DNA-based diagnostics in oncology PATHOBIOCHEMISTRY (The third year –Winter Term 2009/2010) P. Pohlreich Cancer • Cancer is characterized by uncontrolled growth, invasion and sometimes metastasis • Benign tumors do not invade or metastasize • Cancers are caused by abnormalities in the genetic material of transformed cells • Causes of cancer: Carcinogens (tobacco smoke, radiation, chemicals or infectious agents Errors in DNA replication Inherited abnormalities Hereditary and sporadic cancer Most forms of cancer are sporadic Number of syndromes with inherited predisposition to cancer Familial adenomatous polyposis (FAP) - inherited mutation of the APC gene Hereditary nonpolyposis colorectal cancer (HNPCC, Lynch syndrome) - germline mutations in mismatch repair genes MSH2, MLH1, MSH6, PMS1 Hereditary breast-ovarian cancer syndrome – mutations in BRCA1 and BRCA2 genes Hereditary retinoblastoma – mutations in RB1 gene Li-Fraumeni syndrome - inherited mutations in p53 gene 20 Hereditary nonpolyposis colorectal Colorectal cancercancer (HNPCC) Sporadic (65%–85%) Familial (10%–30%) Rare syndromes(<0.1%) Familial adenomatous polyposis (FAP) (1%) Hereditary nonpolyposis colorectal cancer (HNPCC) (5%) Sporadic and hereditary breast cancer Most breast cancers are sporadic Breast cancer 15%-20% 5%–10% Sporadic occurence Familial occurence Mutations in dominant predispozing genes (BRCA1/2) 20 Breastr cancer – age at diagnosis 90 – p<0.0001* Věk (roky) 80 – 70 – 60 – 54 50 – 40 – 40 30 – - Min-Max 20 – Hereditary Sporadic (N=72) (N=222) - 25%-75% - Median Breast and ovarian cancer risk in carriers of BRCA1/2 mutations BRCA+ BRCA1 BRCA2 20% risk by 40 years 82% lifetime risk BRCA1: 54% lifetime risk BRCA2: 23% lifetime risk King MC at al. Science 2003 (302) 643-646 Genetic testing for familial cancer • Genetic tests are used: to clarify the diagnosis of inherited cancer syndromes in patients with tumors to provide information about cancer susceptibility to asymptomatic persons • Germline cancer gene tests are available for different genes (BRCA1/2, APC, MSH2, MLH1, MSH6, RB1, p53) • Cancer gene testing includes: linkage analysis, direct detection of known mutation, sequencing of relevant genes when mutation is unknown, tests for microsatellite instability may support diagnosis of HNPCC. Genetic testing for familial cancer • Results of genetic testing: In affected individuals, gene tests may be used to diagnose an inherited cancer syndrome In asymptomatic persons, gene tests may be used to identify whether or not they are at increased risk of cancer • Health benefits of testing: Persons at increased risk for cancer will be given options for preventive screening or other interventions (such as prophylactic surgery or chemoprevention) • Cancer gene testing includes: linkage analysis, direct detection of known mutation, sequencing of relevant genes when mutation is unknown, tests for microsatellite instability may support diagnosis of HNPCC Genetic testing in a family with breast and ovarian cancer C56, Dg. 42 C50, Dg. 34 Age: 36 Breast cancer Ovarian cancer Results of genetic testing C56, Dg. 45 BRCA1+ C50, C50, Dg. 32 Dg. 43 BRCA1+ BRCA1+ Breast cancer Věk: 35 BRCA1– Tested patient is not at increased risk of breast or ovarian cancer Ovarian cancer Genes that predispose for breast-ovarian cancer syndrome Gene Frequency Tumor types BRCA1 52 % Breast cancer, ovarian ca, colorectal ca, prostate ca BRCA2 32 % Breast cancer, ovarian ca, breast ca in male, pancreatic ca, prostate ca, other ATM <5 % Lymphoma, leukemia, breast ca, ovarian ca , stomach PTEN <1% Multiple hamartomas, breast cancer, thyroid cancer <1% Breast ca, soft tissue sarkoma, brain, leukemia, osteosarkoma, adrenal , lung, prostate, pancreas p53 Low penetrance genes (CHEK2, PALB2, RAD50…) Pathogenic mutations in BRCA1, BRCA2, ATM, p53 and CHEK2 genes in high-risk breast and ovarian cancer families N=615 BRCA1 N=112 (18.2%) Mutations N=162 (26.3) BRCA2 N=33 (5.4%) P53 N=3 (0.5) CHEK2 N=9 (1.5) ATM N=5 (0.8) Genetic materials and tissue sources for clinical gene testing • Genetic material (DNA, eventually RNA) is usually obtained from blood leukocytes. • • DNA obtained from paraffin-embeded tissue blocks is also an option. To identify microsatellite instability (MSI) or loss of heterozygosity (LOH), DNA from both normal tissue and tumor tissue are analyzed. Hereditary nonpolyposis colorectal cancer (HNPCC) • HNPCC represents 2 to 6 % of all colorectal cancers • • • • HNPCC appears to be due to hereditary defects ( mutations) in DNA mismatch repair genes (mainly MSH2 and MLH1) DNA mismatch repair is a system for recognizing and repairing erroneous insertion, deletion and misincorporation of bases that can arise during DNA replication Cancers arising in HNPCC are thus genetically unstable; these tumors exhibit a “microsatellite instability” (MSI) “MSI” is detectable in ~ 90 % of colorectal cancers from HNPCC patient • “MSI” is detectable in 10 to 15 % of sporadic colorectal cancers Microsatellite instability (MSI) Microsatellite: - short DNA segments widespread throughout the human genome - tandem repetitions of a short nucleotide sequence (1 to several bases in length) …..CATGCATGCATGCATGn…… …..CACACACACAn….. ..…AAAAAAAAAn….. Normal Tumor Size of alleles Boulton SJ. Biochem Soc Transact 2006 (34) 633-645 Loss of heterozygosity (LOH) Mutations in cancer • A mutation may be defined as a permanent change in the nucleotide sequence of the DNA. • Mutatioins that affect the germ cells are transmitted to the progeny and may give rise to hereditary tumors. • Mutations that arise in somatic cells are important in the genesis of cancers. • Chromosome mutations result from rearrangement of genetic material and give rise to visible structural changes in the chromosomes. • Gene mutations are submicroscopic. Point mutation - a single nucleotide base is substituted by a different base. These changes are classified as transitions (A ↔ G or C ↔ T) and transversions (C/T ↔A/G). - Silent mutation codes for the same amino acid - Missense mutation codes for a different amino acid - Nonsense mutation codes for a stop and leads to the termination of translation - Deletions and insertions can lead to alterations in the reading frame; frameshift mutations - large genomic deletions and rearrangements The Philadelphia chromosome Chromosomal translocation creates the Philadelphia chromosome and its bcr-abl oncogene Minimal residual disease (MRD) • Minimal residual disease (MRD): Evidence for the presence of residual malignant cells, even when so few cancer cells are present that they cannot be found by routine means. • Tests for MRD can detect some early tumors • MRD can thus distinguish who needs intensive and potentially more toxic therapy from those who do not. . Techniques for detecting MRD • Flow cytometry: for cell sample from blood or bone marrow The cells are stained with a number of different antibodies. This technology can detect one leukemic cell among 10,000 or more normal cells. • PCR can identify malignant cells based on their characteristic chromosome rearrangements. The chimeric bcr-abl messenger RNA transcript can be detected by RT-PCR. It is possible to detect one Ph-positive cell within a million normal cells. Mutation screening • PCR based methods are mostly used for mutation screening. • Several prescreening methods were developed: - RFLP-analysis detects frequently occurring point mutations - Electrophoretic methods (DGGE, TGGE, SSCP) are standard techniques that reveal all sequence changes, including those which are not pathogenic (polymorphisms) or are of questionable pathogenicity (missense mutations). - PTT uncovers certain disease-causing mutations (only those causing premature translation termination). • All mutations are confirmed and characterized by sequencing Control of the ras protein The active form of ras converted to the inactive form hydrolysis of its bound GTP GDP. Hydrolysis is promoted GAP protein is by to by Activation, bound GDP is exchanged for GTP. This reaction require the help of GEF factor The ras protein bound to GTP is active; GDP-bound form of ras is inactive Mutations in the ras gene The ras oncogene represents the best example of oncogene activation by point mutation. Several distinct mutations have been identified, all of which reduce the GTPase activity of the ras protein. Most of them involve codon 12. In an abnormal ras protein glycine was converted to valine. RFLP-analysis of K-ras codon 12 mutations • • DNA was extracted from bile samples of 116 patients (46 with malignant tumors) Mutations in ras gene were identified by RFLP-analysis and confirmed by sequencing. • In bile, K-ras codon 12 mutations were detected in 16 of 46 malignant benign cases were negative. Clinical Chemistry 50:3, 481–489 (2004) cases; all Mutations in human p53 gene Temperature gradient gel electrophoresis (TGGE) • • Mutations in p53 were analyzed by TGGE in pancreatic juice samples from patients with chronic pancreatitis Four distinct bands indicate mutations in samples in lanes 2 and 3 Gastrointest Endosc 2001; 53:734-43 20 Mutations in tumor suppressor gene APC Codon 1309 5' 12 3 4 5 6 7 8 3' 9 10 111213 14 15 Mutations identified in BRCA1 and BRCA2 gene BRCA1 185delAG Identified mutations BRCA2 6174delT 5382insC Truncating mutations identified in various genes Disease Truncating mutations Gene FAP 95% APC Ataxia telangiectasia 90% ATM Hereditary breast and ovarian cancer 90% BRCA1/BRCA2 HNPCC 80% MSH2 HNPCC 70% MLH1 Neurofibromatosis 50% NF1 Cell from blood DNA, exons mRNA, exons Primer Primer cDNA PCR transcription +translation RNA PCR-products Protein SDS-PAGE+autoradiogr. Full-length protein Truncated protein Protein truncation test (PTT) - PTT uncovers disease-causing mutations that cause premature translation termination. The coding region of the gene is screened for the presence of translation terminating mutations - First step involves the isolation of genomic DNA and amplification of the target gene coding sequences using PCR, or alternatively, isolation of RNA and amplification of the target sequence using reverse transcription PCR (RTPCR ). - PCR products are then used as a template for the in vitro synthesis of RNA, which is subsequently translated into protein. - The final step is the SDS-PAGE analysis of the synthesized protein. MLPA: Multiplex ligation-dependent probe amplification Cancer Research 63, 1449-1453, 2003 Large genomic deletions and rearrangements identified in the gene BRCA1 by MLPA-analysis Control samples are indicated by wt, numbers denote exons, C- control DNA-sequences Breakpoint detection of large genomic deletions and rearrangements by oligonucleotide array-based comparative genomic hybridization (aCGH) Methods in mutational analysis (testing of BRCA1/2 genes Isolation of DNA a RNA BRCA 1 B C Analysis of PCRproducts PCR amplification D Exon 11 A BRCA 2 E 2a Exon 10 1 3 4 6 Exon 11 2 1 2 3 4 5 y 7 5 6 8 9 Data evaluation PTT BIC Sequence analysis Clinical genetics MLPA Oncology c.3450C>T p.G1111X c.5385insC (p.G1756fsX1829) WT:GAGAATCCCAGGACAGAAAGGT Mut:GAGAATCCCCAGGACAGAAAGG G A T C Gynecolo gy Analysis of Somatic mutations in BRCA1 gene c.1116G>A a c.3862delG in tumor tissue A: C T WT 5´ T CC TT GG A T AA C A C T AAA T T MUT 5´ T CC TT G AA T AA C A C T AAA T 3´ 3´ 3´ B: 3´ 3´ C T C c •c 3´ C WT 5´ T CC TT GG A T AA C A C T AAA T 3´ T WT 5´ A G T G A G GAA A C AA AA T G TT MUT 5´ A G T G A G AAA C AAA A T G TT C 3´ 3´ WT 5´ A G T G A GG AAA C AAAA T G TT 3´