, J. V., Lambris, J. D., and
Ward, P. A. (2003) J Immunol 170,
503-507
Ameen, N. A., Figueroa, Y., and Salas,
P. J. (2001) J Cell Sci 114, 563-575
Buhler, H., and Schaller, G. (2005)
Mol Cancer Res 3, 365-371
12
FIGURE LEGENDS
Figure 1: IL-6 induces the expression of K8 and K18:
(A) Time course of IL-6-induced keratin mRNA in Caco2-BBE cells. Monolayers were treated
basolateraly with 100ng/ml IL-6 for the times shown and total RNA was extracted. Northern
blotting was performed using isoform-specific radiolabelled probes. Autoradiograms are shown
with GAPDH as a control. Data shown is representative of two independent experiments with 6
BBE cells. Whole cell lysates prepared from cells treated with basolateral IL-6 (100ng/ml) for
various times. Western blot was performed using anti-K8/K18 (mouse monoclonal 1:1000) or
anti-K18 antibodies (mouse monoclonal 1:1000) as described in the methods section. β-actin
served as loading control. The bar chart indicates relative band intensity (K8/K18:βactin)
obtained by scanning densitometry as described in the Methods section. Data shown is
representative of five independent experiments n=15 per time point.
Figure 2: IL-6-induced K8/K18 localize to the subapical region of Caco2-BBE cells:
(A) Filter grown Caco2-BBE monolayers were stimulated with basolateral IL-6 (100 ng/ml) for
24h. Monolayers were fixed and stained with anti-K8/18 antibody (rabbit polyclonal, 1:400
dilution) or anti-phospho CREB (1:500 dilution) followed by fluoroscein isothiocyanateconjugated secondary antibody. Monolayers were also stained with rhodamine/phalloidin (actin,
red). Images were visualized by indirect immunofluorescence using a Zeiss confocal
microscope. Vertical sections (x-z) were taken off the monolayers to define the top (set at 0 µm)
and bottom of the monolayer (at the level of stress fiber). En face sections (x-y) were then
generated from apical plane in the vertical section. Shown here are en face (xy) images taken 1.2
13
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
samples per time point. (B) Time course of IL-6-induced keratin protein expression in Caco2-
µm from the top, at the level of apical junctional complex. Also shown are reconstructed vertical
section (xz) images taken through full thickness of the monolayer. Inset in the top left panel
shows p-CREB nuclear staining (B) The intensity of bands from panel A was quantified as
described in Methods section. The bar graphs represent relative band intensity K8/K18:β-actin
membrane, mean ± SEM n=4, significantly different from vehicle ** p< 0.001
Figure 3: (A) IL-6 induces the expression of insoluble K8/K18: Caco2-BBE monolayers treated
with basolateral IL-6 (100 ng/ml) for indicated times and were subjected to detergent extraction
electrotransferred to nitrocellulose membranes and probed with anti K8/18 antibody (mouse
monoclonal 1:1000). The membranes were incubated with peroxidase-linked secondary antibody
and subsequently incubated with ECL reagents (Amersham Pharmacia Biotech, Piscataway, NJ)
before exposure to high-performance chemiluminescence films (Amersham Pharmacia Biotech).
The distribution of keratin in Triton-soluble and –insoluble fraction is shown. The bar chart
below indicates relative band intensity obtained by scanning densitometry. Data shown is
representative of two independent experiments n=6 per time point, significantly different from 0
hour # p<0.04, * p< 0.001. (B) IL-6 induces serine phosphorylation of K8: Caco2-BBE
monolayers treated with basolateral IL-6 (100 ng/ml) for 12 or 24 hours and were subjected to
Western blotting with anti-phosphoserine 431 (p-ser431 K8) and 73 (p-ser73 K8) respectively as
described in Methods section. β-tubulin was used as loading control. The bar chart below
indicates band intensity of p-ser 431 K8:β tubulin obtained by scanning densitometry. Data
shown is representative of two independent experiments, n=4. significantly different from 0 hour
# p<0.001, * p<0.05. (C) Filter grown Caco2-BBE monolayers were stimulated with basolateral
IL-6 (100 ng/ml) for 24h. Monolayers were fixed and stained with anti-K8/18 antibody followed
14
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
as described in Methods section. Samples were separated on 10% polyacrylamide gel,
by anti-phosphoserine 431 K8 antibody. FITC (green, phospho serine 431 K8) and rhodamine
(red, K8/18) conjugated secondary antibodies were used. Images were visualized by indirect
immunofluorescence using a Zeiss confocal microscope. En face sections (x-y) were then
generated from apical plane in the vertical section. Shown here are en face (xy) images taken 2
µm from the top, at the level of apical junctional complex (Magnification X40).
Figure 4: K8 mediates IL-6 induced barrier protective effects: (A) IL-6 decreases paracellular
permeability: Paracellular flux of FD-4 was measured in confluent Caco2-BBE monolayers after
basolateral exposure to IL-6 (100 ng/ml) as described in Methods section. The graph represents
average of three experiments was performed in quadruplicate with error bars representing SEM,
p<0.01 compared to vehicle. (B) IL-6 is unable to induce its barrier protective effects in the
absence of K8: Caco2-BBE monolayers were transfected with scrambled or K8-specific siRNA
as described. Cells were stimulated with basolateral IL-6 (100 ng/ml) for 24 hours and
paracellular flux of FD-4 was measured. The graph represents % change in FD flux compared to
vehicle treated monolayer (scrambled siRNA + vehicle: 15.1 ± 1.6 and K8 siRNA + vehicle:
14.9 ± 1.1 µM · cm-2.h-1 respectively). Values represent data from two independent experiments
n=12, *p<0.04, #p<0.05. Cells were lysed and K8 expression was determined by Western blot
using anti-K8/18 antibody. β-tubulin served as a loading control.
Figure 5:IL-6 mediates barrier protective effects in vivo: WT and IL-6-/- mice (C57/B6) were
given FITC-dextran (Molecular Weight 4000) orally as described in Methods section. Serum was
obtained retro-orbitally and processed for fluorescence. Data are represented as mg FITC/µg
protein. Each bar represents mean ± S.E. n=4 a vsr b or c: p< 0.01, c vs b: p<0.05.
15
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
% change in FD flux compared to vehicle treated monolayers (6.4 ± 0.5 µmol.cm-2.h-1). An
Figure 6: K8/18 is downregulated in the colon of IL-6-/- mice. A. WT or IL-6-/- mice were
sacrified, colonic lysates were obtained and processed for Western blot using anti-K8/18
antibody (rabbit polyclonal 1:1000). STAT-3 and β-tubulin were used as loading controls. Each
lane represents sample obtained from an individual mouse. B. Immunoflorescence staining of
colonic sections obtained from WT or IL-6-/- mice. Colonic tissues were embedded in OCT and
sections were stained for anti-K8/18 antibody (rabbit polyclonal, 1:400 dilution) followed by
anti-E-cadherin (1:500 dilution) antibody. Samples were counterstained with rhodamine (redkeratin) or FITC (green- E-cadherin)- conjugated secondary antibodies. Confocal images shown
16
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
here are representative of 4 individual mice. Magnification x100.
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
IL-6
Figure 1
0
2h
4h
8h
12h
24h
GAPDH
K18
K8
A
K8/K18
52 kDa
K18
45 kDa
β-actin
43 kDa
IL-6
0
4h
8h
12h
8h
12h
24h
5
4
3
2
1
IL-6
0h
4h
24h
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Relative band intensity
6
Figure 1B
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Vehicle
IL-6
Figure 2
xz
Overlay
CTL
Relative intensity
β-actin
P-CREB
K8/18
IL-6
1
2
**
3
B
A
A
K8/K18
52 kd
IL-6
0
12h 24h
0
Triton
soluble
12h 24h
Triton
insoluble
8
0.8
*
0.6
6
*
#
0.4
4
0.2
2
IL-6
0
12h 24h
Triton
soluble
0 12h
24h
Triton
insoluble
Figure 3A
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Band intensity (AU)
*
B
CTL
IL-6
p-ser 431 K8
p-ser431
p-ser73 K8
β tubulin
K8/K18
0
24h
*
5
4
3
#
2
1
IL-6
0h
12h
24h
Figure 3B
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Relative intensity
12h
B
A
#
Paracellular flux
(% WT)
120
*
75
50
100
80
*
25
60
0
IL
-6
n
Co
_
IL-6
_
+
Scrambled
siRNA
+
K-8 siRNA
C
50kd
K8
β tubulin
IL6 100ng/ml
K8 siRNA
CTL 12h
_
_
24h
_
CTL
+
12h
24h
+
+
Figure 4
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Paracellular flux
(% control)
100
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Figure 5
water
WT
IL-6-/-
DSS
WT
IL-6-/-
0
FITC in mg/ µg protein
0.4
0.8
1.2
a
a
1.6
b
2
c
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Figure 6A
WT
1
2
IL-6-/3
4
β-tubulin
STAT-3
K8/K18
Downloaded from http://www.jbc.org/ by guest on September 9, 2014
Figure 6B
E-cadherin
K8/K18
Overlay
IL-6-/x100
WT
x100