5b. Students know how to apply base-pairing rules to explain precise copying of DNA during semiconservative replication and transcription of information from DNA into mRNA. 4a Students know the general pathway by which ribosomes synthesize proteins, using tRNAs to translate genetic information in mRNA. 4b Students know how to apply the genetic code rules to predict the sequence of amino acids from a sequence of codons in RNA •DNA double helix unwinds •DNA now single-stranded •New DNA strand forms using complementary base pairing (A-T, C-G) •Used to prepare DNA for cell division •Whole genome copied/replicated  Flow of genetic information in a cell  How do we move information from DNA to proteins? DNA replication RNA protein DNA gets all the glory, but proteins do all the work! trait a nucleus DNA transcription a a Cytoplasm a (ribosomes, rough aER) mRNA translation a a a a a protein a a a a a a ribosome trait DNA Transcription RNA Translation Protein  From DNA nucleic acid language to RNA nucleic acid language  RNA forms base pairs with DNA  C-G  A-U  mRNA- type of RNA that encodes information for the synthesis of proteins and carries it to a ribosome from the nucleus  Making mRNA  transcribed DNA strand = template strand  untranscribed DNA strand = coding strand ▪ same sequence as RNA  synthesis of complementary RNA strand =mRNA  enzyme ▪ RNA polymerase coding strand 5′ DNA C G 3′ build RNA 5′→3′ A G T A T C T A rewinding mRNA 5′ G C A G C A T C G T T A 3′ G C A U C G U C G T A G C A T RNA polymerase T A A C T A G C T G A T unwinding 3′ 5′ template strand  RNA polymeraseProduces mRNA by adding together the chain of RNA nucleotides  Promoter region  binding site before beginning of gene  TATA box binding site  binding site for RNA polymerase & transcription factors  Enhancer region  binding site far upstream of gene ▪ turns transcription on HIGH  Initiation complex  transcription factors bind to promoter region ▪ group of proteins which bind to DNA ▪ hormones? ▪ turn on or off transcription  trigger the binding of RNA polymerase to DNA  Match RNA bases to DNA bases on one of the DNA strands G G U C A A G C A U A G U C G A U A C 5' RNA A C C polymerase A G U 3' T G G T A C A G C T A G T C A T C G T A C C G T U C  Eukaryotic genes are not continuous  exons = the real gene ▪ expressed / coding DNA  introns = removed, “junk” DNA ▪ inbetween sequence introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence  Post-transcriptional processing  eukaryotic mRNA needs work after transcription  primary transcript = pre-mRNA  mRNA splicing ▪ edit out introns  make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence primary mRNA transcript mature mRNA transcript pre-mRNA ~1,000 bases spliced mRNA  Need to protect mRNA on its trip from nucleus to cytoplasm  enzymes in cytoplasm attack mRNA ▪ protect the ends of the molecule ▪ add 5′ GTP cap ▪ add poly-A tail ▪ longer tail, mRNA lasts longer: produces more protein 3' mRNA 5' PP G P A Now we have mature mRNA transcribed from the cell’s DNA. It is leaving the nucleus through a nuclear pore. Once in the cytoplasm, it finds a ribosome so that translation can begin. We know how mRNA is made, but how do we “read” the code?  From nucleic acid language to amino acid language   Second stage of protein production mRNA is on a ribosome    Every 3 DNA bases pairs with 3 mRNA bases Every group of 3 mRNA bases encodes a single amino acid Codon- coding triplet of mRNA bases DNA TACGCACATTTACGTACGCGG codon mRNAAUGCGUGUAAAUGCAUGCGCC ? protein MetArgValAsnAlaCysAla    Second stage of protein production mRNA is on a ribosome tRNA brings amino acids to the ribosome   Code for ALL life!  strongest support for a common origin for all life Code is redundant  several codons for each amino acid  3rd base “wobble” Why is the wobble good?  Start codon    AUG methionine Stop codons  UGA, UAA, UAG DNA 3′ 5′ 5′ 3′ TACGCACATTTACGTACGCGG mRNAAUGCGUGUAAAUGCAUGCGCC 3′ tRNA amino acid UAC Met codon 5′ GCA CAU Arg Val anti-codon  “Clover leaf” structure  anticodon on “clover leaf” end  amino acid attached on 3′ end  Facilitate coupling of tRNA anticodon to mRNA codon  Structure  ribosomal RNA (rRNA) & proteins  2 subunits ▪ large ▪ small E P A  A site (aminoacyl-tRNA site)  holds tRNA carrying next amino acid to be added to chain  P site (peptidyl-tRNA site)  holds tRNA carrying growing polypeptide chain  Met E site (exit site)  emptytRNA leaves ribosome from exit site U A C A U G 5' E P A 3'    Initiation  mRNA, ribosome subunits, initiator tRNA come together Elongation  adding amino acids based on codons Termination  STOP codon = Release factor 3 2 Val Leu Met Met Met Leu Met Leu 1 Ala Leu release factor Ser Trp tRNA UAC 5' C UG A A U mRNA A U G 3' E P A 5' UA C G A C A UG C U GA AU 5' 3' U A C GA C A U G C U G AA U 3' 5' UAC G AC AA U A U G C UG 3' A CC U GG UA A 3' Destinations:  Signal peptide  address label      start of a secretory pathway   secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron pre-mRNA tRNA 5' GTP cap mature mRNA poly-A tail large ribosomal subunit aminoacyltRNA synthetase 3' polypeptide 5' small ribosomal subunit tRNA E P A ribosome enhancer 1000+b 3' 20-30b RNA TATA polymerase DNA promoter translation start TAC translation stop exons transcriptional unit (gene) UTR UTR introns transcription start transcription stop 5' pre-mRNA 5' GTP mature mRNA 5' DNA ACT 3' 3' AAAAAAAA Bacterial chromosome Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall  Prokaryotes  Eukaryotes  DNA in cytoplasm  DNA in nucleus  circular chromosome  linear chromosomes  naked DNA  DNA wound on  no introns histone proteins  introns vs. exons intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence introns come out!  Transcription & translation are simultaneous in bacteria  DNA is in cytoplasm  no mRNA editing  ribosomes read mRNA as it is being transcribed  Differences between prokaryotes & eukaryotes  time & physical separation between processes ▪ takes eukaryote ~1 hour from DNA to protein  no RNA processing  Point mutations  single base change ▪ silent mutation ▪ no amino acid change ▪ redundancy in code ▪ missense ▪ change amino acid ▪ nonsense ▪ change to stop codon When do mutations affect the next generation? What kind of mutation? Missense!  Frameshift  shift in the reading frame ▪ changes everything “downstream”  insertions ▪ adding base(s)  deletions ▪ losing base(s) Where would this mutation cause the most change: beginning or end of gene? Transcription  Process by which genetic information encoded in DNA is copied onto messenger RNA Translation  Process by which information encoded in mRNA is used to assemble a protein at a ribosome  Occurs in the nucleus  Occurs on a Ribosome  DNA  mRNA mRNA protein