Supporting Information
Ebrahimkhani et al. 10.1073/pnas.1413582111
SI Materials and Methods
Animals. Aag−/− mice were generated previously in our laboratory
(1, 2). WT and Aag−/− mice are C57BL/6 and were used at the
age of 8–12 wk and the weight of 25–35 g. Parp1−/− mice were originally from Jackson Laboratory and maintained on 129S background. Aag−/− Parp1−/− mice are B6/129S and compared with their
littermate controls when studied.
In Vivo Warm Liver Ischemia and Reperfusion Model. Under isoflurane anesthesia and maintained body temperature of 37 °C, an
upper midline abdominal incision was made. The hepatic hilum
was exposed and an atraumatic clip placed across the portal vein,
hepatic artery, and bile duct just above the branching to the right
lateral lobe. The median and left lateral lobes (∼70% of the
liver) quickly exhibit significant blanching. We added 10 μL/g
of 10-U/mL heparinized saline directly into the peritoneal cavity
via syringe and covered the incision with well-moistened gauze.
After either 60 or 90 min of warm ischemia, the clip was removed, initiating hepatic reperfusion. Mice were killed after 6 or
24 h of reperfusion, and serum and tissue samples were collected. Sham WT controls underwent the same procedure, but
without vascular occlusion. To maintain fluid balance, all mice
were supplemented with 0.5 mL of saline administered s.c.
In Vivo Ischemia and Reperfusion Model of Brain. Adult male mice
(20–28 g) were anesthetized with 1.5–2% (vol/vol) isoflurane.
Body temperature was maintained at 37 °C. Focal cerebral ischemia was induced with the intraluminal filament technique
and cerebral blood flow (CBF) was monitored over the lateral
parietal cortex. A small incision was made in the scalp, and a
1-mm laser Doppler flowmeter probe was secured against the
lateral temporal bone to assess the adequacy of vascular occlusion during the first 10 min of ischemia. To produce focal ischemia, a midline ventral incision was made in the neck, the
common carotid artery was occluded with a 6-0 silk suture, the
external carotid artery was ligated and cut, and a Silicon-coated
monofilament (Doccol) was passed through the cut stump of the
external carotid and into the internal carotid artery. The filament
tip was advanced until stable reductions in CBF were obtained
(∼6 mm past the bifurcation of the internal carotid and pterygopalatine arteries). Ischemia was maintained for 60 min and
animals were kept under 1% isoflurane for the duration of ischemia. Temperature and respiratory rate were monitored
through experiment. To allow reperfusion, the filament in the
internal carotid artery was withdrawn and the suture around the
common carotid artery was untied. The incision was then closed
with suture, and isoflurane was discontinued. Mice were killed
after 24 h of reperfusion, and brain slices were obtained. Body
weight before and after brain ischemia/reperfusion (I/R) showed
no difference among the groups.
In Vivo Warm I/R Model of Kidney. Mice were anesthetized with
inhalational isoflurane. Using a midline abdominal incision, both
renal pedicles were clamped for 30 min with microaneurysm
clamps. During the period of ischemia, body temperature was
maintained at 37 °C using heating pad. After removal of the
clamps, the kidneys were inspected for 1 min for restoration of
blood flow, returning to their original color and then the abdomen was closed. Sham-operated mice received identical surgical
procedures except that microaneurysm clamps were not applied.
To maintain fluid balance, all mice were supplemented with
1 mL of saline administered s.c. Mice were killed 24 h after
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
reperfusion. Blood was collected and kidney tissues were fixed in
10% (vol/vol) neutral-buffered formalin for paraffin embedding.
Examination of Tissue Injury After I/R. After liver I/R, serum alanine
aminotransferase (ALT) levels, an indicator of hepatocellular
injury, and LDH were measured (IDEXX). Liver sections (4 μm)
were stained with H&E and analyzed for area of necrosis using
ImageJ (National Institutes of Health version 1.47a). All slides
were also blindly evaluated and scored by a board-certified veterinary pathologist for the type of inflammation and necrosis.
After brain I/R, infarct volume was evaluated 24 h after ischemia
by standard volumetric analysis of eight 1-mm-thick coronal
sections stained with 2% (wt/vol) 2,3,5-triphenyltetrazolium
chloride, with correction for swelling. After renal I/R, serum
creatinine and blood urea nitrogen levels, surrogate markers of
kidney function were measured (IDEXX). Kidney sections
(4 μm) were stained with H&E and blindly evaluated by a boardcertified veterinary pathologist. Markers of tubular damage are
scored by calculation of the percentage of tubules in the corticomedullary junction and outer cortex that display cell necrosis,
loss of the brush border, cast formation, and tubular dilatation
(0, none; 1, ≤10%; 2, 11–25%; 3, 26–45%; 4, 46–75%; and 5, >76%,
at least 10 high-power fields).
Liver Nonparenchymal Cell Isolations and Flow Cytometry Analysis.
We opened the abdominal cavity of an anesthetized mouse and
cannulated the portal vein. Then the liver was perfused with
HBSS without Ca2+ and Mg2+ containing Hepes (5 mM) and
EDTA (0.5 mM), 3 mL/min for 7 min followed by collagenase
D (1 mg/mL; Roche) perfusion for another 9 min. We passed the
digested tissue through a nylon mesh (pore size: 100 μm).
Hepatocytes were excluded using two rounds of centrifugation
at 50 × g for 3 min. Liver nonparenchymal cells were isolated
based on their density by centrifuging the cells on a 22% (vol/vol)
OptiPrep gradient (Axis-Shield) at 1,400 × g for 17 min. Isolated
cells were washed with FACS buffer [HBSS with 2% (vol/vol)
FBS] followed by Fc block for 15 min at 4 °C and antibody labeling for 25 min at 4 °C. Antibodies were against CD11b, Gr1,
CD4, and CD8 (eBiosciences). Cells were also stained for live/
dead state using 7-AAD (BD Biosciences Pharmingen). Data
acquisition was performed by LSR-II flow cytometry and analyzed
using FlowJo software.
Measurements of Hepatic Total NAD, ATP, and Serum Hmgb1. Total
NAD and ATP levels were measured using commercially available kits (ab65348 and ab83355, respectively; Abcam). Serum
high-mobility group box 1 (Hmgb1) was assayed using an IBL kit.
Expression Analysis of mRNA from Liver. RNA was extracted from
frozen liver tissues using RNeasy Mini Kit (Qiagen) and firststrand cDNA was synthesized using the SuperScript III FirstStrand Synthesis System (Invitrogen) according to the manufacturer’s instructions. Quantitative real-time PCR was performed using 7500 Fast Real-Time PCR machine (Applied
Biosystems) with SYBR Green incorporation and analyzed using
the 2(−ΔΔC(T)) method. A complete list of primers used in this
study is shown in Table S1.
In Vitro Aag DNA Glycosylase and Apurinic–Apyrimidinic Endonuclease
Activity Assay. Cell extracts were made from mouse liver in gly-
cosylase assay buffer [20 mM Tris·Cl (pH 7.6), 100 mM KCl,
5 mM EDTA, 1 mM EGTA, and 5 mM β-mercaptoethanol]
along with protease inhibitors, followed by sonication. Protein
1 of 9
concentration was measured with a Micro BCA Kit (Pierce). Aag
and apurinic–apyrimidinic endonuclease (APE) activity were assessed as described previously (3).
AP Sites and DNA Adducts Determination. DNA was isolated using
Roche isolation kit according to the manufacturer’s instructions
with precautions taken to reduce artifactual oxidative damage
during the isolation (1). AP sites were determined by using the
DNA Damage Quantification Kit (Dojindo) and performed according to the manufacturer’s instructions. DNA adducts were
quantified using a liquid chromatography–tandem mass spectrometry (LC–MS/MS) variation of a published LC–MS method (1).
Immunofluorescence. Liver tissue was embedded in paraffin, sectioned into 4-μm-thick slices, and mounted on slides. To deparaffinize samples, the slides were incubated in xylene (3 × 5
min) and then in serially decreasing concentrations of ethanol
[100%, 90%, 70%, 50% (vol/vol), 5 min each], all at room
temperature. The slides were washed in deionized water and
then in PBS. To perform heat-induced antigen retrieval (HIER),
the slides were placed in Citrate 6 buffer (00-5001; Invitrogen),
and HIER was performed in a Retriever 2100 according to the
manufacturer’s instructions. After HIER, the slides were washed
in PBS and permeabilized in 0.2% Triton-X-100 in PBS for 30
min at room temperature. Samples were then washed in deionized water and then PBS, and blocked in 5% (wt/vol) BSA in
PBS for 1 h at room temperature. Primary and secondary antibodies were diluted in blocking solution. Incubation in primary
antibodies was carried out overnight at 4 °C, and in secondary
antibodies (1:200) for 90 min at room temperature. Hoechst
33342 staining (2 μg/mL in PBS) was carried out for 10 min at
1. Calvo JA, et al. (2012) DNA repair is indispensable for survival after acute inflammation.
J Clin Invest 122(7):2680–2689.
2. Meira LB, et al. (2008) DNA damage induced by chronic inflammation contributes to
colon carcinogenesis in mice. J Clin Invest 118(7):2516–2525.
3. Hazra TK, Hill JW, Izumi T, Mitra S (2001) Multiple DNA glycosylases for repair of
8-oxoguanine and their potential in vivo functions. Prog Nucleic Acid Res Mol Biol 68:
193–205.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
room temperature. The slides were then washed in PBS and
mounted in ProLong Gold antifade reagent (P36930; Invitrogen), and imaged 24 h later. The primary antibody concentrations used were as follows: poly(ADP-ribose) (PAR; 4335MC-100; Trevigen): 1:1,000; HMGB1 (ab18256; Abcam): 1:500.
Highly cross-adsorbed goat secondary antibodies conjugated to
Alexa 568 or Alexa 647 were procured from Invitrogen.
Microscopy and Image Analysis. Images were acquired on a Carl
Zeiss Observer Z1 wide-field microscope with a Hamamatsu
Orca-ER camera using a 10×, 20×, or 100× objective as needed.
To distinguish the healthy cells from the necrotic regions of the
tissue, image analysis routines were custom-written in MatLab.
Briefly, the nuclear images as obtained from the Hoechst stain
were thresholded based on intensity, size, and eccentricity to
obtain specifically select healthy nuclei from morphologically
distinct necrotic nuclei. The nuclear masks thus obtained were
used to evaluate intensities in the corresponding immunofluorescence images. To calculate the nuclear-to-cytoplasmic ratios
of Hmgb1 concentrations, an annulus of cytoplasm around the
nuclei were considered.
Data Analysis. Data were analyzed using GraphPad Prism software
and presented as mean ± SEM. Statistical significance was determined by performing Mann–Whitney test or t test. P values
of less than 0.05 were considered of statistical significance. Statistical analysis and plotting of immunostained images were performed in MatLab and OriginPro 8.5. To compare full distributions
of Hmgb1 NCR over cell populations, the Kolmogorov–Smirnov
statistic was used as described before (4).
4. Mazumder A, Pesudo LQ, McRee S, Bathe M, Samson LD (2013) Genome-wide singlecell-level screen for protein abundance and localization changes in response to DNA
damage in S. cerevisiae. Nucleic Acids Res 41(20):9310–9324.
2 of 9
Fig. S1. I/R-induced liver injury in WT and Aag−/− mice. (A) Histological assessment of livers showed centrilobular and midzonal necrosis as the prominent
types of necrosis. However, WT mice had higher total pathological score for necrosis and exhibited other type necrosis, including portal/periportal and subcapsular/capsular. Average total sum of pathological scores for necrosis was shown. (B) Evaluation of liver inflammation in histological slides showed both
lobular and portal inflammation in WT and Aag−/− samples, although overall inflammation was more extensive in WT vs. Aag−/−. (C) Representative liver H&E
staining are shown in control mice or at 6 h after liver I/R (ischemia for 60 min). Nonviable patches of ischemic lobes are marked by a dotted line and arrows.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
3 of 9
Fig. S2. Basal DNA adducts, Aag, and APE activity in liver of WT or Aag−/− mice. (A) Aag glycosylase activity on eA-containing oligonucleotide duplex DNA
substrate in 10 μg liver cell extract protein; liver cell extracts were prepared at 0, 6, and 24 h after reperfusion following 60 min of ischemia. (B) APE activity on
double-stranded DNA substrate containing an apurinic–apyrimidinic (AP) site in 40 ng liver cell extract protein; liver cell extracts were prepared at 0, 6, and 24 h
after reperfusion following 60 min of ischemia. (C–E) Baseline level of DNA adducts [e-base DNA lesions and 8-oxoguanine (8-oxoG)] in WT and Aag−/− mice.
Error bars represent the mean ± SEM of at least three independent experiments.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
4 of 9
Fig. S3. Detecting healthy cells in a heterogeneous sample. (A) Images of a WT I/R liver are shown. Nuclei are in blue; PAR is in red. The necrotic regions stain
lower for PAR. The healthy cell nuclei can be segmented out based on nuclear morphology. (B) A schematic for image segmentation routines based on nuclear
morphology of healthy vs. necrotic cells. The nuclear masks of the healthy cells thus obtained are used to interrogate PAR intensity in the corresponding PAR
images. Such approaches allow us to measure the heterogeneity specifically in the healthy cells.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
5 of 9
Fig. S4. Detecting cytoplasm of cells using a single-cell analysis program. Healthy nuclei are segmented as described before. Cell boundaries are not detected
and hence full cells cannot be segmented. To get average cytoplasmic intensities, therefore, we consider an annulus around the nucleus as the cytoplasm. Such
an approach is not adequate for obtaining total cytoplasmic intensity, but is good for measuring average cytoplasmic intensity.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
6 of 9
Fig. S5. Comparison of PAR and Hmgb1 translocation on a cell-by-cell basis. Hmgb1 NCR is useful for quantifying translocation of the protein, but has a much
narrower range than PAR intensities, and also does not report on the fact that Hmgb1 is both induced and translocated upon I/R. However, the average Hmgb1
intensity in the cytoplasm reports both on induction and Hmgb1 translocation. We performed simultaneous immunofluorescence for PAR and Hmgb1 and
plotted Hmgb1 cytoplasmic average intensity against PAR average intensity measured in the nucleus, on a cell-by-cell basis. Every sample shows a correlation
between the two intensities, and this may arise both due to technical and biological reasons. However, the spread of the cells is remarkably different among
sham and I/R samples. In I/R samples, the WT sample shows both a higher fraction of cells with high PAR intensity and high Hmgb1 cytoplasmic intensity. To
illustrate this fact, dotted lines have been placed at specific arbitrary values of intensity and fractions indicated (red for PAR and blue for cytoplasmic Hmgb1).
In every case, data from 1,600 individual cells are plotted.
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
7 of 9
Fig. S6. Real-time PCR quantitation of a subset of genes important for tissue homeostasis, inflammation, and oxidative stress response in WT and Aag−/− mice
following I/R. (A–O) The values are fold change in expression relative to mean expression in WT sham (n = 3–5 in each group, error bars represent mean ± SEM).
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
8 of 9
Fig. S7. (A) Cerebral blood flow measured by laser Doppler flowmetry before, during, and after ischemia in WT and Aag−/− mice. (B) Brain swelling calculated
as the difference between direct and indirect infarct volumes. Ischemic brain swelling did not differ between groups (n = 10 for WT and n = 11 for Aag−/−; error
bars represent mean ± SEM).
Table S1. List of primers (5′–3′) that used in the study
Primer
TNF-α F
TNF-α R
IL-1β F
IL-1β R
MIP-2 (CXCL2) F
MIP-2 (CXCL2) R
CD68 F
CD68 R
P-selectin F
P-selectin R
ICAM-1 F
ICAM-1 R
VCAM-1 F
VCAM-1 R
CD44 F
CD44 R
IGF1 F
IGF1 R
GAPDH F
GAPDH R
Ncf1 F
Ncf1 R
Ncf2 F
Ncf2 R
Cyba F
Cyba R
GPx-1 F
GPx-1 R
HO-1 F
HO-1 R
SIRT1 F
SIRT1 R
Ebrahimkhani et al. www.pnas.org/cgi/content/short/1413582111
Sequence
AGGCTGCCCCGACTACGT
GACTTTCTCCTGGTATGAGATAGCAAA
TCGCTCAGGGTCACAAGAAA
CATCAGAGGCAAGGAGGAAAAC
AAAATCATCCAAAAGATACTGAACAA
CTTTGGTTCTTCCGTTGAGG
TGCGGCTCCCTGTGTGT
TCTTCCTCTGTTCCTTGGGCTAT
GCCAGTTCATGTGCGATGAA
GGCGAAGATTCCTGGACACTT
CAATTTCTCATGCCGCACAG
AGCTGGAAGATCGAAAGTCCG
TGAACCCAAACAGAGGCAGAGT
GGTATCCCATCACTTGAGCAGG
TGAAACATGCAGGTATGGGT
GCTGAGGCATTGAAGCAATA
ACCTCTTCCCACGTAGCTCA
TTGCTCTTAAGGAGGCCAAA
CCC ACT CTT CCA CCT TCG
TCC TTG GAG GCC ATG TAG GCC AT
CCAGGGCACTCTCACTGAATA
ATCAGGCCGCACTTTGAAGAA
GCTGCGTGAACACTATCCTGG
AGGTCGTACTTCTCCATTCTGTA
TGGAGCGATGTGGACAGAAG
CCCGGACGTAGTAATTCCTGG
GACTGGTGGTGCTCGGTTTC
GTCGGACGTACTTGAGGGAATT
GGTGATGGCTTCCTTGTACC
AGTGAGGCCCATACCAGAAG
GCAGGTTGCGGGAATCCAA
GGCAAGATGCTGTTGCAAA
9 of 9