1. No category

From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
1996 88: 609-621
Lymphocytic progenitor cell origin and clonal evolution of human Blineage acute lymphoblastic leukemia
F Davi, C Gocke, S Smith and J Sklar
Updated information and services can be found at:
http://www.bloodjournal.org/content/88/2/609.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
Lymphocytic Progenitor Cell Origin and Clonal Evolution of Human
B-Lineage Acute Lymphoblastic Leukemia
By Frederic Davi, Christopher Gocke, Stephen Smith, and Jeffrey Sklar
At presentation, bone marrow specimens from over 25% of
B-lineageacute lymphoblastic leukemias (ALL) display more
than two clonal rearrangements of immunoglobulin heavy
chain (IgHJgenes in Southern blot analyses. Nucleotide sequence analysis has shown predominantly different VHDJH
junctions among these genes, leading t o the frequent description of such cases as oligoclonal leukemias. In the present study, we have analyzed the IgH genes from four patients whose leukemic cells contained different patterns of
IgH gene rearrangementsbetween presentation and relapse.
Nucleotide sequence analysis of the IgH genes showed that
three mechanisms could account for these differences: de
novo V H D J H rearrangement, VH to DJH recombination, and
VHreplacement. In all cases, more than two totally different
VHWH rearrangements appeared during evolution of the dis-
ease, formally consistent with the conclusion that these tumors were composed of apparently unrelated clones. However, the retention of some of the antigen receptor gene
rearrangements, as well as the persistence of a chromosomal marker in two cases, indicated that these leukemias
had a monoclonal origin. These findings support the hypothesis that some ALLs arise from a lymphoid progenitor cell
at a stage of lymphocyte development before the onset of
IgH gene rearrangement. These leukemic lymphocyte progenitors generate malignant daughter cells capable of an in
vivo maturation that involves the completion of multiple
different IgH rearrangements as well as the modification of
preexisting rearrangements by VH t o DJH recombination or
by a VH replacement.
0 1996 by The American Society of Hematology.
A
loci in the germline configuration and spawns progeny cells
in which de novo VHDJH joining occurs as the neoplasm
evolves.739
Finally, truly bi- or oligoclonal tumors might arise
from independent transformation events in separate progenitor
We have evaluated the possible mechanisms for apparent
oligoclonality and clonal evolution of ALL in four patients
by sequencing IgH gene rearrangements. Our results suggest
the origin of these tumors from a transformed lymphocyte
progenitor cell, the progeny of which are capable of continuing de novo gene rearrangement and additional recombination events such as VHto DJH gene joining and VHreplacements.
NTIGEN RECEPTOR gene rearrangements have been
widely used as markers of clonality in human
lymphoid neoplasms.’,*During B-cell ontogeny, the genes
that encode immunoglobulins (Ig) are rearranged by recombination of discontinuous DNA segments that have been
termed variable (V), diversity (D), and joining (J). This process occurs most often in a sequential order: heavy (H) chain
genes before light (L) chain genes, and K light chain genes
before A light chain genes. Among the IgH genes, the first
event is generally the joining of a D segment to a JH segment,
followed by the addition of a VH segment to the DJH join.
Further diversity is created by the insertion of random nucleotides (the so-called N-regions) and/or the deletion of short
stretches of sequence from the ends of the participating segments at the time of DJH and VHD joining, thereby creating
a unique genetic marker for the cell and any progeny that
cell may produce.
Multiple studies using iso-en~ymes,~
karyotype: Ig idiotype,5 and gene rearrangement’.’ analyses have suggested
that leukemia represents the clonal expansion of a single
transformed hematopoietic cell. Nevertheless, Southern blot
analysis has shown that at least 25% of early B-lineage acute
lymphoblastic leukemias (ALLs) contain more than two IgH
Furthermore, sequential follow-up of
some patients has shown that the pattern of IgH gene rearrangement can change over the course of the disease.l’-I3
Therefore, many ALLs appear to be oligoclonal with respect
to these markers. Several mechanisms could account for this
observation. First, biclonality might be artificially created
by hyperploidy of chromosome 14 with independent IgH
rearrangements present in each chromosome.6 Second, apparent oligoclonality could be the result of evolution within
the tumor clone by modification of a preexisting IgH gene
rearrangement through at least four types of processessomatic mutation of immunoglobulin gene DNA,14 the replacement of a rearranged VH segment by a more 5’ unrearranged VH ~ e g m e n t , ’ ~the
. ’ joining
~
of a VHsegment to an
incomplete DJH rearrangement,17and by an “open and shut”
mechanism with deletion and addition of junctional nucleotides.” Third, oligoclonality could also occur by transformation of an early lymphoid precursor cell that had retained Ig
Blood, VOI 88, NO 2 (July 15). 1996 pp 609-621
MATERIALS AND METHODS
Patients, samples, and cell lines. All tissues were obtained with
the informed consent of patients. Malignant cells were obtained from
patients with ALL at the time of presentation and at relapse. In each
case, bone marrow aspirates and peripheral blood samples contained
>80% leukemic cells. Diagnosis of ALL was established by standard
morphological, cytochemical, and immunophenotypic methods. The
precursor B phenotype was based on the presence of malignant cells
positive for TdT, CD19, and HLA-DR (null ALL), or for TdT,
From the Division of Molecular Oncology, Department of Pathology, Brigham & Women’s Hospital and Harvard Medical School,
Boston, MA: the Department of Pathology, Pennsylvania State University School of Medicine. Hershey, PA: and the Division of Pediarric Hematology-Oncology, The University of Chicago Medical Center, Chicago, IL.
Submitted December 4, 1995; accepted March 11, 19%.
Supported by Grants No. PO1 CA34183 and ROI CAS8621 from
the National Institutes of Health to J.S. F.D. was the recipient of a
fellowship from The Lady Tata Memorial Trust.
Address reprint requests to Jefiey Sklar, MD, Department of
Pathology, Brigham and Women’s Hospital, 75 Francis St, Boston,
MA 02115.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
OOO6-4971/96/8802-O1$3.00/0
609
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
DAVl ET AL
610
Table 1. Sequence of Oligonucleotides Primers Used for IgH PCR
Outer Primers
5'
Inner Primers
3'
GCTGAGGTGAAGAAGCCTGGG
CAGGTCACCTTGAGIAGGAGTCTGG
AGGTGCAGCTGGTGCIGAGTCTGG
AGGTGCAGCTGCAGGAGTCGGG
GTGTCTCCCNCCACAGGTIAGTCTTIGTG
AGGTACAGCTGCAGCAGTCAGGT
ACCTGAGGAGACGGTGACCNGGRGITGT
5'
3'
TCGGATCCTCNGGTGANGGGTCflTCCTGC
GAAGATCTCACACTGACCTGCACCTIGTC
GAAGATCTCTCCTGTGCAGCCTCTGG
GTGGATCCTGTCCCTCACCTGCNGTICTG
CCAGATCTCCTGTAAGGGTTCTGG
GAAGATCTCTCACTCACCTGTGCCATC
TGGAATTCCAGflGGTGICKCCTCITGGCCCCAG
The BamHI, 69,II, and EcoRl restriction sites are underlined.
CDIO, CD19, and HLA-DR (common ALL), or for TdT, CDIO,
CD19, HLA-DR and cytoplasmic 1.1 chains (pre-B ALL). Establishment of cell lines, as well as their cytogenetic analysis, was performed using techniques previously described." Normal bone marrow was obtained from donors for allogeneic bone marrow
transplantation. Normal blood was obtained from healthy volunteers.
Southern blot anulysis. High molecular weight DNA was isolated and analyzed using the Southem blot hybridization procedure,
as previously described.' Probes used for hybridization consisted of
cloned DNA fragments containing human J,, C,, Chz regions of the
IgH genes and the J, regions,*' the J, regions," and Jo region2" of
the T-cell receptor (TCR) genes. The following restriction enzymes
were used for analyses of the various genes: IgH-BumHI, EcoRI,
Hind111 and Bgl 11; IgK-BamHI; IgX---EcoRI; TCR 0-BurnH1,
HindII1, and EcoRI; TCR y-BumHI and Bgl 11; TCR b-ButnHI.
EcoR1, and HindlI1.
Polymerase chuin reuction (PCR). Amplification of IgH gene
rearrangements using the PCR was performed in a two-part procedure. In the first step, 50 ng to I pg of DNA was amplified for 20
ro 25 cycles with a set of Vwfamily-specific primers and a consensus
Jtl primer. Ten percent of this amplified material was then reamplified
for 15 to 20 cycles using a second set of nested VH family-specific
and consensus J H primers. PCR was performed using nucleotides,
buffer, and enzyme provided in the Perkin-Elmer Cetus Gene Amp
Kit (Perkin-Elmer Cetus, Nonvalk, CT), according to the manufacturer's specifications. All reactions contained IS0 ng of each primer
and were performed in a 50-pL volume. Each amplification cycle
consisted of a denaturation step at 94°C for I minute (3 minutes in
the first cycle), a primer annealing step at a temperature ranging
from 45°C to 55°C for 1 minute, and a primer extension step at 72°C
for I minute (and 7 minutes in the last cycle). Negative controls were
prepared by performing amplifications on samples lacking DNA or
containing DNA from polyclonal specimens (bone marrow or blood
from normal individuals). Precautions to avoid contamination with
amplified material were followed. a s described in Kwock et al" and
Sarkar et aLzx PCR products were analyzed by electrophoresis in
I .2% agarose and 6% polyacrylamide gels.
Oligonucleoride primers. Design of the 5' primers was based
on sequence homology within the framework I region of each VtI
family, according to the published human germline V,, genes."' ''
The 3' antisense primers were chosen to match consensus sequences
within the six human J H genes.'"-'' Restriction sites were incorporated
into the set of nested primers to facilitate the ligation of the PCR
products into vectors for cloning in Escherichiu coli. The sequences
of the VtI and the .I,,
primers are given in Table I . Clone-specific
oligonucleotides were designed to correspond to the N-regions of
clonal IgH rearrangements found within the leukemic cells of individual patients. All primers were constructed with an automated
DNA synthesizer (Applied Biosystems, Foster City, CA).
DNA sequencing. PCR products were digested with the restriction enzymes EcoRI and BumHI or Bgl I1 (BRL, Gaithersburg, MD).
After purification in low melting point agarose, the fragments were
ligated into DNA of the M I 3 sequencing vector. Multiple M I 3
clones grown in E coli were isolated and subjected to sequence
analysis using the Sequanase Kit (US Biochemical Corp, Cleveland.
OH). Only sequences found repeatedly in at least four MI3 clones
were considered to represent clonal rearrangements. The specific
identity of individual V, segments was not determined.
N-oligonucleotide hybridization. PCR products amplified from
tumor DNA, dilutions of tumor DNA in control DNA (bone marrow
from normal individuals), and control DNA by itself, were separated
by electrophoresis on I .2% agarose gel and transferred to Genatran
nylon membranes (Plasco, Wobum, MA). Alternatively, the PCR
products were directly applied to the membrane using a slotted manifold apparatus (Schleicher and Schuell, Keene, NH). Membranes
were hybridized for 4 hours at 46°C in 5X SSPE (1 X SSPE is 0. I 5
mol1L sodium chloride, 10 mmol/L sodium phosphate, I mmol1L
EDTA) and 0.5% SDS (sodium dodecyl sulfate) with clone-specific
oligonucleotide probes which had been 5' end-labeled with '?P. After
hybridization, membranes were washed twice in 2X SSPE, 0. I%
SDS for 2 minutes at room temperature, and then once in 5 X SSPE.
0.1% SDS for 15 minutes at 2°C below the melting point of the
oligonucleotide sequence. Blots were exposed on Kodak XAR-5 film
(Eastnian Kodak, Rochester. NY) for 2 to 16 hours.
RESULTS
Patient 1. Patient 1 (Figs 1 and 2 ) was diagnosed with
pre-B ALL containing the Philadelphia chromosome (Ph').
Two cell lines, SUP-B13 and SUP-B15, were established
from cells collected at the time of first and second bone
marrow relapses, 2 years and 26 months, respectively, after
initial diagnosis.jx
F o r this and all other cases except one (patient 3), digestion of DNA with Hind111 restriction enzyme, rather than
with BamHI or EcoRI, seemed to display a greater number
of bands in Southem blot analyses of the IgH genes. Using
HindIII, the presentation bone marrow from this case showed
a germline band, an equally intense rearranged band, and a
second weakly hybridizing band, which probably also represented a clonally rearranged gene (this weakly hybridizing
band occurred at the position of a minor cross-hybridizing
germline band; the interpretation that this band may have
represented a rearrangement in the presentation specimen
was based on its relative increased intensity). At both the
first and second relapses (bone marrow was analyzed for the
first relapse and blood for the second) and in each cell line,
the intense rearranged band was lost and a new, strongly
hybridizing nongermline band appeared. A band at the position of the weakly hybridizing rearranged band was retained,
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
611
ORIGIN AND EVOLUTION OF B-ALL
I I I I I
-G
>
>
- Gf
Fig 1. Southern blot analysis
of leukemic cells from patient 1
at presentation, relapse, and call
lines. DNA was digested with
Hind 111 and the blot was hybridized with a JH probe. G shows
the position of the germline
band and G' the position of a
weakly cross-hybridizing band;
arrows indicate clonally rearranged bands. BM, bone marrow; PB, peripheral blood.
>
but it was not possible to distinguish it from the minor crosshybridizing germline band. The germline band, still present
in the marrow relapse. was not seen in the cell lines and
only faintly hybridized in the analysis of blood from the
second relapse.
Other antigen receptor genes displayed the same pattern of
rearrangement in both marrow samples, the peripheral blood
sample, and the SUP-B 13 cell line. This pattern consisted of
the germline configuration for immunoglobulin light chain
genes (IgL) and beta T-cell receptor genes (TCR /3), deletion
of delta T-cell receptor chain genes (TCR 6). and apparent biallelic rearrangement of the gamma T-cell receptor genes (TCR
7 ) .The SUP-B 15 cell line showed one detectable kappa immunoglobulin light chain (Iglc) gene rearrangement and one
weakly hybridizing rearranged band with each of the lambda
immunoglobulin light chain (IgX) and TCR /3 probes, as well
as an additional TCR y rearrangement.
The Ph' chromosome was detected cytogenetically in all
samples. At relapse, some cells had a more complex karyotype:
46,XY,t(9;22)(q34;qI 1 ),t( I ;4)(p22;q33),der( 14q),16p+. Both
cell lines had only this karyotype in all cells.
Amplification of IgH DNA in the presentation bone marrow repeatedly yielded three bands, two generated with the
VHI-family primers, one with the VH3-family primers. The
first VH1rearrangement involved a vH1 segment (VHIa), the
DLR3 segment, and the JH4 segment, all joined in frame.
The second VH1 rearrangement used a different VH1 segment
(VHlb)joined out of frame to the DLRl segment and the
JH6 segment. The vH3 rearrangement consisted of an inframe joining of a vH3segment (VH3a) directly to the JH6
segment, without any obvious D segment. In the samples
obtained at relapse and in both cell lines, a single band was
obtained, and only using VJ-family primers. This rearrangement had a partial homology with the original V H l b
rearrangement identified in the presentation specimen, as
both rearrangements shared the same D-N-JH region. However, the VH segment in this new rearrangement segment
(VJb) and the N-region between VI, and D segments differed completely from that of the original rearrangement.
This could be due to either two different VH segments rearranging to the same DJH joint, or the replacement of the
VHI b gene by the VH3bgene. The later process, well characterized in mice, has been shown to occur in cultures of virally
It intransformed pre-B cells and in B-cell
volves a recombination process mediated through a heptamer
sequence located in the 3' portion of most VI, genes.'"
Theoretically, the sequences amplified from the blood or
bone marrow in this patient could correspond with rearrangements of nonmalignant lymphocytes cells admixed with tumor cells rather than to bona fide clonal rearrangements
contained in leukemic cell populations. To confirm the origin
of these sequences from tumor cells, the frequencies of the
sequences obtained were roughly quantitated within the
specimens by hybridization studies using oligonucleotides
specific for the individual rearrangements. Radiolabeled oligonucleotides (N-oligonucleotides) complementary to the
sequences of the N-regions for each of the four rearrangements amplified in this case were hybridized to IgH DNA
amplified from the total specimen DNA before or after dilution of that DNA with the DNA of normal bone marrow.
Each oligonucleotide hybridized to product amplified from
DNA of the appropriate specimen and not to product from
normal DNA or from the DNA of specimens from the patient
in which the rearrangement could not be detected by PCR
(data not shown; similar results are illustrated for patient
3 below). Moreover, the hybridization occurred to product
amplified from specimen DNA that had been diluted several
orders of magnitude before amplification. The results indicate that the rearrangements represented by the N-oligonucleotides were relatively abundant within the specimens and
probably reflected a significant clonal proliferation of cells
containing the rearrangements.
Although the VH3brearrangement was presumably generated by modification of a preexisting rearrangement (DJHor
VHDJH), the tumor contains at least two apparently distinct
clonal lines because three different VHDJH recombinations
and a germline band were present in the presentation specimen. These clonal lines may have originated from a leukemic
progenitor with both IgH alleles in the germline configuration. Alternatively, these lines may represent subclones that
were derived from a tumor cell having one common rearranged allele, but which diverged as a result of different
rearrangements on the second germline allele.
Purient 2. Patient 2 (Fig 3) was diagnosed with a pre-B
ALL containing a t ( l ; 19)(q23;p13). A cell line, SUP-B27,
was derived from bone marrow obtained at relapse I year
later. Southern blot analysis of the DNA from the presentation marrow after digestion with Hind 111 and hybridization
with a JH probe showed a germline and four rearranged
bands. The two more intense rearranged bands were conserved at relapse and in the cell line. The relapse marrow also
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
DAVl ET AL
612
P r e s e n t a t i o n (BM)
- - - -
Relapse 1(BM)
Relapse 2 (PB)
1
Gt1R
c
1
~
~
1
G+2R
G+lR
G
G
G
G
G+2R
G+2R
de 1
de 1
de 1
de 1
de 1
G
G
G
G
G+lR
2
1R
G
G
G+lR
G
G
G+lR
G+2R
IJUNCTIOHAL
1R
~ Cellp line
~ 2 ~
(SUP-B15)
2
G+2R
2
c--)
G+3R
SEQUENCES~
VH3a
JH6
TACTGTGCaagagggtcggagcccaACTACTACTACGGTATGGACGT
---__----___--____--_
VHla
DLR3
JH4
TACTGTGCaacagccagtgaggaGGTGGTGACTGCTATTCagTTTGACTA
_---____--_____-_____
VHlb
DLRl
....................
Cell l i n e s 1&2
(+)
JH 6
TACTGTGCGAGAgaGGTGGTGTATGCTATACCggTACTACTACTACGGTATG~CGT
Relapses 1&2
(+)
(-)
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
VH3b
TACTGTACGAGAgttgccagggGGTGGTGTATGCTATACCggTACTACTACTACGGTATGGACGT
.....................
(+)
Fig 2. Patient 1: Summary of immunogenotype and IgH gene rearrangement junctional sequences. (A) Pattern of antigen receptor gene
rearrangements by Southem blot analysis. BM, bone marrow; PB, peripheral blood; G, germline; R, rearranged; del, deleted. Arrows indicate
identity balween rearranged bands; the number above the arrow indicates the number of rearranged bands that were identical. (B) Regions
identified as VH, D, and Jn gene segments are overlined. The specific identity of individual VHsegments was not determined. N-regions are in
small characters. Hatched bars, N-oligonudeotide probes. Vertical parallel bars, identical nucleotides between two rearrangements. (+I, in
frame; (-1, out of frame.
had a germline IgH band and two additional rearrangements,
while the cell line showed no germline band. Light chain
genes were in the germline configuration in the presentation
marrow, while one Igrc and one Igh rearrangement appeared
at relapse and were retained in the cell line. The cell line
had four additional Igrc rearrangements, which appeared as
bands with much lower intensities. TCR y genes were in
the germline configuration in all samples. A germline and a
rearranged band at the similar position were detected with
a TCR 6 probe in the presentation and relapse marrows, the
latter having two additional rearrangements. The cell line
had a different TCR 6 rearrangement, and over time in culture acquired a second TCR 6 rearrangement. Finally, hybridization with a TCR 0 probe showed a germline and a
rearranged band in the presentation marrow, while the relapse marrow and the cell line displayed only the germline
configuration of this gene.
Amplification of IgH rearrangements using VH3-family
primers yielded the same two products from each sample,
likely corresponding to the two conserved bands seen on the
Southem blot analysis. One was an in-frame rearrangement
of a vH3 segment (vH3c) to the DXP, segment, which in
tum was joined to the JH6segment. This rearrangement may
account for the cytoplasmic Igp chain produced by the leukemic cells in this case. The other IgH rearrangement amplified
was out-of-frame and involved a different vH3 segment
(VH3d),the DXP’1 segment, and the J& segment. In addition, VH6-familyprimers amplified an in-frame vH6-JH4rearrangement from the presentation marrow. On the other
hand, a VHl-DXP’1-JJb rearrangement was amplified
solely from the relapse marrow. Therefore, although Southem blot analysis displayed four rearrangements in both presentation and relapse samples, only three of them could be
amplified from any specimen in this case. Absence of ampli-
~
~
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
ORIGIN AND EVOLUTION OF E-ALL
613
- -
Presentation
1gH
G+4R
I9K
G
G
TCR7
G
TCR~
G+lR
TCR~
G+lR
Cell line
(SUP-BZ7)
Re1 apse
2
G+4R
2
2R
G+lR
1
G+5R
G+lR
1
G+lR
G
1
G+3R
G
G
G+lR
f----t
1
2R
G
JUNCTIONAL SEQUENCES
Presentation
I-
TATTGTGCAAGAGtgttgggtgttacccaTGACTA
_---___-----__-----
vH3c
JH6
....................
Re 1apse
Relapse
DXP4
TACTGTGCGAGAGAagtggGTATTACGATTTTTGGAGTGGcttcgcggtggTACTACGGTATGGACGT
presentation
Cell line
JH4
-
VH6
r
vH3d
DXP'I
JH4
1
TACTGTGCGAcctaatcaggcGTATTACTATGGTTCGGGGAGcctatagggggaaTTGACTA
r1
DXP ' 1
JH5b
vH1c
TACTGTGCGAGAcaggggcagccgctTGGTTCGGGGAGTTAatgacttcgcggtcgtAAAACTGGTTCGACCC
.....................
Fig 3. Patient 2: Summary of immunogenotype and IgH gene rearrangement junctional sequences.
fication could be explained by the presence of a partial DJH
rearrangement, which lacked a rearranged VH segment. Alternatively, insufficient complementarity between rearranged
target VHor JH sequences and the consensus oligonucleotides
used may have prevented amplification of additional, complete VHDJH rearrangements. The origin of each of the amplified rearrangements from clonal cell populations was confirmed by hybridization with N-oligonucleotides.
These results suggest that this case contains several clonal
lines, with one predominant line that is present at presentation and at relapse and is also represented by the in vitro
cell line. In vivo, as well as in vitro, evolution within this
line is demonstrated by rearrangements of the IgL and TCR
6 genes. At least one additional line at presentation and
one at relapse, each bearing different IgH, TCR 6 and p
rearrangements, were also present. All of these lines appear
totally unrelated, at least with regard to their IgH genes.
Because three separate leukemogenic transformation events
seem unlikely in a single patient, the most plausible explanation for the findings in this case is a common B-lineage
committed leukemic progenitor that had its antigen receptor
genes in the germline configuration, but could undergo further maturation to the pre-B-cell stage.
Patient 3. Patient 3 (Fig 4) was diagnosed with common
ALL. Bone marrow from this patient was analyzed at presentation and at relapse 2 years later. Southern blot analyses
performed on an EcoRI digest of DNA from the presentation
marrow showed two rearranged IgH genes, as well as a band
in the germline position. At relapse the germline band and
one rearranged band persisted, while two less intense new
rearranged bands also appeared. The patterns of bands in the
analyses of IgL genes were identical in both samples and
consisted of the deletion of both Igrc alleles, and one Igh
rearrangement. Similarly, the TCR y gene pattern of a germline and two rearranged bands was unchanged between the
two specimens. One of the two TCR 6 rearranged bands
found at presentation was lost at relapse and one rearranged
TCR p band was acquired at relapse.
Amplification of IgH DNA from the presentation bone
marrow yielded PCR products with vH2 and V& primers.
One product consisted of a vH2 segment (VH2a)joined in
frame to a D-D fusion (DK4 and DM2 segments), which,
was in turn, joined to the JH6csegment. The second product
consisted of a vH4 segment (V&a), parts of the DM 1 and
DLR 5 segments and a JH segment that could not be precisely
identified because of extensive 5' deletion. Two contiguous
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
DAVl ET AL
614
-
Presentation
G+2R
de 1
G+1R
G+2R
Re 1apse
1
G+3R
de 1
1
G+lR
2
G+2R
4----t
G+2R
G+lR
G
G+lR
I JUNCTIONAL SEQUENCES I
Presentation
Presentation
[
rL
r
Re 1apse
VH2 a
I
DK4
DM2
-
JH6c
---_--------------
TACTGTGCacGGATACAGCGGAACTACTACTACATGGACGT
DLR5
CACGGCTGTGTATTACTGTGCGAGAggcgggtTGGAAgtcctatgATAGTACggt cccccgc
VH4a
DM1
.....................
VH4b
CACGGCC. .
---e--
(+)
(-)
llllllllllllllllllllllllllllllllll
. . . . . . . . . . . . .--------------cggggagggtTGGAAgtcctatgATAGTACggtcccccgc
VH5b
JH6
TACTGTGCaagagggtcggagcccaACTACTACTACGGTATGGACGT
------------------
(-)
(+)
Fig 4. Patient 3: Summary of immunogenotype and IgH gene rearrangement junctional sequences. Dotted line indicates a l&bp deletion
within the 3' end of the VH4b gene.
stop codons in the DLR5 segments interrupted the reading
VHreplacement, when exonucleolytic digestion of rearranging gene segments, as in de novo V-D joining, commonly
frame of this rearrangement. The vH4 rearrangement was
occurs. Figure 5 illustrates the results of N-oligonucleotide
also found at relapse, while the VH2 rearrangement was not
detected. Instead, a vH5 and a different V d rearrangement
hybridization in this case.
Therefore, it appears that the bone marrow of patient 3
were amplified. The v H 5 rearrangement contained the VH5b
segment joined in frame to the JH6 segment. The second
contained a leukemic clone bearing a vH4 rearrangement that
persisted through the course of the disease, but underwent a
V& rearrangement was clearly related to the rearrangement
VHreplacement event within a subclone. At different times,
previously detected, as they shared the same N-D-N-JH rethe leukemic cells in this patient also possessed additional
gion, but the vH4 segment used in this case (V&b) was
IgH rearrangements, including the vH2 rearrangement found
different (substitutions of nucleotides at 10 separate positions
at presentation and the vH5 rearrangement found at relapse.
distinguished the portions of the rearrangements amplified).
These must have been produced by a VHDJH recombination
This IgH modification most likely reflects a VHreplacement,
in a precursor neoplastic clone with germline IgH genes.
in which there is retention of sequences located 3' to the
Whether both alleles were in the germline configuration in
conserved internal VH gene heptamer (TACTGTG) recognized as the signal for VH to VH r e c ~ m b i n a t i o n . ' ~ An
. ~ ~ . ~ ~this precursor, or only one allele was germline and the other
had already undergone the vH4 rearrangement cannot be
alternative explanation for these observations is a gene conresolved, although the deletion of IgK genes at both presentaversion event within the VH sequence; however, the 18-bp
tion and relapse favors the latter interpretation.
deletion found within the rearrangement at the 3' end of the
Patient 4. Patient 4 (Figs 6 and 7) was an infant diagV&b segment, is more likely to have been generated during
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
615
ORIGIN AND EVOLUTION OF B-ALL
N-region specific
probe
Presentstion
IO'
I
to-' 10-'10-~
I I I
Normal
-
Relapse
'01
I
IC'16' lom31
I
I
I
I
i
VHZa
VH4b
Additionally, the second relapse marrow showed another IgA
rearrangement. A common TCR y rearrangement was found
in all samples, while the second relapse marrow had an
additional rearrangement. After prolonged exposure, four
more faint bands appeared in analyses of the presentation
sample and the first relapse sample, only two of which migrated at the same position. Four TCR 6 rearrangements
were detected in the presentation sample, but only a single
shared rearranged band was observed in both relapse samples. Exclusively germline configurations of TCR 0 genes
were detected in all samples from this case.
Four IgH rearrangements were amplified from the DNA
of the presentation marrow. Three of these had similar DN-JH regions composed of the DN4 segment joined to the
J ~ 3 bsegment. However, the VH-N regions were different
and involved either a vH2 (VH2b),a VH5(VH%), or the VH6
segment. The fourth rearrangement had a totally unrelated
sequence, created by a vH3 segment (VH3e)joined to the
JH4segment. All four rearrangements were out of frame. In
both relapse samples, a rearrangement was amplified that
displayed partial homology with the first rearrangement detected in the presentation bone marrow; it had the same
DN4-JH3b recombination identified previously, but this sequence was joined in frame to a vH4 segment (vH4c). Two
additional rearrangements were obtained from the first re-
Presentation
VHSb
FmP
I
Fig 5. Detection of leukemic cells from patient 3 bearing a clonal
IgH gene rearrangement with a N-region clone-specific probe. DNA
from tumor at presentation or relapse, 10-fold dilutions of tumor
DNA in normal bone marrow (BM) or normal B M DNA were amplified
with VHfamily-specific and JHconsensus oligonucleotides. PCR products were applied t o a nylon membrane using a slot-blot apparatus
and hybridized with a N-region specific probe. The rearrangements
from which the probes are derived are indicated on the left of each
panel (see Fig 4 for sequence of the probes). A common rearrangement involving the VH4a segment is detected in both presentation
and relapse samples, although the number of cells bearing this rearrangement is about 5 t o 10 times more abundant in the former than
the latter. A specific product for the VH2a, VH4b, and the VH5b rearrangements is only detected in the sample from which this rearrangement was originally amplified.
Relapse 2
mw
'?
>
>
>
i.
8
. y
*
>
-------- *
*-
G
m
nosed with a null ALL. Six IgH rearranged bands, in addition
to a germline band, were identified in Southern blot autoradiograms of a Hind111 digest of DNA from his presentation
bone marrow. In a first relapse, I year later, a germline band
and two strongly hybridizing rearranged bands were present,
one of which had already been detected in the previous
sample. Furthermore, three faint rearranged bands could also
be seen. In the second relapse, 8 months later, the bone
marrow displayed only two IgH rearranged bands, identical
to the two intensity hybridizing bands seen on the first reThe 'gK genes remained in the germline 'Onlapse
figuration throughout the disease, while one IgA rearranged
band appeared at the same position among all three samples.
-
Relapse 1
-4
--------*
>
?.
>
Fig 6. Southern blot analysis of bone marrow samples from patient 4. DNA was digested with Hidl11 and the blot was hybridized
with a JH probe. G shows the position of the germline band and
arrows indicate clonally rearranged bands.
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
DAW ET AL
616
lapse marrow. One involved a vH3 segment (VH3f) joined
directly to the J Hsegment;
~
the other, a v H 1segment (VHld)
joined in frame to the DLR2 segment and the JH5bsegment.
In the second relapse marrow, only one rearrangement could
be amplified despite the detection of two IgH rearrangements
by Southem blot analysis of this specimen. As mentioned
in the discussion of patient 2, this could be due to a partial
DJH recombination or to a mismatch between primers and
target sequences. Hybridizations to PCR products derived
from the DNA of the various specimens in this case were
performed using an N-oligonucleotide probe specific for the
junctional sequence each rearrangement. As expected, the
N-oligonucleotides hybridized to product from amplified
DNA and DNA dilutions of the appropriate specimens. An
Presentation
G+6R
N-oligonucleotide for the V& rearrangement yields a
strong hybridization signal in both relapse samples, but B
negative signal in the presentation marrow (data not shown).
Therefore, the common IgH rearranged band seen on the
Southern blot analysis in all three samples seems to correspond to a nonamplifiable sequence.
In this patient with a complex pattern of antigen receptor
gene rearrangements, four IgH rearrangements were clearly
related and came from a common allele bearing a DN4-JH3b
recombination. Although it could be possible that multiple
VH replacements occurred, it seems more likely that these
rearrangements arose in the progeny of a cell containing a
partial DJH joining and that several distinct VH segments
were subsequently rearranged in different subclones de-
Relapse 1
1
f--)
G+5R
G
Relapse 2
c2-)
G
G
G+lR
1
c--)
3
G+5R
2R
G+lR
G+5R
G+4R
G+lR
G
G
1
c--)
&
&
G+2R
G+2R
G+lR
G
VH3e
JH4
.....................
TACTGTtcttccccccctACTACTTTGACTA
VH6
DN4
JH3b
------------------
TACTGTGCAAGAGgggATAGCAGCTCGTCCggATGCTTTTGATAT
lllllllllllllllllllllllllllll
llllllllllllllllllllllllll
....................
I/III/II1lII/0IIIIII/ll/
....................
VH5c
TACTGTGCGAGAccgtATAGCAGCTCGTCCggATGCTTTTGATAT
------------------
VH2b
TACTGTGCacgggccttgagGCAGCTCGTCCggATGCTTTTGATAT
Relapses
1 & 2
vH4c
TACTGTGCGAGCggtggggttaggaCAGCTCGTCCggATGCTTTTGATAT
DLR2
VHld
....................
JH5b
TACTGTGCaacagcactccttaataGTAGTGGTccctACkCC
( +)
Fig 7. Patient 4 Summary of
immunogonotype and IgH gene
rearrangement junctional sequences.
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
ORIGIN AND EVOLUTION OF BALL
scended from that cell. The presence of other totally unrelated sequences suggests that the original leukemic clone
had other antigen receptor genes in the germline configuration. This inference is consistent with the intense germline
band in the Southern blot autoradiogram of DNA from the
presentation marrow. Therefore, evolution of the leukemic
clone in this patient may have occurred by a series of steps:
(1) a committed B-cell precursor with germline IgH genes
gave rise to different lines with distinct rearrangements, as
seen the the presentation specimen; ( 2 ) one of these lines,
in which a DJH recombination had occurred, gave rise to
subclones represented by the two relapse specimens in which
VH to DJH rearrangement was completed; and (3) a cell
having fully rearranged both IgH alleles at first relapse underwent additional rearrangement of the second Igh allele
and TCR y genes before clonally expanding to produce the
second relapse.
DISCUSSION
In this study we have analyzed antigen receptor genes to
characterize the origins and evolution of ALL. This work
relied heavily on PCR amplification to isolate and sequence
IgH gene rearrangements. Previous studies have used single
consensus oligonucleotides to 3’ VH and JH sequences and
have shown IgH rearrangements could be amplified in 60%
to 90% of
In our hands, this method had failed to
amplify multiple rearrangements in oligoclonal tumors; in
general, only one or sometimes two bands were obtained.
This could be due to the preferential amplification of sequences having better matches with the consensus VHprimer
or to more efficient amplification of rearrangements that are
more abundant within the sample. In view of these problems,
we used VH-family specific primers. This approach enabled
us to amplify many more IgH rearrangements. However,
the number of sequences obtained by PCR did not strictly
correspond with the number of bands detected on Southern
blot analyses. Some sequences might not be amplified because they were partial DJH recombinations or were partially
mismatched with the primers. Conversely, some sequences
amplified were not seen on Southern blot analyses. This
reflects the greater sensitivity of PCR techniques over Southern blot analysis for detection of less abundant but still clonal
rearrangements, as discussed by Deane et al.43
The interpretation that an amplified IgH rearrangement
was tumor-related and did not come from background lymphocytes was supported by the following considerations: (1)
all sequences were found in multiple M13 clones obtained
from independent amplifications; ( 2 ) amplification of polyclonal cells (bone marrow or blood from normal individuals)
was always performed in parallel and generated a smear of
PCR products assayed by polyacrylamide gel electrophoresis, while clonal populations showed one or sometimes two
discrete bands (data not shown); and (3) slot blot hybridization of these PCR products with clone-specific N-region oligonucleotide probes showed that the specific sequences
could be detected only in the relevant samples and not in
control normal bone marrows. Furthermore, rough quantitation indicated that the amplified sequence was present in
multiple copies within the tumor sample and did not arise
617
Table 2. Summary of IgH Gene Rearrangement Modifications in
the Evolution of Precursor-B ALL
Loss of IgH
Rearrangement
Patient
Patient
Patient
Patient
3
+
+
+
4
f
1
2
VH to DJ.
De Novo VHDJH
VH
Replacement Recombination Rearrangement
+
+
or
+
+
+
+
+
from the amplification of a single background lymphocyte.
It should be noted, however, that quantitation by this assay
is only approximate and that the extent of dilution at which
clonal IgH rearrangements were still detected might not exactly reflect the true abundance of cells with these rearrangements, since many factors, such as the degree of homology
with the VHprimers, may affect the efficiency of amplification.
The four patients presented in this study had a pattern of
IgH gene rearrangements that differed between diagnosis
and relapse (Table 2). In three of these patients (patients 2
to 4), a common IgH rearrangement was conserved, indicating a straightforward clonal relationship. This was further
supported by the presence of a common rearrangement for
some other antigen receptor gene, and in one case by the
persistence of a chromosomal translocation t( 1;19) (patient
2). In one patient (patient l), there was no definite conserved
IgH rearrangement, but the presence of an identical DJH
joining, as well as the conserved configurations of TCR y
and 6 genes and the persistence of the Ph’ chromosome leads
to a similar conclusion.
Three different mechanisms were responsible for shifting
patterns of Ig gene rearrangement observed over time among
the cases in our study (Table 2).
(1) Loss of rearrangements. Loss of IgH gene rearrangements was seen in all four patients. Loss of TCR gene
rearrangements was also detected for three of them: TCR y
gene rearrangements for one patient (patient 4),TCR 6 gene
rearrangements for two patients (patients 2, 3, and 4), and
TCR p gene rearrangements for one patient (patient 2 ) . Loss
of Ig and TCR gene rearrangements was probably related,
at least in some instances, to the loss of the clonal lines
bearing these sequences. The disappearance of subclones
between presentation and relapse may have been related to
their elimination by chemotherapy. On the other hand, certain cells containing a subset of rearrangements observed
earlier in the case may have become resistant to chemotherapy andor acquired mutations leading to a selective growth
advantage and overwhelming of competing subclones. A
comparable phenomenon took place during the establishment in culture of the in vitro cell line developed for patient
2.
( 2 ) ModiJcation of apreexisting rearrangement. Modification of a preexisting rearrangement by a VHreplacement
clearly occurred in one case (patient 3) and possibly in another (patient 1). Rearrangements of distinct VH genes to
a common DJH joining could also account for IgH gene
modification in one case (patient 4) and possibly in one other
(patient 1). Therefore, in all but one patient (patient 2 ) , clonal
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
DAW ET AL
618
evolution involved, at least for some IgH rearrangements,
modification of a preexisting rearrangement by VH replacement or VH to DJH joining, as reported by other investigator~.--~~
Two other mechanisms responsible for modification of
preexisting rearrangements have also been described: somatic mutations and “open and shut” events. Somatic mutations occur frequently during evolution of some mature Bcell tumors such as follicular lymphoma,I4 similar to the
process by which postrearrangement diversification of Ig
gene sequences takes place during the normal immune response. Recent studies have also shown that somatic mutations may also occur at low frequency in precursor B leukemic cells- and can modify IgH rearrangements between
diagnostic and relap~e.~’
In any event, somatic mutation is
probably not responsible for the IgH gene alterations detected by Southern blot in our patients, as the sequences of
PCR products amplified from the tumors show far greater
differences than can be explained by somatic mutation. Junctional sequences can be changed by an “open and shut”
mechanism.” In this process, new N-region nucleotides are
generated after the rearrangement has reopened and closed
following previous deletion and addition of nucleotides. This
mechanism has been observed in artificial recombination
substrates introduced into murine early B cells” and more
recently in human ALL.@However, these types of modification were not seen in our study.
( 3 ) De novo rearrangements. De novo rearrangements
were observed for three patients (patients 2 to 4). The fourth
patient (patient 1) had three different VHDJH recombinations
at presentation. Therefore in all cases, more than two totally
unrelated VHDJH sequences appeared during the evolution
of these ALL, formally consistent with oligoclonality of the
tumors.
Several explanations could account for this apparent oligoclonality in ALL. (1) Extra chromosome 14 may be present in a monoclonal tumor, as has been shown to occur in
some ALL.‘ Cytogenetic data were available for two of our
patients and did not show any evidence of additional copies
of chromosome 14. Nevertheless, we cannot rule out this
possibility for the two other patients. (2) Oligoclonality
might result from independent transformation of separate
lymphoid cells. Indeed, there is a group of tumors, particularly among those arising in immunosuppressed patients, in
which independent lines of tumor cells are present, as confirmed by study of polymorphism in Epstein-Barr viral genome commonly found in these tumors.” Therefore, true
multiclonality cannot be excluded a priori. (3) Transformation of a single progenitor lymphoid cell with unrearranged
Ig genes, followed by the emergence of subclones with independent diverse IgH rearrangements, has been proposed to
occur in some lymphocytic
Considered in aggregate, our data best fits this overall mechanism for apparent
oligoclonality of the ALL cases in our study. Thus, our
analysis strongly supports the hypothesis of a transformed
lymphocyte progenitor cell that undergoes distinct IgH rearrangements within different subclones. These subclones can
further differentiate by completing VH to DJH rearrangements, VH replacement, and also IgL rearrangements, the
Table 3. IgH Gene RearrangementSequences as Targets
for Minimal Residual Disease Analysis
Loss
Patient 1
Patient 2
Patient 3
Patient 4
Partial (D-N-JHl
Conservation
+
+
+
+
+
+
Total (V,-N-D-N-J,)
Conservation
t
latter being observed for three patients (patients I , 2, and
4). Maturation of the leukemic cells in the form of Ig gene
rearrangements appearing over the course of the disease
would seem to reflect the physiologic differentiation of their
benign conterpart during normal B-cell de~elopment.~”
However, rearrangements of TCR ?, 6, and p genes acquired
over time may or may not be a property shared by normal
developing B cells.
Our results confirm those of some previous studies of
oligoclonal B-lineage ALL.’,’ In contrast, Wasserman et al”
have recently suggested that evolution of the immunogenotype in B-lineage ALL is most often related to VH replacement or VHto DJH recombination, ie, modification of a preexisting rearrangement rather than de novo rearrangement. This
discrepancy might be due to the usage of different primers
for DNA amplification, as we found that VHfamily-specific
primers could amplify more diverse IgH rearrangements
within oligoclonal tumors than the single VH consensus
primer.
Other investigators have reported that only a single pattern
of ongoing rearrangement (ie, VHreplacement or VHto DJH
recombination or complete de novo rearrangement) occurred
in an individual patient.45These results suggested that the
type of ongoing rearrangement was restricted depending on
the development stage and IgH status of the precursor cells
at the time of malignant transformation. Our data differ in
showing that distinct ongoing IgH rearrangements processes
can coexist within the same tumor.
Our study suggests that despite an appearance of biclonality or oligoclonality, all the ALL analyzed here were monoclonal tumors and represented the leukemic transformation
of lymphoid progenitors that yield progeny cells in which
rearrangements of Ig genes continued well after primary
transformation events had already taken place. A similar
situation has been found in mice, where pre-B-cell tumors
induced by Abelson murine leukemia virus could undergo
clonal evolution and exhibit multiple IgH and L rearrangements. ‘ 7 5 2 Furthermore, continuing rearrangement of antigen
receptor genes is not a phenomenon confined to leukemic
cells in vivo; rearrangement of genes may also proceed in
vitro (as in the cell line SUP-B27). All of these examples
illustrate that transformation does not preclude further maturation and that the concept of tumor cells “frozen” at a
specific stage of differentiation has limited relevance. Thus,
despite the fact that acute leukemias consist of proliferating
cells that fail to fully mature beyond certain stages of differentiation, this stage does not represent the stage at which
transformation occurred. Transformation of a lymphocyte
progenitor cell followed by clonal evolution has been well
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
ORIGIN AND EVOLUTION OF B-ALL
619
application of these gene rearrangements as markers for the
documented in some cases of ALL,53of acute myelogenous
detection of minimal residual disease.
leukemia," and in chronic myelogenous leukemia." Some
bilineage leukemia might also originate from transformation
ACKNOWLEDGMENT
of a pluripotent progenitor
Therefore, partial maturation of transformed cells appears to be a common feature of
We thank S. Schaflhausen for help in preparation of the manuleukemia, although the reasons why cells cannot continue to
script.
develop beyond certain immature stages is unclear.
Two of our patients (patients 1 and 2) had a pre-B ALL,
REFERENCES
one had a common ALL (patient 3), and one had a null ALL
1. Arnold A, Cossman J, Bakhshi A, Jaffe E, Waldmann TA,
(patient 4). Therefore, clonal evolution is not restricted to
Korsmeyer S: Immunoglobulin-gene rearrangements as unique
clonal markers in human lymphoid neoplasms. N Engl J Med
a specific subtype of B-lineage ALL. Myeloid-associated
309:1593, 1983
antigens such as CD13, CD15, and CD33 were also detected
2. Cleary ML, Choa J, Warnke R, Sklar J: Immunoglobulin gene
on the leukemic cells of two of our patients (patients 1 and
rearrangement
as a diagnostic criterion of B cell lymphoma. hoc
4). These findings add further evidence for the lymphocytic
Natl Acad Sci USA 81:593, 1984
progenitor cell origin of these leukemias and suggest
3. Dow LW, Martin P, Moohr J, Greenberg M, Macdougall LG,
involvement of a pluripotential stem cell in some instances.
Najfield V, Fialkow PJ: Evidence for clonal development of childPrevious studies have shown preferential usage of certain
hood acute lymphoblastic leukemia. Blood 66:902, 1985
VH,DH, and JH gene segments in human ALL. Though the
4. Yunis JJ: The chromosomal basis of human neoplasia. Science
number of IgH rearrangements sequenced in our study was
221:227, 1983
small, similar findings were made. VH gene segments from
5. Mayumi M, Jubagawa H, Omura GA, Gathings WE, Kearney
JF, Cooper MD: Studies on the clonal origin of human B cell leukefamilies vH4 (15.8%), vH5 (10.5%), and VH6(10.5%)were
mia using monoclonal anti-idiotype antibodies. J Immunol 129:904,
overrepresented compared with the expected frequencies
1982
based on the size of each family (respectively, lo%, 1%,
6. Kitchingman GR, Mirro J, Stass S, Rovigatti U, Melvin SL,
and < 1 %), as previously reported.57The two most frequently
Williams
DL, Raimondi SC, Murphy SB: Biologic and prognostic
used D segments belonged to the DLR and DXP families
significance of presence of more than two p heavy-chain genes in
(30% each), as already noted by Kiyoi et al.47 Finally, the
childhood acute lymphoblastic leukemia of B precursor cell origin.
JH4 and JH6 genes were the most frequently found (38.5%
Blood 67:698, 1986
each) as previously shown by several investigator~.4~.~~ 7. Bird J, Galili N, Link M, Stites D, Sklar J: Continuing rearTherefore, ALLs with unstable IgH gene rearrangements do
rangement but absence of somatic hypermutation in immunoglobulin
not display any specific type of repertoire and cannot be
genes of human B cell precursor leukemia. J Exp Med 168:229,
distinguished from other ALLs based on their use of certain
1988
8. Katz F, Ball L, Gibbons B, Chessells J: The use of DNA probes
gene segments.
to monitor minimal residual disease in childhood acute lymphoblasDetection of minimal residual disease in B-ALL by PCR
tic leukaemia. Br J Haematol 73:173, 1989
using clone-specific probes for the N-region of the IgH genes
9. Carter M, Neale GAM, Kitchingman GR: Characterization of
has become increasingly widely used in recent years.4042.58.59
immunoglobulin heavy chain genes from an acute lymphocytic leuThis approach to monitoring of disease after therapy assumes
kemia with four rearrangements. Leukemia 5:668, 1991
stability of the rearrangement over the course of the disease.
10. Beishuizen A, H2hlen K, Hagemeijer A, Verhoeven M-AJ,
In our study, all cases had lost one or more IgH rearrangeHooijkaas H, Adriaansen HJ, Wolvers-Tetter0 ILM, van Wering ER,
ments, and more importantly the associated N-regions, bevan Dongen JJM: Multiple rearranged immunoglobulin genes in
tween presentation and relapse. However, one IgH rearrangechildhood acute lymphoblastic leukemia of precursor B-cell origin.
ment was at least partially conserved among samples at
Leukemia 5:657, 1991
1 1. Raghavachar A, Thiel E, Bartram CR: Analyses of phenotype
various stages during the disease (Table 3). Because it is
and genotype in acute lymphoblastic leukemias at first presentation
impossible to predict which rearrangement may disappear
and in relapse. Blood 70:1079, 1987
and which may persist, the most accurate assay would re12. Wright JJ, Poplack DG, Bakhshi A, Reaman G, Cole D, Jenquire use of a specific probe for each rearrangement. While
sen JP, Korsmeyer SJ: Gene rearrangements as markers of clonal
this strategy may be impractical, the DJH junction seems
variation and minimal residual disease in acute lymphoblastic leukeoverall more often conserved than the VHD junction, and it
mia. J Clin Oncol 5:735, 1987
would seem reasonable to choose this region as a target for
13. Bunin NJ, Raimondi SC, Mirro Jr. J, Behm FG, Goorha R,
minimal residual disease analysis. TCR y , which is freKitchingman GR: Alterations in immunoglobulin or T cell receptor
quently rearranged in B-ALL, has been suggested as a more
gene rearrangement at relapse: Involvement of 1lq23 and changes
in immunophenotype. Leukemia 4:727, 1990
stable marker." Indeed, three of the cases in our study had
14. Cleary ML, Meeker TC, Levy S, Lee E, Trela M, Sklar J,
TCRy rearrangements that were apparently not modified
Levy
R: Clustering of extensive somatic mutations in the variable
over time. Nevertheless, one case (patient 4) had lost some
region of an immunoglobulin heavy chain gene from a human B
of the TCRy rearrangements. Similarly, Tycko et a16' have
cell lymphoma. Cell 44:97, 1986
reported a case with totally different TCRy rearrangements
15. Kleinfield R, Hardy RR, Tarlinton D, Dangl J, Herzenberg
at diagnosis and relapse, while IgH rearrangements remained
LA, Weigert M: Recombination between an expressed immunoglobidentical. Taken together, these data indicate the instability
ulin heavy-chain gene and a germline variable gene segment in a
of antigen receptor gene rearrangement in some cases of
Ly 1' B-cell lymphoma. Nature 322:843, 1986
ALL represents a potentially important complication in the
16. Reth M, Gehmann P, Petrac E, P. W: A novel VH to VHDJH
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
620
joining mechanism in heavy-chain-negative (null) pre-B cells results
in heavy-chain production. Nature 322:840, 1986
17. Reth MG, Jacson S, Alt FW: VHDJH formation and DJH replacement during pre-B differentiation: Non-random usage of gene
segments. EMBO J 5:2131, 1986
18. Lewis SM, Hesse JE, Mizuuchi K, Gellert M: Novel strand
exchanges in V(D)J recombination. Cell 55: 1099, 1988
19. Sklar J, Cleary ML, Thielemans K, Gralow J, Wamke R,
Levy R: Biclonal B-cell lymphoma. N Engl J Med 331:20, 1984
20. van Dongen JJM, Hooijkaas H, Michiels JJ, Grosveld G, de
Klein A, van der Kwast TH, Prins MEF, Abels J, Hagemeijer A:
Richter’s syndrome with different immunoglobulin light chains and
different heavy chain gene rearrangements. Blood 64:571, 1984
21. Downing JR, Grossi CE, Smedberg CT, Burrows PD: Diffuse
large cell lymphoma in patient with hairy cell leukemia: Immunoglobulin gene analysis reveals separate clonal origins. Blood 67:739,
1986
22. Cleary ML, Nalesnick MA, Shearer WT, Sklar J: Clonal analysis of transplant-associated lymphoproliferations based on the structure of the genomic termini of the Epstein-Barr virus. Blood 72:349,
1988
23. Smith SD, Morgan R, Link MR, McFall P, Hecht F: Cytogenetic and immunophenotypic analysis of cell lines established from
patients with T cell leukemidlymphoma. Blood 67:650, 1986
24. Weiss LE, Hu E, Wood GS, Moulds C, Cleary ML, Wamke
R, Sklar J: Clonal rearrangements of T-cell receptor genes in mycosis
fungoides and dermatopathic lymphadenopathy. N Engl J Med
315:539, 1985
25. Lefranc MP, Rabbits T: Two tandemly organized human
genes encoding the T-cell gamma constant region sequences show
multiple rearrangements in different T-cell types. Nature 3 1 6:464,
1985
26. Hata S, Brenner MB, Krangel MS: Identification of putative
human T cell receptor 6 complementary DNA clones. Science
238:678, 1987
27. Kwock S, Higushi R: Avoiding false positive with PCR. Nature 339:237, 1989
28. Sarkar G, Sommer SS: Shedding light on PCR contamination.
Nature 343:27, 1990
29. Kodaira M, Kinashi T, Umemura I, Matsuda F, Noma T, Ono
Y, Honjo T: Organization and evolution of variable region genes of
the human immunoglobulin heavy chain. J Mol Biol 190:529, 1986
30. Lee KH, Matsuda F, Kinashi T, Kodaira M, Honjo T: A novel
family of variable region genes of the human immunoglobulin heavy
chain. J Mol Biol 195:761, 1987
31. Schroeder HWJ, Hillson JL, Perlmutter RM: Early restriction
of the human antibody repertoire. Science 238:791, 1987
32. Humphries CG, Shen A, Kuziel WA, Capra JD, Blattner FR,
Tucker PW: A new human immunoglobulin VHfamily preferentially
rearranged in immature B-cell tumours. Nature 331:446, 1988
33. Berman JE, Mellis SJ, Pollock R, Smith CL, Suh H, Heinke
B, Kowal C, Surti U, Chess L, Cantor CR, Alt FW: Content and
organization of the human Ig VH locus: Definition of three new VH
families and linkage to the Ig CHlocus. EMBO J 7:727, 1988
34. Sanz I, Kelly P, Williams C, Scholl S, Tucker P, Capra JD:
The smaller human VHgene families display remarkably little polymorphism. EMBO J 8:3741, 1989
35. van Dijk KW, Mortari F, Kirkam PM, Schroeder Jr. HW,
Milner ECB: The human immunoglobulin VH7 gene family consists
of a small, polymorphic group of six to eight gene segments dispersed throughout the VH locus. Eur J Immunol 23:832, 1993
36. Ravetch JV, Sibenlist U, Korsmeyer S, Waldmann T, Leder
P: Structure of the human immunoglobulin p locus: Characterization
of embryonic and rearranged J and D genes. Cell 27:583, 1981
37. Yamada M, Wasserman R, Reichard BA, Shane S, Caton AJ,
DAVl ET AL
Rovera G: Preferential utilization of specific immunoglobulin heavy
chain diversity and joining segments in adult human peripheral blood
lymphocytes. J Exp Med 173:395, 1991
38. Naumovski L, Morgan R, Hecht F, Link MP, Glader BE,
Smith SD: Philadelphia chromosome-positive acute lymphoblastic
leukemia cell lines without classical breakpoint cluster region rearrangement. Cancer Res 48:2876, 1988
39. Covey LR, Ferrier P, Alt FW:VH to VHDJH rearrangement
is mediated by the internal V, heptamer. Int Immunol 2:579, 1990
40. Yamada M, Hudson S, Toumay 0, Bittenbender S, Shane
SS, Lange B, Tsujimoto Y, Caton AJ, Rovera G: Detection of minimal disease in hematopoietic malignancies of the B-cell lineage by
using third-complementarity-determining region (CDR-111)-specific
probes. Proc Natl Acad Sci USA 86:5123, 1989
41. Brisco MJ, Tan LW, Orsbom AM, Morley AA: Development
of a highly sensitive assay, based on the polymerase chain reaction,
for rare B-lymphocyte clones in a polyclonal population. Br J
Haematol 75: 163, 1990
42. Jonsson OG, Kitchens RL, Scott FC, Smith RG: Detection
of minimal residual disease in acute lymphoblastic leukemia using
immunoglobulin hypervariable region specific oligonucleotide
probes. Blood 76:2072, 1990
43. Deane M, Pappas H, Norton JD: Immunoglobulin heavy chain
gene fingerprinting reveals widespread oligoclonality in B-lineage
acute lymphoblastic leukaemia. Leukemia 5:832, 1991
44. Kitchingman GR: Immunoglobulin heavy chain gene VH-D
junctional diversity at diagnosis in patients with acute lymphoblastic
leukemia. Blood 81:775, 1993
45. Steenbergen EJ, Verhagen OJHM, van Leeuwen EF, von dem
Borne AEG, van der Schoot CE: Distinct ongoing Ig heavy chain
rearrangement processes in childhood B-precursor acute lymphoblastic leukemia. Blood 82:581, 1993
46. Steward CG, Goulden NJ, Katz F, Baines D, Martin PG, Langlands K, Potter MN, Chessels JM, Oakhill A: A polymerase chain
reaction study of the stability of Ig heavy-chain and T-cell receptor b
gene rearrangements between presentation and relapse of childhood
B-lineage acute lymphoblastic leukemia. Blood 83:1355, 1994
47. Kiyoi H, Naoe T, Horibe K, Ohno R: Characterization of the
immunoglobulin heavy chain complementarity determining region
(CDR)-111sequences from human B cell precursor acute lymphoblastic leukemia cells. J Clin Invest 89:739, 1992
48. Cleary ML, Galili N, Trela M, Levy R, Sklar J: Single cell
origin of bigenotypic and biphenotypic B-cell proliferations in human follicular lymphomas. J Exp Med 167:582, 1988
49. Potter MN, Steward CG, Oakhill A: Clonal instability in early
B-lineage acute lymphoblastic leukemia. Blood 80:1630, 1992 (letter)
50. Rolink A, Melchers F: Molecular and cellular origins of B
lymphocyte diversity. Cell 66:1081, 1991
51. Wasserman R, Yamada M, Ito Y, Finger LR, Reichard BA,
Shane S, Lange B, Rovera G: VH gene rearrangement events can
modify the immunoglobulin heavy chain during progression of Blineage acute lymphoblastic leukemia. Blood 79:223, 1992
52. Whitlock CA, Ziegler SF, Treiman LJ, Stafford JI, Witte ON:
Differentiationof cloned populations of immature B cells after transformation with Abelson murine leukemia virus. Cell 3 2 9 3 , 1983
53. Tachibana N, Raimondi SC, Lauer SJ, Satain P, Dow LW:
Evidence for a multipotential stem cell disease in some childhood
Philadelphia chromosome-positive acute lymphoblastic leukemia.
Blood 70:1458, 1987
54. Fialkow PH, Singer JW, Raskind WH, Adamson JW, Jacobson RJ, Bemstien ID, Dow LW, Najfeld V, Veith R: Clonal development, stem-cell differentiation, and clinical remissions in acute nonlymphocytic leukemia. N Engl J Med 317:468, 1987
55. Fialkow PJ, Jacobson RJ, Papayannopoulou T: Chronic my-
From www.bloodjournal.org by guest on November 10, 2014. For personal use only.
ORIGIN AND EVOLUTION OF BALL
elocytic leukemia: Clonal origin in a stem cell common to the granulocyte, erythrocyte, platelet and monccyte/macrophage. Am J Med
63:125, 1977
56. Gale RP, Ben Hassat I: Hybrid acute leukemia. Br J Haematol
65261, 1987
57. Deane M, Norton JD: Immunoglobulin heavy chain variable
region family usage is independent of tumor cell phenotype in human
B lineage leukemias. Eur J Immunol 20:2209, 1990
58. Yamada M, Wasserman R, Lange B, Reichaxd BA, Womer
RB, Rovera G: Minimal residual disease in childhood B-lineage
lymphoblastic leukemia. Persistence of leukemic cells during the
first 18 months of treatment. N Engl J Med 323:448, 1990
59. Billadeau D, Blackstadt M, Greipp P, Kyle RA, Oken MM,
62 1
Kay N, Van Ness B: Analysis of B-lymphoid malignancies using
allele-specific polymerase chain reaction: A technique for sequential
quantitation of residual disease. Blood 78:3021, 1991
60.Tycko B, Palmer JD, Link MP, Smith SD, Sklar J: Polymerase
chain reaction amplification of rearranged antigen receptor genes
using junction-specific oligonucleotides: Possible application for detection of minimal residual disease in acute lymphoblastic leukemia.
Cancer Cells 7:47, 1989
61. Tycko B, Ritz J, Sallan S, Sklar J: Changing antigen receptor
gene rearrangements in a case of early pre-B cell leukemia: Evidence
for a tumor progenitor cell with stem cell features and implications
for monitoring residual disease. Blood 79:481, 1992