1. No category

From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
1995 85: 981-988
Genomic structure, chromosomal localization, and conserved
alternative splice forms of thrombopoietin
AL Gurney, WJ Kuang, MH Xie, BE Malloy, DL Eaton and FJ de Sauvage
Updated information and services can be found at:
http://www.bloodjournal.org/content/85/4/981.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
Genomic Structure, Chromosomal Localization, and Conserved Alternative
Splice Forms of Thrombopoietin
By Austin L. Gurney, Wun-Jing Kuang, Ming-Hong Xie, Beth E. Malloy, Dan L. Eaton, and Frederic J. de Sauvage
Thrombopoietin (TPO), the ligand for c-mpl, is a novel cytokine comprising an amino terminal domain with homology
to erythropoietin and a glycosylated carboxyl terminal domain that does not bear overall homology to other known
proteins. We report the cloning of cDNAs encoding
the porcine and murine TPO and the characterization of the human
TPO gene. The cDNA for an additional splice form (TPO-2)
with a four-amino-acid deletion within the erythropoietinlike domain has been isolated and is conserved between
humans, pigs, and mice. Species comparison of TPO shows
that the amino terminal erythropoietin-like domain is highly
conserved. while the carboxyl terminal domain is less conserved. Recombinant murineTPO and human TPO are each
able to activate both the murine andhuman c-mplrecepton,
indicating an absenceof strict speciesspecificity.Human
TPO is encodedby a single gene consisting six
of exons and
located on chromosome 3q27-28.
0 1995 by The American Societyof Hematology.
T
MATERIALSANDMETHODS
HE ONCOGENE c-mpl is a member of the hematopoietic receptor family. It was identified as the cellular
Isolation of the porcine TPO gene and cDNA. Genomic clones
homolog of the viral oncogene v-mpl present in the rnyeloof the porcine TPO gene were isolated by screening a pig genomic
proliferative leukemia virus (MPLV).’ The receptor bears
library (EMBL3; Clontech Inc, Palo Alto, CA) with pR45, a previously described oligonucleotide probe? This probe was derived
homology to other members of the hematopoietin receptor
from a polymerase chain reaction (PCR) product obtained using
superfamily, including the erythropoietin (epo) and interleuamino acid sequence information from purified porcine “PO. Clones
kin-3 (IL-3) receptors.* Expression of c-mpl mRNA in mice
(2 X lo6) were lifted on nitrocellulose filters and hybridized overis restricted to fetal liver, spleen, and bone marrow, sugnight to pR45 in 35% formamide, 5X SSC, 50 mmol/L Na PO, pH
gesting a role in hematopoie~is.~
Further analysis of human
6.5, 0.1% sodium pyrophosphate, lox Denhardt’s solution, 0.1%
adult tissues has shown that c-mpl mRNA is present in hemasodium dodecyl sulfate (SDS), 0.1 mg/mL salmon sperm DNA and
topoietic progenitors, megakaryocytes, and platelets, but not
washed for 45 minutes in 0.3X SSC, 0.1% SDS at 42°C. Several
other hematopoietic cell lineage^.^ Antisense oligodeoxyclones were isolated, and the exon corresponding to the amino acid
nucleotides of c-mpl selectively inhibited in vitro rnegakarysequence obtained from the purified porcine TPO was sequenced.
ocytic colony formation without affecting the growth of eryThe porcine TPO cDNA was obtained by rapid amplification of
cDNA ends (RACE) PCR with the following modifications. Polyadethroid or granulomacrophage colonies! Collectively, these
nylated mRNA was isolated from the kidney of an aplastic pig, as
observations suggest that c-mpl and its putative ligand might
previously de~cribed.’~
Single-strand cDNA wasfirst prepared by
function in regulating megakaryocytopoiesis.
reverse transcription using BamdT: 5’GACTCGAGGATCCATCRecently, the c-mpl ligand thrombopoietin (TPO) was pu3‘. An initial round of PCR amplificarified and cloned from several specie^.^" The human TPO
tion (28 cycles of 60 seconds at 95”C, 60 seconds at 58°C. and 90
cDNA sequence predicts a mature protein of 332 amino acids
seconds at 72°C) was conducted using the TPO-specific primer F-l
that can be divided into two domains: an amino terminal half
(5’GCTAGCTCTAGAAATTGCTCCTCGTGGTCATGCTI’CT 3’)
of 153 amino acids with homology to erythropoietin and a
and the shortened antisense primer BAMAD (5’ GACTCGAGGATunique C-terminal domain of 179 amino acids containing
CCATCG 3’) in a 100-pL reaction (50 mmoVLKCI, 1.5 mmoVL
multiple potential N-linked glycosylation sites. Both recomMgCI, 10 mmol/L Tris pH 8.0, 0.2 mmoVL dNTPs, with 0.05 U/
binant full-length human TPO and a truncated form conpL Amplitaq polymerase, Perkin Elmer Inc, Nonvalk, CT). The
PCR product was digested with Cia I and ligated to 0.1 pg of
sisting of the epo-like domain (TPOIs3)stimulated [3H]-thyBluescript SK- vector (Stratagene Inc, La Jolla, CA), previously
midine incorporation in murine Ba/F3 cells transfected with
digested
with Cia I and Kpn I. After incubation for 2 hours at room
human c-mpl, demonstrating that the epo-like domain alone
temperature, one fourth of the ligation mixture was subjected to a
is sufficient for activation of c-mpl.’ Recombinant human
second round of PCR (22 cycles as described above) using the
TPO stimulated human megakaryocytopoiesis in vitro alone
internal TPO-specific primer F-2 (5’ GCTAGCTCTAGAAGCor in the presence of other exogenously added early-acting
CCGGCTCCTCCTGCCTG 3’) andthe T3 primer (5’ CGAAAhematopoietic growth factor^.^,^.^ Also, TPO stimulated
’ITAACCCTCACTAAAG 3’). The resulting PCR product was diplatelet production in mice and dramatically increased the
gested with Xba I and Cia I and subcloned into Bluescript SK-.
number of megakaryocytes in the spleen and bone marrow,
Several clones from independent PCRs were sequenced. The DNA
indicating that TPO regulates thrombopoiesis in v ~ v o . ~ , ~ , ’ , ~
In this report, we compare TPO from three species: pig,
mouse, and human. A variant form of TPO (TPO-2) is identiFrom the Departments of Molecular Biology and Cardiovascular
fied in each species. TPO-2 has a four-amino-acid deletion
Research, Genentech, Inc, San Francisco, CA.
Submitted September 13, 1994; accepted October 17, 1994.
within the epo homology domain and was unable to stimulate
Address reprint requests to Frederic J. de Sauvage, PhD, DepartBaJF3-mpl proliferation. Characterization of the human gene
ment of Molecular Biology, Genentech, Inc, 460 Pt. San Bruno Blvd,
indicates that the two splice forms of TPO arise from the
San Francisco, CA 94080.
use of alternative splice acceptor sites within exon 6. The
The publication costs of this article were defrayed in part by page
human gene is localized to chromosome 3q27-28, a region
charge payment. This article must therefore be hereby marked
of the long arm of chromosome 3, previously associated
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
with elevated platelet counts and increased bone marrow
indicate this fact.
megakaryocytes in patients with acute nonlymphocytic leu0 1995 by The American Society of Hematology.
kemia.””’
oo06-4971/95/85~-0018$3.00/0
Blood, Vol 85, No 4 (February 15), 1995: pp 981-988
981
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
GURNEY ET AL
982
sequence of the first seven deduced amino acids of the mature TPO
were derived from sequence contained within the PCR primers.
lsolnrion ofmwine TPO (.DNA. A XgtlO cDNA library prepared
from murine liver mRNA (Clontech. Inc) was screened with a prohe
encompassing the entire coding region of the human TPO cDNA.
Clones ( 2 X 10") were screened essentially as described above with
a probe labeled by the random oligonucleotide method using ["PIlabeled d-adenosine triphosphate (dATP) and
("PI-labeled d-cytidinetriphosphate(dCTP).cDNAfrom
purified phageweresuhclonedintotheEcoRIsiteofRluescriptSK-(Stratagene).and
the DNA sequence of both strands was determined on an AB1373
automated sequencer.
fsolrrrion ofthe l w t w n TPO g e n ~ . Human genomic DNA clones
of the TPO gene were isolated from a human genomic library
in
XGem12. as previously described.'
Norfhern blot ctncrlwis. A northern blot of poly (A)' RNA from
perlane)waspurchasedfromClontech
variousmousetissues (2
andhybridizedovernightwitharandomoligonucleotide-labeled
probe containing the entire murine TPO coding region. The
blot was
washed at 42°C in 0.2X SSC/O.I% SDS and exposed ovcrnight to
X-omat film (Kodak. Rochester. NY).
Expression qf recomhincrttr TP0. Expression vectors for murine
andhuman TPO wereprepared as previouslydescribed.'Clones
encoding TPO and TPO-2 were subcloned into pRKStkneo. a mam-
malianexprcssionvectorcontainingthecytomegalovirus(CMV)
promoter and thc SV40 polyadenylation signal. The resulting expressionvectors(PRKtkneo-mTPO.PRKtkneo-mTPO-2.PRKtkneohTPO. and PRKtkneo-hTPO-2) were transiently transfected into 293
cells (a human embryonic kidney cell line) using the calcium phosphate method. After transient transfection. medium was conditioned
for 3 days. Cells were maintained in high glucose Dulhecco's modified Eagle'smedium (DMEM) supplemented with 10% fetal calf
serum (FCS).
Prol;ferdorl msny.s. Stable cell lines expressing human or mupreviously.'
rine c-mpl in RalF3 cells were prepared as described
R d F 3 cellsweremaintained in RPM1 1 6 4 0 mediasupplemented
with 1 0 % FCS and 5% conditioned media from WEHI-3R cells as
a source of [L-3. For proliferation assays. cells were cultured in the
absence of IL-3 for I h hours in RPMI. 10% FCS. Cells were washed
twice with PBS and plated in 96-well plates at 25.000 cells per well
of conditioned medium from
in the presence of various dilutions
293 cells transiently transfected with expressionvectorsencoding
human or murine TPO. Each concentration was tested in duplicate.
After 22 hours at 37°C. I pCi of ['HI-thymidine was added per well,
and incubation was continued for an additional 6 hours. Incorporation of['HI-thymidinewasmeasuredwitha
Top CountCounter
(Packard Instruments).
ff,f,nrtnoprec.ipif[rfio~~
qf TPO. Expressionvectorsencodinghu-
m-TPO
0
0
m-TPO
0
0
-
Fig 1. Comparison of the predicted mature TPO from mouse, pig, and human. The predicted amino acid sequenceof murine, porcine, and
for optimal alignment
human TPO (m-TPO, p-TPO, and h-TPO, respectively) are aligned. Identical amino acids are boxed, and gaps introduced
are indicated by dashes. Potential
N-linked glycosylation sites are indicated by the shaded boxes. The conserved cysteine residues
indicated are
by dots. The conserved dibasic amino acid
motif that presents a potential protease cleavage point
is underlined. The four-amino-acid deletion
found to occur in each species (TPO-2) is outlined by a box.
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
TPO
AND SPLICE FORMS
amino-acid deletion corresponding to amino acid residues
112 to 115, was also identified.
Murine TPO cDNAs were isolated from a mouse liver
cDNA library using probes derived from the human TPO
cDNA.5 The longest murine TPO cDNA clone contained an
open reading frame of 1,068 bp flanked by 137 bases of 5'
and 244 basesof3'untranslated
sequence followed by a
poly(A) tail. The presumedinitiationcodonatnucleotide
position 138 to 140 lies within a sequence context favorable
for eukaryotic translationinitiation."
The openreading
frame encodes a predicted protein of 356 amino acids. The
amino terminus is highly hydrophobic and likely to function
as a secretory signal, which is presumably cleaved between
amino acids 21 and 22 to generate a mature protein of 335
9.5
7.5
4.4
983
a
2.4
1.35
S
Q)
L
Fig 2. Northern blot analysis ofmurine TPO expression in selected
tissues. Northern blot analysis of poly (AI' mRNA (2 p g per lane1
isolated from the indicated tissues was hybridized overnight t o a
probe containing sequence from the entire murine TPO cDNA. The
position of molecular weight markers is indicated.
man TPO, TPO-2, or the control plasmid pRK were transiently
transfected into 293 cells by the calcium phosphate method. After
12 hours,the medium was replaced with serum-free DMEM containing 0.05 mCi/mL [3sS]-methionine and cysteine. Medium was
conditioned for 4 hours. TPO was immunoprecipitated withrabbit
polyclonal antisera raised against human TPO, and subjected to SDSPAGE under reducing conditions.
Chromosomal localization. Mapping of a TPO cDNAprobe (1.8
kb) was performed by fluorescence in situ hybridi~ation'~
to normal
human lymphocyte chromosomes counterstained with propidium iodide and 4',6-diamidino-2-phenylindole(DAPI). Biotinylated probes
were detected with avidin fluorescein isothiocyanate (FITC). Images
of metaphasepreparations were capturedbya
thermoelectrically
cooled charged coupled camera (Photometrics, Tucson, AZ). Separate images of DAPI banded chromosome^'^ and the hybridization
signals obtained using the TPO probe were acquiredand merged
using image analysis software.
RESULTS
Porcine TPO cDNA was isolated by PCR using an oligonucleotide dT primer and two specific primers based on the
genomic sequence of the exon of the
TPO gene encoding
the N-terminal amino acid sequence obtained from purified
mature TPO.' The cDNA was synthesized from various tissues of aplastic pigs and amplified using a modified RACEPCR technique. A product of 1,342 bp was obtained from
kidneymRNAand
subcloned. Several clones weresequenced and found to encode the complete mature pig TPO.
The cDNA encodes a 332-amino-acid mature protein (Fig
1). TPO-2, a second form, encoding a protein with a four-
p.
-
0
o
L L n
I
l- l-
W
"
200 -
97 68 -
29 -
A?
1
J
18Fig 3. Determinationof relative expression levelsof TPO and TPO2. The relative abundance of TPO and TPO-2 in themedium of transiently transfected 293 cells was determined immunoprecipitation
by
of TPO with anti-TPO antisera from ['SSl-labeled conditioned medium. The 293cells weretransiently transfected with expression vectors for human TPO or TPO-2 or a control pRK5 vector. Immunoprecipitated proteins were separated by SDS-PAGE on a4% to 12%gel
and visualizedby autoradiography. Lane 1 lprebleedl shows acontrol
immunoprecipitation with preimmune seraof conditioned media
containing human TPO. The mobility of molecular weight standards
is indicated.
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
GURNEY ET AL
984
20000
h
E
0
h
B
mTPO
mTPO-2
hTPO
0
pRK
0
B
mTPO
hTPO-2
hTPO
D
pRK
o
v
C
.
P
c
10000
0
e
8
70000
IB
50000
1
40000
30000
4
20000
j
I
\ \
\ a
l
10000
Fig 4. Effect of recombinant TPO on BalF3-mpl cell proliferation.
(A) The ability of conditioned medium from 293 cells transiently
transfected with expression vectorsfor murine TPO or TPO-2, human
TPO, or control vector pRK to induce proliferation in Ba/F3 cells expressing murine c-mpl was measured by extent of incorporation of
['HI-thymidine into DNA. The average of duplicate determinations
is shown. The experiment was repeated several times with similar
results. (B) The ability of conditioned medium from 293 cells transiently transfected with expression vectors for human TPO or TPO2, murine TPO, or control vector pRK to induce proliferation in Ba/
F3 cells expressing human c-mpl was measured as in panel A.
amino acids (Fig 1). Several clones (four of eight) had a
deletion of 12 bp corresponding to amino acid residues I I2
to 115 and are, therefore, analogous to the porcine TPO-2
described above. We also identified several human TPO-2
cDNA clones with a 12-bp deletion atthe same position.
Northern blot analysis of mRNA from various mouse tissues
A
exon 1
indicates the presence of a single 1.8-kb transcript in liver
and kidney (Fig 2). This result is consistent with the expression pattern observed for human TPO. Expression was found
to be higher in the liver than in the kidney.
Comparison of the predicted amino acid sequences of the
mature TPO from human, mouse, and pig (Fig 1 ) showed a
72% sequence identity betweenmouse and human, 68%
identity between mouse and pig, and 73% identity between
human and pig. The homology is substantially greater in the
amino terminal half of TPO (epo homologous domain). This
domain is 8 1 % to 85% identical between any two species,
whereas the carboxyl half is only 57% to 67% identical. A
conserved dibasic amino acid motif that could represent a
protease cleavage site is present at the carboxyl end of the
epo homology domain (positions 153 and 154) in all three
species. A second dibasic site presentatposition 245 and
246 in the human sequence is not conserved in the murine
and porcine sequences. The three TPO sequences contain
four conserved cysteines located within the amino terminal
half of the protein. There are seven potential N-linked glycosylation sites within murine TPO andsixwithin
porcine
TPO. Four glycosylation sites are conserved among murine,
porcine, and human TPO. All the potential N-linked glycosylation sites are located in the C-terminal half of theprotein.
To determine whether the two splice forms of TPO are
expressed, cells transfected with expression vectors encoding
human TPO or TPO-2 wereincubated in the presence of
[3sS]-labeledmethionine and cysteine. and conditioned medium was immunoprecipitated with a polyclonal antibody
directed against human TPO. A strong, broad band of 68 to
85 kD was detected in medium from cells transfected with
pRKtkneo-hTPO, whereas only a weak but detectable band
from
cells transfected with
was observed in medium
pRKtkneo-hTPO-2 (Fig 3). Quantitation of relative expression by phosphoimager analysis indicated a 500-fold greater
expression of TPO thanTPO-2. To determine if the two
splice forms of TPO encode functional c-mpl ligands, expression vectors containing the entire coding sequence of murine
and human TPO and TPO-2 were transfected into 293 cells,
and conditioned medium from transfected cells was assayed
for ability to stimulate proliferation of BaE3 cells stably
transfected with either murine or human c-mpl. Conditioned
medium from cells transfected with murine or human TPO
cDNA stimulated ['HI-thymidine incorporation in BaE3
cells expressing either receptor (Fig 4) butnotin parental
B e 3 cells (data not shown), indicating that the cloned mu-
exon 5
exon 2 exon 3 exon 4
exon 6
-3'
5"
I
I
ATG
STOP
1 kb
Fig. 5A
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
TPO GENE AND SPLICE FORMS
985
43
leuHillS0rAr LBU
2401 ~~-tg(Mctcccaacattatcccctttatccgcgtaact~taagacacc=~tactcccawaag~cacc~t=actt~ctcta
2501 actCCttgaCCCMtgaCtattCttcccatattgtccccacctactgatcacactctctgacMgaattattcttcacaatacaprccgcatttaaaa9c
2601 tctcgtctag~atagtactcatg~wactagcctgcttatta~ctaccataqctctctctatttcagctcccttctccccccaccaatctttttcaa
27;!
~&~$sPp~~~~~l
<Exon4>
O
a
lu
g
a
a
a
g
c
2801 c a t c c c t a a c c t t g g c t t c c c t ~ a g t c c t g t c t t c a g t t t c c c a ~ t q ~ t t c c c a t g g a t t C t c c a ~ c n t t c t t g a g ~ t t t t M M ~ t ~ t ~ c a c c t t c a
Rg 5. Sequence of the human
TPO gene. (A) A schematic of human TPO gene is shown. Exons
are boxed. The hatched box indicates 5' and 3' untransiated sequence as identified in human TPO
cDNA. The dark shaded boxes
indicate the secretion signal. Thelight
shadedboxes indicate sequence
encoding the qm-like
domain, and
the white box indicates sequence
encoding the carboxyl domain.
The four amino acids involved in
the alternative splice variants of
TPO are located at the 5' junction
of exon 6 and are indicated by a
black box. The ATG initiation codon and the stop codon are indicated. (B) The sequence of the TPO
gene is shown in the 5' to 3' orientation. Exon coding sequence is
denoted in upper case letters, and
intron sequence is denoted in
lower case letters. GTlAG splice
donor and acceptor sites are indicated in bold characters. The ded u d amino acid sequence
of TPO
is shown above the DNA s e
quence. The putative signal peptide is underlined.Cysteineresiduesare indicated by dots.The
sequence involved in the alternative splice variants of TPO is double-undarllned. A single base dfferenca, indicated by vertical
arrowheed, between the gene sequence and the reported cDNA sequence is due to a polymorphism
and doea not alter the amino acid
sequence. The ATG translation
start and the in-frame stop codon
areboxed.The
polyadenylation
site is noted.
2901 gCttggccacCECtaaCCCaatcta~attC.CCt.tgatgatagc~gt~atangatgatwct~gc~~tccaatatgtgaatagatttgMgctgaac
3001 accatgaaaagCtggagagaaatc~tcatggccatprctttgacctatt~ttcagtCttcttMattg~atgaagMqcMga~catatgtcat
3101 c c a c s g a t g a c a c ~ a a g c t ~ ~ ~ g t a c c a c t a a a ~ t a ~ ~ ~ ~ a a g a c t g a a t c a a 9 ~ t t c M ~ t c a c t g a a a g a c t a q g t c a ~ ~ a a c a a ~ 9 a a a c a a c
3201 agagatataaacttctacatgtgg~~~ctca~cctgtaatcccagcacttt~a9gccgaggcnggcagatcacctga9~9cawa9ttt9ag
3301 agcagcCCtwCCaacatg~a~accccgtctctact~~g~atacaaaattagcc9~c~t9gtagtgcatgcctgtaatccca9ct~~twaawCtg
3401 ..gcaggagaatcccttg~a==caggaggtmaggttgt~~gagctgagatcatgcc~atgcactccagcctgwtgaca~g~gc~aa~~ccgtctca
3501 a a a a g a a a a a s a a a t t c t a c a t g t g t a ~ ~ t t ~ ~ t g a g t a a a g t c c t a t t = = ~ g = t t t c ~ g g c c a c a a t g c c c t g = t t = = ~ t = ~ t t t a a ~ c t c t w c c c t
3601 ~ g C ~ C t t c C t a C g a a ~ ~ g g ~ t c t g a g a g a a t t ~ a ~ t t g ~ ~ c ~ ~ ~ a ~ c t t a c c a t g t a ~ ~ ~ t t ~ ~ t g ~ a g c t g c t a t t c t t ~ ~ ~ g ~ t ~ g t
3701 g t t t g a t g t t t a g C . t C c c c a t t g t g g ~ ~ ~ t g c t = g t a c a g a ~ c t = t ~ t t = = g ~ g t g g a c t a c a c t t a ~ ~ t ~ t ~ ~ t m = = t g a a c ~ c c ~ a c a t c c c c c t
3801 ga.g.catatgct..ttt*tt~ag~ggaccat~tt~~~=t*~=~t~~ctagaaagcaqcagc=tgaacagaaagagactaga~gc~tgttttatggg
3901 caatagttt~~aaaactaa~~tctatcct~aagaaccctagcgtcccttctt~~ttca~actgagtcag~aaga~g~c~gttcctat~gtcccttc
4001 tagtcCtttcttttc~tCCtt~tgatcattatggtag~gt~t~~t~~~t~~atttagtttatttattatt~ttatttgaga~agtctcactctatccc
4101 CCaggctggagtgcagtggcatgatctc~~~t~a~tgcaacctcagcctcccwattcMgcgattctcctgcctcagtctcccaa~agct~attac
4201 aggtgcccaCCaccatgcccagct~tttttgtatttttggtagagat~gwtttcaccat9tt~ccaggctgatcttgaactcctgacctca~tgat
4301 ccacctgcctcagcctcccaaagt~tgggatt~~a~cgtgagccactgcacccagccttcattcagtttaaaaatcaaatgatcctaaggttttgc~g
4401 C a g ~ a a g a g t a ~ ~ t t t ~ C ~ g c ~ ~ t ~ a ~ ~ c a a g a ~ t a a a a g c t g t ~ ~ ~ ~ ~ g ~ a g a t t t c n g c a a ~ t a a g a a a ~ a a ~ ~ g ~ t c t t c t c
4501 agtgt~~gaccamctggactagaw~cac~~gtttttgaagcagawctqatgaccagctgtcwg~gactgtgaaggaattcctgccctg~tgw
4601 accttggtCCtgtccagttctcagcctgtatg~ttcactctgct~ctactcctaa~Ctccccacccgcttttagtgtgccctttgawcagtqcgctt
tExon5,
77
GluOluThrL SAlaGlUAS I l e L e e ~ e t A l a A l a A r1 GlnLeu
4701 ctctcttccatctctttctcm-m&m&m
loocu;crc&LAAm
4901 *gtcaagggatctgtagaa.ctgttcttttctgactcagtcccactagaagacctgagggaaga~gw=tcttcca~agctcaagggcagaagagctg
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
986
GURNEY ET AL
Fig 6. Chromosomal localization of human TPO gene. Human metaphase cells were hybridized to a biotinylated 1.8-kb cDNA probe for
TPO gene and counterstainedwith propidium iodide and DAPI. Hybridizationwas detected with avidin-FITC. The signal on chromosome 3q2728 is indicated by an arrow.
rineandhuman TPO cDNAs encode functional c-mplligands. However, comparison of the titration curves obtained
in parallel experiments using conditioned medium containing human TPO versus murine TPO shows a degree of
species specificity. Conditioned medium from cells
transfected with expression vectors encoding either murine
or human TPO-2 did not induce a proliferative response in
BalF3-mpl cells. The ability to detect TPO activity at dilutions greater than the 500-fold difference in expression between TPO and TPO-2 suggests that the limited amount of
TPO-2 that is expressed is not active.
Analysis of both human and murine genomic DNA by
Southern blot indicates that the gene for TPO is present in
a single copy (data not shown). The human TPO gene was
isolated in two overlapping lambda clones spanning 35 kb.
Two overlapping fragments (BumH1 and EcoRI) containing
the entire TPO gene were subcloned and sequenced. The
structure of the human gene is composed of six exons within
7 kb of genomic DNA (Fig 5). The boundaries of all exon/
intron junctions are consistent with the consensus motif established for mammalian genes." Exon 1 and exon 2contain
5' untranslated sequence and the initial four amino acids of
the signal peptide. The remainder of the secretory signal and
the first 26 amino acids of the mature proteir. are encoded
within exon 3. The entire carboxyl domain and 3' untranslated, as well as approximately 50 amino acids of the epo-
like domain, are encoded within exon 6. The four amino
acids involved in the deletion observed within TPO-2 are
encoded at the 5' end of exon 6.
The chromosomal location of the human W O gene was
determine by fluorescent in situ hybridization (FISH). The
full-length human TPO cDNA was biotinylated and hybridized to the metaphase spreads of a normal individual. The
1.8-kb cDNA gave a clear FISH signal that mapped to 3q2728 (Fig 6). The regional assignment was determined by the
analysis of 20-well spread metaphases. Adetectable hybridization signal at 3q27-28 was noted in 45 of 100 chromatid
targets.
DISCUSSION
The cDNA of porcine TPO and murine TPO encode putative mature proteinsof 332 amino acids and335 amino acids,
with molecular weights of 35.1kD and 37.8 kD, respectively.
TPO contains two distinct domains roughly corresponding
to
the amino- and carboxyl-terminal halves of the protein. The
amino-terminal 153 amino acids of TPO bear homology to
epo (23% identity,50% similarity, including conservative substitutions with humanTPO)? Three of the four cysteines present within epo, including the two found to be essential for
epo activity," are conserved in TPO, suggesting that this domain may assume afour a-helix bundle configuration similar
to other members of the hematopoietic cytokine family.Ig
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
TPO GENEAND
987
SPLICE FORMS
The carboxyl domain of TPO is not present in epo or any
of the other hematopoietic growth factors identified to date.
Interestingly, all the potential N-linked glycosylation sites
of TPO from each species are confined to the carboxyl domain of the protein. Immunoprecipitation of human TPO
shows a protein of 68 to 85 kD, suggesting that this domain
is highly glycosylated as the predicted molecular weight for
the nonglycosylated molecule is 38 kD. The function of this
highly glycosylated domain remains tobe determined. Glycosylation of the carboxyl domain ofTPO may provide a longer
half-life for TPO in vivo, as in the case for epo.2au
TPO does not display strict species specificity. Porcine
TPO was purified based on its ability to bind to recombinant
human mpl-IgG fusion protein and stimulate [3H]-thymidine
incorporation in B e 3 cells expressing human c-mpl, and
recombinant human TPO induced platelet production in a
mouse rebound thrombocytosis assay.5Here we demonstrate
that recombinant murine TPO and human TPO are able to
induce a proliferative response in B e 3 cells transfected
with either murine c-mpl or human c-mpl. The lack of strict
species specificity is consistent with the high degree of conservation within the amino-terminal domain. There is, however, a degree of species specificity. Human and murine
TPO expression in the conditioned medium of transiently
transfected 293 cells was similar as estimated by immunoprecipitation using polyclonal antisera raised against the human TPO epo-like domain (data not shown). This suggests
that the human ligand is less active than the murine ligand
on the murine receptor.
Two alternative splice forms of TPO have been identified.
They differ by the presence (TPO) or absence (TPO-2) of a
four-amino-acid insertion at positions 112 to 115. The insertioddeletion occurs within the amino terminal epo-like domain at an identical position within murine, porcine, and
human TPO. The four amino acids are encoded at the 5’
junction of exon 6 in the human gene. The TPO-2 mRNA
form may result from the use of a favorable alternative splice
acceptor sequence. To date, no splice variants of epo have
been identified. However, granulocyte colony-stimulating
factor (G-CSF) does possess two alternative splice variants
that differ by a three-amino-acid deletiodinsertion. Both of
these forms are active, although the larger splice form is
reported to have a lower specific a~tivity.’~
In contrast, we
have not observed any agonist activity with TPO-2, the
shorter form. Immunoprecipitation experiments suggest that
TPO-2 is very poorly secreted. A similar deletion has been
introduced into epo to study epo function.%This five-aminoacid deletion of residues 122 to 126 alters a loop between
alpha helixes C and D in the proposed structure of epo and
results in an inhibition of secretion. By comparison with
epo, the four-amino-acid deletion within TPO-2 would also
be predicted to occur within this loop. Thus, the significance
of TPO-2 is uncertain. As mRNA encoding the shorter TPO
form appears to be abundant in each of the three species
examined to date, this may represent a novel mechanism
for cytokine regulation. The level of TPO expression could
potentially be modulated by altering the proportion of TPO
mRNA that is spliced to encode each of the forms.
The human TPO gene was mapped by FISH to chromo-
some 3q27-28. Although no other cytokine gene has been
localized to this locus, it will be of interest to examine this
region, as there are several examples in the human and the
mouse genome of close tandem linkage of genes encoding
growth factors or growth factor receptors. The first to be
described was a region of chromosome 5 containing the
genes coding for granulocyte-macrophage (GM)-CSF, IL-3,
IL-4, and IL-5.25.26
The mapping of the TPO gene is particularly interesting, as structural abnormalities of the long arm
of chromosome 3 have been associated with increased bone
marrow megakaryocytes and elevated platelet counts in patients with acute nonlymphocytic leukemia.1°-12 Although
frequently found in combination with other chromosomal
defects, the most common abnormality in these patients is
an inversion of 3q between bands 21 and 26.2, suggesting
that a gene critical to the regulation of thrombopoiesis may
be located at one end of the inverted segment. In fact, elevated levels of TPO activity have been measured in the
serum of patients with 3q inversion.” Characterization of
the TPO gene and of its promoter in these patients will help
to determine if aberrant production of TPO is responsible
for this leukemia.
ACKNOWLEDGMENT
We thank Audrey Goddard, Jeremy Squire, and Barbara Beatty
for assistance in FISH analysis; Greg Bennett for antibodies; the
Genentech DNA synthesis group; L. Tamayo and A. Bruce for preparing figures; Sunita Sohrabji for help in preparing the manuscript;
and Michel Aguet for criticism of the manuscript.
REFERENCES
1. Souyri M, Vigon I, Penciolelli .I-F, Heard J-M, Tambourin P,
Wendling F: A putative truncated cytokine receptor gene transduced
by the myeloproliferative leukemia virus immortalizes hematopoietic
progenitors. Cell 63:1137, 1990
2. Vigon I, Mornon J-P, Cocault L, Mitjavila M-T, Tambourin
P, Gisselbrecht S, Souyri M: Molecular cloning and characterization
of mpl, the human homolog of the v-mpl oncogene: Identification
of a member of the hematopoietic growth factor receptor superfamily. Proc Natl Acad Sci USA 89:5640, 1992
3. Vigon I, Florindo C, Fichelson S, Guenet J-L, Mattei M-G,
Souyri M, Cosman D, Gisslebrecht S: Characterization of the murine
mpl proto-oncogene, a member of the hematopoietic cytokine receptor family: Molecular cloning, chromosomal location and evidence
for a function in cell growth. Oncogene 8:2607, 1993
4. Methia N, Louache F, Vainchecker W, Wendling F: Oligodeoxynucleotides antisense to the proto-oncogene c-mpl specifi82:1395,
callyinhibit
in vitromegakaryocytopoiesis.Blood
1993
5. de Sauvage FJ, Hass PE, Spencer SD, Malloy BE, Gumey AL,
Spencer SA, Darbonne WC, Henzel WJ, Wong SC, Kuang W-J,Oles
KJ, Hultgren B, Solberg LA, Goeddel DV, Eaton DL: Stimulation of
megakaryocytopoiesis and thrombopoiesis by the c-mpl ligand. Nature 369533. 1994
6. Lok S, Kaushansky K, Holly RD, Kuljper JL, Lofton-Day CE,
Oort PJ, Grant FJ, Helpel MD, Burkhead SK, Kramer JM, Bell LA,
Sprecher CA, Blumberg H, Johnson R, Prunkard D, Ching AFT,
Mathewes SL, Bailey MC, Forstrom J W , Buddle MM, Osbom SG,
Evans SJ, Sheppard PO, Presnell SR, O’Hara PJ, Hagen FS, Roth
GJ, Foster DC: Cloning and expression of murine thrombopoietin
cDNA and stimulation of platelet production in vivo. Nature
369:565, 1994
From www.bloodjournal.org by guest on November 14, 2014. For personal use only.
988
7. Bartley TD, Bogenberger J, Hunt P, Li YS, Lu HS, Martin F,
Chang MS, Samal B, Nichol JL, Swift S, Johnson MJ, Hsu R-Y,
Parker VP, Suggs S, Skrine JD, Merewether LA, Clogston C, Hsu
E, Hokom MM, Hornkohl A, Choi E, Pangelinan M, Sun Y, Mar
V, McNich J, Simonet L, Jacobsen F, Xie C, Shutter J, Chute H,
Basu R, Selander L, Trollinger D, Sieu L, Padilla D, Trail G , Elliot
G , Izumi R, Covey T, Crouse J, Garcia A, Xu W, Del Castillo D,
Biron J, Cole S, Hu MCT, Pacifici R, Ponting I, Saris C, Wen D,
Yung YP,Lin H, Bosselman RA: Identification and cloning of a
megakaryocyte growth and development factor that is a ligand for
the cytokine receptor mpl. Cell 77:1117, 1994
8. Kaushansky K, Lok S, Holly RD, Broudy VC, Lin N, Bailey
MC, Forstrom J W , Buddle MM, Oort PJ, Hagen FS, Roth GJ, Papayannopoulou T, Foster DC: Promotion of megakaryocyte progenitor
expansion and differentiation by the c-mpl ligand thrombopoietin.
Nature 369568, 1994
9. Wendling F, Marakskovsky E, Debili N, Florindo C, Teepe
M, Titeux M, Methia N, Breton-Gorius J, Cosman D, Vainchenker
W: c-mpl ligand is a humoral regulator of megakaryocytopoiesis.
Nature 369:571, 1994
10. Rowley JD, Potter D: Chromosomal banding patterns in acute
nonlymphocytic leukemia. Blood 47:705, 1976
11. Pintado T, Ferro MT, San Ramon C, Mayayo M, Larana JG:
Clinical correlations of the 3q21;q26 cytogenic anomaly. Cancer
55:535, 1985
12. Jenkins R, Tefferi A, Solberg L, Dewald G: Acute leukemia
with abnormal thrombopoiesis and inversions of chromosome 3.
Cancer Genet Cytogenet 39:167, 1989
13. Badley JE, Bishop GA, St. John T, Frelinger JA: A simple,
rapid method for the purification of poly A + RNA. Biotechniques
6:114, 1988
14. Lichter P, Tang C-JC, Call K, Hermanson G , Evans GA,
Housman D, Ward DC: High resolution mapping of human chromosome 11 by in situ hybridization with cosmid clones. Science 24754,
1990
15. Heng H, Tsui L: Modes of DPI banding and simultaneous in
situ hybridization. Chromosoma 102325, 1993
GURNEY ET AL
16. Kozak M: The scanning model for translation: An update. J
Cell Biol 108:229, 1989
17. Shapiro MB, Senpathy P: RNA splice junctions of different
classes of eukaryotes: Sequence statistics and functional implications
by gene expression. Nucleic Acids Res 15:7155, 1987
18. Wang FF,Kung CKH, Goldwasser E: Some chemical properties of human erythropoietin. Endocrinology 116:2286, 1985
19. Bazan JF: Haemopoietic receptors and helical cytokines. Immunol Today 11:350, 1990
20. Takeuchi M, Takasaki S, Shimada M, Kobata A: Role of
sugar chains in the invitro biological activity of human erythropoietin produced in recombinant Chinese hamster ovary cells. J Biol
Chem 265:12127, 1990
21. Narhi LO, Arakawa T, Aoki KH, Elmore R, Rohde MF,
Boone T, Strickland TW: The effect of carbohydrate on the structure
and stability of erythropoietin. J Biol Chem 266:23022, 1991
22. Spivak JL, Hogans BB: The in vivo metabolism of recombinant human erythropoietin in the rat. Blood 73:90, 1989
23. Nagata S, Tsuchiya M, Asano S, Yamamoto 0, Hirata Y,
Kubota N, Oheda M, Nomura H, Yamazaki T: The chromosomal
gene structure and two mRNAs for human granulocyte colony-stimulating factor. EMBO J 3:575, 1986
24. Boissel J-P, Lee W-R, Presnell SR, Cohen FE, Bunn H F
Erythropoietin structure-function relationships. J Biol Chem
268:15983, 1993
25. Barlow DP, Bucan M, Lehrach H, Hogan BLM, Gough NM:
Close genetic and physical linkage between the murine hematopoietic growth factor genes GM-CSF and multi-CSF (IL-3). EMBO J
6:617, 1987
26.van Leeuwen BH, Martinson ME, Webb GC, Young IG:
Molecular organization of the cytokine gene cluster, involving the
human IL-3, L-4, IL-5, and GM-CSF genes, on human chromosome
5. Blood 73:1142, 1989
27. Pinto M, King M, Goss G , Bezwoda W, Fernandes-Costa F,
Mendelow B, McDonald T, Dowdle E, Bemstein R: Acute megakaryoblastic leukemia with 3q inversion and elevated thrombopoietin. Br J Haematol 61:687, 1985