1. health and fitness
2. disease
3. cancer

Topical treatment with Xiaozheng Zhitong Paste (XZP)
alleviates prevents bone destruction and alleviates bone
cancer pain in a rat model of prostate cancer-induced bone
pain
model
by
modulating
the
targeting
RANKL/RANK/OPG signaling pathway
Yanju Bao1# *, Yebo Gao1,2# , Maobo Du3 , Wei Hou1# , Liping Yang3 Yang4 , Xiangying
Kong4 Kong3 , Maobo Du4 , Honggang Zheng1 , Weidong Li 1 , and Baojin Hua1 *
1 Department of Oncology, Guang’anmen Hospital, China Academy of Chinese
Medical Sciences, Beixiange 5, Xicheng District, Beijing 100053, China
2 Beijing University of Chinese Medicine, Beijing North Third Ring Road No. 11,
Chaoyang District, Beijing 100029, P. R. China
3 Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences,
Nanxiaojie,Dongzhimen District, Beijing, 100700, China.
3 4 Department of Nephrology, Guang’anmen Hospital, China Academy of Chinese
Medical Sciences, Beixiange 5, Xicheng District, Beijing 100053, China
4 Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences,
Nanxiaojie,Dongzhimen District, Beijing, 100700, China.
# They made equal contributions to this work.
*Correspondence should be addressed to:
Baojin Hua, M.D. Department of Oncology, Guang‟anmen Hospital, China Academy
of Chinese Medical Sciences, Beixiange 5, Xicheng District, Beijing 100053, China.
Phone: 010-88001221, Email: [email protected]
1
Yanju Bao, M.D. Department of Oncology, Guang‟anmen Hospital, China Academy
of Chinese Medical Sciences, Beixiange 5, Xicheng District, Beijing 100053, China
Phone: 010-88001192, Email: [email protected]
Abstract
The analgesic herbal analgesic Xiaozheng Zhitong Paste (XZP) and its
modifications have beenare used in traditional Chinese medicine to manage cancer
pain, but their analgesic . However, its mechanisms are still unknown. This study was
aimed at To investigatinge the effects and mechanisms of XZP on bone cancer pain in
a rat model of breast prostate cancer- induced bone pain rat model. Wistar rats were
inoculated with vehicle or prostate cancer PC-3 into the tibia bone and treated
topically with inert paste, XZP at 15.75, 31.5 or 63g/kg twice per day for 21 days. A
breast cancer- induced bone pain rat model was established by inoculating prostate
cancer PC-3 cells directly into the left tibia of the hind paw of Wistar rats (150–180 g).
Hank‟s solution inoculation plus topical administration of inert paste was used as
control group. The rats with prostate cancer PC-3 inoculation were randomly and
treated topically with the inert paste as the placebo, the XZP at 15.75 g/kg (as the Low
dose), 31.5 g/kg (Medium dose) or 63 g/kg (High dose). PC-3 cell inoculation plus
topical administration of inert paste was used as placebo group. Cancer-bearing rats
were treated twice a day with external XZP at a dosage of 15.75g/kg/day (Low dose),
31.5g/kg/day (Medium dose) and 63g/kg/day (High dose).
Their bone structural
damages nociceptive behaviors, bone osteoclast and osteoblast activity and the levels
of bone OPG, RANL, RNAK, PTHrP, IGF-1, M-CSF, IL-8 and TNF-α were examined
by radiology, histology, RT-PCR and Western blot assays. In comparison with that in
the placebo group, significantly reduced numbers of invaded cancer cells, decreased
levels of bone damages and mechanical threshold and paw withdrawal latency were
detected in the XZP-treated rats (p<0.05). Furthermore, significantly lower levels of
serum Bone destruction was examined by X-ray and Micro-CT imaging. Behavioral
tests such as mechanical threshold and paw withdrawal latency (PWL) were carried
out. Osteoclastic activities were determined and tartrate- resistant acid phosphatase 5b
(Tracp5b), carboxyterminal pyridinoline cross- linked type I collagen telopeptides
2
(ICTP), procollagen type I amino-terminal propeptide (PINP) and bone alkaline
phosphatase (BALP) concentrations were detected with ELISA after treatment.
mRNA and Western blot of NF-κB (RANK) ligand (RANKL) /RANK/
osteoprotegerin(OPG) signaling pathway were also determined. XZP treatment
significantly restored prostate cancer- induced bone pain compared to inert paste. XZP
treatment also significantly prevented bone destruction, by decreasing the level of
blood
serum
tartrate-
resistant
acid
phosphatase
5b
(Tracp5bTRACP5b),
carboxyterminal pyridinoline cross-linked telopeptides of type I collagen (ICTP),
procollagen type I amino-terminal propeptide (PINP) and bone alkaline phosphatase
(BALP) in the XZP-treated rats (p<0.05), accompanied significantly less levels o f
bone osteoblast and osteoclast activity (p<0.05). Moreover, significantly increased
levels of bone OPG, but significantly decreased levels of RANL, RNAK, PTHrP, IGF1, M-CSF, IL-8 and TNF-α were detected in the XZP-treated rats (p<0.05 for all).,
inhibitting osteoclast activities and reducing the expression of receptor activator of
RANKL/RANK/OPG, increasing the expression of OPG, at both mRNA and protein
levels. The present study shows that Therefore, XZP treatment significantly mitigated
the cancer- induced bone damages and bone osteoclast and osteoblast activity and
alleviates alleviated prostate cancer- induced bone pain by modulating the
RANKL/RANK/OPG pathway and bone cancer-related inflammation in rats.
preventing the bone destruction and inhibit osteoclast formation by regulating
RANKL/RANK/OPG signal pathway.
Keywords: Xiaozheng Zhitong Paste (XZP); traditional Chinese medicine; bone
cancer pain; RANKL /RANK/ OPG signaling pathway.
1. Introduction
Cancer pain is reported to be experienced by 75%–90% of late stage metastatic
cancer patients [1]. Cancer-induced bone pain (CIBP) is Tthe most common type of
cancer pain and is cancer- induced bone pain (CIBP), which is often debilitating and
intractable, and is a major factor in reduced affecting the quality of life and functional
status in cancer patients [2 ,3]. Bone cancer pain is not does not exist as a single entity,
but is instead a combination of background and breakthrough pain, which is.
Breakthrough pain has been defined as “a transitory exacerbation of pain experienced
3
by the patient who has relatively stable and adequately controlled baseline pain ” [2].
Hence, control of bone cancer pain will be of great significance in management of
patients with bone cancer.
Currently, there are many therapeutic options available for the alleviation of bone
cancer pain and they include external beam radiotherapy, opioid analgesia,
nonsteroidal anti- inflammatory drugs (NSAIDs), bisphosphonates, local surgery, and
anaesthetic techniques [4]. However, each of these treatment options is accompanied
by limitations of less effectiveness and severe effects [4-9]. Hence, control of bone
cancer pain will be of great significance in management of patients with bone cancer.
Radiotherapy is the gold standard treatment of bone cancer pain, but with less
effectiveness. Studies have shown that complete pain relief is only achieved in about
25 % of patients [11], whereas 50 % of patients will achieve 50% pain relief [13].
Opioids are an effective therapy for background pain in bone cancer pain. Howeve r,
their usefulness in breakthrough pain is unclear. Furthermore, titration of opioids to
doses that control episodes of breakthrough pain may result in unacceptable opioid
side-effects, such as nausea, constipation, urinary retention, dizziness, and dysphoria
[12]. Although NSAIDs are regarded by clinicians as an important drug in the
treatment of bone cancer pain, they are limited by their adverse effects, such as gastric
ulceration, hepatic dysfunction, myocardial infarction, and renal failure [15-17].
Bisphosphonates are used to reduce skeletal morbidity from bone metastases and for
analgesia in bone cancer pain. Bisphosphonates act on osteoclasts both directly by
inhibiting attachment, differentiation, and survival and also indirectly through effects
on osteoblasts [14]. Although their efficacy in preventing skeletal events has been
shown in some tumor groups, in the management of acute and chronic bone cancer
pain, their role is less clear [18].
According to Traditional Chinese Medicine (TCM) theory, cancer pain is the
result of tumor-caused stagnation and insufficiency of Qi and blood flow in the body.
Thus the main therapeutic goals are to promote Qi and activate blood by softening
hard lumps, dispelling nodes, and warming the channels [10].In aOur previous study,
we has demonstrated that an herbal analgesic paste, Xiaozheng Zhitong Paste (XZP)
containing , prepared from six herbs of, Xuejie (Dragon's blood), Yanhusuo
(Corydalis Rhizoma), Ruxiang (Olibanum), Moyao (Myrrha), Qingdai (Natural
Indigo), and Bingpian (Borneolum Syntheticum), significantly alleviated cancer pain
including bone cancer pain in patients with middle/late stage cancer [11]. However,
4
the mechanisms underlying action of XZP in alleviating bone cancer pain have not
been systemically explored. In advanced medicine, the development of bone cancer
pain has been attributed to cancer-related bone destruction, reactive muscle spasm,
cancer-related inflammation and release of inflammatory mediators as well as
increased concentrations of calcium [2]. During the process of bone cancer pain,
aberrant activation of osteoclasts and compensatively increased osteoblast activity
contribute to the bone structural damages and are positively regulated by the receptor
activator of nuclear factor-κB (RANK) ligand (RANKL) [12], but negatively
regulated by osteoprotegerin (OPG). Furthermore, the bone formation and resorption
are also regulated by the parathyroid hormone related proteins (PTHrP) and insulinlike growth factor 1 (IGF-1)-related signaling [13 ,14]. Accordingly, the levels of
serum
tartrate-resistant
acid
phosphatase
5b
(TRACP5b),
carboxyterminal
pyridinoline cross- linked telopeptide of type I collagen (ICTP), procollagen type I
amino-terminal propeptide (PINP) and bone alkaline phosphates (BAP) have been
used to estimate bone destruction in patients with bone metastatic cancers, such as
prostate cancer [15-17]. In addition, bone cancer can cause inflammation and produce
inflammatory cytokines, such as interleukin 8 (IL-8), tumor necrosis factor (TNF)-α
and macrophage colony-stimulating factor (M-CSF), which feedback up-regulate
bone damages and pain [12 ,18 ,19]. It is unclear whether and how XZP treatment can
inhibit cancer invasion in the bone and related bone damage as well as osteoclast and
osteoblast activity. Furthermore, it is still unknown on whether and how XZP
treatment can modulate the activation of the RANKL/RANK/OPG signaling and the
expression of bone metabolic regulators and inflammatory mediators.
The aim of this study was to evaluate the effects of XZP and to explore the
mechanisms underlying its action in alleviating bone cancer pain. We employed a rat
model of bone prostate cancer pain to test the hypothesis that XZP can alleviate bone
cancer pain by modulating the RANKL/RANK/OPG signaling and the expression of
bone metabolic regulators of PTHrP and IGF-1, and inflammatory mediators of IL-8,
M-CSF and TNF-α in the bone of rats.
However, the mechanisms of action of XZP are largely unknown, especially its
roles in bone destruction, which is a major problem of bone cancer pain, are still
unclear.
The aim of this study was to evaluate the effects of XZP and to explore the
mechanisms of its action on bone cancer pain by assessing both mechanical and
5
thermal sensitivity, the time course of serum ICTP and BAP, the activity of osteoclasts
and osteoblasts in the tibia and RANKL/RANK/OPG signal pathway. We
hypothesized that our XZP prevents bone destruction and alleviates bone cancer pain
by targeting RANKL/RANK/OPG signaling pathway.
2. Materials and Methods
2.1. Composition and preparation of XZP
XZP was composed of six traditional Chinese medicines, which were purchased
from Tong-Ren-Tang (Beijing, China), and authenticated by Professor Hu Shilin,
Institute of Chinese Materia Medica, China Academy of Chinese Medical Scie nces.
The basic pharmacological functions of these Chinese medicines are illustrated in
Table 1. All the components of XZP were dried and homogenized to fine powders. To
prepare the XZP, individual powdered medicine (950g) were extracted twice with
70% ethanol (1:5 w/v) for 1-1.5 h each. The extracts were filtrated and concentrated
to 1 g per 3.59 g (crude herbs)/g extracts, followed by stored at -20o C. The extracts
were mixed with cataplasm matrix to generate a proper concentration of XZP before
use in vivo.
2.2. High performance liquid chromatography
To determine the potential components, the XZP was prepared and analyzed by
high performance liquid chromatography (HPLC) using >98% purity of the standards
of tetrahydropalmatine, imperatorin, isoimperatorin, coptisine, and palmatine chloride
(in methanol) that were purchased from the National Institute for Food and Drug
Control (Beijing, China). Methanol and acetonitrile (HPLC grade, Fisher Scientific,
New Jersey, USA) and pure water (Wahaha Group, China) were used for HPLC
analysis. All other chemicals were of analytical grade. The solutions were filtered
through 0.45 μm membranes and subjected to analysis at 280 nm using an Agilent
Zorbax Eclips XDB C18 column (250×4.6 mm，4.5μm) on a Waters HPLC system
(Waters Corporation, USA) equipped with an 2487 pump, an UV detector, an
Empower 2 system controller, an waters 717 plus autosampler at 30 o C. Samples at 10
μl were injected and acetonitrile- methanol-water-triethylamine (24:32:44:0.5) at a
flow-rate of 1.0 ml per min was used for at the mobile phase. According the
chromatographic characteristics of these standard compounds, the peak areas of
6
individual compounds in the samples were used for determining the contents of these
compounds and expressed as the percent.
2.3 Animals
Female Wistar rats weighing 150-180 g were from the Department of
Experimental Animal Sciences, Peking University Health Sc ience Center (Beijing,
China). Individual rats were housed in specific pathogen free (SPF) facility at 24 ±
1°C on a cycle of 12/12 h light/dark and cycle with free access to food and water. All
experiments were carried out in accordance with the guidelines of the International
Association for the Study of Pain All animal protocols were approved by the Animal
Care and Use Committee of China Academy of Chinese Medical Sciences and were
carried out in accordance with the guidelines of the International Association for the
Study of Pain [20] and. approved by the Animal Care and Use Committee of China
Academy of Chinese Medical Sciences.
2.4 Cell preparation and bone cancer pain model
Prostate cancer PC-3 cells were prepared and bone cancer pain model were
established, as our previous report [21]. Briefly, individual Wistar rats were injected
intraperitoneally (i.p) with PC-3 cells (2×107 in 0.5 mL) and seven to 14 days later,
the cells in the produced ascites were collected. After being anesthetized,
intraperitoneally (i.p) with sodium pentobarbital (45 mg/kg) and the left tibia of
individual rats was exposed. The left tibia of individual rats was individual rats were
injected with 105 PC-3 cells in 10-μl Hank‟s solution into the left tibia of the hind paw
and the injection site was covered by bone wax, followed by closing the wound. A
group of rats (n=10) received the same surgery and the same volume of vehicle
injection and served as the Sham controls. All rats were subjected to the same postoperational cares.
2.5 Treatment and groups
The Sham control rats were treated topically with the inert paste as the Control
(n=10 per group). The bone cancer-bearing rats with bone cancer were randomly and
treated topically with the inert paste as the placebo, the XZP at 15.75 g/kg (as the Low
dose), 31.5 g/kg (Medium dose) or 63 g/kg (High dose)). The Sham control rats were
7
treated topically with the inert paste as the Control (n=10 per group). To investigate
the effects of XZP on bone cancer- induced pain, the XZP at 15.75 g/kg (as the Low
dose), 31.5 g/kg (Medium dose) or 63 g/kg (High dose) or placebo (control group)
were evenly applied on the skin of tumor-bearing tibias, covered with gauze and a
layer of plastic film, sealed and fixed with desensitized adhesive plaster twice a day at
8:00 AM and 20:00 PM for a total of consecutive 21 days beginning one day after
Walker 256 cell inoculation implantation [11].
2.6 Radiological Analysis analysis
The cancer-related osteolytic lesions in the tibia of individual rats were examined
by X-ray radiology at 21 days post the inoculation. The rats were anaesthetized i.p
with sodium pentobarbital (45 mg/kg), and exposed to X-ray (Emerald 125) at 40
KVP for 1/20 s, followed by the development of X-ray film (Henry Schein blue
sensitive film) using a film developer (Konica SRX-101). The radiological score was
calculated according to Stewart's radiological score [22]: 0, normal bone structure
with no sign of deterioration; 1, minor loss of medullary bone; 2, substantial loss of
medullary bone with erosion of cortical bone; and 3, substantial loss of medullary
bone with major cortical destruction of the proximal epiphysis.
The tibias were scanned by micro-CT and reconstructed with 8μm isotropic
voxel size on a micro-CT system (eXplore Locus SP, GE Medical Systems). The
reconstructed 3D imagines of femurs were analyzed using Microviewer (GE Medical
Systems), as described previously [23]. Micro-CT is used to measure several
histomorphometric variables including bone volume (BV), total volume (TV), and
bone volume fraction (BV/TV) [24].
2.7 Mechanical Threshold threshold and Paw paw Withdrawal withdrawal
latency
The impact effects of treatment with XZP on the spontaneous nocifensive
behaviors of the different groups of rats wereas tested for the mechanical threshold
and paw withdrawal latency (PWL) in a blinded manner, as our previous description
[25 ,26] [21]. In brief, individual rats were placed in an inverted plastic chamber on
the glass surface of the Paw Thermal Stimulator System (UCSD, San Diego) for 30
min before the test. Mechanical hyperalgesia was measured by using a single rigid
8
filament attached to a handheld transducer (automatic plantar analgesia tester;
Institute of Biomedical Engineering, Chinese Academy of Medical Science, Tianjin,
China). Animals were acclimated to their surroundings for 10 min daily for 10 min for
three consecutive days in a plexiglass box on a metal grid surface prior to testing. On
the testing days, rats were allowed to acclimate for 5–-10 min. A rigid filament was
pressed perpendicularly against the medial plantar surface of the hind paw with an
increasing force. Brisk paw withdrawal or paw flinching accompanied by head
turning, biting, and/or licking upon application of an increasing force was considered
as a positive response. The paw withdrawal threshold (PWT) was defined as the
minimal force (g) required to evoke the cited positive responses. Each hind paw of
rats was tested three times and the data were averaged. The interval between
consecutive tests of the same paw was 5 min. The same procedure was performed on
days 3, 6, 9, 12, 15, 18 and 21 after tumor inoculation. The each hind paw of rats was
stimulated with a focused beam of radiant heat using an analgesiometer (37360, Ugo
Basile, Italy) underneath the glass surface. When the paw was withdrawn from the
stimulus the PWL was automatically recorded to the nearest 0.1 s. The intensity of
stimuli was adjusted to generate an average baseline PWL of approximately 10.0 s in
naive animals. The maximum stimulation was controlled < 20-s to prevent potential
tissue damage. Paws were alternated randomly to preclude “order” effects. Individual
rats were subjected to four tests with a 5- min interval before surgery and 2, 5, 8, 11,
14, 17 and 20 days after inoculation in a blinded manner. The mean PWL was
calculated for each time point in individual rats. Their body temperatures were
measured with a rectal probe pre- injection, and their heart rates, blood pressures and
mean arterial pressures were measured using a tail cuff and Coda monitor (Kent
Scientific; Torrington, CT, USA).
2.7 Histological Evaluationevaluation
The rats were deeply anesthetized by pentobarbital and transcardially perfused
with saline on day 21 post inoculation (n=10 per group8). The left tibia from each
animal was dissected, fixed in 10% formalin overnight, decalcified in 15% EDTAPBS for 7 days and paraffin-embedded. The tissue sections (6 μm) were stained with
hematoxylin and eosin (HE). Furthermore, the numbers of osteoclasts and osteoblasts
in the regions were identified by the tartarate-resistant acid phosphatase (TRAP) or
alkaline phosphatase (AKP) staining using the TRAP or AKP staining kits (Kamiya
9
Biomedical Company, Seattle WA,USA), respectively. The numbers of osteoclasts
and osteoblasts in 10 sections from each rat were counted under a light microscope
(Leica DM 2500) in a blinded manner [25].
2.8 Enzyme-linked Immunosorbent immunosorbent Assay assay (ELISA)
Peripheral blood samples were collected from individual rats at 0, 7, 14 or 21
days post inoculation and the concentrations of serum tartrate- resistant acid
phosphatase 5b (Tracp5bTRACP5b), carboxy-terminal pyridinoline cross- linked type
I collagen telopeptides of type I collagen (ICTP), procollagen type I amino-terminal
propeptide (PINP) and bone alkaline phosphatase (BALP) in individual rats were
determined by ELISA using the specific kits, according to the manufacturer‟s
instruction (R&D Systems Inc., Minneapolis, MNcompany name, city, USA). The
limitation of detection for Tracp5bTRACP5b, ICTP, PINP and BALP wasere 0.078
mIU/ml, 25 ng/ml, 18.75 pg/ml and 25U/L, respectively.
2.9 Quantitative RT-PCR
Total RNA was extracted from individual rat tibias using the TRIzol reagent and
reversely transcribed to cDNA using the first-strand cDNA synthesis kit (Invitrogen).
The relative levels of target gene mRNA transcripts were determined by quantitative
RT-PCR using the SYBR Green system and specific primers on the LightCycler
system (Roche).
The sequences of primers are shown in Table 2. The PCR
amplification was performed in triplicate at 95 o C for 10 minutes, and was subjected
to 40 cycles of 95 o C for 15s, 60 o C for 30s. The relative levels of each gene to
GAPDH mRNA transcripts were calculated by normalizing to the GAPDH and
expressed as a relative ratio.
2.10 Western blot assay
Total tibia proteins were extracted from individual rats by sonication in RIPA
buffer containing protease inhibitors (Roche). After quantification of protein
concentrations using the BCA protein assay kit (Thermo Scientific, Rockford, IL), the
protein
samples
(20µg/lane)
were
separated
by
sodium
dodecyl
sulfate
polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene
difluoride (PVDF) membranes (Millipore). After being blocked with 5% fat- free dry
milk, the membranes were incubated with anti-OPGosteoprotegerin (ab73400), anti10
GAPDH ([6C5,] (ab8245), anti-IL-8 (ab7747), anti- Parathyroid hormone related
proteins (PTHrP ,( ab85205), anti-M-CSF (ab99109), anti-IGF1 antibody (ab36532),
anti-TNF-α (ab66579), anti- RANKL ([EPR4999,] (ab124797, Abcam, Cambridge,
MA, USA), anti-RANK (H-300, sc-9072, Santa Cruz Biotechnology), respectively.
The bound antibodies were detected using a horseradish peroxidase (HRP)-conjugated
secondary antibody and visualized by an enhanced chemiluminescence detection
system, followed by quantifying using the Image Quant
TM
LAS 4000 (GE
Healthcare).
2.11 Statistical analysis
Data are expressed as the mean ± standard deviation (SD) and analyzed by twoway repeated ANOVA or by one-way ANOVA, followed by a Newman-Keuls test
using SPSS 13.0 statistical software. A p value of <0.05 was considered statistically
significant.
3. Results
3.1 HPLC analysis of XZP
Our previous study has shown that XZP, prepared from six herbs, of Xuejie
(Dragon's blood), Yanhusuo (Corydalis Rhizoma), Ruxiang (Olibanum), Moyao
(Myrrha), Qingdai (Natural Indigo), and Bingpian (Borneolum Syntheticum),
significantly alleviates bone cancer pain in patients with middle/late stage of cancer
[11]. To understand the effect of XZPpotential mechanisms underlying the action of
XZP, the major components of in the ethanol-extracted XZP were analyzed by HPLC.
We found that Following ethanol extraction, the XZP contained tetrahydropalmatine
(0.0568%), imperatorin (0.0041%), isoimperatorin (0.0122%), coptisine (0.0358%),
and palmatine chloride (0.112%, Fig. 1).
3.2 The effect of XZP on the implanted cancer growth and bone destruction
Radiographs of the structure of the bone and the development of the tumor
At 21 days post inoculation, all rats were sacrificed and their tibial bones were
examined by X-rad and micro-CT as well as pathology. While Tthere are is no
radiological change in the tibial bones of the control group of rats (Fig. 2A). Full
thickness bicortical bone loss and displaced fractures were observed in placebo group.
Less degrees Some loss of medullary bone loss and the cortical bone erosion of the
11
cortical bone was
were apparent in the rats that had been treated with XZP.
Quantitative analysis revealed that the radiological scores in the rats that had been
treated with different doses of XZP were significantly less than that of the placebo
group (p<0.05 or p<0.01) although they were still significantly higher than that of t he
healthy controls. Micro-CT examinations indicated that the percentages of bone
volume in total volume in the XZP-treated rats were significantly greater than that of
the placebo group of rats (p<0.05 or p<0.01, Fig. 2B) and the effect of XZP on
preserving the bone structure appeared to be dose-dependent. In addition, histological
examination revealed that while many cancer cells invaded in the bone tissues of the
placebo group of rats the numbers of invaded cancer cells in the bone of the XZPtreated rats were obviously reduced, particularly from the rats that had been treated
with a higher dose of XZP (Fig. 2C). Collectively, treatment with XZP mitigated the
cancer invasion into the bone and cancer-related bone destruction in rats. apparent in
different doses of treatment (Fig 2A). As compared with the placebo group, osteolytic
lesion areas were significantly smaller in medium (P< 0.05 versus placebo group) and
high dose of XZP (P< 0.01 versus placebo group) treated bones (Fig 2B).
Micro-CT
3D micro-CT images of tibias show no bone mass change in the control group.
However, decreased bone mass were observed in the placebo group and some loss of
bone mass in different doses of XZP (Fig 2C).
HE staining of bone tissue
The results of HE staining of bone tissue show that no invasion of prostate
cancer cells in bone tissue in the control group. However, bone tissue was invaded by
a lot of prostate cancer cells in the placebo group, and some prostate cancer cells
invaded the bone tissue in different doses of XZP treatment (Fig 2D).
3.3 The effect of XZP treatment on the nociceptive behaviors in rats
Mechanical threshold and thermal hyperalgesia
Bone cancer usually causes severe pain in humans and nociceptive responses in
animals. To determine tThe effects of XZP on bone cancer-related nociceptive
12
behaviors of the PAT and PWL in the different groups of rats were measured
longitudinally post inoculation. , Wister rats were inoculated with, or without PC-3
cells and treated topically with, or without, XZP at different doses, followed by
longitudinally measuring the nociceptive behaviors of the PAT and PWL in the
different groups of rats. While similar consistent levels of PWT were observed in the
control rats throughout the observation period, the levels of PWT were gradually
reduced throughout the observation period (Fig. 3A). In contrast, treatment with
different doses of XZP significantly mitigated the mechanical allodynia in a dose and
time-dependent manner. A similar pattern of the PWL was observed in the different
groups of rats (Fig. 3B). Hence, These data indicated that treatment with XZP reduced
the mechanical and thermal nociceptive behaviors in rats with bone cancer.
3.4 The effect of XZP treatment on the levels of osteoclast and osteoblast
activity in bone cancer rats ELISA for Tracp5b、 ICTP, PINP and BALP
To understand the effect of XZP treatment on the levels of osteoclast and
osteoblast activity, the levels of serum TRACP 5b, ICTP, PINP and BAP in individual
rats were measured longitudinally by ELISA. First, there was no significantly
difference in the levels of serum TRACP5b, ICTP, PINP and BAP among the different
groups of rats before inoculation (Fig. 4). Second, the levels of serum TRACP5b,
ICTP, PINP and BAP in the placebo group of rats were significantly higher t han that
of the control throughout the observation period (p<0.01). In contrast, the levels of
serum TRACP5b, ICTP, PINP and BAP in the XZP-treated rats, particularly for the
rats received a high dose of XZP, were significantly lower than that of the placebo
group (p<0.05) although they remained significantly higher than that of the controls
(p<0.05).
In parallel, the activity of osteoclasts and osteoblasts in the bone tissues from
the different groups of rats was further evaluated by AP and TRAP staining,
respectively. There were a few AP+ osteoblasts in the bone sections of the control rats
and increased numbers of AP+ osteoblasts were detected in the bone sections of the
placebo group of rats, but not obviously in the bone sections from the XZP-treated
rats (Fig. 5A). Quantitative analysis indicated that the numbers of AP+ osteoblasts in
the bone sections from the XZP-treated rats were significantly less than that in the
placebo rats at 14 and 21 days post inoculation (p<0.05), but remained significantly
13
greater than that in the controls (p<0.05). Furthermore, the numbers of TRAP+
osteoclasts and polykaryocytes in the XZP-treated rats were significantly greater than
that in the controls (p<0.05), but were significantly less than in the the placebo group
of rats at 7, 14 and 21 days post inoculation (p<0.05, Fig. 5B). Together, treatment
with XZP mitigated the cancer-stimulated osteoclast and osteoblast activity in vivo.
Prostate cancer bone metastasis rats showed significant increase in serum
Tracp5b (n=10, P<0.05). Control rats showed no significant difference from the
baseline. XZP reversed Tracp5b increase in a dose-related manner, with the peak
effect being observed in high dose group after 21d by a mean Tracp5b of 19.1± 0.6g
(n=10, P<0.05), (Fig 4A).
Prostate cancer bone metastasis rats showed significant increase in serum ICTP
(n=10, P<0.05). Control rats showed no significant difference from the baseline. XZP
reversed ICTP increase in a dose-related manner, with the peak effect being observed
in high dose group after 21d by a mean ICTP of 7.52± 0.53g (n=10, P<0.05), (Fig
4B).
Prostate cancer bone metastasis rats showed significant increase in serum PINP
(n=10, P<0.05). Control rats showed no significant difference from the baseline. XZP
reversed PINP increase in a dose-related manner, with the peak effect being observed
in high dose group after 21d by a mean PINP of 150.07± 3.26g (n=10, P<0.05), (Fig
4C).
Prostate cancer bone metastasis rats showed significant increase in serum Bone
alkaline phosphatase (n=10, P<0.05). Control rats showed no significant difference
from the baseline. XZP reversed BALP increase in a dose-related manner, with the
peak effect being observed in high dose group after 21d by a mean BALP of
2.63±0.36 (n=10, P<0.05), (Fig 4D).
3.5 XZP treatment modulates the OPG/RANKL/RANK signaling and other
bone regulator expression in the bone of rats.
The bone metabolism is regulated by the OPG/RANKL/RANK signaling,
inflammatory mediators and hormone and IGF-1 [12-14]. To understand molecular
mechanisms by which XZP inhibited the cancer-related bone destruction, the relative
levels of OPG, RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α in the bones
from the different groups of rats were analyzed by quantitative RT-PCR. The relative
levels of OPG mRNA transcripts to control GAPDH in the XZP-treated rats at
14
different time points post inoculation were significantly higher than that in the
placebo group (p<0.05, or p<0.01), but were significantly higher than that in the
control (p<0.05, Fig. 6A). In contrast, the relative levels of RANKL, IL-8, PTHrP, MCSF, IGF-1 and TNF-α, but not RANK mRNA transcripts in the placebo group at
different time points post inoculation were significantly higher than that in the
controls (p<0.05 or p<0.01, Fig. 6B-H), except that there was no significant difference
in the relative levels of IGF-1, M-CSF and TNF-α mRNA transcripts between these
two groups of rats at earlier time points post inoculation. The relative levels of
RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α mRNA transcripts in the
XZP-treated rats were significantly lower than that in the placebo group of rats
(p<0.05 or p<0.01), except that the relative levels of IL-8, PTHrP, M-CSF and TNF-α
mRNA were higher than that in the placebo group at earlier time points post
inoculation.
Further Western blot analysis revealed that in comparison with that in the
placebo group of rats, significantly higher levels of OPG and lower levels of RANKL,
RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α were detected in the bones of the
control group of rats (Fig. 7). In contrast, the relative levels of OPG in the bones from
the XZP-treated rats significantly increased while the relative levels of RANKL,
RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α in the bones from the XZP-treated
rats were significantly reduced (p<0.05, p<0.01 or p<0.001). The modulatory effects
of different doses of XZP were dose-dependent in rats. Collectively, these data
indicated that XZP treatment modulated the expression of OPG/RANKL/RANK
pathway events and other bone metabolic regulators as well as inflammatory
mediators in the cancer bones of rats.
Histological Evaluation of Osteoblast Activity.
Alkaline Phosphatase (ALP) is present in large polykaryocytes with multiple
nuclei. ALP positive profiles, which were associated with the bone and rare in normal
control bone, appeared scattered in the tumor mass and close to the remnants of the
trabeculae. The overall number of ALP positive polykaryocytes grew dramatically in
model group
(P<0.01
versus normal control).
In contrast,
ALP positive
polykaryocytes were almost completely absent from sections obtained from XZP
treated bones (P<0.05 versus blank control), (Fig 5A and 5B).
15
Histological Evaluation of Osteoclast Activity.
TRAP is present in large polykaryocytes with multiple nuclei. TRAP positive
profiles, which were associated with the bone and rare in normal control bone,
appeared scattered in the tumor mass and close to the remnants of the trabeculae. The
overall number of TRAP positive polykaryocytes grew dramatically in model group
(P<0.01 versus normal control). In contrast, TRAP positive polykaryocytes were
almost completely absent from sections obtained from XZP treated bones (P<0.05
versus blank control), (Fig 5C and 5D).
OPG/RANKL、RANK pathway mRNA
XZP treatment significantly upregulated the expression of OPG mRNA. The
mRNA expression of RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α raised
dramatically in the model group, and XZP treatment significantly downregulated the
expression of those mRNA (Fig 6).
OPG/RANKL、RANK pathway- Western blot
XZP treatment significantly upregulated the expression of OPG protein. The
protein expression of RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α raised
dramatically in the model group, and XZP treatment significantly downregulated the
expression of those proteins (Fig 7).
4. Discussion
In this study, we examined the effects of XZP treatment on the bone prostate
cancer nociceptive behaviors and potential mechanisms underlying the action of X ZP
treatment in a rat model of prostate cancer bone pain. We found that XZP treatment
significantly mitigated cancer invasion and bone damages as well as nociceptive
behaviors in rats, consistent with our previous findings [11]. Furthermore, we found
that XZP treatment significantly reduced the levels of serum TRACP5b, CIPT, PINP
and BAP and the AP+ osteoblasts and TRAP+ osteoclasts in rats, related to that of
placebo group, demonstrating that XZP treatment mitigated the bone cancer- induced
aberrant activation of osteoclasts and osteoblasts. In addition, we found that XZP
treatment up-regulated OPG expression, but down-regulated RANKL, RANK, Il-8,
16
M-CSF, TNF-α, PTHrP and IGF-1 expression in the tibial bones of rats, as compared
with that in the placebo group. These data indicated that XZP treatment inhibited the
activation of bone cancer-related RANKL/RANK/OPG pathway and inflammation,
leading to a reduction in the cancer-related bone destruction and alleviation of bone
cancer pain in rats. To the best of our knowledge, this was the first study on the
mechanisms underlying the action of XZP. Our findings may provide new insights
into understanding the molecular pathogenesis of bone cancer pain and aid in design
of new therapies for intervention of bone cancer pain.The present study reported for
the first time the analgesic activity of XZP and the mechanisms of its action on bone
cancer pain. The main findings of our study are as the following two points: (1) XZP
attenuates prostate cancer induced bone pain partially by preventing the bone
destruction; (2) XZP inhibits osteoclast formation by regulating RANKL/RANK/OPG
signal pathway.
Cancer- induced bone diseases are common and can have a devastating impact on
the quality of life in cancer patients Bone cancer pain is associated with bone
destruction, which is attributed to aberrant activation of osteoclasts [3 ,27 ,28]. The
functional development of osteoclasts is positively regulated by the RANKL/RANK related signaling, but is negatively regulated by OPG [12 ,29]. Furthermore, the
activity of osteoclasts is also regulated by the IGF-1-related signaling and PTHrP and
other hormones [13-18]. In this study, we found that in comparison with that in the
placebo group, XZP treatment significantly mitigated the bone cancer-upregulated
RANKL, RANK, PTHrP, IGF-1, IL-8, M-CSF and TNF-α, but increased the levels of
OPG expression in the tibial bones of rats, accompanied by decreased numbers of
osteoclasts and osteoblasts. These data were consistent with previous findings [30-33]
and support the notion that the RANKL/RANK/OPG signaling is crucial for the
development and progression of bone cancer pain [12 ,34-36]. It is like that bone
metastasis of cancer cells recruits inflammatory infiltrates, which secrete
inflammatory mediators, such as IL-8, TNF-α and M-CSF, and promotes
osteoclastogenesis, leading to the bone destruction and bone cancer pain. Hence, the
RANKL/RANK/OPG signaling may be a target for the design of new therapies for
intervention of bone cancer pain.
Aberrant activation of osteoclasts also compensatively promotes the activity of
osteoblasts to balance the bone absorption and formation [12 ,35 ,37 ,38]. We detected
high levels of serum PINP and BAP and increased numbers of AP+ osteoblasts in the
17
tibial bones of the placebo group of rats. Indeed, the levels of serum PINP and BAP
have been sued as biomarkers for evaluating the bone turnover in patients with bone
metastatic cancer [15-17]. However, XZP treatment significantly reduced the values
of serum TRACP5b and CIPT, but also decreased the levels of serum PINP and BAP
in rats, further supporting that aberrant activation of osteoclasts enhanced the activity
of osteoblasts in the bone cancer rats. Therefore, aberrant activation of osteoclasts
should be therapeutic targets for treatment of bone cancer pain [39 ,40].
In TCM, tumor-caused stagnation and insufficiency of Qi and blood flow in
the body are responsible for the development of bone cancer pain while increase in
the Qi and blood flow, such as softening hard lumps, dispelling nodes, and warming
the channels is crucial for alleviation of bone cancer pain [10]. We found that XZP
treatment significantly alleviated the bone cancer-related nociceptive behaviors.
Indeed, the herbs in the XZP formula have been used for the control of pain in TCM
for many years. The dragon‟s blood contains cochinchinenin A, cochinchinenin B, and
loureirin B and can inhibit the expression of Cox2 and substance P, and reduce the
levels of intracellular calcium, leading to potent analgesic activity [41 ,42]. Corydalis
Rhizoma can also significantly inhibit formalin-evoked spontaneous nociceptive
responses in rodents [43] and combination of corydalis yanhuso (rhizome) and
Angelicae dahuricae, alleviates pain in a clinical trial [44]. Ruxiang (Olibanum) and
moyao (Myrrha) can also
have anti- inflammatory and analgesic activities,
respectively [45]. It is possible that these drugs in the XZP synergistically inhibited
inflammation and promoted the Qi and blood flow, alleviating bone cancer
nociception in rats.
In conclusion, our data demonstrated that XZP treatment significantly reduced
cancer invasion, related osteoclast activity and bone destruction as well as nociceptive
behaviors in rats by modulating the RANKL/RANK/OPG signaling and the
expression of inflammatory mediators and bone metabolic regulators. Therefore, our
findings may provide a new basis for the design of therapies for intervention of bone
cancer pain.
One of the most difficult sequelae of cancer is metastases to the skeleton, an
event that results in bone destruction and bone cancer pain [3 ,27 ,28]. Bone cancer
pain is usually progressive as the disease advances, and is particularly difficult to treat
[27]. Recently, experimental models of bone cancer pain have been developed and
have provided seminal insight in understanding the pathophysiology of bone cancer
18
pain [29-31]. Animal models of bone cancer provided the finding that bone
destruction is associated with pain, and it has been determined that cancer- induced
osteolysis is mediated by osteoclasts [2 ,32]. Having established that RANK ligand
contributed to cancer- induced osteoclastogenesis, it was determined that disruption of
the RANKL-RANK axis with OPG inhibited tumor- induced osteoclastogenesis and
decreased bone cancer pain [12 ,33-35].
In line with the data of our previous study [11], we here first found that XZP
significantly alleviates bone cancer pain. We observed that XZP treatment decreased
mechanical and thermal pain 4–5 post-prostate cancer cell inoculation. Then, we also
found that XZP improved histological findings in a dose-dependent manner by
decreasing the extent of cancer cell and inflammatory cell iniltration and bone
destruction in implanted tibia of bone cancer pain rats. These results were also
confirmed by X-ray and three-dimensional micro-CT, which showed that bone
destruction and osteopenia were the common alterations of the bone in the cancer
implanted tibia in bone cancer pain rats.
According to Traditional Chinese Medicine (TCM) theory, cancer pain is the
result of tumor-caused blockage of Qi and blood flow through the channels of the
body. This occurs in two phases. First, stagnation of Qi and blood causes pain. Second,
the insufficiency of Qi and blood causes pain. Thus the main therapeutic goals are to
promote Qi and activate blood, soften hard lumps and dispel nodes, replenish Qi and
blood and warm the channels [16]. XZP, which significantly inhibited bone cancerinduced pain in this study, was formulated accordingly.
Consistent with our data, previous studies show that a number of the individual
herbs in the XZP formula inhibit pain. For instance, dragon‟s blood significantly
exerted anti- inflammatory and analgesic effects by blocking the synthesis and release
of substance P through inhibition of COX-2 protein induction and intracellular
calcium ion concentration [18], and the combination of cochinchinenin A,
cochinchinenin B, and loureirin B was the material basis for the analgesic effect of
Dragon‟s blood [19]. Corydalis Rhizoma could also significantly inhibit formalinevoked spontaneous nociceptive responses (licking behavior) [20]. It has been
reported that corydalis yanhuso (rhizome), combined with Angelicae dahuricae,
alleviated pain in a clinical trial [21]. Ruxiang (Olibanum) and moyao (Myrrha)
exhibited significant anti- inflammatory and analgesic activities respectively. Further,
the combination of the two herbals were therap eutically more useful for mitigating
19
inflammatory pain than individual herbal [22]. These literature reports lend further
support to our observation that XZP significantly alleviates bone cancer pain.
Further, our data showed that XZP significantly and progressively decreased
serum Tracp5b, ICTP, PINP and BALP levels. Tracp5b is an enzyme that is liberated
from osteoclasts into serum during bone resorption, and has been shown to correlate
better with osteoclast number than histological evidence of bone erosion [38]. Serum
ICTP, a product of the degradation of type I collagen by matrix metalloproteases, is
strongly affected by processes active in myeloma bone disease [5]. PINP is one of the
most specific and sensitive markers of bone formation, which reflects the rate of
synthesis of the main constituent of bone tissue [39]. BALP is also an indicator for
new bone formation because skeletal growth and bone consolidation correlate well
with serum levels of bone biochemical markers like BALP [40]. The lower, XZPinduced levels of Tracp5b、ICTP, PINP and BALP suggest that XZP inhibits bone
metastasis, which is also evidenced by the data showing that XZP inhibits osteoclastic
and osteoblastic activity.
Recent studies have identified osteoclasts as the principal cell type responsible
for bone destruction in bone cancer pain [37 ,38]. Thus, we hypothesized that XZP
would play a role in osteoclastogenesis in bone cancer pain. Consistent with this
hypothesis, we found that the administration of XZP significantly reduced the number
of osteoclasts in the areas of bone destruction with a dose-dependent tendency by
down-regulating the expression of RANKL/RANK/OPG signaling pathway related
molecules including RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α, upregulating the expression of OPG in prostate bone cancer pain rats.
In conclusion, our data offer the convincing evidence for the first time that XZP
may attenuate bone cancer pain partially by preventing the bone destruction. XZP
may inhibit osteoclast formation by regulating RANKL/RANK/OPG signaling
pathway, targeting which with XZP may, therefore, be an important therapeutic
strategy for preventing bone destruction in bone cancer pain.
Acknowledgement
The current work was partially supported b y the grants of National Natural Science
Foundation Project of China (no. 81302961, no.81273718 and no. 81202931). All
20
authors declare that there is no conflicts of interest.
Reference
1. Sabino MA, Mantyh PW. Pathophysiology of bone c ancer pain. J Support Oncol 2005;3(1):15-24
2. Mercadante S. Malignant bone pain: pathophysiology and treatment. Pain 1997;69(1 -2):1-18
3. Coleman RE. Clinical features of metastatic bone disease and risk of skeletal morbidity. Clin Cancer
Res 2006;12(20 Pt 2):6243s-49s
4. Chow E, Zeng L, Salvo N, et al. Update on the systematic review of palliative radiotherapy trials for
bone metastases. Clin Oncol (R Coll Radiol) 2012;24(2):112-24
5. Portenoy RK, Payne D, Jacobsen P. Breakthrough pain: characteristics and impact in patients with
cancer pain. Pain 1999;81(1-2):129-34
6. McQuay HJ, Collins SL, Carroll D, et al. Radiotherapy for the palliation of painful bone metastases.
Cochrane Database Syst Rev 2000(2):CD001793
7. Michaelson MD, Smith MR. Bisphosphonates for treatment and prevention of bone metastases. J
Clin Oncol 2005;23(32):8219-24
8. Chan FK. Primer: managing NSAID-induced ulcer complications --balancing gastrointestinal and
cardiovascular risks. Nat Clin Pract Gastroenterol Hepatol 2006;3(10):563 -73
9. Lapeyre-Mestre M, de Castro AM, Bareille MP, et al. Non-steroidal anti-inflammatory drug-related
hepatic damage in France and Spain: analysis from national spontaneous reporting systems.
Fundam Clin Pharmacol 2006;20(4):391-5
10. Lin C, Lin X, Yang J. An observation on combined use of chemotherapy and traditional Chinese
medicine to relieve cancer pain. J Tradit Chin Med 1996;16(4):267 -9
11. Bao YJ, Hua BJ, Hou W, et al. Alleviation of cancerous pain by external compress with Xiaozheng
Zhitong Paste. Chin J Integr Med 2010;16(4):309-14
12. Luger NM, Honore P, Sabino MA, et al. Osteoprotegerin diminishes advanced bone cancer pain.
Cancer Res 2001;61(10):4038-47
13. Adami S, Zivelonghi A, Braga V, et al. Insulin-like growth factor-1 is associated with bone formation
markers, PTH and bone mineral density in healthy premenopausal women. Bone
2010;46(1):244-7
14. Kubota T, Elalieh HZ, Saless N, et al. Insulin-like growth factor-1 receptor in mature osteoblasts is
required for periosteal bone formation induced by reloading. Acta Astronaut 2013;92(1):7378
15. Abildgaard N, Brixen K, Kristensen JE, et al. Comparison of five biochemical markers of bone
resorption in multiple myeloma: elevated pre-treatment levels of S-ICTP and U-Ntx are
predictive for early progressi on of the bone disease during standard chemotherapy. Br J
Haematol 2003;120(2):235-42
16. Leeming DJ, Koizumi M, Byrjalsen I, et al. The r elative use of eight collagenous and noncollagenous
21
markers for diagnosis of skeletal metastases in breast, prostate, or lung cancer patients.
Cancer Epidemiol Biomarkers Prev 2006;15(1):32-8
17. Zafeirakis AG, Papatheodorou GA, Limouris GS. Clinical and imaging correlations of bone turnover
markers in prostate cancer patients with bone only metastases. Nucl Med Commun
2010;31(3):249-53
18. Mantyh P. Bone cancer pain: causes, consequences, and therapeutic opportunities. Pain 2013;154
Suppl 1:S54-62
19. Yoneda T, Hata K, Nakanishi M, et al. Involvement of acidic microenvironment in the
pathophysiology of cancer-associated bone pain. Bone 2011;48(1):100-5
20. Zimmer mann M. Ethical guidelines for investigations of experimental pain in conscious animals.
Pain 1983;16(2):109-10
21. Bao Y, Hua B, Hou W, et al. Involvement of Protease-Activated Receptor 2 in Nociceptive Behavior
in a Rat Model of Bone Cancer. J Mol Neurosci 2013
22. Sweitzer SM, Colburn RW, Rutkowski M, et al. Acute peripheral inflammation induces moderate
glial activation and spinal IL-1beta expression that correlates with pain behavior in the rat.
Brain Res 1999;829(1-2):209-21
23. Lamoureux F, Baud'huin M, Rodriguez Calleja L, et al. Selective inhibition of BET bromodomain
epigenetic signalling interferes with the bone-associated tumour vicious cycle. Nat Commun
2014;5:3511
24. Parsa A, Ibrahim N, Hassan B, et al . Bone quality evaluation at dental implant site using multislice
CT, micro-CT, and cone beam CT. Clin Oral Implants Res 2013
25. Wang J, Zhang R, Dong C, et al. Topical treatment with Tong-Luo-San-Jie gel alleviates bone cancer
pain in rats. J Ethnopharmacol 2012;143(3):905-13
26. Bao Y, Hou W, Liu R, et al. PAR2-mediated upregulation of BDNF contributes to central sensitization
in bone cancer pain. Mol Pain 2014;10:28
27. Coleman RE. Metastatic bone disease: clinical features, pathophysiology and treatmen t strategies.
Cancer Treat Rev 2001;27(3):165-76
28. DePuy V, Anstrom KJ, Castel LD, et al. Effects of skeletal morbidities on longitudinal patientreported outcomes and survival in patients with metastatic prostate cancer. Support Care
Cancer 2007;15(7):869-76
29. Canon JR, Roudier M, Bryant R, et al. Inhibition of RANKL blocks skeletal tumor progression and
improves survival in a mouse model of breast cancer bone metastasis. Clin Exp Metastasis
2008;25(2):119-29
30. Mach DB, Rogers SD, Sabino MC, et al. Origins of skeletal pain: sensory and sympathetic
innervation of the mouse femur. Neuroscience 2002;113(1):155 -66
31. Medhurst SJ, Walker K, Bowes M, et al. A rat model of bone cancer pain. Pain 2002;96(1 -2):129-40
32. Wacnik PW, Kehl LJ, Trempe TM, et al. Tumor implantation in mouse humerus evokes movementrelated hyperalgesia exceeding that evoked by intramuscular carrageenan. Pain 2003;101(1 -
22
2):175-86
33. El Mouedden M, Meert TF. Evaluation of pain-related behavior, bone destruction and effectiveness
of fentanyl, sufentanil, and morphine in a murine model of cancer pain. Pharmacol Biochem
Behav 2005;82(1):109-19
34. Clohisy DR, Mantyh PW. Bone cancer pain and the role of RANKL/OPG. J Musculoskelet Neuronal
Interact 2004;4(3):293-300
35. Roudier MP, Bain SD, Dougall WC. Effects of the RANKL inhibitor, osteoprotegerin, on the pain and
histopathology of bone cancer in rats. Clin Exp Metastasis 2006;23(3 -4):167-75
36. Fili S, Karalaki M, Schaller B. Mechanism of bone metastasis: the role of osteoprotegerin and of the
host-tissue microenvironment-related survival factors. Cancer Lett 2009;283(1):10-9
37. Bezerra MC, Carvalho JF, Prokopowitsch AS, et al. RANK, RANKL and osteoprotegerin in arthritic
bone loss. Braz J Med Biol Res 2005;38(2):161-70
38. Bai YD, Yang FS, Xuan K, et al. Inhibition of RANK/RANKL signal transduction pathway: a promising
approach for osteoporosis treatment. Med Hypotheses 2008;71(2):256 -8
39. El Mouedden M, Meert TF. The impact of the opioids fentanyl and morphine on nociception and
bone destruction in a murine model of bone cancer pain. Pharmacol Biochem Behav
2007;87(1):30-40
40. Zwolak P, Dudek AZ, Bodempudi VD, et al. Local irradiation in combination with bevacizumab
enhances radiation control of bone destruction and cancer -induced pain in a model of bone
metastases. Int J Cancer 2008;122(3):681-8
41. Li YS, Wang JX, Jia MM, et al. Dragon's blood inhibits chronic inflammatory and neuropathic pain
responses by blocking the synthesis and release of substance P in rats. J Pharmacol Sci
2012;118(1):43-54
42. Wei LS, Chen S, Huang XJ, et al. Material basis for inhibition of dragon's blood on capsaicin -induced
TRPV1 receptor currents in rat dorsal root ganglion neurons. Eur J Pharmacol 2013;702(1 3):275-84
43. Wang C, Wang S, Fan G, et al. Screening of antinociceptive components in Corydalis yanhusuo W.T.
Wang by comprehensive two-dimensional liquid chromatography/tandem mass spectrometry.
Anal Bioanal Chem 2010;396(5):1731-40
44. Yuan CS, Mehendale SR, Wang CZ, et al. Effects of Corydalis yanhusuo and Angelicae dahuricae on
cold pressor-induced pain in humans: a controlled trial. J Clin Pharmacol 2004;44(11):1323 -7
45. Su S, Hua Y, Wang Y, et al. Evaluation of the anti -inflammatory and analgesic properties of
individual and combined extracts from Commiphora myrrha, and Boswellia carterii. J
Ethnopharmacol 2012;139(2):649-56
23
Figure legends:
Figure 1. HPLC analysis of the components of XZP.
XZP were extracted with ethanol and the representative active components in
the XZP extracts were characterized by HPLC using the standard components of (a)Tetrahydropalmatine (b)- Imperatorin (c)- Isoimperatorin (d)- Coptisine (e)Palmatine chloride. Data are representative chromatographic histograms at 280nm of
XZP (A), characterized profile (UV chromatograms at 280 nm) of the standard
compounds (A), XZP ethanol-extracts (B) and blank (C) from three independent
experiments. (D) The structures of standard compounds.
HPLC profile (UV chromatograms at 280 nm) of XZP (XZP, A (Standard), B (XZP
Samples), C (Blank)) and the identified compounds from XZP (D). (a)Tetrahydropalmatine (b)- Imperatorin (c)- Isoimperatorin (d)- Coptisine (e)Palmatine chloride
Figure 2. XZP treatment reduces the cance r-induced bone damages in rats.
At 21 days post inoculation, the tibial bone structure and damages in the
individual rats were characterized by X-rad and micro-CT and quantitatively analyzed.
Subsequently, their tibial bone sections were stained with HE. Data are representative
images of individual groups of rats (n=10 per group). (A) Radiographs of the bone
structure and tumor invasion. (B) 3D micro-CT images of the tibias. (C) HE analysis
of the cancer bone tissues (magnification x 400). Low dose, Medium dose and High
dose: The rats were treated with low, medium or high dose of XZP. (** p<0.01 vs. the
control group; # p<0.05 vs. the placebo group; ** p<0.01 vs placebo group).
(A) Radiographs of the structure of the bone and the development of the tumor.
Different doses of Xiaozheng Zhitong Past (XZP) treatment relieved some loss of
medullary bone and erosion of the cortical bone. (B) 3D micro-CT images of tibias.
Control group showed no bone mass change, and decreased bone mass was observed
in placebo group. Different doses of XZP treatment ameliorated some loss of bone
mass. (C) HE staining of bone tissue. Different doses of XZP treatment suppressed
24
some breast cancer cells to invade the bone tissue. (** p<0.01 vs control group; # p<0.05
vs placebo group; ** p<0.01 vs placebo group).
Figure 3. XZP treatment mitigates the bone cance r-related nociceptive
behaviors in rats.
The mechanical allodynia and paw withdrawal latency of individual rats
before and at the indicated time points post inoculation were measured. Data are
expressed as the means ± SD of individual groups of rats (n=10 per group). (A) The
changes in the mechanical allodynia. (B) The changes in thermal hyperalgesia.
*p<0.05, ** p<0.01, ***p<0.001 vs. the control group; # p<0.05, ## p<0.01 vs. the
placebo group.
(A) Changes in mechanical allodynia (n=10 per group). Mechanical allodynia was
measured on days 0 (baseline), 2, 5, 8, 11, 14, 17 and 20 after surgery. Cancer induced
a significant decrease of mechanical threshold of the hind paw ipsilateral to the
cancer- inoculated tibia: XZP treatment significantly restored it compared to placebo
group. (B) Changes in thermal hyperalgesia (n=10 per group). Thermal hyperalgesia
was measured on days 0 (baseline), 1, 4, 7, 10, 13, 16 and 19 after surgery. Cancer
induced a significant decrease of paw withdrawal latency (PWL) of the hind paw
ipsilateral to the cancer cell- inoculated tibia. XZP treatment significantly restored it
compared to control group. (* p<0.05 vs control group; ** p<0.01 vs control group;
***p<0.001 vs control group; # p<0.05 vs placebo group; ## p<0.01 vs placebo group).
Figure 4. XZP treatment modulates the levels of serum TRACP5b, ICTP,
PINP and BALP in rats.
The levels of serum TRACP5b, ICTP, PINP and BALP in individual rats were
analyzed at the indicated time points before and after prostate cancer cell inoculation.
Data are expressed as the means ± SD of individual groups of rats (n=10 per group)
from three separated experiments. (A) The levels of serum TRACP5b. (B) The levels
25
of serum ICTP. (C) The levels of serum PINP. (D) The levels of serum BAP. *p<0.05
vs. the control group; # p<0.05 vs. the placebo group.
ELISA for Tracp5b、 ICTP, PINP and BALP
(A) Prostate cancer bone metastasis rats showed significant increase in serum
Tracp5b (n=10, P<0.05). Control rats showed no significant difference from the
baseline. XZP reversed Tracp5b increase in a dose-related manner, with the peak
effect being observed in high dose group after 21d by a mean Tracp5b of 19.1± 0.6g
(n=10, P<0.05). (* p<0.05 vs control group; # p<0.05 vs placebo group).
(B) Prostate cancer bone metastasis rats showed significant increase in serum
ICTP (n=10, P<0.05). Control rats showed no significant difference from the baseline.
XZP reversed ICTP increase in a dose-related manner, with the peak effect being
observed in high dose group after 21d by a mean ICTP of 7.52± 0.53g (n=10,
P<0.05). (* p<0.05 vs control group; # p<0.05 vs placebo group).
(C) Prostate cancer bone metastasis rats showed significant increase in serum
PINP (n=10, P<0.05). Control rats showed no significant difference from the baseline.
XZP reversed PINP increase in a dose-related manner, with the peak effect being
observed in high dose group after 21d by a mean PINP of 150.07± 3.26g (n=10,
P<0.05). (* p<0.05 vs control group; # p<0.05 vs placebo group).
(D) Prostate cancer bone metastasis rats showed significant increase in serum
Bone alkaline phosphatase (n=10, P<0.05). Control rats showed no significant
difference from the baseline. XZP reversed BALP increase in a dose-related manner,
with the peak effect being observed in high dose group after 21d by a mean BALP of
2.63±0.36 (n=10, P<0.05). (* p<0.05 vs control group; # p<0.05 vs placebo group).
Figure 5. Histological Evaluation of Osteoblast and Osteoclast Activity and
Macrophage infiltration
The numbers of osteoblasts and osteoclasts in the cancer-invaded tibial bones
of individual groups of rats were characterized by AP and TRAP-enzymatic staining,
respectively. The yellow-brown staining represents AP+ osteoblasts or TRAP+
osteoclasts, respectively. Data are representative images (magnification x 400) and
expressed as the means ± SD of individual groups of rats (n=10 per group) from three
separated experiments. (A) Characterization of osteoblasts; (B) Characterization of
26
osteoclasts. *p<0.05 vs. the control group; # p<0.05 vs. the placebo group.
(A) Alkaline Phosphatase (ALP) is present in large polykaryocytes with multiple
nuclei. ALP positive profiles, which were associated with the bone and rare in normal
control bone, appeared scattered in the tumor mass and close to the remnants of the
trabeculae. The overall number of ALP positive polykaryocytes grew dramatically in
model group (P<0.05 versus placebo group). In contrast, ALP positive polykaryocytes
were almost completely absent from sections obtained from XZP treated bones
(P<0.05 versus placebo group). (* p<0.05 vs control group; # p<0.05 vs placebo group).
(B) TRAP is present in large polykaryocytes with multiple nuclei. TRAP positive
profiles, which were associated with the bone and rare in normal control
bone,appeared scattered in the tumor mass and close to the remnants of the trabeculae.
The overall number of TRAP positive polykaryocytes grew dramatically in model
group (P<0.05 versus placebo group). In contrast, TRAP positive polykaryocytes were
almost completely absent from sections obtained from XZP treated bones (P<0.05
versus placebo group). (* p<0.05 vs control group; # p<0.05 vs placebo group).
Figure 6. Quantitative RT-PCR analysis of the relative levels of target
gene mRNA transcripts in the tibial bones of individual groups of rats.
The relative levels of OPG, RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α
mRNA transcripts to the control GAPDH in the tibial bones of individual rats at the
indicated time points were determined by quantitative RT-PCR. Data are expressed as
the means ± SD of individual groups of rats (n=10 per group) from three separated
experiments. (A) The levels of OPG mRNA transcripts; (B) The levels of RANKL
mRNA transcripts; (C) The levels of RNAK mRNA transcripts; (D) The levels of
IL_8 mRNA transcripts; (E) The levels of PTHrP mRNA transcripts; (F) The levels of
27
M-CSF mRNA transcripts; (G) The levels of IGF-1 mRNA transcripts; (H) The levels
of TNF-α mRNA transcripts. *p<0.05 vs. the control group; # p<0.05 vs. the placebo
group.
The mRNA expression of OPG decreased dramatically in the model group, XZP
treatment significantly upregulated the expression of OPG mRNA.The mRNA
expression of RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α raised
dramatically in the model group, XZP treatment significantly downregulated the
expression of those mRNA. (* p<0.05 vs control group; # p<0.05 vs placebo group).
Figure 7. Western blot analysis of the relative levels of OPG, RANKL,
RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α expression in the tibial bones of
individual groups of rats.
The relative levels of OPG, RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α
expression in the tibial bones of individual groups of rats at the indicated time points
were determined by Western blot assays. Data are representative images and
expressed as the means ± SD of individual groups of rats (n=10 per group) from three
separated experiments. (A) Western blot analysis; (B) Quantitative analysis; *p<0.05,
** p<0.01, ***p<0.001 vs. the control group; # p<0.05, ## p<0.01 vs. the placebo group.
The protein expression of OPG decreased dramatically in the model group, XZP
treatment significantly upregulated the expression of OPG protein. The protein
expression of RANKL, RANK, IL-8, PTHrP, M-CSF, IGF-1 and TNF-α raised
dramatically in the model group, XZP treatment significantly downregulated the
expression of those proteins. (** p<0.01 vs control group; ***p<0.001 vs control group; #
p<0.05 vs placebo group).
28
Table 1 Composition of XZP
Pharmaceutical
Botanical
name
source/family
Dragon's blood
Daemonorops
Part used
Traditional actions/uses
Amount
(g)
Dried resin
Draco Bl.
Calms pain, promotes Qi and 10
moves
blood,
promotes
circulation in the collaterals
Corydalis
Corydalis
Rhizoma
yanhusuo
moves
W.T.Wang
circulation in the collaterals
Olibanum
Boswellia
Dried rhizome
Dried resin
Calms pain, promotes Qi and 50
blood,
Calms pain,
promotes
moves
blood, 50
carterii Birdw.
promotes circulation in the
Boswellia bhaw-
collaterals
dajiana Birdw
Myrrha
Commiphora
Dried resin
Calms pain,
moves
blood, 50
Myrrha Engl.
promotes circulation in the
Commiphora
collaterals
molmol Engl.
Borneolum
-
-
Calms pain
20
Baphicacanthus
Dried Stem or Anticancer, clearing away heat 10
cusia(Nees)
Dried leavies
Syntheticum
Natural Indigo
and toxic material
Breek.
Polygonum
tinctorium Ait.
Isatis indigotica
Fort.
29
Table 2. The sequences of primers
Target gene
Primers sequences
Forward
5„-TGGGATCAAACTGTCTCCCCAG-3'
PTHrP
171
Reverse
5„-AAACAGAGTCAGCAGCACCAAG-3'
Forward
5„-AGCAGGAGTATCACCGAGGA-3'
220
M-CSF
Reverse
5„-TATCTCTGAAGCGCATGGTG-3'
Forward
5„-GCTCTTCAGTTCGTGTGTGGA-3'
133
IGF-1
Reverse
Forward
TNF-α
Reverse
Forward
5„-GCCTCCTTAGATCACAGCTCC-3'
5„-CAGGCGGTGCCTATGTCTC-3'
89
5„-CGATCACCCCGAAGTTCAGTAG-3'
5„-GGGATCAAACTGTCTCCCCAG-3'
PTHrP
171
Reverse
5„-AACAGAGTCAGCAGCACCAAG-3'
Forward
5„-AGCAGGAGTATCACCGAGGA-3'
Reverse
5„-TATCTCTGAAGCGCATGGTG-3'
M-CSF
Forward
IGF-1
Reverse
Forward
TNF-α
Size (bp)
Reverse
Forward
220
5„-GCTCTTCAGTTCGTGTGTGGA3'
5„-GCCTCCTTAGATCACAGCTCC-
133
3'
5„-CAGGCGGTGCCTATGTCTC-3'
89
5„-CGATCACCCCGAAGTTCAGTAG-3'
5′- CCCCCAATGTATCCGTTGTG -3′
GAPDH
118
Reverse
5′-TAGCCCAGGATGCCCTTTAGT-3′
30
Figure 1
31
Figure 2
32
Figure 3
33
Figure 4
34
Figure 5
35
Figure 6
36
Figure 7
37