1. No category

From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
2012 120: e35-e44
doi:10.1182/blood-2012-05-433797 originally published
online August 16, 2012
Efficient generation, purification, and expansion of CD34+
hematopoietic progenitor cells from nonhuman primate−induced
pluripotent stem cells
Jennifer L. Gori, Devikha Chandrasekaran, John P. Kowalski, Jennifer E. Adair, Brian C. Beard,
Sunita L. D'Souza and Hans-Peter Kiem
Updated information and services can be found at:
http://www.bloodjournal.org/content/120/13/e35.full.html
Articles on similar topics can be found in the following Blood collections
e-Blood (132 articles)
Hematopoiesis and Stem Cells (3259 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
HEMATOPOIESIS AND STEM CELLS
e-Blood
Efficient generation, purification, and expansion of CD34⫹ hematopoietic
progenitor cells from nonhuman primate–induced pluripotent stem cells
Jennifer L. Gori,1 Devikha Chandrasekaran,1 John P. Kowalski,1 Jennifer E. Adair,1 Brian C. Beard,1,2 Sunita L. D’Souza,3
and Hans-Peter Kiem1,2,4
1Clinical
Research Division, Fred Hutchinson Cancer Research Center, Seattle, WA; 2Department of Medicine, University of Washington School of Medicine,
Seattle, WA; 3Department of Developmental and Regenerative Biology, Black Family Stem Cell Institute, Mount Sinai School of Medicine, New York NY; and
4Department of Pathology, University of Washington School of Medicine, Seattle, WA
Induced pluripotent stem cell (iPSC) therapeutics are a promising treatment for
genetic and infectious diseases. To assess engraftment, risk of neoplastic formation, and therapeutic benefit in an
autologous setting, testing iPSC therapeutics in an appropriate model, such as
the pigtail macaque (Macaca nemestrina;
Mn), is crucial. Here, we developed a chemically defined, scalable, and reproducible
specification protocol with bone morphogenetic protein 4, prostaglandin-E2 (PGE2),
and StemRegenin 1 (SR1) for hematopoi-
etic differentiation of Mn iPSCs. Sequential coculture with bone morphogenetic
protein 4, PGE2, and SR1 led to robust Mn
iPSC hematopoietic progenitor cell formation. The combination of PGE2 and SR1
increased CD34ⴙCD38ⴚThy1ⴙCD45RAⴚ
CD49fⴙ cell yield by 6-fold. CD34ⴙCD38ⴚ
Thy1ⴙCD45RAⴚCD49fⴙ cells isolated on
the basis of CD34 expression and cultured in SR1 expanded 3-fold and maintained this long-term repopulating HSC
phenotype. Purified CD34high cells exhibited 4-fold greater hematopoietic colony-
forming potential compared with unsorted hematopoietic progenitors and had
bilineage differentiation potential. On the
basis of these studies, we calculated the
cell yields that must be achieved at each
stage to meet a threshold CD34ⴙ cell
dose that is required for engraftment in
the pigtail macaque. Our protocol will
support scale-up and testing of iPSCderived CD34high cell therapies in a clinically relevant nonhuman primate model.
(Blood. 2012;120(13):e35-e44)
Introduction
New therapies are needed to treat disease attributed to genetic (ie,
Fanconi anemia, hemoglobinopathies) and infectious (ie, HIV/
AIDS) hematologic diseases. Autologous or allogeneic HSC transplantation in which the graft has been gene-modified offers a
potential cure for hematopoietic or immune system failure. However, appropriate autologous HSCs for genetic modification often
are unavailable, and the limited availability of MHC-matched
donors significantly restricts allogeneic treatment options.1 In
addition, patients receiving allogeneic grafts also may experience
acute and chronic life-threatening complications.2
Induced pluripotent stem cell (iPSC) therapies are a tractable
alternative to allogeneic cell transplantation because they represent
an unlimited source of autologous, patient-specific cells.3-7 However, in vivo preclinical models for long-term functional and safety
analysis of iPSC-related therapeutics are limited by model organism life span and further compromised in that available infectious
disease models fail to recapitulate human disease. Studies in
nonhuman primates (NHP) permit the longitudinal evaluation of
iPSC-derived hematopoietic progenitor cells (HPCs) in an autologous setting and provide assays for safety validation, therapeutic
benefit, and terminal cell fate and function. Furthermore, findings
in NHP models generally translate well to human applications.8
Thus, to critically evaluate the longitudinal therapeutic benefits,
risks, and fate of iPSC-derived HPCs in vivo, an appropriate NHP
model is required.
Toward modeling novel therapies for blood-related diseases and
HIV/AIDS in the pigtail macaque, we have shown previously
stable engraftment of bone marrow and peripheral blood–derived
autologous CD34⫹ cells expressing therapeutic and anti-HIV
transgenes.9-11 The CD34-enriched fraction from mobilized blood
or bone marrow reconstitutes the hematopoietic system, indicating
that enriched CD34high fraction contains a subset of cells that are
long-term repopulating HSCs (LT-HSCs). We also have shown
recently that transplantation with HSCs modified to express the
anti-HIV protein C46 reduces viral load in simian/human immunodeficiency virus (SHIV)–infected monkeys and supports partial
recovery of immune function (H.-P.K., unpublished results, May
2012). Because iPSCs represent an inexhaustible source for the
generation of virus-resistant, gene-modified CD34⫹ cells and
hematopoietic progeny, the pigtail macaque allows us to test
SHIV-specific iPSC-derived hematopoietic cell therapeutics in
vivo as well as assess the long-term safety of iPSC hematopoietic
progeny.
To address safety concerns, we previously generated and
characterized several MniPSC lines12,13 and engineered MniPSCs
to express an inducible suicide gene.13 Scale-up and quality control
of therapeutic cell production to attain an appropriate cell dose for
transplantation in the monkey or a patient must meet the following
criteria: (1) a relatively efficient hematopoietic induction protocol,
(2) a well-established purification method to enrich for the target
Submitted May 29, 2012; accepted July 27, 2012. Prepublished as Blood First
Edition paper, August 16, 2012; DOI 10.1182/blood-2012-05-433797.
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
This article contains a data supplement.
© 2012 by The American Society of Hematology
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
e35
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
e36
GORI et al
therapeutic population (CD34⫹ cells) and simultaneously deplete
residual undifferentiated cells, and (3) a strategy to expand
primitive CD34⫹ cells without loss of multipotency.
The production of sufficient iPSC-derived HPCs for engraftment will likely require ex vivo expansion. To this end, novel
factors that maintain and expand primitive HSCs ex vivo have been
identified, including StemRegenin 1 (SR1), an aryl hydrocarbon
receptor (AhR) antagonist,14 and prostaglandin-E2 (PGE2),15 both
of which are involved in HSC homeostasis. Several groups have
shown that bone morphogenetic protein (BMP) and Wnt pathways
specify hematopoietic fate and that activation of these pathways
impacts lineage development from mouse and human PSCs.16-19
Here we describe a novel, chemically defined differentiation,
expansion, and purification strategy that meets scale-up and quality
control criteria and relies on sequential modulation of the BMP,
Wnt, and AhR pathways to generate HSC-like cells from MniPSCs.
We also describe a method for expansion of enriched CD34high cells
with a putative LT-HSC phenotype and show that these cells exhibit
both myeloid and lymphoid differentiation potential ex vivo.
Methods
Macaque iPSC culture
Derivation of MniPSC lines 3 and 7 has been described.12 Before
differentiation, normal karyotype was validated and phenotype confirmed
by flow cytometry and visual assessment of colony appearance. MniPSCs
were passaged weekly at ratios of 1:2 to 1:4 on the basis of colony density
onto irradiated mouse embryonic fibroblast feeder layers (iMEFs) plated at
a density of 6 ⫻ 105 cells per well of a 6-well plate. MniPSCs on iMEFs
were fed daily with PSC media consisting of 1:1 DMEM/F12 supplemented
with 20% knockout serum replacement, 1% MEM nonessential amino
acids, 2 mM L-glutamine (all from Life Technologies), 0.1mM
2-mercaptoethanol (Sigma-Aldrich), and 20 ng/mL human basic fibroblast
growth factor (bFGF; R&D Systems), and passaged weekly with 200 U/mL
collagenase type IV (Life Technologies) in DMEM/F12 containing
100 U/mL Dnase I (Sigma-Aldrich). All undifferentiated iPSC cultures
were maintained at 37°C in a humidified incubator (5% CO2, 20% O2).
Hematopoietic mesoderm induction and differentiation
Before passage of MniPSCs to feeder-free conditions, MniPSCs on iMEFs
were treated with 10␮M Y-27632 rock inhibitor (Calbiochem) for 1 hour
and dissociated with 200 U/mL collagenase type IV plus Dnase I. Cells
were passaged at ratios of 1:2 to 1:3 onto 6-well plates or 10-cm dishes
(Costar) coated with 1:2 GFR matrigel (BD Bioscience) and cultured
overnight in PSC media plus 20 ng/mL bFGF and 10␮M Y-27632 (Figure
1A). On day ⫺1 relative to differentiation, cells were fed with PSC media
plus 20 ng/mL bFGF. On day 0, 75%-90% confluent MniPSC colonies were
dissociated with 200 U/mL collagenase type IV plus 200 U/mL Dnase I,
washed with DMEM:F12 media, and scraped into clusters. Basal media
formulation and BMP4-mediated mesoderm induction has been previously
described for hESC differentiation.20,21 MniPSC aggregates were suspended in complete StemPro (cStemPro) media (StemPro-34 plus supplement [Life Technologies], 2mM L-glutamine, 50 ␮g/mL ascorbic acid
[Sigma-Aldrich], 4 ⫻ 10⫺4 M 1-thioglycerol [Sigma-Aldrich], and
150 ␮g/mL transferrin [Roche]), supplemented with 10, 20, or 50 ng/mL
BMP4 (Figure 1A), and cultured in low-cluster plates (Costar). cStemPro
was supplemented with human cytokines, indicated below and in panel A of
each figure. All cytokines were recombinant human cytokines purchased
from R&D Systems unless indicated. On day 1, embryoid bodies (EBs)
were settled by gravity and suspended in cStemPro with BMP4 (20 ng/mL)
and bFGF (10 ng/mL). On day 4, EBs were settled by gravity and
suspended in cStemPro with 10 ng/mL each of VEGF and bFGF.
For hematopoietic specification, from day 8 onward cStemPro media
were supplemented with SCF (100 ng/mL; Miltenyi Biotech), IL-3 (20 ng/
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
mL; Peprotech), IL-6 (20 ng/mL; Peprotech), IL-11 (50 ng/mL), erythropoietin (EPO, 4 U/mL; Peprotech), thrombopoietin (TPO, 20 ng/mL; Peprotech), and insulin-like growth factor-1 (IGF-1; 25 ng/mL). Cultures were
maintained in hypoxia (5% CO2/5% O2/90% N2). In some experiments,
0.75␮M SR1 (Cellagen Technology, days 1-21 or 8-21) or 2␮M PGE2
(Cayman Chemical, days 1-21 or 1-8) were added at indicated time points
(Figures 2A, 3A, 4A, and 5A). The PGE2 concentration used (2␮M) has
been tested in the context of hESC hematopoietic differentiation.19 The SR1
concentration (0.75␮M) was selected on the basis of our recent optimization studies expanding macaque cord blood, as well as bone marrow and
peripheral blood–derived CD34⫹CD38⫺ HSCs ex vivo (H.-P.K., unpublished results, September 2011).
Purification of CD34high MniPSC-derived HPCs
Day 8 EBs were dissociated into single cells with Accutase (Life
Technologies). Cells were resuspended in DPBS (Life Technologies)
containing 100 U/mL Dnase I, 1% FBS, and 2% chick serum; stained with
PE conjugated anti–human CD34 antibody (clone 563; BD Bioscience);
and sorted by FACS on a FACS Aria II (BD; Figure 3A) or by
magnetic-activated cell-sorting system (MACS; Miltenyi Biotech; see
Figure 4A), as described.22
Myeloid-type differentiation of CD34high MniPSC-derived
hematopoietic progenitors
On day 8, sorted CD34⫹ cells were plated with or without irradiated mouse
OP9 stromal cells23 in 6-well plates and cultured in cStemPro media
containing SCF (100 ng/mL), IL-3 and IL-6 (20 ng/mL each), IL-11
(50 ng/mL), EPO (4 U/mL), TPO (20 ng/mL), and IGF-1 (25 ng/mL).
Expansion of CD34high MniPSC-derived hematopoietic
progenitors
CD34⫹ cells were replated at a density of 40 000 cells per well in 12-well
plates (nontissue culture treated; Costar) in cStemPro media supplemented
with 0.75␮M SR1, IL-11 (50 ng/mL), IGF-1 (25 ng/mL), SCF, and fms-like
tyrosine kinase receptor-3 ligand (FL; 100 ng/mL each; see Figure 4A).
Cultures were maintained in hypoxia (5% CO2/20% O2/90% N2) or normoxia
(5% CO2/20% O2) for 1-2 weeks. Media was replaced every 3-4 days.
Colony formation in methylcellulose
For short-term colony-forming cell assays, EBs were dissociated with
Accutase and suspended in IMDM and single-cell suspensions from
unsorted EBs, or sorted CD34high cells were plated in triplicate in Methocult
H4435, H4230, or H4100 (all from StemCell Technologies) at densities of
100 000 or 3000 cells per 3.5-cm2 dish, respectively. For H4100 formulation, IMDM was supplemented with 1% H4100 Methocult, 15% plasmaderived serum, 10% protein-free hybridoma media (Gibco), 2mM
L-glutamine, 150 ␮g/mL transferrin, SCF (100 ng/mL), IL-11 (50 ng/mL),
IGF-1 (25 ng/mL), TPO, IL-3, IL-6 (20 ng/mL each), bFGF, VEGF
(10 ng/mL each), EPO (4 U/mL), and GM-CSF (1 ng/mL). After 14 days,
methylcellulose plates were evaluated for colonies by microscopy
(Nikon TMS), and myeloid colony-forming units (CFUs) calculated per
input 105 cells.
Lymphoid-type differentiation in OP9DL1 stromal cell coculture
Day 14 HPCs were dissociated and enriched for CD34⫹ cells as described.33 CD34⫹ cells were plated on mouse OP9 stromal cells that stably
express the Notch ligand Delta-Like 1 and green fluorescent protein
(OP9DL1-GFP) in freshly prepared ␣-MEM media (Life Technologies)
containing 50 ␮g/mL ascorbic acid, 100␮M 1-monothioglycerol, 20%
FBS, 10 ng/mL SCF, 5 ng/mL each of FL and IL-7, maintained, passaged,
and analyzed as previously described (see Figure 5A).24-26
HIV-1 and SHIV infection, Ghost(3) cell, and antigen ELISA
assays
T lymphocytes were activated overnight with IL-2 plus CD3/CD28
magnetic beads (Life Technologies). The following reagents were obtained
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
MONKEY iPSC HEMATOPOIETIC PROGENITOR GENERATION
e37
Table 1. Sequences of macaque-specific oligonucleotides for quantitative RT-PCR assays
Gene
ACTB
Forward primer
Reverse primer
TGAGGGGTATGCCCTCCCCCAT
AGGACTCCATGCCCAGGAAGGA
ACA AAGAGATGATGGAGGAACCCG
AGGATGAGGATTTGCAGGTGGACA
CD3⑀
TGGCGTTTGGGGGCAAGATGGTA
AGTAAACCAGCAGCAGCAAGCCC
CD34
GACCTCCAGCTGTGCGGAGT
GCTCCAGCTGCGGCGATTCA
CD4
AGAAGGTGGAACGCACCCAGGA
ACTGCTGGGAGTAGCGCCAGTT
CDX1
AGTGGCAGCGGTAAGACTCGGA
TGGCCAGGAGGCTAGTGTTGCT
CDX2
TCACCATCCGGAGGAAAGCCGA
GTCCACGCTCCTCATGGCTCAG
CDX4
CCCTATGCATGGATGCGCAAG
CAGAGTCACTTTGCACCGAGCC
FLT3
GCCGATCGTGGAATGGGTGCTT
TTTCTAATTCCCAGGTGAGCCCGA
GATA2
AGCCCAAGCGAAGACTGACGAC
ACAGGTGCCATGTGTCCAGCCA
HOXA9
GATCCCAATAACCCAGCGGCCA
TTTAGAGCCGCTTTGTGCGGGG
IL7␣R
TGAAATATGTGGGGCCCTCGTGGA
CTGGCGGTAAGCTACATCGTGC
RAG-1
TGGCAGGCCACACTGGACAA
ATGCCCCAATGGAGCCATCCCT
ATGCCTTCCCTATGTTCACCACCA
TGAAGATACGCCGCACAACTTTGG
BRACHYURY
SCL
through the AIDS Research and Reference Reagent Program, Division of
AIDS, National Institute of Allergy and Infectious Diseases, National
Institutes of Health: HIV-1 89.627 from Dr Ronald Collman (University of
Pennsylvania, Philadelphia, PA); and SHIV KU-128 from Dr Opendra
Narayan and Dr Sanjay Joag (University of Kansas Medical Center, Kansas
City, KS); and pNL4-329 from Dr Malcolm Martin. NL4.3 virus was
generated in HEK293T cells as described.29
Myeloid cells isolated from Methocult, unsorted lymphoid-like cells
(both derived from MniPSC CD34⫹ cells), Mn CD4⫹ lymphocytes from
blood MNCs, and OP9DL1-GFP cells were inoculated with HIV 89.6
(50 ␮L, primary stock 9.12 ⫻ 103 TCID50/mL), NL4.3 (20 ␮L, multiplicity
of infection of 5), or SHIV KU-1 (50 ␮L, primary stock 1.04 ⫻ 102
TCID50/mL) and incubated for 24 hours. Media was changed 24 hours after
inoculation. Then, 2 days later, cell-free supernatant was collected and
transferred to Ghost(3) indicator cells. At 3 days after Ghost(3) cell
inoculation, cells were collected and analyzed by flow cytometry as
described.30 Background GFP levels detected in cells exposed to OP9DL1GFP cell supernatant were subtracted from GFP percentages observed in
MniPSC lymphoid cultures. For HIV p24 and SIV p27 tests, cell-free
supernatants were diluted 1:6 or 1:100, respectively, in media and assayed
with the p24 Antigen ELISA kit (PerkinElmer) or the p27 Antigen ELISA
kit (ZeptoMetrix Corporation), per the manufacturer’s instructions, on the
Varioskan Flash Multimode Reader with SkanIt RE for Varioskan Flash,
Version 2.4.3 software (490 nm; Thermo Scientific).
Flow cytometry
MniPSC-derived EBs, HPCs, and differentiated cells were dissociated and
stained with the following antibodies: CD14-PeCy7, CD31-PE, -APC,
CD33-PE, CD34-PE, -APC, CD45-APC, CD45RA-APC-Cy7, CD49fPerCP Cy5.5, CD90-PeCy7, CCR5-PE, CD235a-PE (Glycophorin A; all
from BD); KDR-PE (R&D Systems); CD43-APC-Cy7 (Beckman Coulter),
CD38-FITC (StemCell Technologies); and CXCR4-PE (Caltag). The
ALDEFLUOR kit (StemCell Technologies) was used to detect aldehyde
dehydrogenase. Lymphoid cells were stained with the following antibodies:
CD3-PE, -APC, CD4-APC, CD8-PE, CD1a-PE, CD7-PE, CD25-APC (all
from BD); CD69-PE, CD27–Pacific Blue (eBioscience); and TCR␥␦-PE
and TCR␣␤-PE (Biolegend). Viability was determined by 7-aminoactinomycin D (eBioscience) staining. Flow cytometry was performed on an
LSR-II (BD) and data analyzed with FlowJo Version 9.4.1 (TreeStar)
software.
RNA isolation and quantitative real-time RT-PCR
Total RNA was prepared with the RNeasy Plus Kit and treated with
RNase-free DNase (all from QIAGEN). RNA was reverse transcribed into
cDNA with the use of the Superscript III First-strand Synthesis System kit
(Life Technologies) according to the manufacturer’s protocol. Macaquespecific (human cross-reactive) primers (Table 1) were designed on the
basis of the annotated rhesus macaque genome (synthesized by IDT). For
target sequences that lacked annotated confirmed or predicted sequences,
oligonucleotides specific for the human sequences were used, with human
SCL- and Brachyury-specific primers already described.3 Quantitative
PCR (qPCR) was performed with 2X Power SYBR green master mix
(Applied Biosystems) on a real-time PCR system machine (Applied
Biosystems 7500).
Statistical methods
Means and SDs were calculated, and Student t tests and ANOVA statistical
tests performed where indicated with the use of Microsoft Excel Version
12.3.2 software.
Results
Titration of BMP4 for efficient hematopoietic mesoderm
induction of MniPSCs
Toward scaling up CD34⫹ cell production, we titrated BMP4 added
during day 0 aggregation, which impacts efficiency of mesoderm
induction (Figure 1A).31 Because the optimal BMP4 concentration may vary depending on the human ESC/iPSC line, we
tested 3 BMP4 concentrations (10, 20, 50 ng/mL) on MniPSC
lines 3 and 7, which we previously used for inducing hematopoietic mesoderm in hESCs (data not shown). For MniPSC line 3,
high BMP4 on day 0 led to robust expression of CD34
(30%-45%) in day 14 and 21 cultures (Figure 1B). For day 14 MniPSC
EBs induced with 20 ng/mL BMP4, 1.5 million viable CD34⫹ cells
were generated from 1 million undifferentiated MniPSCs (Figure 1C).
Although the total percentage of CD34⫹ cells was greater on day 21, the
best viable cell yield was achieved on day 14. Only ⬃ 5% (⬍ 100 000)
CD34⫹ cells coexpressed hematopoietic markers (CD31, CD45). Importantly, CD31, which is expressed on early hematoendothelial precursors,
emerged before CD45, which is induced later and is associated with
lineage commitment.
We next assessed myeloid and short-term hematopoietic potential in CFU assays. To determine the optimal Methocult formulation for MniPSC-HPCs, we tested 3 different formulations: H4230,
historically used with human and pigtail macaque CD34⫹ cells;
H4435, used with human ESC-derived hematopoietic progenitors;
and a noncommercial formulation used with hESCs that has been
previously described.20,21 MniPSCs induced with 20 ng/mL BMP4
gave rise to significantly more CFUs, displaying a 90% CFU-M
and 10% CFU-GM phenotype. Similar CFU numbers and morphologies were noted for the 3 semisolid media tested; therefore, CFU
data for the H4435 formulation only is shown (Figure 1D). CFUs
peaked on day 14 and were significantly increased for cells induced
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
e38
GORI et al
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
We first evaluated the effect of PGE2 or SR1 on hematopoietic
differentiation of MniPSC lines 3 and 7 (Figure 2A). We selected a
previously published PGE2 concentration used in the context of
hESC hematopoietic specification19 and a SR1 concentration
determined to be optimal for expansion of NHP CD34⫹ cells
obtained from cord blood, peripheral blood, and bone marrow (data
not shown). PGE2 treatment nearly tripled the viable CD34⫹ cell
yield in day 14 HPCs generated from MniPSC line 3 cultures
(Figure 2B-C). Primitive hematopoietic cell (CD34⫹CD45⫹) yields
increased 4- and 2-fold, respectively, in PGE2- and SR1-treated
MniPSC cultures with no negative impact on total CD34⫹ cell
yield. Importantly, PGE2 treatment restricted to the first 8 days
increased CD34⫹ cell yield without compromising CFUs (Figure
Figure 1. Optimization of BMP4 concentration for hematopoietic specification
of nonhuman primate iPSCs. (A) Schematic of EB method of hematopoietic
differentiation specifying titration of BMP4 on day 0 of induction. On day ⫺2, MniPSC
line 3 colonies (passage 47) on iMEF feeders were treated with rock inhibitor (10␮M
Y-27632) and then passaged as clusters 1:2 onto GFR-matrigel in standard PSC
media supplemented with bFGF and Y-27632. On day 0, MniPSCs clusters
aggregated in media consisting of complete StemPro (cStemPro; StemPro-34 plus
StemPro supplement, 2mM L-glutamine, 150 ␮g/mL transferrin, 50 ␮g/mL ascorbic
acid, and 4 ⫻ 10⫺4M 1-thioglycerol) with different concentrations of BMP4 (10, 20, or
50 ng/mL, test conditions in bold type) and transferred to hypoxia (5% O2). On day 1,
EBs were induced with cStemPro supplemented with BMP4 and bFGF. On day 4,
media was changed to cStemPro containing VEGF and bFGF for induction. To induce
hematopoietic cell expansion, EBs were suspended in cStemPro containing a
10-cytokine cocktail as indicated and placed in normoxia. (B) Comparative kinetics of
hematopoietic specification as determined by flow cytometry analysis. On the
indicated days of differentiation, EBs were dissociated, counted, stained with
fluorophore-conjugated antibodies and analyzed by flow cytometry. (C) Absolute cell
number of fluorophore cells. Absolute cell yields corresponding to the indicated
hematoendothelial subsets were calculated (absolute positive cell yield ⫽ 100 ⫻ [%
flurophore⫹ ⫻ viable cell yield]). Each number shown is ⫻106 and is representative of
the total fluorpohore⫹ cell yield obtained from an input undifferentiated MniPS cell
number of 1 million. (D) Hematopoietic colony-forming cell assays plated on the
indicated days of differentiation. MniPSC-derived cells were dissociated and single
cells plated in Methocult H4435. CFUs were enumerated and scored as a function of
input cell number (CFUs per 105 cells plated). The results from 1 representative
experiment of 3 conducted are shown. Error bars indicate SD of mean of triplicates.
ANOVA significance levels: *P ⫽ .039 (day 8), *P ⫽ .016 (day 14).
in 20 ng/mL BMP4, coinciding with the greatest CD34⫹ viable cell
yield. BMP4 titration also was tested for hematopoietic induction
of MniPSC line 7, and similar results were obtained (data not
shown).
Treatment with PGE2 and SR1 enhances hematopoietic
progenitor emergence and expansion
We next tested whether PGE232 or SR1,14 which activate downstream pathways implicated in HSC emergence and homeostasis,
respectively, would improve HPC formation from macaque iPSCs.
Figure 2. PGE2 and SR1 alter the kinetics and efficiency of hematopoietic
differentiation of MniPSCs. (A) Schematic of hematopoietic differentiation with or
without the addition of PGE2 or SR1. On day 0, MniPSC line 3 colonies (passage 50)
were aggregated into EBs in cStemPro medium with BMP4. On day 1, media were
supplemented with 2␮M PGE2, 0.75␮M SR1, or untreated (No Rx). For each
subsequent induction and media change until the end of the experiment, cStemPro
was supplemented with PGE2 or SR1. (B) Comparative kinetics of hematopoietic
specification for PGE2, SR1, or untreated cultures as determined by flow cytometry
analysis. On the indicated days of differentiation, EBs were dissociated, counted,
stained with fluorophore-conjugated antibodies and analyzed by flow cytometry.
(C) Absolute cell number of fluorphore⫹ cells. Absolute cell yields corresponding to
the indicated hematoendothelial subsets were calculated (absolute positive cell
yield ⫽ 100 ⫻ [% fluorphore⫹ ⫻ viable cell yield]). Each number shown is ⫻106 and
is representative of the total fluorphore⫹ cell yield obtained from an input undifferentiated MniPS cell number of 1 million. (D) Hematopoietic colony-forming cell assays
plated on the indicated days of differentiation. MniPSC-derived cells were
dissociated and single cells plated in Methocult H4435. CFUs were enumerated
and scored as a function of input cell number (CFUs per 105 cells plated). The
results from 1 representative experiment of 3 conducted are shown. Error bars
indicate SD of mean of triplicates. ANOVA significance levels: *P ⫽ .042 (day 14),
*P ⫽ .039 (day 21).
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
MONKEY iPSC HEMATOPOIETIC PROGENITOR GENERATION
e39
Figure 3. FACS-sorted MniPSC-CD34ⴙ cells give rise to
CD45ⴙCD34ⴚ hematopoietic progeny. (A) Schematic of differentiation of MniPSC lines 3 and 7. Both MniPSC lines were induced
days 0 to 8 with the optimized protocol outlined in Figure 2 with 2␮M
PGE2 added to EBs on days 1-8 of differentiation. On day 8, EBs were
dissociated into single cells, immunostained with PE-conjugated
anti-CD34 antibody (clone 563), and sorted by FACS for the CD34high
fraction. CD34high cells were plated in cStemPro plus cytokines
(50 000 CD34high cells per well of a 6-well plate) on irradiated OP9
stromal cells. (B) Percentages of CD34high cells that coexpress
hematoendothelial markers on the indicated days of differentiation,
which include presorted (day 8) and postsorted populations (days 14,
21). (C) Absolute number of fluorphore⫹ cells for MniPSC lines 3 and 7
that were induced toward hematopoietic differentiation, sorted for the
CD34high fraction on day 8, and plated in OP9 coculture. Absolute cell
yields corresponding to the indicated hematoendothelial subsets were
calculated (absolute positive cell yield ⫽ 100 ⫻ [% fluorphore⫹ ⫻ viable cell yield]). Each number shown is ⫻106 and is representative of
the total fluorphore⫹ cell yield obtained from an input undifferentiated
MniPS cell number of 1 million. (D) Comparison of hematopoietic
colony-forming potential (CFUs) of unsorted and CD34-enriched cells
from day 8 MniPSC line 3 and line 7 HPCs and pigtail macaque
mobilized bone marrow. To evaluate MniPSC-derived HPCs, EBs
were dissociated on day 8, kept in bulk (unsorted), or sorted by FACS
and then plated in Methocult H4435. Error bars indicate SD of mean of
3 separate experiments. (E) Representative flow cytometry dot plots
of MniPSC-derived HPCs on day 18 of differentiation. (F) Representative images of MniPSC Line 7-derived CD34high cell-derived hematopoietic zones on OP9 stromal cells on day 21 of differentiation. Similar
results were obtained from MniPSC line 3 CD34high cells. Colonies
were imaged on a Nikon Eclipse Ti-M (TiSR) microscope and
photographed with a Nikon camera, in cStemPro media (10⫻ [left]
and 20⫻ [right] objectives). Scale bar ⫽ 100 ␮m.
2D). Prolonged treatment with PGE2 (14 days) significantly reduced hematopoietic colony-forming potential compared with
untreated controls. In contrast, SR1 treatment increased CFUs
compared with controls. Similar results were obtained for MniPSC
line 7. These findings indicate that short-term treatment with either
PGE2 or SR1 improves CD34⫹ cell generation from MniPSCs, but
PGE2 is superior on the basis of viable cell yields.
Purification of CD34high cells enhances hematopoietic
specification and lineage commitment
Although PGE2 increased hematopoietic lineage commitment
compared with untreated controls, differentiation was relatively
inefficient. Flow cytometry analysis revealed persistence of 10%30% undifferentiated cells after induction. In addition, hematopoietic maturation as indicated by a loss of CD34 in the CD45⫹
population was very low (⬍ 2% CD45⫹CD34⫺). On the basis of
these findings, we hypothesized that removal of undifferentiated
cells would improve hematopoietic commitment and maturation.
To determine whether hematopoietic specification could be improved by isolation of the CD34⫹ fraction, day 8 CD34⫹ cells
generated from MniPSC lines 3 and 7 were FACS sorted and
replated with or without OP9 stromal cells in hematopoietic
expansion medium (Figure 3A). Purified CD34high cells increased
production of primitive hematopoietic cells (30% or 0.3 million
CD34⫹CD45⫹ generated from 1 million undifferentiated MniPSCs)
and coexpression of hemogenic markers compared with unsorted
hematopoietic EBs (Figure 3B-C). MniPSC line 7 CD34high cells
gave rise to more CD45⫹CD34⫺ cells compared with MniPSC line
3 (Figure 3B-C). Hematopoietic colony-forming potential doubled
for sorted compared with unsorted HPCs (Figure 3D). CFUs
generated from sorted CD34⫹ cells were 2-fold greater for line 7
compared with line 3, consistent with their CD45⫹CD34⫹CD31low
phenotype, which is associated with erythro-myeloid potential33
(Figure 3E). In contrast, line 3-derived cells had a CD45⫺CD34⫹
CD31high phenotype. Sorted CD34⫹ cells gave rise to ⬃ 4-fold
more hematopoietic colonies compared with unsorted cells.
Purified CD34⫹ cells derived from MniPSC line 7 approached
CFU counts obtained from unsorted macaque mobilized bone
marrow (Figure 3D). Close to 90% of the hematopoietic
colonies had CFU-M morphology, with only 10% of colonies
displaying CFU-GM morphology. MniPSC CD34⫹ cells formed
hematopoietic zones25 in OP9 stromal cell coculture, which
resemble cobblestone area–forming cells (Figure 3F).
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
e40
GORI et al
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
An optimized 4-step protocol supports the expansion of
MniPSC-derived HPCs with a putative LT-HSC phenotype
On the basis of stage-specific biologic roles of the prostaglandin
pathway in early hematopoiesis and AhR signaling in HSC
homeostasis, we wanted to determine whether sequential modulation of these pathways with PGE2 and SR1 would enhance the
emergence and expansion of putative HSCs. To clarify the effect of
SR1 on HPC homeostasis, we tested whether a novel multistep
approach to HSC generation, purification, and expansion would
increase HPC yield. We hypothesized that early treatment with
PGE2 would boost viable CD34⫹ cell yield, purification of
CD34high cells would enhance hematopoietic commitment by
eliminating residual undifferentiated iPSCs, and subsequent SR1
treatment would expand the CD34⫹ putative HSCs (Figure 4A).
We also developed a progenitor expansion media, which excludes
endothelial (VEGF)–, erythroid (TPO, EPO)–, and myeloid (IL-3,
IL-6)–specific cytokines. To expand HPCs, we supplemented basal
media with SCF, FL, IL-11, bFGF, and SR1 (Figure 4A).
As the results shown in Figure 3 indicate, MniPSC line
7–derived CD34high cells have greater hematopoietic mesoderm
potential compared with line 3; thus, subsequent studies were
conducted with MniPSC line 7. Toward scaling up HPC production, we
also switched from a 6-well plate format to 10-cm dishes. To clarify the
phenotype of MniPSC-derived primitive HPCs, we included hematopoietic cell-specific gene expression by qRT-PCR (Figure 4B and Table 1)
and a multiparametric LT-HSC like phenotype, which has been shown
to identify human cord blood–derived SCID-repopulating cells (SRCs;
CD34⫹CD38⫺Thy1⫹CD45RA⫺CD49f⫹).34
Gene expression assays for mesoderm and hematopoietic
transcription factors showed that Brachyury, CDX4, and GATA2
mRNA peaked on day 1, whereas CDX1, CDX2, and HOXA9
peaked on day 4, followed by SCL on day 8. Cell-surface markers
Flt3 and CD34 peaked on days 4 and 6, respectively. On days 4, 6,
and 8 of differentiation, all CD34⫹ cells also were CD38⫺ and a
fraction of the CD34⫹ cells coexpressed CD49f as determined by
flow cytometry (Figure 4C). CD34⫹ cell yield was greatest on day
4 (4.5 million CD34⫹ cells per 10-cm plate) and decreased on days
6 and 8 (2.4 million CD34⫹ cells). The CD34high fraction was
isolated on day 8 and maintained in our novel expansion media.
After a 1-week expansion in SR1, the enriched cell fraction
maintained a putative LT-HSC phenotype (Figure 4D). However,
CD34⫹ cell number cultured under normoxic conditions expanded
3-fold, whereas cells grown in hypoxia maintained their phenotype
but did not increase in total cell number. These data clarify a 4-step
protocol that expands MniPSC-derived HPCs ex vivo. This optimized hematopoietic specification protocol for MniPSCs includes
the following steps: (1) BMP4 mesoderm induction (20 ng/mL
BMP4, days 0 and 1); (2) hematopoietic specification with PGE2
(2␮M PGE2, days 1-7); (3) purification of CD34high cells; and (4)
CD34⫹ cell expansion in normoxia with SR1.
MniPSC-derived CD34high cells give rise to CD45ⴙCD34ⴚ
hematopoietic progeny with bilineage differentiation potential
We next evaluated MniPSC-derived CD34⫹ cell differentiation
potential. HPCs were expanded for 14 days and MACS enriched
for CD34⫹ cells (Figure 5A). As in previous experiments, the majority
of the hematopoietic colonies had a CFU-M phenotype (Figure 5B).
Colonies isolated and evaluated by flow cytometry were heterogeneous
in phenotype, expressing HPC (CD34, CXCR4)–, myeloid (CD33,
CD14, CCR5)–, erythroid (GlyA)–, and lymphoid (CD3, CD19)–
specific cell-surface markers (Figure 5B).
Figure 4. SR1 maintains and expands MniPSC-derived CD34ⴙ HPCs purified by
MACS enrichment. (A) Schematic of MniPSC HPC cell differentiation, enrichment, and expansion. MniPSC Line 7 (Passage 54) cells were aggregated and
induced toward differentiation as shown in Figure 3. On day 9 of induction, cells
were purified by MACS with anti–human CD34 antibody (clone 12.8). The CD34⫹
fraction was then cultured under hypoxic (5% O2) or normoxic (20% O2) conditions
in cStemPro containing the indicated cytokines and 0.75␮M SR1 for HPC
expansion. (B) qRT-PCR–based expression of hematopoietic specific genes on
days 1, 4, 6, and 8 of hematoendothelial differentiation. Expression levels are
relative to ␤-actin and calibrated to undifferentiated MniPSCs. Error bars indicate
SD of mean of triplicate samples from 1 representative experiment of
3. (C) Flow cytometry analysis of CD34 and CD49f coexpression on days 4, 6, and
8 of differentiation before enrichment by MACS. (D) Flow cytometry analysis of
putative LT-HSCs (CD34⫹CD38⫺Thy1⫹CD45RA⫺CD49f⫹) after a 1-week expansion in SR1 under hypoxic (top) or normoxic (bottom) conditions. Fold expansion
of total CD34⫹CD38⫺Thy1⫹CD45RA⫺CD49f⫹ cells: 1.1 (hypoxia), 3 (normoxia).
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
MONKEY iPSC HEMATOPOIETIC PROGENITOR GENERATION
e41
Figure 5. MniPSC-derived CD34ⴙ HPCs exhibit myeloid and
lymphoid differentiation potential. (A) Schematic of differentiation.
MniPSC Line 7 cells (Passage 18) were induced according to the
optimize protocol outlined in the previous figure schema. On day 8,
EBs were replated in cStemPro plus SCF and FL for HPC expansion.
On day 15, CD34⫹ cells were MACS purified and plated into Methocult
(myeloid CFU assays) or into stromal cell coculture with OP9 cells that
express GFP and the Notch ligand Delta-Like 1 (OP9DL1-GFP). To
induce lymphoid differentiation, cells were cultured in freshly prepared
␣-MEM containing FBS, SCF, FL, and IL-7. T0 indicates the starting
time point for lymphocyte differentiation. (B) Myeloid phenotype of
MniPSC-derived hematopoietic progeny. Left, Representative CFU-M
colony differentiated from day 14 CD34⫹ HPC cells. Colonies were
imaged on a Nikon Eclipse Ti-M (TiSR) microscope and photographed
with a Nikon camera, in Methocult (20⫻ objective). Scale
bar ⫽ 100 ␮m. Right, Flow cytometry analysis of myelomonocytic
hematopoietic colonies isolated from Methocult. Myelomonocytic
colonies from day 14 MniPSC line 7 CD34high HPCs were isolated
from Methocult after CFU scoring on day 24 and analyzed. Gray
histograms indicate isotype controls for the indicated fluorophores.
(C) qRT-PCR–based expression analysis of T lymphocyte–specific
genes in MniPSC-derived lymphoid cocultures (day 30 of lymphoid
differentiation). Gene expression also was assessed in CD4⫹ lymphocytes purified from macaque peripheral blood mononuclear cells and
corrected for OP9DL1 stromal cell gene expression. Gene expression
levels are relative to ␤-actin and calibrated to levels detected in
undifferentiated MniPSCs. Error bars indicated the SD of the mean of
quadruplicate samples. (D) Up-regulation of early activation markers
in MniPSC lymphoid cells. Macaque (Mn) CD4⫹ lymphocytes and day
45 MniPSC lymphoid cultures were untreated or activated for 24 hours
with hIL-2 and CD3/CD28 beads and then analyzed by flow cytometry.
(E) Expression of HIV entry coreceptors in activated macaque (Mn)
CD4⫹ lymphocytes and day 45 MniPSC-derived lymphoid cultures.
(F) MniPSC-derived myeloid and lymphoid cells support SHIVKU-1
entry and viral replication. GFP expression in Ghost cells cultured with
supernatant from CD4⫹ lymphocytes, MniPSC myeloid and lymphoid
cultures infected with SHIV-KU1 after virus washout.
To assess lymphoid potential of the MniPSC-derived CD34high
cells, we induced lymphoid differentiation by OP9DL1-GFP
coculture (Figure 5A). GFP⫺ colonies appeared 1 week later
(supplemental Figure 1A, see the Supplemental Materials link at
the top of the article). CD1a, expressed on early lymphocytes,
peaked on day 28 whereas CD3, CD4, CD8, and CD7 expression,
acquired later, increased over time. Intracellular CD3⑀ increased to
60% by day 35, with surface expression of CD3⑀ with TCR␣␤ and
TCR␥␦ represented (supplemental Figure 1B). To validate lymphoid phenotype, RAG-1, CD3⑀, CD4, and IL7-R␣ mRNA levels
were compared in day 30 MniPSC lymphoid/OP9DL1-GFP coculture and macaque peripheral blood CD4⫹ cells (Mn CD4) with
primers specific for Mn orthologs (Figure 5C and Table 1).
Importantly, RAG-1 mRNA was up-regulated 107-fold in MniPSC
lymphoid-like cells, suggesting an early lymphoid progenitor state
had been achieved (Figure 5C). In contrast, relatively low levels of
RAG-1 were detected in Mn CD4⫹-derived mRNA. These findings
are consistent with the 2 waves of RAG-1 gene expression
previously reported, in which RAG genes are highly expressed in
CD25⫹CD4⫺CD8⫺CD3⫺ T lymphocyte progenitors, when TCR
loci undergo rearrangement, and then later at the CD4⫹CD8⫹
stage.35,36
Given that ⬃ 4% of the Mn CD4⫹ cells were also CD8⫹, we
expected to detect a low level of RAG-1. Relative expression of
CD3⑀, CD4, and IL7-R␣ mRNA in MniPSC lymphoid cultures and
Mn CD4⫹ cells was 103-105-fold greater compared with undifferentiated MniPSCs. Consistent with an immature phenotype, 17% of
resting MniPSC lymphoid cultures also expressed CD25 (Figure
4D top). Mn CD4⫹ and day 45 MniPSC lymphoid cultures were
then costimulated with CD3/CD28 beads and assayed for upregulation of the early activation marker CD69 in combination with
CD25 (Figure 4D bottom). In costimulated Mn CD4⫹ cells, CD25
increased almost 5-fold with 29% of the cells coexpressing CD69,
and CD69 expression was restricted to the CD25⫹ fraction. In
contrast, 81% of costimulated day 45 MniPSC lymphoid cultures
expressed CD69, a fraction of which expressed CD25. Differential
expression of CD69 (63% CD69⫹CD25⫺, 18% CD69⫹CD25⫹) in
MniPSC CD4⫹ lymphoid-like cells may indicate emergence of
2 distinct lymphoid subsets, the former consistent with a recently
identified nontraditional FoxP3-null regulatory T-cell population
(CD69⫹CD4⫹CD25⫺) implicated in tumor immune escape.37,38
Myeloid and lymphoid cells generated from MniPSC-derived
CD34high cells support HIV-1 and SHIV entry and viral
replication ex vivo
To develop HIV-directed PSC therapeutics and validate bilineage
differentiation potential, we next assessed whether MniPSC
lymphoid-like cells were susceptible to SHIV infection. Expression
of HIV-1 entry coreceptors CXCR4 and CCR5 with CD4 were
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
e42
GORI et al
evaluated by flow cytometry on day 45 (Figure 5E). Costimulated
Mn CD4⫹ and MniPSC lymphoid-like cells coexpressed CXCR4
and CD4 (65% and 33%, respectively). Consistent with an
activated phenotype,39 10% of costimulated Mn CD4⫹ cells and
24% of MniPSC lymphoid-like cells coexpressed CD4 with CCR5.
Given the limited yield of lymphoid cells and differences between
ex vivo and in vivo functionality, we focused on testing SHIV
infectivity as an indirect measure of hematopoietic maturation and
potential in vivo application and did not conduct additional ex vivo
functional assays (cytotoxicity, cytokine production). MniPSCCD34high derived lymphoid-like and myeloid-like cells were challenged with R5- and X4-tropic 89.6 and X4-tropic NL4.3 HIV-1
isolates.27,29 Mn CD4⫹ cells, unsorted MniPSC-derived myeloid
and lymphoid cells were susceptible to low levels (⬃ 1%) of HIV-1
infection, as determined in Ghost(3) cell assays.40 HIV p24 was
detected in media of infected cells after virus washout and culture,
confirming HIV-1 entry and replication (supplemental Figure 1C).
Given the cellular restriction factors (ie, TRIM5␣) that block
the HIV life cycle in NHP cells,41 we challenged cells with
R4-tropic SHIV-KU1, to which NHP cells should be more permissive.28 Day 45 MniPSC lymphoid-like cells supported SHIV
infection (2.4%), at levels 2- and 8-fold less than in MniPSC
myeloid cells (5%), and Mn CD4⫹ cells (20%), respectively
(Figure 5F). The SIV p27 antigen capture ELISA, which measures
viral replication, indicated high p27 levels in the media of both Mn
CD4⫹ (2.2 ⫻ 104 pg/mL) and MniPSC lymphoid-like cells
(2.4 ⫻ 103 pg/mL; ⬃ 9-fold difference; supplemental Figure 1D).
These results indicate that NHP iPSCs give rise to lymphoid-like
cells that respond to costimulation and support SHIV entry and
replication ex vivo.
Discussion
We have developed a novel hematopoietic differentiation, enrichment, and expansion protocol to facilitate the emergence and
expansion of HPCs from MniPSCs. We report that sequential
treatment with PGE2 followed by SR1 increases production of
CD34high cells, which display a cell-surface marker phenotype
similar to putative LT-HSCs. Purified CD34high cells have bilineage
differentiation and substantial hematopoietic colony-forming potential. This protocol is translatable to human PSC differentiation
because BMP4,20 PGE2,19 and SR114 interact with BMP, prostaglandin, Wnt, and AhR signaling in human stem cells. To the best of our
knowledge, this is the first reported use of SR1 to expand
iPSC-derived HPCs.
Transplantation of gene-modified iPSC derivatives has potential for
the treatment of hematologic diseases. To test iPSC-derived cell
engraftment in an autologous large animal model, we and other groups
have generated NHP iPSCs, including pigtail and rhesus macaque,42
cynomolgus monkey,43,44 and common marmoset.45 Toward scaling up
hematopoietic differentiation for HPC transplantation, we developed a
strategy to expand and purify HPCs from MniPSCs. We present a
chemically defined induction protocol that will permit production
scale-up of CD34high cells that have a phenotype associated with SRCs
(CD34⫹CD38⫺Thy1⫹CD45RA⫺CD49f⫹).
We show that sequential treatment with BMP4 (days 0-1),
PGE2 (days 1-7), and SR1 (days 8-17) supports the emergence and
expansion of HPCs with an SRC phenotype. We also show that
MniPSC-derived CD34⫹ cells can be purified with the MACS
system used for CD34⫹ purification in autologous transplantation
studies in our laboratory. This technology allows us to obtain a
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
⬎ 98% pure population of MniPSC-derived CD34high cells. Second, when sorted CD34⫹ cells are extracted from heterogeneous
culture containing undifferentiated MniPSCs, they expand by
coculture with SR1 in normoxia and maintain an HSC-like cell
surface phenotype. This finding is novel and significant because
translation from ex vivo small-scale CD34⫹ cell production to
transplantation in a large animal will require extensive expansion
of the input cell population. On the basis of our experience
transplanting gene-modified autologous HSCs enriched from mobilized blood or bone marrow in the macaque, the minimum
threshold CD34⫹ cell dose required for long-term, multilineage
repopulation after myeloablative preconditioning is 2 million cells
per kilogram of body weight. Our test scale-up in 10-cm plates
indicates that to generate 10 million CD34⫹ cells to transplant into
a 5-kg monkey, 400 million cells would be required for aggregation.
Although the scale-up for such a transplantation will be a
challenge, other issues must be addressed to translate iPSC
technology to a larger physiologic system, including selection of
the specific iPSC line, the passage number to be used in transplantation, and quality control of the reagents used for differentiation.
In our studies, both the passage number and clonal line of iPSCs
impacted efficiency of differentiation and cell yield. For each line,
it is likely that the expansion protocol will have to be further
optimized to reach minimum cell doses for transplantation. In
addition, for the small-scale studies presented herein, we have used
previously validated batches of reagents. Scale-up for the monkey
transplantation will require liters of StemPro media and several
grams of cytokines for differentiation.
If human/mouse xenograft data are predictive of engraftment
potential of HSCs derived from various sources (ie, umbilical cord
blood, bone marrow, iPSCs), then chemical modification, coculture
methods, genetic manipulation, and/or greater cell doses will likely
be required to approach the therapeutic benefit that is currently
achievable with umbilical cord blood and bone marrow–derived
HSC transplantation. To this end, in vivo selection or expansion
will likely be required for long-term engraftment and contribution
to hematopoiesis, which raises additional concerns. Although it is
straightforward to gene modify iPSCs, we have observed loss of
transgene expression after serial passaging and lineage commitment, which could impede iPSC-related gene therapy applications.
Finally, given the somewhat-undefined repopulation potential of
PSC-derived putative HSCs, transplantation of a more phenotypically distinct hematopoietic lineage, such as a purified lymphocyte
population, may be more easily translatable to a large animal model
and eventual patient population, including HIV/AIDS patients.
Although gene modification of somatic HSCs and T lymphocytes from HIV⫹ patients may be complicated because of potential
infection, iPSCs can be generated from patient cells that are not of
hematopoietic origin (ie, fibroblasts) and not susceptible to HIV
infection. Transplantation of iPSC-derived HIV-resistant HPCs and
lymphocytes would likely decrease toxicity associated with conventional HSC transplantation because only a low-dose conditioning
regimen would be required for successful HIV-resistant autologous
cell engraftment.46 Given the worldwide impact of HIV infection
on human health, iPSC-derived, patient-specific, and HIV-resistant
cells for hematopoietic reconstitution is an exciting treatment
option. This potential application stems from successful treatment
of an HIV⫹ leukemia patient after radiation and transplantation of
donor HSC with a mutated HIV coreceptor (CCR5⌬32).47 Because
matched CCR5⌬32 donors are rare, autologous genetically engineered knockout CCR5 iPSC-derived cells may provide an alternative option for HIV⫹ patients. Nonhuman primate iPSCs provide a
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
preclinical model to test transplantation of virus-resistant cells and
other novel therapies.
In summary, our findings establish a reproducible protocol for
induction, expansion, and isolation of NHP iPSC-derived HPCs
with bilineage differentiation potential, which we will now use to
test novel iPSC-based therapeutics for the treatment of hematologic
genetic and infectious disease in the pigtail macaque. This protocol
may be more broadly applicable to mouse and human PSC systems.
Because we engineered our MniPSC lines to express inducible
suicide genes (ie, iCaspase9) and selectable markers (ie,
MGMTP140K), we now can test the engraftment of MniPSCCD34high cells and control their in vivo expansion and elimination
in a clinically relevant large animal model.
Acknowledgments
The authors thank Helen Crawford, Laura Farren, and Bonnie
Larson for manuscript preparation; Veronica Nelson and University
of Washington National Primate Research Center staff; members of
H.-P.K.’s laboratory; UW Department of Cytogenetics for karyotype assessment; FHCRC Flow Cytometry Core Facility; and
MSSM hESC/iPSC Shared Resource Facility. H.-P.K. is a Markey
Molecular Medicine Investigator and the recipient of the Jose
Carreras/E.D. Thomas Endowed Chair for Cancer Research.
MONKEY iPSC HEMATOPOIETIC PROGENITOR GENERATION
e43
This work was supported by National Institutes of Health grants
HL098489, HL084345, AI080326, and DK56465. S.L.D. and the
hESC/iPSC Shared Resource Facility at Mount Sinai School of
Medicine are supported by a New York State Department of
Health/NYSTEM grant (C024176).
Authorship
Contribution: J.L.G. and H.-P.K. designed the studies; J.L.G.
performed the experiments, data analysis and interpretation, and
statistical analyses and wrote the manuscript; D.C. contributed to
experimental design and performed experiments and data analysis;
J.P.K. prepared NL4.3 HIV-1 virus stock and performed p24 and
p27 assays; B.C.B. performed (S)HIV infections and Ghost(3) cell
assays; S.L.D. contributed to the development of the protocol; and
J.L.G., D.C., J.E.A., B.C.B., S.L.D., and H-P.K. edited the
manuscript.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Hans-Peter Kiem, PO Box 19024, M/S D1100, 1100 Fairview Ave N, Seattle, WA 98109; e-mail:
[email protected].
References
1. Rudge C, Matesanz R, Delmonico FL, Chapman
J. International practices of organ donation. Br J
Anaesth. 2012;108(Suppl 1):i48-i55.
2. Tomblyn M, Chiller T, Einsele H, et al. Guidelines
for preventing infectious complications among
hematopoietic cell transplantation recipients: a
global perspective [erratum appears in Biol Blood
Marrow Transplant. 2010;16(2):294]. Biol Blood
Marrow Transplant. 2009;15(10):1143-1238.
3. Lengerke C, Daley GQ. Autologous blood cell
therapies from pluripotent stem cells [review].
Blood Rev. 2010;24(1):27-37.
4. McKnight KD, Wang P, Kim SK. Deconstructing
pancreas development to reconstruct human islets from pluripotent stem cells. Cell Stem Cell.
2010;6(4):300-308.
5. Sanal MG. Future of liver transplantation: nonhuman primates for patient-specific organs from
induced pluripotent stem cell [review]. World J
Gastroenterol. 2011;17(32):3684-3690.
6. Laflamme MA, Murry CE. Regenerating the heart
[review]. Nat Biotechnol. 2005;23(7):845-856.
7. Ronaghi M, Erceg S, Moreno-Manzano V,
Stojkovic M. Challenges of stem cell therapy for
spinal cord injury: human embryonic stem cells,
endogenous neural stem cells, or induced pluripotent stem cells? [review]. Stem Cells. 2010;
28(1):93-99.
8. Trobridge GD, Kiem H-P. Large animal models of
hematopoietic stem cell gene therapy. Gene
Ther. 2010;17(8):939-948.
9. Beard BC, Trobridge GD, Ironside C, McCune JS,
Adair JE, Kiem H-P. Efficient and stable MGMTmediated selection of long-term repopulating
stem cells in nonhuman primates. J Clin Invest.
2010;120(7):2345-2354.
10. Trobridge GD, Beard BC, Gooch C, et al. Efficient
transduction of pigtailed macaque hemtopoietic
repopulating cells with HIV-based lentiviral vectors. Blood. 2008;111(12):5537-5543.
11. Trobridge GD, Wu RA, Beard BC, et al. Protection of stem cell-derived lymphocytes in a primate
AIDS gene therapy model after in vivo selection.
PLoS One. 2009;4(11):e7693.
12. Zhong B, Trobridge GD, Zhang X, et al. Efficient
generation of nonhuman primate induced pluripotent stem cells. Stem Cells Dev. 2011;20(5):795807.
23.
13. Zhong B, Watts KL, Gori JL, et al. Safeguarding
nonhuman primate iPS cells with suicide genes.
Mol Ther. 2011;19(9):1667-1675.
14. Boitano AE, Wang J, Romeo R, et al. Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells. Science.
2010;329(5997):1345-1348.
24.
15. North TE, Goessling W, Walkley CR, et al. Prostaglandin E2 regulates vertebrate haematopoietic
stem cell homeostasis. Nature. 2007;447(7147):
1007-1011.
25.
16. Goessling W, North TE, Loewer S, et al. Genetic
interaction of PGE2 and Wnt signaling regulates
developmental specification of stem cells and regeneration. Cell. 2009;136(6):1136-1147.
26.
17. Lengerke C, Schmitt S, Bowman TV, et al. BMP
and Wnt specify hematopoietic fate by activation
of the Cdx-Hox pathway. Cell Stem Cell. 2008;
2(1):72-82.
27.
18. Nostro MC, Cheng X, Keller GM, Gadue P. Wnt,
activin, and BMP signaling regulate distinct
stages in the developmental pathway from embryonic stem cells to blood. Cell Stem Cell. 2008;
2(1):60-71.
28.
19. Woods NB, Parker AS, Moraghebi R, et al. Brief
report: efficient generation of hematopoietic precursors and progenitors from human pluripotent
stem cell lines. Stem Cells. 2011;29(7):11581164.
29.
20. Kennedy M, D’Souza SL, Lynch-Kattman M,
Schwantz S, Keller G. Development of the hemangioblast defines the onset of hematopoiesis
in human ES cell differentiation cultures. Blood.
2007;109(7):2679-2687.
30.
21. Grigoriadis AE, Kennedy M, Bozec A, et al. Directed differentiation of hematopoietic precursors
and functional osteoclasts from human ES and
iPS cells. Blood. 2010;115(14):2769-2776.
31.
22. Horn PA, Topp MS, Morris JC, Riddell SR, Kiem
H-P. Highly efficient gene transfer into baboon
marrow repopulating cells using GALVpseudotype oncoretroviral vectors produced by
32.
human packaging cells. Blood. 2002;100(12):
3960-3967.
Vodyanik MA, Bork JA, Thomson JA, Slukvin II.
Human embryonic stem cell-derived CD34⫹
cells: efficient production in the coculture with
OP9 stromal cells and analysis of lymphohematopoietic potential. Blood. 2005;105(2):617-626.
Van Coppernolle S, Verstichel G, Timmermans F,
et al. Functionally mature CD4 and CD8 TCRalphabeta cells are generated in OP9-DL1 cultures
from human CD34⫹ hematopoietic cells. J Immunol. 2009;183(8):4859-4870.
Timmermans F, Velghe I, Vanwalleghem L, et al.
Generation of T cells from human embryonic
stem cell-derived hematopoietic zones. J Immunol. 2009;182(11):6879-6888.
Wang H, Pierce LJ, Spangrude GJ. Distinct roles
of IL-7 and stem cell factor in the OP9-DL1 T-cell
differentiation culture system. Exp Hematol.
2006;34(12):1730-1740.
Collman R, Balliet JW, Gregory SA, et al. An infectious molecular clone of an unusual macrophagetropic and highly cytopathic strain of human immunodeficiency virus type 1. J Virol. 1992;66(12):
7517-7521.
Stephens EB, Joag SV, Atkinson B, et al. Infected
macaques that controlled replication of SIVmac
or nonpathogenic SHIV developed sterilizing resistance against pathogenic SHIV(KU-1). Virology. 1997;234(2):328-339.
Adachi A, Gendelman HE, Koenig S, et al. Production of acquired immunodeficiency syndromeassociated retrovirus in human and nonhuman
cells transfected with an infectious molecular
clone. J Virol. 1986;59(2):284-291.
Vo¨dro¨s D, Tscherning-Casper C, Navea L,
Schols D, De Clercq E, Fenyo EM. Quantitative
evaluation of HIV-1 coreceptor use in the
GHOST3 cell assay. Virology. 2001;291(1):1-11.
Irion S, Clarke RL, Luche H, et al. Temporal
specification of blood progenitors from mouse
embryonic stem cells and induced pluripotent
stem cells. Development. 2010;137(17):28292839.
Hoggatt J, Singh P, Sampath J, Pelus LM. Prostaglandin E2 enhances hematopoietic stem cell
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
e44
GORI et al
homing, survival, and proliferation. Blood. 2009;
113(22):5444-5455.
33. Nakayama N, Lee J, Chiu L. Vascular endothelial
growth factor synergistically enhances bone morphogenetic protein-4–dependent lymphohematopoietic cell generation from embryonic stem cells
in vitro [erratum appears in Blood. 2000;96(4):
1273]. Blood. 2000;95(7):2275-2283.
BLOOD, 27 SEPTEMBER 2012 䡠 VOLUME 120, NUMBER 13
T cells, suppress T cell proliferation through
membrane-bound TGF-beta 1. J Immunol. 2009;
182(1):111-120.
38. Xu D, Wang FS. Are non-traditional CD4(⫹)
CD69(⫹) CD25(⫺) regulatory T cells involved in
disease progression of human hepatocellular carcinoma? J Gastroenterol Hepatol. 2011;26(10):
1469-1470.
34. Notta F, Doulatov S, Laurenti E, Poeppl A,
Jurisica I, Dick JE. Isolation of single human hematopoietic stem cells capable of long-term multilineage engraftment. Science. 2011;333(6039):
218-221.
39. Palmer LA, Sale GE, Balogun JI, et al. Chemokine receptor CCR5 mediates alloimmune responses in graft-versus-host disease. Biol Blood
Marrow Transplant. 2010;16(3):311-319.
35. Wilson A, Held W, MacDonald HR. Two waves of
recombinase gene expression in developing thymocytes. J Exp Med. 1994;179(4):1355-1360.
40. Vo¨dro¨s D, Fenyo EM. Quantitative evaluation of
HIV and SIV co-receptor use with GHOST(3) cell
assay. Methods Mol Biol. 2005;304:333-342.
36. Alt FW, Rathbun G, Oltz E, Taccioli G, Shinkai Y.
Function and control of recombination-activating
gene activity [review]. Ann NY Acad Sci. 1992;
651:277-294.
41. Javanbakht H, Diaz-Griffero F, Stremlau M, Si Z,
Sodroski J. The contribution of RING and B-box 2
domains to retroviral restriction mediated by monkey TRIM5alpha. J Biol Chem. 2005;280(29):
26933-26940.
37. Han Y, Guo Q, Zhang M, Chen Z, Cao X. CD69⫹
CD4⫹ CD25⫺ T cells, a new subset of regulatory
42. Liu H, Zhu F, Yong J, et al. Generation of induced
pluripotent stem cells from adult rhesus monkey
fibroblasts. Cell Stem Cell. 2008;3(6):587-590.
43. Okamoto S, Takahashi M. Induction of retinal pigment epithelial cells from monkey iPS cells. Invest
Ophthalmol Visual Sci. 2011;52(12):8785-8790.
44. Okahara-Narita J, Umeda R, Nakamura S, Mori T,
Noce T, Torii R. Induction of pluripotent stem cells
from fetal and adult cynomolgus monkey fibroblasts using four human transcription factors. Primates. 2012;53(2):205-213.
45. Tomioka I, Maeda T, Shimada H, et al. Generating induced pluripotent stem cells from common
marmoset (Callithrix jacchus) fetal liver cells using defined factors, including Lin28. Genes Cells.
2010;15(9):959-969.
46. Kiem H-P, Jerome KR, Deeks SG, McCune JM.
Hematopoietic-stem-cell-based gene therapy for
HIV disease [review]. Cell Stem Cell. 2012;10(3):
137-147.
47. Hu¨tter G, Nowak D, Mossner M, et al. Long-term
control of HIV by CCR5 Delta32/Delta32 stem-cell
transplantation. N Engl J Med. 2009;360(7):692-698.