From www.bloodjournal.org by guest on November 10, 2014. For personal use only. 1994 84: 4283-4294 Characterization of a vitamin D3-resistant human chronic myelogenous leukemia cell line SR Lasky, MR Posner, K Iwata, A Santos-Moore, A Yen, V Samuel, J Clark and AL Maizel Updated information and services can be found at: http://www.bloodjournal.org/content/84/12/4283.full.html Articles on similar topics can be found in the following Blood collections Information about reproducing this article in parts or in its entirety may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests Information about ordering reprints may be found online at: http://www.bloodjournal.org/site/misc/rights.xhtml#reprints Information about subscriptions and ASH membership may be found online at: http://www.bloodjournal.org/site/subscriptions/index.xhtml Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036. Copyright 2011 by The American Society of Hematology; all rights reserved. From www.bloodjournal.org by guest on November 10, 2014. For personal use only. Characterization of a Vitamin D3-Resistant Human Chronic Myelogenous Leukemia Cell Line By Stephen R. Lasky, Marshall R. Posner, Keigo Iwata, Anabel Santos-Moore, Andrew Yen, Varman Samuel, Jeffrey Clark, and Abbey L. Maize1 Avariantof the chronicmyelogenousleukemiacellline, RWLeu-4, that is resistant to the antiproliferative effects of vitamin D, was established. Although RWLeu-4proliferation is inhibited by1 nmol/L vitamin D,, the resistantcells (JMRD,) continue to proliferate in the presence of 100nmol/ L vitamin D,. Both cells express similar patterns of differentiation-specific antigensafter treatment with vitamin D,, and both express the retinoblastoma gene product (pllORb).Vitamin D, treatment of the sensitive RWLeu-4 cells decreased the level of the pllORbprotein, as well as its phosphorylation. In contrast, vitamin D, treatment of JMRD, had no effect on p110” expression or phosphorylation. Both RWLeu- 4 and JMRD, express similar vitamin D3 receptors andvitamin D,-inducible enzymeactivities.Differences were detected in the DNA binding characteristicsof the vitamin Do receptors as determined by electrophoretic mobility shift studies. However, sequence analysisthe of DNA-binding domain and immunoblot analysis showed no differences in the receptors. We conclude that some process subsequent to vitamin D, receptor activation isaltered in JMRD, that partially separatesvitamin D,-induced inhibitionof proliferation from the induction of differentiation. 0 1994 by The American Society of Hematology. T copies of RBI or the inactivation of the p1 loRbprotein has been implicated in the loss of control of proliferation and increased cellular transformation. The activity of wild-type pllORbis regulated by phosphorylation and fluctuates with the stages of the cell cycle; p1 loRbis hypophosphorylated in late M and early GI26-28; when it can act as a transcriptional reg~lator.~~,’’ It is believed that the hyperphosphorylation of p1 IORbis necessary to transit a restriction point at the GI/S boundary.30 To investigate the mechanisms by which 1,25-VD3inhibits proliferation and induces differentiation in the RWLeu-4 cell line, we have selected a variant, JMRD3, that is resistant to the antiproliferative effects of 1,25-VD3. This article reports the initial characterization of JMRD3. Our results show that, while these cells are resistant to the antiproliferative actions of 1,25-VD,, they retain other responses mediated by functional receptor:hormone complexes. Although differences in the DNA binding characteristics of unpurified receptor preparations from sensitive and resistant cells were noted, no differences in VDR cDNA sequences have been detected. In addition, we have found that the regulation of phosphorylation of the p1 loRbis different in these two cells. These HE ACTIONS OF vitamin D3 in regulating calcium and phosphate homeostasis in the kidney, bone, and intestine have been well documented.’.’ Recent evidence has shown that the most active metabolite, la,25(OH)z-vitamin D3 (1,25-VD3)plays a role in the regulation of proliferation and differentiation ofmany cell type^.^,^ It has also been reported that 1,25-VD3 inhibits proliferation and induces differentiation inboth murine and human myeloid leukemia~?~ Furthermore, we have reported that 1,25-VD3 inhibits the proliferation and induces the differentiation to monocyte/macrophage-like cells of the human chronic myelogenous leukemia (CML) cell line, RWLeu-4.’ It is thought that manyof the pleiotrophic activities of 1,25-VD3are mediated by high affinity nuclear receptors.’.1° Indeed, Kuribayashi et all’ determined that 1,25-VD3resistant sublines of the promyelocytic cell line HL-60 are receptor mutants. Furthermore, patients with tissue insensitivity to 1,25-VD3 appear to have defects in different functions of the 1,25-VD3 receptor”; Hughes et a l , I 3 Ritchie et all4 Kristjansson et al,15 and others have demonstrated that vitamin D resistant rickets type I1 is associated with mutations in the regions coding for either the DNA-binding domain or the ligand-binding domain of the vitamin D receptor (VDR). The VDR is a member of the steroid hormone receptor superfamily, most closely related to the thyroid (T3R) and retinoic acid receptors (RAR).’6,17Umesono et all’ have shown that the response elements for the 1,25-VD3,T3, and RAR have half-sites with similar consensus DNA sequences. Hormone specificity is determined, at least in part, by the spacing between two half-sites; VDR’s bind preferentially to half-sites separated by three bases, T3R’s bind to halfsites spaced by four bases, and RAR bind to half-sites separated by five bases. Although the VDR is capable of forming homodimers, which bind to a 1,25-VD3 response element (VDRE),19 it is more likely that heterodimers of the VDR with the 9 4 s retinoic acid receptors (RxR) or other nuclear accessory factors are the biologically active complexes.20-2z We have previously shown that 1,25-VD3treatment of the RWLeu-4 CML cell line leads to a decrease in the steady state levels of c-myc RNA.8 It is now known that rnyc binds to the product of the RB 1 gene, p1 loRb,and that myc expression can be regulated by p1 10.Rb23-25 The -1 gene is the paradigm antioncogene and is important in regulating the proliferation of normal cells. The loss of both functional Blood, Vol84, No 12 (December 15), 1994: pp 4283-4294 From the Section of Experimental Pathology, Department of Pathology and LaboratoryMedicine and the Department of Medicine, Roger Williams Medical Center, Brown University School of Medicine, Providence, RI: the New England Deaconess Hospital, Cancer Research Institute, Harvard University,Boston, MA: and the Department of Pathology, Cancer Biology Laboratory,Veterinary College, Cornell University, Ithaca, NY. Submitted April 25, 1994: accepted August 12, 1994. Supported by National Institutes of Health GrantsNo.P30CA13943,ROI-CA50558(toJ.C. and S.R.L.),ROI-CA50054(to M.R.P.),R01-CA33505(toA.Y.),and R37 (toA.L.M.), and the American Institute on Cancer Research. Address reprint requests to Stephen R. Lasky, PhD, Roger Williams Medical Center, Experimental Pathology Section, 825 Chalkstone Ave, Providence, RI 02908. The publication costsof this article were defrayedin part by page chargepayment. This article must therefore behereby marked “advedsernent” in accordance with 18 U.S.C. section 1734 solely to indicate this fact. 0 1994 by The American Society of Hematology. 0006-4971/94/8412-0002$3.00/0 4283 From www.bloodjournal.org by guest on November 10, 2014. For personal use only. 4284 LASKY ET AL data suggest that apostreceptorprocesshasbeenaltered in JMRD3 that partially uncouples the processes regulating proliferation from those involved in the induction of differentiation and 1 ,25-VD3 metabolism. MATERIALS AND METHODS Reagents. la,25(OH), Vitamin D3 (1,25-VD3), 24(R),25(OH), Vitamin D, (24R,25-VD3), and 25(OH) Vitamin D, (25-VD3) were kindly provided by M. R. Uskokovic of Hoffman-LaRoche, Inc (Nutley, NJ). Stock solutions of 0.2 m m o K vitamin D3 metabolites were prepared in absolute ethanol, sparged with nitrogen gas, and protected from direct light. High performance liquid chromatography (HPLC) grade methanol, chloroform, isopropanol, and hexane were purchased from J.T. Baker Inc (Phillipsburg, NJ). Tissue culture reagents were purchased from GIBCO-BRL Life Technologies (Gaithersburg, MD). Enhanced ChemiLuminescence (ECL) kits were purchased from Amersham Life Science (Arlington Heights, IL). All other chemicals were of the highest commercially available purity. [(26,27)3H]-25(OH)vitamin D3 waspurchased from DuPont NEN Research Products (Boston MA). [(26,27)3H]-1a,25(OH)2Vitamin D3and ”P and 3’S nucleotides were purchased from Amersham or New England Nuclear. [5-methyL3H]thymidineand Universolv liquid scintillation cocktail were purchased from ICN (Irvine, CA). Cells and cell culture. The human leukemia cell lines RWLeu-4 and JMRD3were cultured in complete medium (a-modified minimal essential medium [MEM] supplemented with glutamine, 1 0 0 U/mL penicillin, 100 U/mL streptomycin, nonessential amino acids, and sodium pyruvate) plus 10% heat-inactivated fetal calf serum (FCS) in 5% COz atmosphere at 37°C. Cells were inoculated at 0.5 X I O 5 to 2 X 10’ cells/mL and grown exponentially for 3 to 4 days. Viability of cells was determined by trypan blue dye exclusion. The morphologic characteristics of the cells were determined by examination of Wright-Geimsa stained cells. Photomicrographs were made using an Olympus model CK2 microscope and Olympus C-35AD-4 camera (Microtech Optical, Hudson, MA) with Kodak Pan-ASA 50 film (Eastman Kodak, Rochester, NY). The capacity of cells treated with 50 nmol/L 1 ,25-VD3to reduce nitroblue toluidine (NBT) and express nonspecific esterase activity was measured using protocols supplied with the reagent kits (Sigma, St Louis). Isolation of variants of RWLeu-4 cells resistant to 1,25-VD3. Four million RWLeu-4 cells were suspended in 20 mL of complete aMEM containing 0.4 nmol/L 1 ,25-VD3 and incubated under standard growth conditions for 4 days. Three million nonadherent cells from this culture were then suspended in 30 mL of the same medium containing 0.5 nmol/L 1,25-VD3.Nonadherent cells were transferred every 3 to 4 days with the final cell density never exceeding 1 X IO6 cells/mL. After two or three passages at the same dose of hormone, the 1,25-VD3concentration was sequentially increased to 1 nmol/L, 2.5 nmolL, 10 nmoVL, 50 nmolL, and 100 n m o L After growth for 3 weeks under these final conditions, JMRD3 cells were camed continuously in medium containing 50 nmol/L 1,25-VD3or in the same medium without selective pressure. Effects of 1,25-VD3on the proliferation of RWLeu-4 and JMRD, cells. Cultures of 0.5 X lo5 to 1 X 10’ cells/mL were grown in 1 mL complete a-MEM plus 10% heat inactivated FCS containing 50 nmolL 1,25-VD3or equivalent concentrations of diluent alone for 24, 48, 72, and 96 hours. The culture medium was supplemented with the appropriate fresh medium after 3 days. Viable cells were counted each day. Viability was greater than 90% under these culture conditions. Effects of 1,25-VD3 and 12-0-tetradecanoylphorbol-13-acetate (TPA) on RWLeu-4 and JMRD, DNA synthesis. Fifty thousand cells/mL were treated in triplicate with twofold serial dilutions of 1,2S-VD, or TPA from 10 p m o m to 0.2 pmol/L in a final volume of 200 FL of complete a-modified MEM plus 10% heat inactivated FCS for 24, 48, 72, and 96 hours. Control cultures received vehicle alone. At the end of the incubation period, 0.5 FCi of [5-methyl3H]thymidine, was added to each well. After a 4-hour pulse, the cells were harvested onto glass fiber filters using an automatic cell harvester (PHD cell harvester; Cambridge Technology, Inc, Cambridge, MA). Filters were dried, andthe total label incorporated into macromolecular fractions was determined by liquid scintillation counting. Average control (untreated) incorporation was 80,000 cpm. Immunojluorescent detection of cellularantigens. Indirect immunofluorescent detection of cell surface maturation-specific antigens was performed as described by Lasky et alRand Posner et al.“ Cellular content of the retinoblastoma and antioncogene product was detected by flow cytometry using a previously described rabbit polyclonal antibody directed against a peptide fragment of the p 1 1OHh protein.” These antibodies recognize both the hyperphosphorylated and hypophosphorylated forms of the p1 loRbprotein. A fluorescein isothiocyanate (FITC)-conjugated goat antirabbit Ig was used as the secondary, immunofluorescent, reagent. Cellular DNA content was quantitated by staining with propidium iodide after RNase treatment as described by Yen et al.33Analysis was performed on an EPICS flow cytometer (Coulter, Hialeah, FL). The significance of changes in the expression of cell surface antigens was analyzed using the Wilcoxon rank-sum tests on data from a minimum of three independent experiments. Analysis of the phosphorylationlevels of p l I P proteins. RWLeu-4 and JMRD3 cells were grown without 1,25-VD3for 24 to 72 hours. The cells were then resuspended at 0.5 X 10’ to I X I O ’ cells/rnL in the presence of 50 nmoVL 1,25-VD3for 24, 48, 72, or 96 hours or of vehicle alone (untreated). The cells were chilled on ice for 30 minutes to loosen the adherent cells and 1 X IO’ to 5 X lo’ were collected. Cell extracts were made essentially as described by Ludlow et al.34Briefly, cells were washed once in ice-cold Trisbuffered saline (TBS: 20 mmolL Tris-HC1 pH 8.0, 120mmol/L NaCI) and lysed with EBC buffer (20 mmol/L Tris-HCI pH 8.0, 120 mmolL NaC1,0.5% NP-40) containing 1 pmol/L Na orthovanadate, 10 pg per mL aprotinin, 10 pg per mL leupeptin, I O pg per mL phenylmethylsulfonyl fluoride. Protein concentrations were determined by the method of Bradf~rd.~’ Approximately 10 pg of protein were separated by electrophoresis on an 7.5% sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE). The proteins were electrotransferred onto Hybond (Amersham) membranes using standard protocol. The membrane was treated with 0.4 pg/mL of anti-Rb antibodies (Triton Diagnostics, Almeda, CA) followed by development using the ECL kit and HP-conjugated second antibody from Amersham. Films were exposed from 5 seconds to IS minutes, and digitized using a Hewlett-Packard flat-bed scanner (HewlettPackard, Boise, ID). The digitized hypophosphorylated and hyperphosphorylated pllORbbands were quantitated using the Image version 1.45 developed by Wayne Rasband at the National Institutes of Health. Values obtained from several gel exposures were averaged to determine the relative amount of protein represented by each band. Extraction of cellular vitamin D binding proteins. High-salt cytosolic extracts were prepared essentially as described by Lasky et aL8 Briefly, exponentially growing RWLeu-4 and JMRD3 cells were washed once in ice-cold PBS and resuspended at 30 to 60 million cells/mL in ice cold hypotonic TED+ (10 mmolL Tris-HCI, pH 7.4, 1 m o l & EDTA, 10 mmol/L dithiothreitol [DTT], 2 mmol/L phenylmethylsulfonyl fluoride [PMSF], and 50 pg/mL each of aprotinin and leupeptin). All subsequent operations were performed at 4°C. The cells were swollen in this buffer for 10 minutes and disrupted using 20 strokes of a tight-fitting Dounce Tissue Grinder (Kontes, Vineland, NJ). KC1 was added to a final concentration of 300 mmol/L and the cell lysate incubated on ice for 30 minutes. Cell debris was removed by centrifugation at 300,000g for 1 hour. From www.bloodjournal.org by guest on November 10, 2014. For personal use only. VITAMIN D,-RESISTANTLEUKEMIACELLS The supernatant was removed, made 20%in glycerol, dialyzed against 2,000 volumes of TEDKIWwith 20% glycerol and aliquots stored at -80°C. Nuclear extracts from cells treated with 1,25-VD3 for varying lengths of time were isolated by the method described byDignam.’6 The protein concentration was determined by the method of Bradford (Bio-Rad) using bovine serum albumin (BSA) as a standard. 1,25-VD3receptor assays. The binding of [3H]-1,25-VD3to receptors found in high-salt cytosolic extracts was assayed by a modification of the hydroxyapatite technique of Liberman et a1 as described by Lasky et al.’ Nonspecific binding was determined by isotope dilution with 1 pmoVL unlabeled 1,25-VD3before the addition of cell extract, and nonspecific counts in the final ethanol wash were subtracted to give specific 1,25-VD3 binding. Results were normalized to mole bound per milligram protein. Binding parameters for the data from at least three separate experiments were calculated by the method of Scatchard.,’ 2 5 ( 0 H ) Vitamin D3 24R-hydroxylase assay. The induction of 24R-hydroxylase (24-(0H)ase) activity was measured by the method of Gamblin et aI3’ as described by Lasky et al.’ Immunoblot analysis of the VDR. Cytosolic or nuclear extracts were prepared from RWLeu-4 and Jh4RD3cells as described above and aliquots of each extract were separated by SDS-PAGE on a 7.5% to 15% gradient gel. The proteins were then electrotransferred to Immobilon-P membranes (Millipore Corp, Bedford, MA), the membrane blocked with powdered milk, and incubated with a 1: 1500 dilution of the IgG2b rat-anti-VDR antibody, 9a7, kindly provided by Dr J.W. Pike. Alkaline phosphatase coupled second antibody (Amersham) wasusedto visualize the VDR. Nonspecific binding was determined by omitting the first antibody. DNA synthesis, pur$cation, and labeling. Oligonucleotides were synthesized on an Applied Biosystems, Inc (Foster City, CA) model 392 or 394 synthesizer. Oligonucleotides used for electrophoretic mobility shift analysis were purified by denaturing gel electrophoresis” before annealing and labeling. Plasmids were purified using Qiagen Maxi-prep columns (Qiagen Inc, Chatworth, CA) or Promega Wizard MiniPrep columns (Promega Corp, Madison, WI). Oligonucleotides, plasmids, and DNA restriction fragments were labeled with [a3’P]-dCTP, [a”P]-dATP, or [y3*P]-ATPby standard filling in, end-labeling, or random priming technique^.,^ Unincorporated nucleotides were removed using NucTrap push columns (Stratagene, La Jolla, CA). DNA ampl$cation and sequencing. Total RNAwas isolated from RWLeu-4 or JMRD, cells using the technique first described by Chomczynski and Sacchi4’ and supplied with the Stat-30 reagent kit (Tel-Test “B”, Inc, Friendswood, TX). Two micrograms of this RNA was used for first strand synthesis using the CycleDNA synthesis kit (Invitrogen Corp, San Diego, CA). Oligonucleotide primers or oligo-dT primers were complementary to the VDRmRNA usedto prime first strand synthesis. One quarter of this reaction was used for logarithmic polymerase chain reaction (PCR) amplification in a total volume of 50 pL with the standard PCR buffer supplied with the Perkin-Elmer-Cetus (Nonvalk, CT) GeneAmp kit containing 50 pmoVL of oligonucleotides complementary to VDR sequences (Perkin-Elmer-Cetus). Oligonucleotides [201: bases -26 to -7JCTTACCTGCCCCCTGCTCCT. [102: bases 265 to 283 GAATGAACTCCTTCATCATG, [S 1: bases 92 to 11l ] CCACTGGCTITCACTTCAATGC, [s3: bases 168 to 1871 ACTATTCACCTGCCCCITCAACG, and [a3: bases 474 to 4931 TCCCTCCACCATCATTCACACG were used to amplify the DNA binding region of the VDR. Amplified sequences were cloned into pCRlO00 using the TA cloning kit (Invitrogen). Randomly selected clones were analyzed by double-stranded DNA sequencing using the Sequenase reagent kit (US Biochemical, Cleveland, OH). Electrophoretic mobiliv shi@ analysis. Samples containing 15 pg of protein from nuclear extracts of RWLeu-4 or JMRD, cells 4285 were usedin DNA binding reactions. Each reaction had a final volume of 20 ,uL containing 10 mmoVL Tris-HC1, pH7.8,0.5 mmoU L EDTA, IO mmoVL P-mercaptoethanol, 50 mmoVLKCI, 10% glycerol, 1 pg polydI:dC, 2.5 fmol labeled double-stranded oligonucleotides (20,000 dpm) with or without a 100-fold molar excess of cold oligonucleotide. A double-stranded DNA consisting of the sequence 5’CGGGTAGGGGTGACTCACCGGGTGAACGGGGGCATCTCGACTCGT3’ and its complement were usedasthe human osteocalcin 1,25-VD, response element. Binding reactions were incubated for 20 minutes at room temperature. To identify bands containing the VDR, blocking experiments using the 9a7 antiVDR antibody (Affinity BioReagents, Inc, Neshanic Station, NJ) were performed. Extracts from 1,25-VD, treated or untreated RWLeu-4 and JMRD, cells were preincubated at room temperature for 15 minutes with 0.1 pg of the 9a7 antibody in the binding buffer described above. The radioactively labeled OC-VDRE wasthen added, and the reactions continued for an additional 20 minutes. The reaction products were separated on 5% nondenaturing polyacrylamide gels using the tris/borate/EDTA buffer ~ystem.~’ RESULTS Isolation of 1,25-VD3 resistant cells. After several days exposure to low concentrations of 1,25-VD3 (1-10 nmol/L), the RWLeu-4 cell line becomes adherent, clumps together, and demonstrates a decreased rate of growth and DNA synthesis. To establish a resistant variant, RWLeu-4 cells were treated with 0.4 nmol/L 1,25-VD3 for 3 days. Nonadherent cells remaining in the culture medium were transferred into freshmediumcontainingthe same concentrationof hormone. As the growth rate and number of nonadherent cells increased in subsequent passages, the concentration of 1,25VD3 was increased by twofold to fivefold. After each increase in concentration,progressivelyfewer cells became adherent tothe substratum and after approximately3 months oftreatment a populationofnonadherentcells, called JMRD3, was obtained. These cells have a doubling time of approximately 24 hours in the presence or absence of 100 nmol/L1,25-VD3. JMRD3 cellshavebeenremovedfrom medium containing 1,25-VD3and cultured without reversion to hormone sensitivity. JMRD3 are now maintained in the presence of 50 nmol/L 1,25-VD3. Growth characteristics of the RWLeu-4 and JMRD, cell lines. Figure 1 shows the growth rates of the parental and resistant cell lines. One hundred thousand RWLeu-4 or JMRD3 cells/mL were inoculated into completeaMEM with 10% FCS in the presence or absence of50 nmol/L 1,25-VD3. As observed in this figure, RWLeu-4 cells cease proliferating within 2 days in the presence of50 nmol/L 1,25-VD3, while JMRD3, either in the presence or absence of 1,25-VD3, continue to proliferate ata rate similar to the untreated RWLeu4 cells. Both RWLeu-4 and JMRD3 cease proliferating at high-cell densities (greater than 2 to 3 X lo6 cells/mL). The induction of mitochondrial oxidative processes is indicative of maturation towards monocyte/ma_crophage-like cells. Table 1 shows results of experiments masuring the induction of NBT reducing activity.Two hundred thousand RWLeu-4 or JMRD3 cells/mL were seeded into 12 well microtiter plates inthe presence or absence of 50 nmol/L 1,25VD3, incubated for 72 hours, assayed and for NBT reduction. These data show that, whereas the parental RWLeu-4 cells did not reduce NBT in the absence of 1,25-VD3, treatment with 50 nmol/L 1,25-VD3 for 72 hours caused 70% to 90% From www.bloodjournal.org by guest on November 10, 2014. For personal use only. LASKY ET AL Table 1. Analysis of NBT Reduction by RWLeu-4 and JMRD, Cells 1.25-VD3 % NBT Positive RWLeu-4 - 2~6% 70-90% 44% + 20-30% + JMRD, Triplicate 1 mL cultures of RWLeu-4 or JMRD, cells were treated with 50 nmol/L 1,25-VD3 or carrier alone in 24-well microtiter plates for 3 days as described in Materials and Methods. NBT reduction was determined according to the directions supplied with the kit. At least 200 cells were counted for each sample. l 0, 0 I I I I I 1 2 3 4 5 6 Days In Culture Fig 1. Comparison of growth rates ofRWLeu-4 and JMRD, in the presence and absence of 1.25-VDl. Triplicate 10 mLcultures of 1 x lo5 cells/mL ofRWLeu-4and JMRD, cells/mL were grown in complete amodifiedMEMcontaining 50 nmol/L 1,25-VD1 oran equivalent amount of vehicle alone in T-25 flasks. Incubations were from1 t o 6 days. The medium was supplemented after 3 days of growth. Viable cell number was determinedeach 24 hours by dye exclusion of trypan blue. (nl, untreated RWLeu-4; (U), 1,25-VD3-treated RWLeu-4; (01. untreated JMRD3; 101, 1.25-VD,-treated JMRD3. of these cells to reduce NBT to formazan granules. NBT reducing activity was also induced in the JMRD3 variants by S0 nmol/L 1,2S-VD3, although not to as great an extent as seen in the sensitive cells with only 20% to 30% of the cells appearing positive after 72 hours in medium containing I ,2S-VD’. Microscopic examination of these cells showed that the morphology of RWLeu-4 changes in the presence of 1,2SVD’, and that the JMRD3 variants, both in the presence and absence of 1,2S-VD3, are morphologically more similar to the mature, 1,2S-VD3-treated RWLeu-4 than they are to untreated RWLeu-4: ( I ) they show pseudopod-like projections from the cell surface: (2) the nucleus is more condensed and lobed; (3) the ratio of the cytoplasm to the nucleus is greater; (4) the cytoplasm is more vacuolated:( S ) JMRD’ are smaller than untreated RWLeu-4 cells but similar in size to the 1.25VD3 treatedparental cells; and (6) the cells become monocytoid in appearance (Fig 2). These changes are characteristic of cells with a monocyte-like phenotype. We have previously shown that TPA inhibits the proliferation of RWLeu-4 cells in a time anddose dependent manner.8 It is known thatone of the primary actions of TPA, preceding the inhibition of proliferation and induction of differentiation, is the activation and translocation of protein kinase C (PKc).~’In addition, it has been shown that I ,2S-VD3stimulates the tran~cription~~ or activation4’” of PK, in some systems, and it is thought that the VDR itselfismodified or activated by P&-mediated pho~phorylation.~’ Therefore, it is possible that the antiproliferative effects of 1,2S-VD3 are mediated by a PKc pathway. If this were the case, one might expect JMRD3 cells to show an altered response to TPA. Fig 2. Photomicrographic examination of RWLeu-4 and JMRD, after treatment with 1,25-VD3 or vehicle. RWLeu-4 or JMRD, cells were treated with 50 nmol/L 1,25-VD1 or with an equivalent amount of vehicle (0.025% ethanol)for 72 hours. The cells were thenwashed and diluted in PBS and 5,000 cells were deposited on a glass slide. The cells werethenWrightGeimsa stained and photomicrographs made as described in Materials and Methods. Viability of cells in these cultures was greater than 90% as determined bytrypanblue exclusion. (AI RWLeu-4 cells treated with vehicle, (B) RWLeu-4 cells treated with 50 nmol/L 1.25-VD3, (C) JMRD, cells treated with ethanol, and (Dl JMRD, cells treated with 50 nmol/L 1.25-VDl. From www.bloodjournal.org by guest on November 10, 2014. For personal use only. VITAMIN DJ-RESISTANT LEUKEMIA CELLS 4207 Therefore, we examined the effects of 1,25-VD3 and TPA on tritiated thymidine uptake in RWLeu-4 and JMRD3 cells. Figure 3 shows the dose response and kinetics of the inhibition of incorporation of tritiated thymidine into DNAin RWLeu-4 and J M R D 3 cells. Fifty-thousand cells per milliliter in 0.2 mL were treated with increasing doses of 1,25VD, or TPA for 3 days. The cells were then pulsed for 4 hours with 0.5 pCi [3H-methyl]-thymidine,harvested onto glass fiber filters, washed, and counted. DNA synthesis in the parental cell line was inhibited to 50% of the control levels by incubation with 3 to 10 nmol/L 1,25-VD3, while tritiated thymidine incorporation in JMRD3 cells is not significantly affected by 100 n m o m 1,25-VD3. This figure also demonstrates that there is a slight difference in the dose responses of the parental RWLeu-4 cells (ED5,, = 0.5 nmoV L) and the resistant JMRD3 cells (ED5,, = 0.65 nmol/L) to the inhibition of DNA synthesis by TPA, but these differences are not statistically significant. Similar results were observed with other maturational agents such as all-trans retinoic acid (RA)and dimethyl sulfoxide (DMSO) (data not shown). Characterization of the differentiation state of the RWLeu4 and JMRD3 cell lines. Figure 4 uses flow-cytometric analysis of cell surface phenotypic markers to investigate the induction of differentiation in these cells by 1,25-VD3. Fifty thousand RWLeu-4 or JMRD3 cells/mL were treated with 50 nmoVL 1,25-VD3or vehicle alone for 3 days. Cells were harvested and stained for specific antigen expression as described in the Materials and Methods section. T8 (CD8) and B2 (p-2 microglobulin) served as negative and positive c 0 , 10-10 10 -9 . . . . . . . ., 10 -8 . . . . . ... 10 -1 Concentration (M) Fig 3. Dose responseof inhibition of [,H]-thymidine incorporation by 1.25-VDa or TPA. Triplicate cultures of 5 x 10' cells/mL of RWLeu4 or JMRD3 were grown in 200 pL of complete a-modified MEM supplemented with 10% FCS in the presence of twofold serial dilutions of 1,25-vD3 or TPA. Concentrations of inducer rangedfrom 90 pmol/L to 100 nmol/L for 3 days. Control cell cultures were grown in complete a-modified MEM plus 10%FCS and diluent alone. At the end of incubation, the cells were pulsed for 4 hours with 0.5 pCi of i3H-methyll-thymidineand hervestedonto glass fiber filters. Results are expressedas the percentage of control cell uptake at each time. Control uptake averaged 80,OOO cpm and background cpmfrom a no cell control was 80 cpm. 0, RWLeu-4 treated with VD3; 0 JMRD, treated with VD,; A, RWLeu-4 treated with TPA; A,JMRD, treated with TPA. 100- 80 - v) I U' m- 40 - 20 - 0 T8 Mol B2 M02 - M03 CD4 Antibody Fig 4. Analysis of specific cell surface antigen expression after thousand RWLeu-4 cdls/mL were induction with 1,25-VD3. grown in complete a-modifled MEM with 10% FCS in the presence of 50 nmol/L 1,25-VD3for 72 hours. Control cultures weregrown inthe cell surface presence of diluent alone. The cells were harvested and as described in Materialsand antigen expressiondetermined Methods. Results represent the average of at least three separate experiments. T8 (CD81(negativecontrol), B2 (beta-2 microglobulin) (positive control). M o l ICDllb/CD18), M02 (CD14).CD4; (m), untreated RWLeu-4; ( 8 ) .125-VD3-treatedRWLeu-4; (B), untreated JMRD,; (81,125-VD3-treatedJMRD,. F e controls, respectively. This figure shows that the expression of Mol (CD1 Ib/CDl8), a granulocyte/monocyte related antigen, is stimulated by 1,25-VD3 in both RWLeu-4 and JMRD, cells. M02 (CD14), an antigen uniquely expressed on monocyte/ma~rophages,~~~~ is also induced in RWLeu-4 and JMRD3 cells after 1,25-VD3treatment. Mo3, an antigen representative of monocyte activation, is notsignificantly induced by 1,25-VD3in either the parental or resistant cells. In addition, resistance to 1,25-VD3in JMRD3does not affect TPA-, DMSO-, or RA-induced expression of cell surface phenotypic markers. Treatment of either RWLeu-4 or JMRD, cells with TPA induces monocyte-/macrophage-like differentiation (Mol and M o ~ )while , treatment with DMSO or RA induces the expression of Mol antigens, but not M02 or M03 indicating that the latter agents cause the cells to differentiate along a granulocyte-like pathway (data not shown). Another antigen, CD4, usually associated with a subset of T cells, is also expressed at low-density by myeloidmonocytic leukemia cell lines such as the histiocytic U937 cell line and the promyelocytic HL-60 cell line.48.49 Interestingly, Fig 4 shows that CD4 is constitutively expressed by RWLeu-4 cells and is downregulated after 1,25-VD3 induction. Although the CD4 is also expressed by JMRD3 cells, 1,25-VD3treatment has no significant effect on its expression. Regulation of the RBI gene product in RWLeu-4 and JMRD2. The RBI tumor suppressor gene has been found to respond to ligand and virally induced growth regula- From www.bloodjournal.org by guest on November 10, 2014. For personal use only. LASKY ET AL 4288 l"1 80 T 40 30 20 IO 0 RWLeu-4 R D - 3 RWLeu-4 RD-3 Fig 5. Analysis of Rb antigen expression and cellcycle stage after induction with 1.25-VD3. Fifty t o 100,000 cells/mL were treatedwith 50 nmol/L 1.25-VD3 (B)or vehicle (M)alone for 24 hours. The cells were chilledon ice for 30 minutes, scraped, washed with PBS, permeabilized, and stained for Rb protein (A) or DNA (B) content as described in Materials and Methods. In (A), results are presented as average relative Rb protein content per cell (vertical axis is in arbitrary fluorescence units that are proportional to the amount of Rb protein). In (B), results are as percentage of cells with 2 N DNA content. Error bars indicate the high and low ranges of values from separate experiments. tion ..nsn Of particular relevance, p1 IORh expression has been found to undergo early downregulation in HL-60 cells after treatment with l,25-VD3.-" Because Rbl is a recessive gene whose loss of function confers susceptibility to the development of it is considered to be the proto- type of a class of tumor-supressor genes. Presumably, the normal function of the RBI gene product is the regulation of genes involved in proliferation and/or differentiation. Therefore, we asked if there is a difference in the regulation of the RBI gene product by 1,25-VD3 in RWLeu-4and JMRD3 cells. Figure 5 shows a composite analysis of the level of the pl IORh protein expression and the percentage of cells in the G,,, phase of the cell cycle. RWLeu-4 and JMRDJ cells were treated with 50 nmol/L 1,25-VD3or vehicle alone for 24 hours. Cells were then fixed and stained for p1 IOKh protein and DNA content. The p1 IORh protein is constitutively expressed by both the 1,25-VD3-sensitive and -resistant cell lines. Using dual-label flow cytometry to quantitate the levels of p1 IORhprotein accumulation, we observed that 1,25-VD3treatment of RWLeu-4 cells results in a decrease in the total cellular p1 IORh proteinwith arrest in the Go,, phase of the cell cycle. These data also show that 1,25-VD3 treatment of JMRD? cells did not result in a change in either the level of total pl IORh protein expressed in the resistant cells or an accumulation of these cells in the G,),, phase of the cell cycle. These studies on the expression of the p1 IORh protein do not address the functional activity of the antioncogene, therefore we investigated the level of phosphorylation of the pl IORh protein in these cells. Figure6 shows the immunoblot analysis pl IORh in theRWLeu-4and JMRD? cells.RWLeu-4and JMRD3cells were treated with50 nmol/L 1,25-VD3or vehicle alone for 0 to 72 hours. Cells were disrupted in EBC buffer, proteins separated by SDS-PAGE and transferred onto Hybond membranes as described in the Materials and Methods section. Table 2 shows the quantitation of the band intensity of hypophosphorylated and hyperphosphorylated p1 IORh in Fig 6. The numbers in parentheses indicate the percentageof cells in the Go/,stage of the cell cycle. One can see that in the RWLeu-4 cells the hypophosphorylated form ofp1 IORh increases after 48 hours of treatment and is the predominant species by 72 hours of treatment. There is no apparent change 1 - ~ 1 2 3 4 5 6 7 8 0 24 48 72 0 24 48 72 1- RWLeu-4 1- JMRD3 Fig 6. lmrnunoblot analysis of Rb protein phosphorylation after treatment of RWLeu-4 and JMRD3with 1.25-VD3. RWLeu-4 and JMRD3 cells were grown in the presence of 50 nmol/L 1,25-VD3 for 0 t o 72 hours. The were harvested and lysed as described in Materials and Methods. The extracts were thenseparated on a 7.5% SDS-PAGE minigel and transferredt o a Hybond membrane. The membrane was then incubated with antibodies specific for pllORband the cross-reactive bands visualized by ECL. Lanes 1 t o 4 are RWLeu-4 extracts and lanes 5 to 8 are JMRD, extracts. Lanes land 5 are control cell extracts. Lanes 2 and 6 represent 24-hour treatment with 1.25-VD3. Lanes 3 and 7 represent @-hour treatment, andlanes 4 and 8 represent 72-hour treatment. From www.bloodjournal.org by guest on November 10, 2014. For personal use only. VITAMIN D3-RESISTANTLEUKEMIACELLS 4289 Table 2. Quantitation of the Relative Intensity of the Hyperphosphorylated and HypophosphorylatedpllORb Cells Oh RWLeu-4 Hyper JMRD3 Hypo Hyper HVDO 24 h 0.91 0.98 (45%) (82%) (73%) 0.02 0.09 0.88 0.86 (40%) (36%) 0.12 0.14 48 h 72 h 0.80 0.57 (84%) 0.43 0.87 (36%) 0.13 0.20 0.088 (39%) 0.012 The film from ECL-immunoblot analysis of pllORbwas digitized, and the relative intensity of the hypophosphorylated and hyperphosphorylated pllORbwas determined for the time points indicated in the table using the NIH Image program. Results are expressed as the fraction of the hyperphosphorylated p1loRbor hypophosphorylated p1TORb detected on themembrane. The numbers in parentheses represent the percentage of cells in the G,,, stage of the cell cycle at each time of treatment as determined by propidium iodide staining and FACS analysis. intheamount of hypophosphorylated p1 loRhseeninthe JMRD, cells after this treatment. These findings demonstrate that the p1 lPbprotein is constitutively hyperphosphorylated in JMRD, cells, whereas it may become hypophosphorylated in RWLeu-4 cells treated with 1,25-VD,; it is also evident that the level of hypophosphorylated pllORhcorrelates with the proportion of cells arrested in Go/,. Examination of the 1,25-VD3 receptor expressed by the RWLeu-4 and JMRD, cell lines. The majority of the 1,25VD, resistant cell lines described have been shown to have altered l ,25-VD3 receptors. Therefore, we examined (26,27[3H])-l,25-VD, binding to VDR extracted under high salt conditions in the parental RWLeu-4 and the JMRD, variants. Figure 7 shows the results of radioligand binding experiments using high-salt cellular extracts from RWLeu4 and JMRD3 cells. Four hundred to 500 pg of protein from total cellular extracts was analyzed for (26,27[3H])-1,25-VD3 binding as described in the Materials and Methods section. These results demonstrate that both RWLeu-4 and JMRD, express high-affinity 1,25-VD3 receptors while Scatchard analysis indicates that the number of receptors and the equilibrium dissociation constant (h= 0.4 nmol/L and K., = 0.3 nmoVL) of those receptors is quite similar for the parental and resistant cell lines. To investigate whether the 1,25-VD3binding activity in the resistant cells is due to a truncated or full-length form of the VDR, weperformed immunoblot analysis on the proteins extracted from the RWLeu-4 and JMRD? cells. High-salt cytosolic extracts were separated by SDS-PAGE, transferred to membranes, and stained with the 9a7 anti-VDR antibody as described in the Materials and Methods. Figure 8 shows that there is no apparent difference in the relative mobility of the VDR from RWLeu-4 (lane 1) and JMRD, (lane 2) cells. Lane 3 contains extracts from JMRD3cultured continuously in 1,25-VD3 and indicates that 1,25-VD3treatment of JMRD, does not leadto a decrease in the amount or mobility of the VDR. To further characterize the VDR expressed in RWLeu-4 and JMRD, cells, mRNA was isolated from RWLeu-4 and JMRD3 cells, cDNA synthesized, and amplified by reverse transcriptase-PCR (RT-PCR). Because wehad determined that both cells express similar 1,25-VD3-specificbinding activities, we specifically amplified the cDNAs containing the DNA-binding domain of theVDR. These cDNAs were cloned by TA-cloning (Invitrogen) and double-stranded DNAs were sequenced in both directions using primers com- le-l0 Se-l 1 a fie-1 1 E I 0 Ep 4e-11 Fig 7. SaturationandScatchardanalysis of the 13Hl-1,25-VD,-receptorcomplex by hydroxyapatite (HAP)binding.High KC1 cytosolicextractsfrom RWLeu-4 or JMRD, containing 400 to 500 F g total protein were incubated with tritiated 1,25-VD3 and activatedvitamin-receptorcomplexeswere seperated from unbound1,25-VDI, by absorption to HAP as described in Materials and Methods. Nonspecific binding, detormined by isotope dilution, was wbtracted from total binding to give specitic binding. (DL RWLeu-4; (01, JMRD,.InsetshowsScatchard analysis of binding. 2e-11 le-12 1 - 2e- 106e-10 1 4e-10 - 1 - le-9 1 Se-l0 Total Added (M) - 1 - From www.bloodjournal.org by guest on November 10, 2014. For personal use only. 4290 LASKY ET AL 1 RWLQU-4 JMRD3 192S-VD3 2 3 + + + + 0 Fig 8. lmmunoblot analysis of the VDR in RWLeu-4 and JMRD, cell extracts. High-salt cytosolic extracts fromRWLeu-4 and JMRD3 cells were separated via 10% SDS-PAGE,transferred, incubated with the 9a7 anti-VDR antibody, and stainedas described in Materials and Methods. Lane 1, RWLeu-4 extract; lane 2, JMRD3 extract; lane 3, extract of JMRD, treated with 1.25-VD3. plementary tothe SP6 and T7 RNA polymerase binding sites as described in the Materials and Methods. Sequence analyses of randomly chosen clones detected no differences in the cDNAs encoding the DNA binding domain of the VDR from RWLeu-4 or JMRD3 cells. Therefore. there is no obvious change in either 1,2S-VD3binding or the sequence of the DNA-binding domain in VDRs expressed by RWLeu4 and JMRD3. Because the experiments above do notmeasurethefunctional activity of the VDR, we examined the induction of 25(OH)-vitamin D, 24 hydroxylaseactivity.Thisenzymehas been shown to be induced in a variety of cell types through a l,25-VD3 receptor-mediated process and is used as a marker of I ,25-VD3responsiveness..'x,ss-'flFigure 9 shows the analysis of the induction of25-(OH)-vitaminD3 24 hydroxylase activity in JMRDz and RWLeu-4 cells. These results indicate that 25(OH)-vitamin D, 24 hydroxylase can be induced to the same extent in the parental and resistant cells. Furthermore, Fig IO illustrates that the dose response curves for the induction of 25-(OH)-vitaminD324hydroxylaseactivity by 1,25-VDz in JMRD3'and RWLeu-4 cells are nearly identical. Therefore, the resistance to the antiproliferative effects of1.2S-VD3seen in JMRDl cells isnot due tothe completeabrogationof1.25VD,-receptor mediated responses. We also analyzed the DNA-binding activity of these VDRs using a specific 1,2S-VD3response element. Figure 1 I shows the binding of nuclear extracts to the human osteocalcin VDRE (OC-VDRE). Reactions containing IS pg of cellular proteins were incubated with the radiolabeled OCVDRE as described in Materials andMethodsand in the figure legend. Lane I3 contains the radiolabeled OC-VDRE with no added extract. Lanes 3, 6. 9, and 12 contain a 1 0 0 fold molar excess of unlabeled OC-VDRE oligonucleotide. The band retarded by the binding of the VDR (identified as VDR in the marginof the figure) was determined by blocking the formation of theVDR-specificbandusinganti-VDR antibodies (a-VDR lanes 2. S, 8, and 1 I ) as described in the Materials andMethods.Lanes 1 to 3 and 7 to 9 contain extracts of untreated RWLeu-4 and JMRD3 cells, respectively. Lanes 4 to 6 and IO to 12 use extracts from RWLeu4 or JMRD, cells treated with SO nmol/L 1,2S-VD3for 72 hours. This figure illustrates that there is a difference in the bands retarded by the extracts from thesensitive and resistant cell lines after treatment with 1,25-VD3 (identified as the Abands in the margin of the figure). Because the A-bands are not blocked by preincubation with the anti-VDR antibodies, we do not believe that these bands contain the VDR. DISCUSSION We have previously reported'thatwhentheRWLeu-4 cell line is cultured in the presence of nanomolar concentra- 151 N o Cell Control RWLeu-4 JMRDJ Fig 9. Induction of 24R-(OH)ase activity. One million RWLeu-4 or JMRD3cells were incubated for16 t o 18 hours in the presence of 50 nmol/L 1,25-VD, in serum free medium. JMRD3cells were carried for several days in the absence of hormone. No cell controls measure with the background of the assay. Control cell cultures were treated an equivalent amount of ethanol alone. The cells were harvested, inducer washed out, incubated with 'H-25-VD3for 30 minutes at37°C. extracted, and analyzed as described in Materials and Methods. Internal standards (25-VD3 and 24R.25-VD,) were added and vitamin D3 metabolites analyzed by HPLC. W, Untreated cells; W, 1.25-VD3treated cells. From www.bloodjournal.org by guest on November 10, 2014. For personal use only. VITAMIN D,-RESISTANT LEUKEMIA CELLS tions of 1,25-VD3, proliferation is markedly suppressed, the morphology of the cells becomes monocytoid, biochemical processes indicative of differentiation are induced, c-myc proto-oncogene expression is altered, and the cells express antigens characteristic of differentiated monocyte/macrophages. To investigate the molecular basis for these changes, we have isolated a variant of RWLeu-4, JMRD3, that is resistant to the anti-proliferative effects of 1,25-VD3. Microscopic examination of these cells revealed that the morphology of RWLeu-4 changes in the presence of 1,25VD3: and that the JMRD? variants are more similar to the mature, 1,25-VD3-treated RWLeu-4 than to untreated RWLeu-4 (Fig 2). This is characteristic of more differentiated cells; however, the resistant JMRD3cells do not become adherent and continue to proliferate in the presence of high concentrations of 1,25-VD3. These properties make the JMRD? cells unique in that 1,25-VD3has induced their differentiation into histiocytic cells but has not affected their proliferative capacity or the ability of 1,25-VD3 to induce the expression of monocyte/macrophage-specific antigens. These results suggest that JMRD3 is a cell line where the usual coupling of differentiation and proliferative arrest is broken. Comparison of these two cell types can provide insight into the biochemical regulation of proliferation by 1,25-VD3independently from the processes involved in differentiation. One trivial reason that JMRD3 is resistant to 1,25-VD3 could be that the active form of the hormone (la,25(OH)* vitamin D3) is rapidly metabolized to a less active form (for instance l~x,24,25(OH)~ vitamin D3). We believe that: (1 j the absence of a distinct lag in growth after 1,25-VD3treatment of JMRD,, (2) the lack of an increase in the number of adherent cells immediately after the subculturing of JMRD3 in the presence of 50 nmoVL 1,25-VD3, (3) the fact that the 25(OH)-vitamin D3 24 hydroxylase is induced to the same extent, at the same dose, and with the same kinetics in RWLeu-4 and JMRD3 (Figs 7 and 8), and (4) HPLC analysis of A-ring-labeled 1,25-VD3 has shown that RWLeu-4 and JMRD3cells metabolize 1,25-VD3at the same rate and to the same compounds (data not shown) are strong arguments against this possibility. It is interesting that the level of total cellular pllORbis decreased in the RWLeu-4 cells after treatment with 1,25VD3 but does not change in resistant cells. In addition, the results in Table 2 show that 1,25-VD3 treatment of RWLeu4 cells leads to the accumulation of cells in G,,, and that the amount of hypophosphorylated p1 IORbincreases along with this accumulation, while 1,25-VD3treatment of JMRD3cells does not lead to either the accumulation of cells in Go,,or to an increase in the amount of hypophosphorylated p1 loRb. Because the JMRD3 cells continue to proliferate in the presence of 1,25-VD3but are morphologically and antigenically similar to the differentiated, 1,25-VD3 treated RWLeu-4 cells, our results suggest that the decrease in the level of phosphorylation of p1 IORb correlates more specifically with the arrest of these cells in Go/,than with the extent of their differentiation. Williams et a1,6' Ewen et a1,6* and Dowdy et a163 have shown that the p1 loRbprotein is phosphorylated by a complex of cyclin dependent kinase with either A or D type 4291 Concentration of VD3 (M) Fig 10. Dose response for the induction of 24R-(0H)ase activity. RWLeu-4 (W) or JMRDo ( 0 )cells were treated and analyzed as described in the legend to Fig 9, except that increasing concentrations of1,25-VD1, from 100 prnollL to 10 mrnol/L were used to induce 24R(OH)ase activity. cyclins. In addition, Durfee et alMhave recently shown that the pp1 loRbcan associate with the protein phosphatase type 1 catalytic subunit. The changes in phosphorylation seen in these experiments could reflect either an increase in the rate of dephosphorylation, a decrease in the rate of phosphorylation, or an alteration in the rate of turnover of p1 loRh.We are presently investigating the mechanisms that influencethe effects of 1,25-VD3on phosphorylation of the p1 loRhprotein in these cells. Our results demonstrate that there is a change in the retardation of the OC-VDRE by extracts for the RWLeu-4 and JMRD3 cell lines but we have beenunableto detect any changes in the sequence of the DNA-binding region of the VDRs from RWLeu-4 and JMRD, cells. Although we are investigating the possibility that there are mutations in sequences coding for other domains of the receptor, we do not believe that the differences in the bands observed in electrophoretic mobilityshift experiments are caused by changes in the primary structure of the VDR, because ( I j the data on 25(0H)-vitamin D324 hydroxylase induction shows that the VDR in both cells is capable of inducing that receptor-driven activity to the same extent, (2) the 1,25-VD3 binding data indicate that the VDRin both cell lines is present in approximately the same numbers with the same affinity for the ligand, (3) there is no apparent difference in the M,of the VDR in RWLeu-4 and JMRD3 cells, as demonstrated by immunoblot analysis, and (4) the bands that are different in the electrophoretic mobility shift analysis (EMSA) are not blocked by antibodies specific for the VDR. We believe that the differences represent changes in the interaction of the VDR or the VDRE with some other transacting factor or factors found in the extracts from RWLeu- From www.bloodjournal.org by guest on November 10, 2014. For personal use only. LASKY ET AL 4292 A {= VDR - Probecells vn3 a V Competitor J M R ~ RWL~"~ o o D R . - - + o a mm (#, 72 72 + - - - - o '12 + + - - - o o + - 72 - + - - 4 and JMRD, cells. Because the OC-VDRE contains a consensus AP-I binding site, one could speculate that these differences are due to the differential activation or regulation of the jun and fos proto-oncogenes that make up the AP-l transcription factor. Recent studies of the thyroid hormone, retinoic acid, and vitamin D receptors''." have shown that these trans-acting receptors can form homodimers or heterodimers in their active DNA-binding state~."~."'It has also been shown that the regulatory regions of hormone responsive genes can contain cis-acting elements that bind different trans-acting factor~?'.~'The formation of dimers, heterodimers, and multiple DNA-binding or DNA-bound complexes may act to fine tune transcription or regulate transcription in a tissue specific fa~hion.~' One could hypothesize that the genes regulated by 1,25VD3 at the transcriptional level fall into two broad classes. The first class includes genes involved in the primary metabolic functions regulated by the hormone; the maintenance of calcium and phosphate homeostasis eg, calbindin, PTH, and the 2S(OH)-vitamin D3 24 hydroxylase. The second response class would include genes involved in the regulation of proliferation and differentiation such as members of the m y ,jun, andfos families, the regulatory subunits of cyclin kinases and protein phosphatases, RB I , and differentiationspecific marker antigens. These results indicate that the activity of the pl IORh is differentially regulated by 1,25-VD3 in the sensitive and resistant cells. In addition, preliminary experiments in our laboratory indicate that 1,25-VD3 treatment of the RWLeu-4 and JMRD3 cell lines results in the differential expression or activity of members of thejun and fos families. Regulation of these genes by a single agent would involve not only interactions of the ligand-activated receptor with positive or negative cis-acting elements in the DNA,but also require direct or indirect interactions with other trans-acting accessory factors that are expressed in a 72 + - - - 72 - + - Fig 11. Electrophoretic mobility shift analysis of human osteocalcin-VDRE binding proteins. Fifteen micrograms of protein from nuclear extracts isolated from RWLeu-4 and JMRD3 cells either untreated (0) or treated (72) with 50 nmol/L 1.25-VD1 for 72 hours wereincubatedwiththe 32P-labeled human OCVDRE at room temperaturea s described in Materials and Methods. Lane 13 shows the probewith no nuclear extract added. Lanes l, 2, and 3, untreated RWLeu-4 extracts. Lanes 4, 5, and 6, extracts from RWLeu-4 cells treated with 50 nmol/L 1,25-VD3for 72 hours. Lanes 7, 8, and 9, untreated JMRDl extracts. Lanes 10, 11, and 12, 1,25-VD3 treated JMRDl extracts. Specificity of binding was determined by competition with a 100-fold molar excess of unlalabeled the as VDR in the figure was identified by blocking its formation with anti-VDR antibodies in lanes 2, 5, 8, and 11 a s described in Materials and Methods. Bands that are different in the RWLeu-4 and JMRDl extracts are labeled as A-bands in the figure. cell cycle, tissue, lineage or differentiation specific manner. Therefore, resistance to the antiproliferative effects of 1,25VD3 in the presence of a functional VDR could be explained by alterations in the interactions between multiple transacting factors with specific cis-acting elements. Experiments are now in progress to characterize the interactions of the VDR found in both RWLeu-4 and JMRD, cells with other regulatory factors. Investigating the biochemical effects of 1 ,25-VD3 onsensitive and resistant transformed cells will aid in the analysis of regulation of proliferation and differentiation in both pathologic and normal states. Of fundamental importance is the prospect of using natural products, 1 ,2S-VD3or its analogs, as antineoplastic or antihyperproliferative therapeutic agents. Recently, 1,25-VD3related compounds havebeen approved for the treatment of and are being used in preclinical trials on cancer of the breast.'"'" Elucidation of the complex interactions of VDRs with its coreceptors and other transcription factors will further efforts t o design rational therapies using this hormone. ACKNOWLEDGMENT We thank Dr Robert F. Todd I11 for providing antibodiesto Mol, Mo2, and M03 antigens, and Dr Lee Nadler for supplying antibodies to P2-microglobulin. REFERENCES 1. Haussler M: Vitamin D receptors: Nature and function. Annu Rev Nutr 6527, 1986 2. DeLuca H F The vitaminDstory:Acollaborativeeffortof basic science and clinical medicine. FASEB J 2:224, 1988 3. Manglesdorf DJ, Koeffler HP, Donaldson DA, Pike JW, Haussler MR: Dihydroxyvitamin D3-induced differentiation in a human promyelocytic leukemia cell line (HL-60): receptor-mediated maturation to macrophage-like cells. J Cell Biochem 98:391, 1984 4. Provvedini DM, Deftos W, Manolagas SC: 1.25-Dihydroxyvi- From www.bloodjournal.org by guest on November 10, 2014. For personal use only. VITAMIND,-RESISTANTLEUKEMIACELLS tamin D3 receptors in a subset of mitotically active lymphocytes from rat thymus. Biochem Biophys Res Commun 121:277, 1984 5. Rigby W C , Denome S, Fanger, M W : Regulation of lymphokine production and human T lymphocyte activation by dihydroxyvitamin D3. J Clin Invest 79:1659, 1987 6. Lemire JM, Adams JS, Sakai R, Jordan SC: 1 alpha,25-dihydroxyvitamin D3 suppresses proliferation and immunoglobulin production by normal human peripheral blood mononuclear cells. J Clin Invest 74:657, 1984 7. Tobler A, Gasson J, Reichel H, Norman AW, KoefflerHP: Granulocyte-Macrophage colony stimulating factor: Sensitive and receptor-mediated regulation by dihydroxyvitamin D, in normal human peripheral blood lymphocytes. J Clin Invest 79:1700, 1987 8. Lasky SR. Bell W, Huhn RD, Posner MR, Wiemann M, Calabresi P,Eil C: Effects of 1 alpha,25-dihydroxyvitaminD3 on the human chronic myelogenous leukemia cell line RWLeu-4. Cancer Res 50:3087, 1990 9. DeLuca HF, Ostrem V: The relationship between the vitamin D system and cancer. Adv Exp Med Biol 206:413, 1986 10. Minghetti PP, Norman AW: 1,25(OH)2-VitaminD3 receptors: Gene regulation and genetic circuitry. FASEB J 2:3043, 1988 11. Kuribayashi T, Tanaka H. Abe E, Suda T: Functional defect of variant clones of a human myeloid leukemia cell line (HL-60) resistant to 1 alpha,25-dihydroxyvitamin D3. Endocrinology 113:1992, 1983 12. Liberman UA, Eil C, Marx SJ: Receptor-positive hereditary resistance to 1,25-dihydroxyvitaminD: chromatography of hormonereceptor complexes on deoxyribonucleic acid-cellulose shows two classes of mutation. J Clin Endocrinol Metab 62:122, 1986 13. Hughes M, Malloy P, Kieback D, Kesterson R, Pike JW, Feldman D, O’Malley B: Point mutation in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 242:1702, 1988 14. Ritchie HH, Hughes MR. Thompson ET, Malloy PJ, Hochberg Z , Feldman D, Pike JW, O’Malley BW: An ochre mutation in the vitamin D receptor gene causes hereditary 1,25-dihydroxyvitamin D3-resistant rickets in three families. Proc Natl Acad Sci USA 86:9783, 1989 15. Kristjansson K, Rut AR, Hewison M, O’Riordan J, Hughes MR: Two mutations in the hormone binding domain of the vitamin D receptor cause tissue resistance to 1,25 dihydroxyvitamin D3. J Clin Invest 92:12, 1993 16. Baker A, McDonnell DP, Hughes M, Crisp T, Mangelsdorf D, Haussler M, Pike J, Shine J, O’Malley, BW: Cloning and expression of full-length cDNA encoding human vitamin D receptor. Biochem 85:3294, 1988 17. McDonnell D, Pike JW, O’Malley BW: The vitamin D receptor: A primitive steroid receptor related to thyroid-hormone receptor. J Steroid Biochem 30:41, 1988 18. Umesono K, Murakami KK, Thompson CC, Evans RM: Direct repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin D3 receptors. Cell 65:1255, 1991 19. Forman BM, Samuels HH: Dimerization among nuclear hormone receptors, New Biologist 2:587, 1990 20. Kliewer SA, Umesono K, Mangelsdorf DJ, Evans RM: Retinoid X receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3 signalling. Nature 355:446, 1992 21. Liao J, Ozono K, Sone T, McDonnell DP, Pike JW: Vitamin D receptor interaction with specific DNA requires a nuclear protein and 1,25-dihydroxyvitamin D3. Proc Natl Acad Sci USA 87:9751, 1990 22. Sone T, Kerner S, Pike JW: Vitamin D receptor interaction with specific DNA. Association as a 1,25-dihydroxyvitamin D3modulated heterodimer. J Biol Chem 266:23296, 1991 23. Rustgi AK, Dyson N, Bernards R: Amino-terminal domains 4293 of c-myc and N-myc proteins mediate binding to the retinoblastoma gene product. Nature 352:541, 1991 24. Hiebert SW, Chellappan SP, Horowitz JM, Nevins JR: The interaction of RB with E2F coincides with an inhibition of the transcriptional activity of E2F. Genes Dev 6:177, 1992 25. Zacksenhaus E, Bremner R, Jiang Z, Gill RM, Muncaster M, Sopta M, Phillips RA, Gallie BL: Unraveling the function ofthe retinoblastoma gene. Adv Cancer Res 61:115, 1993 26. Buchkovich K, Duffy LA, Harlow E: The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 58:1097, 1989 27. DeCaprio JA, Ludlow JW, Lynch D, Furukawa Y, Griffin J, Piwnica-Worms H, Huang CM, Livingston DM: The product of the retinoblastoma susceptibility gene has properties of a cell cycle regulatory element. Cell 58:1085, 1989 28. DeCaprio JA, Furukawa Y, Ajchenbaum F, Griffin JD, Livingston DM: The retinoblastoma-susceptibility gene product becomes phosphorylated in multiple stages during cell cycle entry and progression. Proc Natl Acad Sci USA 89:1795, 1992 29. Hamel PA, Gill RM, Phillips RA, Gallie BL: Transcriptional repression of the E2-containing promoters EIIaE, c-myc, and RBI by the product of the RBI gene. Mol Cell Biol 12:3431, 1992 30. Goodrich DW, Wang NP, Qian YW, Lee EH, Lee WH: The retinoblastoma gene product regulates progression through the G1 phase of the cell cycle. Cell 67:293, 1991 31. Posner MR. Elboim HS, Santos D: The construction and use of a human-mouse myeloma analogue suitable for the routine production of hybridomas secreting human monoclonal antibodies. Hybridoma 6:611, 1987 32. Mihara K, Cao X, Yen A, Chandler S, Driscoll B, Murphree AL, T’Ang A, Fung YK: Cell cycle-dependent regulation of phosphorylation of thehuman retinoblastoma gene product. Science 246:1300, 1989 33. Yen A, Chandler S, Sturzenegger-Varvayanis S: Regulated expression of the RB “tumor suppressor gene” in normal lymphocyte mitogenesis: Elevated expression in transformed leukocytes and role as a “status quo” gene. Exp Cell Res 192:289, 1991 34. Ludlow J, DeCaprio J, Huang CM, Lee WH, Paucha E, Livingston D: SV40 Large T antigen binds preferentially to an underphosphorylated member of the retinoblastoma susceptibility gene product family. Cell 56:57, 1989 35. Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of dye binding. Anal Biochem 72:248, 1976 36. Dignam JD, Lebovitz RM, Roeder RG: Accurate transcription initiation byRNA polymerase 11 in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res 11:1475, 1983 37. Scatchard G: The attraction of proteins for small molecules and ions. Ann NY Acad Sci 5 I :660, 1949 38. Gamblin GT, Liberman UA, Eil C, Downs RWJ, DeGrange DA, Marx SJ: Vitamin D-dependent ricketts type 11: Correlation between clinical features and defects of 1,25(0H),-induced 25(OH)D3-24-hydroxylasein skin fibroblasts. J Clin Invest 75:954, 1985 39. Ausubel FM, Brent R, Kingston RE, MooreDD,Seidrnan JG, Smith JA, Struhl K: Current Protocols in Molecular Biology. New York, NY, Wiley, 1988 40. Chomczynski P, Sacchi N: Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156, 1987 41. Castagna M, Takai Y, Kaibuchi K, Sano K, Kikkawa U, Nishizuka Y: Direct activation of calcium-activated, phospholipiddependent protein kinase by tumor-promoting phorbol esters. J Biol Chem 257:7847, 1982 42. Obeid LM, Okazaki T, Karolak LA, Hannun YA: Transcrip- From www.bloodjournal.org by guest on November 10, 2014. For personal use only. 4294 tional regulation of protein kinase C by 1,25-dihydroxyvitaminD3 in HL-60 cells. J Biol Chem 265:2370, 1990 43. Ways DK, Dodd RC, Bennett TE, Gray TK, Earp HS: Dihydroxyvitamin D3 enhances phorbol ester-stimulated differentiation and protein kinase C-dependent substrate phosphorylation activity in the U937 human monoblastoid. Endocrinology 121:1654, 1987 44. Simboli CM, Franks DJ, Welsh J: 1,25(OH)2D3 increases membrane associated protein kinase C in MDBK cells. Cell Signal 4:99, 1992 45. Hsieh JC, Jurutka PW, Galligan MA, Terpening CM, Haussler CA, Samuels DS, Shimizu Y , Shimizu N, Haussler MR: Human vitamin D receptor is selectively phosphorylated by protein kinase C on serine 5 I , a residue crucial to its trans-activation function. Proc Natl Acad Sci USA 88:9315, 1991 46. Foon K A , Todd RR: Immunological classification of leukemia and lymphoma. Blood 68: I , 1986 47. Todd R, Liu DY: Mononuclear phagocytic activation: Activation associated antigens. Fed Proc 45:2829, 1986 48. Wood GS, Warner NL, Warnke RA: Anti-Leu-3m4 antibodies react with cells of monocytehacrophage and Langerhans lineage. .IImmunol 131:212, 1983 49. Stewart SJ, Junichiro F, Levy R: Human T lymphocytes and monocytes bear the same Leu-3(T4) antigen. J lmmunol 136:3733, 1986 50. Yen A, Chandler S, Fung UK, Pearson R, Forbes ME: Regulation of the Rb gene product by retinoic acid and 1,25(OH)2vitamin D, during cell differentiation: Role as a “status quo” gene. Proc Am Assoc Canc Res 31:328, 1990 51. Yen A, Chandler S: Inducers of leukemic cell differentiation cause down-regulation of Rb gene expression. ExptBiolMed 199:291, 1992 52. Friend SH, Bernards R, Rogelj S, Weinberg RA, Rapaport JM, Albert DM, Dryja TP: A human DNA segment with properties of thegenethat predisposes to retinoblastoma and osteosarcoma. Nature 323643, 1986 53. Fung YK-T, Murphree AL. T’Ang A, Qian J, Hinrichs SH, Benedict W F Structural evidence for the authenticity of the human retinoblastoma gene. Science 236: 1657, 1987 54. Lee W-H, Bookstein R, Hong F, Young L-J, Shew J-Y, Lee EY-HP: Human retinoblastoma susceptibility gene: Cloning, identification, and sequence. Science 235:1394, 1987 55. Ohyama Y, Noshiro M, Okuda K: Cloning and expression of cDNA encoding 25-hydroxyvitamin D3 24-hydroxylase. FEBS Lett 278: 195, 1991 56. Armbrecht HJ, Okuda K, Wongsurawat N, Nemani RK, Chen ML, Boltz MA: Characterization and regulation of the vitamin D hydroxylases. J Steroid Biochem Mol Biol 43:1073, 1992 57. Chen KS, Prahl JM, DeLuca H F Isolation and expression of human I ,25-dihydroxyvitamin D3 24-hydroxylase cDNA. ROC Natl Acad Sci USA 90:4543, 1993 58. Chen ML, Boltz MA, Armbrecht HJ: Effects of 1,25-dihydroxyvitamin D3 and phorbol ester on 25-hydroxyvitamin D3 24hydroxylase cytochrome P450 messenger ribonucleic acid levels in primacy cultures of ratrenal cells. Endocnnology 132:1782, I993 59. Roy S, Martel J, Ma S, Tenenhouse HS: Increased renal 25hydroxyvitamin D3-24-hydroxylase messenger ribonucleic acid and immunoreactive protein in phosphate-deprived Hyp mice: A mechanism for accelerated 1,25-dihydroxyvitamin D3 catabolism in Xlinked hypophosphatemic rickets. Endocrinology 134:1761, 1994 60. Zierold C, Darwish HM, DeLuca H F Identification of a vitamin D-response element in the rat calcidiol(25-hydroxyvitamin D3) 24-hydroxylase gene. Proc Natl Acad Sci USA 91:900, 1994 6 I . Williams RT. Carbonaro HD, Hall FL: Co-purification of p34cdc2/p58cyclin A proline-directed protein kinase and the retino- LASKY ET AL blastoma tumor susceptibility gene product: Interaction of an oncogenic serindthreonine protein kinase with a tumor-suppressor protein. Oncogene 7~423,1992 62. Ewen ME, Sluss HK, Sherr CJ, Matsushime H, Katc J, Livingston DM: Functional interactions of the retinoblastoma protein with mammalian D-type cyclins. Cell 73:487, 1993 63. Dowdy SF, Hinds PW, Louie K, Reed SI, Arnold A, Weinberg RA: Physical interaction of the retinoblastoma proteinwith human D cyclins. Cell 73:499, 1993 64. Durfee T, Becherer K. Chen PL, Yeh SH, Yang Y, Kilburn AE, Lee WH, Elledge SJ: The retinoblastoma protein associates with the protein phosphatase type l catalytic subunit. Genes Dev 7555, 1993 65. O’Malley BW: The steroid receptor superfamily: More excitement predicted for the future. Mol Endocrinol 4:363, 1990 66. Evans RM: The steroid and thyroid hormone receptor superfamily. Science 240:889, 1988 67. Abel T. Maniatis T: Gene regulation: action of leucine zippers. Nature 341:24, 1989 68. Kouzarides T, Ziff E: The role of the leucine zipper in the fos:jun interaction. Nature 336:646, 1988 69. Schule R, Muller M, Kaltschmidt C, Renkawitz R: Many transcription factors interact synergistically with steroid receptors. Science 242:1418, 1988 70. Martin KJ, Lille JW, Green MR: Evidence for interactions of different eukaryotic transcriptional activators with distinct cellular targets. Nature 346: 147, 1990 7 1 . Schule R. Umesono K, Mangelsdorf DJ, Bolado I, Pike JW, Evans RM: Jun-Fos and receptors for vitamin A and D recognize a common response element in the human osteocalcin. Cell 61:497, 1990 72. Umesono K, Giguere V, Glass CK, Rosenfeld MG, Evans RM: Retinoic acidand thyroid hormone induce gene expression through a common responsive element. Nature 336:262, 1988 73. Saggese G , Federico G, Battini R: Topical application of 1,25dihydroxyvitamin D3 (calcitriol) is an effective and reliable therapy to cure skin lesions in psoriatic children. Eur J Pediatr 152:389, 1993 74. Douglas WS, Fitzsimons El: Vitamin D analogues, marrow fibrosis and psoriasis. Br J Dermatol 128:359, 1993 75. El AR, Peters MS, Pittelkow MR, Kao PC, Muller SA: Efficacy of vitamin D3 derivatives in the treatment of psoriasis vulgaris: A preliminary report. Mayo Clin Proc 68335, 1993 76. Abe J, Nakano T, Nishii Y, Matsumoto T, Ogata E, lkeda K: A novel vitamin D3 analog, 22-oxa-1,25-dihydroxyvitaminD3, inhibits thegrowth of human breast cancer in vitro andin vivo without causing hypercalcemia. Endocrinology 129832, 1991 77. Colston KW. Mackay AG, James SY, Binderup L, Chander S, Coombes RC: EB 1089: A new vitamin D analogue that inhibits the growth of breast cancer cells invivoandin vitro. Biochem Pharmacol 44:2273, 1992 78. Sedlak l, Speiser P, Hunakova L, Duraj J, Chorvath B: Modulation of EGFreceptor and CD15 (Lewisx) antigen on the cell surface of breast carcinoma cell lines induced by cytokines. retinolc acid, 12-0-tetradecanoylphorbol 13-acetate and 1,25(OH)2-vitarnin D3. Chemotherapy 4 0 5 l , 1994 79. Anzano MA, Smith JM, Uskokovic MR, Peer CW,Mullen LT, Letterio JJ, Welsh MC, Shrader MW, Logsdon DL, Driver CL, Brown CC, Roberts AB, Spom MB: la,25-Dihydroxy- I6-ene-23yne-26,27-hexafluorocholecalciferol(Ro24-5531) A new deltanoid (vitamin D analogue) for prevention of breast cancer in the rat. Cancer Res 54:1653, 1994 80. James SY, Mackay AG, Binderup L, Colston KW: Effects of a new synthetic vitamin D analogue, EB1089, on the oestrogenresponsive growth of human breast cancer cells. J Endocrinol 141:555, 1994
© Copyright 2025