1. science
2. medicine
3. genetics

From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
a-Thalassemia Caused by a Large (62 kb) Deletion Upstream of the Human
a Globin Gene Cluster
By C.S.R. Hatton, A.O.M. Wilkre, H.C. Drysdale, W.G. Wood, MA. Vickers, J. Sharpe, H. Ayyub, I.M. Pretorius,
V.J. Buckle, and D.R. Higgs
We describe a family in which a-thalassemia occurs in
association with a deletion of 62 kilobases from a region
upstream of the a globin genes. DNA sequence analysis has
shown that the transcription units of both a genes downstream of this deletion are normal. Nevertheless, they fail
to direct a globin synthesis in an interspecific hybrid
containing the abnormal (aaIRA
chromosome. It seems
probable that previously unidentified positive regulatory
sequences analogous to those detected in a corresponding
position of the human B globin cluster are removed by this
deletion.
0 1990 by The American Society of Hematology.
by the method of Deisseroth and Hendrick16as modified by Zeitlin
H E H U M A N a globin gene cluster lies near the tip of
the short arm of chromosome 16 within band ~ 1 3 . 3 . ' ~ ~and Weatherall.I7 Epstein-Barr virus (EBV) transformed lymphocytes from the patient R.A. were fused with adenine phosphoribosyl
The complex includes two a genes (a1 and a2), an embryonic
transferase (APRT) negative mouse eryteroleukemia (MEL) cells
a-like gene (Q), several pseudogenes (+al,+a2, +{l) and a
(line 585, a gift from A. Deisseroth, University of California), and
gene of undetermined function (el) in the order (5'-Q-+{lhybrid cells containing human chromosome 16 were selected in
$"-+a1
-(~2-al-B1-3').~-'
a-Thalassemia most frequently remedium containingmethotrexate (0.1 mmol/L), adenine (0.1 mmol/
sults from deletions including either one (denoted-a) or both
L), thymidine (30 @mol/L),and ouabain (0.5 pmol/L). Ouabain was
(denoted --) a genes from one chromosome, although a
only included during the first 14 days of culture to prevent the
variety of nondeletion mutations (denoted aaTor aTa)have
background growth of EBV-transformed lymphocytes in preference
to the mouse/human hybrid cells. Mapping of the a genes and
also been described. In all of these determinants of akaryotyping of two independent clones showed that the normal (aa)
thalassemia, the reduced a globin chain synthesis can be
chromosome 16 was present in a tetraploid MEL background (line
explained in terms of our current understanding of globin
H-201), while the abnormal
chromosome 16 was present in a
gene expression.*
diploid MEL background (line H-101). In situ hybridization to the
W e have recently identified an English individual (R.A.)
cell line H-101, performed as previously described using 'H-labeled
with a-thalassemia in which the molecular basis cannot be so
total human DNA," demonstrated that each of the 5 0 cells
readily explained. D N A analysis has demonstrated a large
examined contained only one human chromosome. To study globin
(62-kilobase [kb]) deletion affecting one chromosome degene expression, MEL and hybrid cell lines were induced with
noted (aa)"",spanning from coordinate + 10 between the Q
DMSO (1.4% vol/vol) and hemin (40 pmol/L) for 3 days before
and +{I genes to a position 52 kb upstream of the Q
analysis of RNA and globin chain synthesis.
messenger R N A (mRNA) C A P site (see Fig 1). However,
RNA analysis. Total RNA was prepared from cell pellets
(usually 2 to 5 x lo7 cells) that had been kept at -7OOC until
both a genes downstream of the deletion in the chromosome
extraction, as described by Maniatis et aii9or by the method of
remain intact.' Therefore, it is not clear whether the deletion
Chomczynski and Sacchi.'' Human or mouse a globin mRNA was
is primarily responsible for the a-thalassemia phenotype or if
detected using the quantitative RNAase mapping procedure.2'
it is merely a coincidental mutation either in cis or trans to
Approximately 1 pg of a plasmid (pSP6a132") containing an insert
another downregulating mutation.
corresponding to the 5' end of both the human a1 and a2 genes was
To establish the relationship of this novel deletion to the
linearized with BamHI. Similarly, 1 pg of plasmid (pSP64 maz2)
associated a-thalassemia we have determined the phenotype
containing an insert corresponding to the 5' end of the mouse a
of other family members with the aa/(aa)"" genotype.
globin gene was linearized with HindIII. A "P-labeled probe was
Furthermore, the structurally normal (aa) and abnormal
transcribed from each template using SP6 polymerase as specified in
[(aa)""] chromosomes 16 derived from the propositus were
GTP
theSP6 system (Amersham Internationalplc, UK) and [(Y-)~P]
(410 Ci/mm01).~'.'~Each probe (approximately 1 x lo6 cpm) was
each isolated in mouse x human somatic cell hybrids for
added separately to 10 pg of total cellular RNA, heated to 95OC for
detailed structural and functional studies. Finally, the a
10 minutes, and then hybridized in 80% formamide, 40 mmol/L
globin genes located downstream of the deletion in the
PIPES
(pH 6.4), 400 mmol/L NaCl, and 1 mmol/L EDTA, at 5OoC
abnormal
chromosome were cloned and sequenced to
overnight. The resulting RNA-RNA hybrids were then treated with
search for mutations that might explain the phenotype, but
none was found. Together, these studies strongly suggest that
the 62-kb deletion is primarily responsible for downregulatFrom MRC Molecular Haematology Unit, Institute of Molecuing the intact a genes on the
chromosome.
T
MATERIALS AND METHODS
Hematologic analysis. Full blood counts, hemoglobin electrophoresis, and HbH preparations were performed using standard
methods,'0.''and a//3globin chain synthesis ratios were measured as
previously described.IZ
DNA analysis. Blot hybridization studies were performed using
standard methods."-" Previously published probes used in this study
are a1 globin/HBAl,' fill globin/HBZP; and a globin RA330.9
Isolation and characterization of interspecific somatic cell hybrids. The somaticcell hybrid lines (H-101 and H-201) were made
B W , VOI 76, NO 1 (July 1). 1990: pp 221-227
lar Medicine, John Radcliffe Hospital, Oxford; and Department of
Haematology. Princess Margaret Hospital, Swindon, UK.
Submitted January 29,1990; accepted March 12,1990.
Address reprint requests to D.R. Higgs. DSc (Med). MRC
Molecular Haematology Unit. Institute of Molecular Medicine.
John Radcliffe Hospital, Headington, Oxford. OX3 9DU UK.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1990 by The American Society of Hematology.
0006-497l/90/7601-0017$3.00/0
22 1
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
HAlTON ET AL
222
Table 1. Hematologic Data in Patient R.A. and His Offspring
Age
R.A.
R0.A.
D.A.
Sex
(y)
M
M
56
ad
ad
F
Hb
(g/lOOmL)
13.2
12.0
12.8
MCV
(R)
MCH
(pg)
HbH
Inclusions
a/@Globin Chain
64
71
72
22
22
24
4-
NS
0.71
0.66
NS
NS
BamHl a-Specific
Fragments (kbP
Synthesis Ratio
Bg/Il$( 1-Specific
Fragments (kb)t
12.6,1 1 .O,6.8
12.6,10.0,6.8
12.6,10.0,6.8
14.0
14.0
14.0
The mother of R0.A. and D.A. was unavailable for study.
Abbreviations: ad, adult at time of study; NS, not studied MCV. mean corpuscular volume; MCH, mean corpuscular hemoglobin.
*The 14.0kb fragment spans from 14 to +28 and contains both the a1 and a2 genes. This normal fragment is not shown in Fig 1.
tOnly the hypervariable segment (1 0 to 1 1 .O kb) and the breakpoint fragment (6.8kb) are shown in Fig 1.
+
RNAases A (40 pg/mL) and TI (2 pg/mL) at 16OC for 30 minutes.
The protected fragments (128 nucleotides for mouse a and 133
nucleotides for both human a1 and a2)'2 were analyzed on an 8%
denaturing polyacrylamide gel.
Molecular cloning of rhe a globin genesfrom the (aa)RA
chromosome. High molecular weight DNA obtained from the hybrid cell
line H-101,containing the abnormal
chromosome, was
digested to completion with BumHI. Unfractionated DNA was
ligated using standard conditions'' to BumHI-cut bacteriophage
arms prepared from the vector X EMBL 3, which had previously
been treated with EcoRl and alkaline phosphatase (Promega). Two
micrograms of the ligation mix were packaged in vitro using a
standard protocol (Lambda in vitro packaging kit, Amersham) and
plated on the host bacterial strain NM621. Recombinants, 4 x IO4,
-1 00
I
-80
I
-60
I
-40
I
were screened with the a1 globin probe as described in Kaiser and
Murray,z5 and one positive plaque (X AWI) was identified. Subsequently, a bulk preparation of DNA from the recombinant phage
was prepared." When analyzed by digestion with BumHl and blot
hybridization to a globin, the predicted 14-kb band was identified.
However, a 10.5-kb fragment, which varied in proportion between
different preparations, was also present. This was thought to have
arisen by spontaneous deletion as a result of recombination between
the tandem a globin genes as previously described.' The correct
14-kb fragment was isolated by bulk digestion of X AWI with
BumHI, agarose gel electrophoresis, excision of the relevant band,
and electroelution. The absence of the contaminating 10.5-kb band
was confirmed and the presence of both a1 and a 2 genes in the 14-kb
BumHI band was demonstrated by ApuI/Psil double digestion.
Okb
-fO
20
I
62
RA330
I
yt6va2
V a l a2al61
mnm
I
H BBgBgBBH
BBg
t
BgB
HBgB
14.0
I
m
I
12.6
I I -
40
I
aa
H
H
BamHl
Bgl II
Hindlll
Fig 1. (Top) The normal human a globin cluster (denoted aa) with reference points given in kilobases. Position 0 represents the
mRNA CAP site. (=I, Functional genes; (Et),pseudogenes, and (0).
the region corresponding t o the probe a globin RA330. The solid bar
beneath the normal cluster represents the extent of the deletion from the normal chromosome t o produce the abnormal (aa)RA
chromosome. The B s d l (E), Bgnl (Bg), and Hindlll (H) restriction sites nearest t o the breakpoints are indicated. (Middle) The abnormal
is shown together with the abnormal BamHI, Sgnl. and Hindlll fragments detected by the $fl and a globin RA330
chromosome, (aaIRA,
probes. (Insert) Examples of normal genomic DNA (1). DNA from a hybrid containing a normal chromosome 16 (2). a hybrid containing
(3). and MEL cell DNA (4) hybridized t o the $fl probe. Abnormal fragments also identified by a globin RA330 are marked thus (0).
The relative migration of DNA molecular weight markers (Hindlll cut is shown on the right of the insert panel. Fragment sizes are 23,9.6,
6.5,4.3.2.3,
and 2.0 kb.
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
A DELETION UPSTREAM OF
223
THE a GLOBIN CLUSTER
Subsequently. the 1.5-kb PstI band
Table 2. Mapping Data for the Normal (aa)
and Abnormal (dRA
subcloned into PstI cut and alkaline
Chromosomes
u Globin RA330
$41
uu
10.8,
12.6,
16.0,
23.0.
BamHl
Bglll
Hindlll
EcoRl
5.9
11.0
13.0
5.0
(UdAA
uu
(UUPA
14.0
12.6.6.8
12.6
>23
13.0
11.0
1.5
11.0
14.0
6.8
12.6
>23
Fragments underlined are common to both the $(and RA330 probes.
A
from the 14-kb fragment was
phosphatase-treated pBR322
(Pharmacia, Sweden). Recombinants containing the a1, a2. or $a1
genes, each of which is contained within the 1.5-kb PstI band, were
distinguished by digestion with Apal and RsaI,'6 and those containing the a1 and a 2 genes are referred to as pRAal and pRAa2,
respectively. Finally. the a l - and a2-specific Pstl fragments were
each subcloned in both orientations into the Pstl site of M 13tg 1302'
and are referred to as M13RAa1, M13RAal(R), and M13RAa2,
M I 3RAa2(R).
Sequence analysis ofthe al and a2 globin genes. 3' End-labeled
Ncol/PstI and Hindlll/PstI fragments were prepared from pRAaI
B
128-
133n
- '5
3'
Mouse a globin gene
5' P
3'
3'
32P-SP6RNA
3,
5'
3' Mouse aglobin mRNA
~
1
RNAases
I
Protected fragment (128 nucleotides)
+
5'
~
I
1
man a j
sin gene
33$-SP6 RNA
Humar! aglobin mRNA
RNAases
I
Protected fragment (133 nucleotides)
Fig 2. (A) Analysis of mouse a globin mRNA in total RNA from uninduced (-1 and induced (+) hybrid cell lines H-101, H-201, MEL. and
the human cell line K562. which has been previously shown t o produce a globin mRNA. The relatively faint band in K562+ at 128
nucleotides represents a low level of cross contamination from the strong signal in the MEL+ lane, with no corresponding band having
been seen on many other occasions. (B) Analysis of human a globin mRNA in total RNA from uninduced (-1 and induced ( 1 hybrid cells
H-101, H-201, MEL, and K562.
+
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
224
H A T O N ET AL
and pRAa2,I9 and sequenced using the method of Maxam and
Gilbert.28 In addition, single-stranded DNA prepared from
M13RAa1, M13RAal(R), and M13RAa2, M13RAa2(R) was
sequenced by the dideoxy sequencing reaction29as described in the
protocol "DNA sequencing with Sequenase"" (US Biochemical
Corporation, 1988).Priming from oligonucleotides corresponding to
sequences within and flanking the structural a genes" allowed
analysis of the entire sequence.
IC
(1
P
E
n
2
0
a
2
RESULTS
The 62-kb deletion is present on the same chromosome as
the a-thalassemia determinant. The propositus (R.A.) was
a 56-year-old man who initially complained of anorexia and
weight loss for which no cause was found. The presenting
symptoms eventually resolved without treatment. A routine
blood count showed a hypochromic microcytic anemia in the
absence of iron deficiency. H b electrophoresis showed normal
proportions of HbA, (2.7%) and H b F (1.1%). A diagnosis of
a-thalassemia was confirmed by demonstrating HbH inclusions in the peripheral red blood cells (RBCs) and a reduced
a/B globin chain synthesis ratio (Table 1). Blot hybridization
studies using DNA obtained from the peripheral blood of
R.A. demonstrated that there was a 62-kb deletion from
upstream of the a globin complex on one chromosome (see
reference 9 and Fig 1). To determine whether the 62-kb
deletion is linked to the a-thalassemia determinant, we
examined two offspring (R0.A. and D.A.) of the propositus.
Both have the phenotype of a-thalassemia and both have
inherited the (aa)"" chromosome, identified by an abnormal
(6.8 kb) {-specific BglII fragment (Table 1 and Fig 1). These
findings suggest that the phenotype of a-thalassemia in this
family can be entirely explained by the inheritance of the
(aa)"" chromosome since the degrees of chain imbalance
and the RBC indices of R.A. and his children, all of whom
have the abnormal 6.8-kb BglII fragment, are nearly identical (Table I ) .
Functional analysis of the somatic cell hybrids. To
simplify the subsequent structural and functional analysis of
the (aa)"" determinant, each chromosome 16 from the
propositus was isolated in human x MEL somatic cell
hybrids. The hybrid containing the (aa)"" chromosome was
mapped with BamHI, BglII, and HindIII, and the expected
breakpoint fragments' were identified (see Table 2 and Fig
1). It has been previously demonstrated that expression of
both the endogenous mouse globin genes (a,p major, and @
minor) and the introduced human a genes (a2 and a l , but
not {) can be induced by treating the hybrid cells with a
variety of agent^.^^.-'^ When H-201 hybrids containing the
normal aa chromosome were treated with hemin and DMSO,
both mouse and human a globin mRNA were induced (Fig 2,
A and B). Furthermore, both mouse and human globin chain
synthesis could be readily detected after induction of these
cells (Fig 3). By contrast, under the same experimental
conditions only a trace of human a mRNA (less than 1% of
mouse a globin mRNA) and no human a globin synthesis
could be detected in the cell line H-101 containing the
abnormal (am)"" chromosome (Figs 2 and 3). Thus, these
data confirm that the a-thalassemia determinant is present in
cis to the deletion on the (ma)"" chromosome.
5
0
5
IY
5
0
3
A
Y
L
0
FRACTION NUMBER
15
-
7
r.
0
E
n
L)
10,
6 1
FRACTION NUMBER
Fig 3. (Top) Carboxymethylcellulose chromatography of labeled globin chains in H-201 aher 3 days in culture with DMSO and
hemin. The ratio of human a to total a globin synthesis was 0.07.
and for six other normal chromosomes 16 the ratio ranged from
0.04 to 0.22 (data not shown). It should be noted that H-201 has a
single chromosome 16 in a tetraploid mouse background, while the
other cell lines were all diploid. In part, the large variation in ratio
observed in normal chromosomes is accounted for by the variable
proportion of cells containing human chromosome 16. We estimate that the sensitivity of this system would allow detection of
any ratio above 0.02. (Bottom) Globin chain synthesis in K101.
Blot analysis and in situ hybridization (see Materials and Methods)
indicated that most H-101 hybrid cells contain a single copy of the
(aa)'" chromosome (see Materials and Methods).
Sequence analysis of the a globin genes on the
chromosome. Because the a thalassemia determinant lies
in cis to the 62-kb deletion, either the a genes are inactivated
as a direct result of the deletion or another inactivating
mutation(s) must exist on this chromosome. The most likely
site for such a mutation(s) would be within the transcription
units of the a genes themselves. Therefore, both a1 and a2
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
225
A DELETION UPSTREAM OF THE a GLOBIN CLUSTER
genes were cloned from DNA obtained from H-101, which
contains the
chromosome, and the sequences from
- 175 to +897 ( a t )or +893 (a2)with respect to the mRNA
CAP site were determined (ie, from 175 nucleotides upstream of the transcription initiation site to 50 nucleotides
downstream of the poly(A) addition site). The sequences of
both the a1 and a2 genes between -175 and the poly(A)
addition site (see Fig 4) were identical to previously published sequences from nonthalassemic individuals (see legend
to Fig 4). However, in the a1 gene there were three
previously undescribed variant nucleotides in the 3' noncoding region beyond the poly (A) addition site (Fig 4), two of
which have also been noted in the sequence of a functional a
gene (Horst J. and Griese E.-U., personal communication,
January 1990). In the a 2 gene there was a previously
undescribed variant nucleotide 27 base pairs beyond the poly
(A) addition site in a region where the sequences of the a1
and a 2 genes are divergent. Because none of these mutations
falls within a region of the gene that is known to be important
in controlling globin gene regulation, it seems very unlikely
that they could account for the inactivation of both a genes
on the (aa)"*chromosome.
DISCUSSION
The initial observation of a large deletion upstream of the
a globin genes in a patient with a-thalassemia' suggested
that this mutation was responsible for the phenotype. Nevertheless, we could not exclude the possibility that there was a
second mutation either in cis or trans to this deletion that
accounted for the a-thalassemia. Such instances have been
noted in populations in which thalassemia is common. For
example, deletions of the a cluster that have no effect on
phenotype, such as those that result in a chromosome with a
single {gene (Q) rather than the normal (Q-t,b{l) arrangement, may occur in cis or trans to other a-thalassemia
mutations.' Furthermore, double mutations affecting the /3
globin cluster have been described in Sardinian patients with
an unusual form of 6$-thalassemia3' and in a single patient
with a &thalassemia mutation in cis to a variant?6 Double
mutations of the a genes have also been described in Algerian
and a small,
patients. In this case there is a large deletion (-a)
dinucleotide deletion in the remaining a gene.37 However,
such occurrences would be quite unexpected in an individual
from a population in which a-thalassemia is otherwise rare.38
We have now clearly demonstrated that the (aa)"" chromosome, with the 62-kb deletion, accounts for the a-thalassemia phenotype in this family. Although this suggests even
more strongly that the deletion is primarily responsible for
the a-thalassemia, it is clearly impossible to rule out a second
inactivating mutation on this chromosome with absolute
certainty, since not all of the cis-acting sequences required
for a globin gene expression have yet been identified.
However, no mutations were found within the transcription
chromosome,
units of the a1 and a2 genes from the
and it seems very unlikely that the previously unreported
sequence changes in their divergent 3' noncoding regions
could severely downregulate both a genes.
Thus, the most plausible explanation is that the deletion is
primarily responsible for downregulating the expression of
the a globin genes. This could be due to a negative element
CAAT
I
AATAAA
'iACAP
I ATG
Gr
AG
AG
Gr
TAA
I
97(al)
+893(a2)
(~L)RA
a1
a2
( U 2 )RA
1
C*
G
G*
CAGCCTGTGTGTGCCTGAGTTTTTTCCCTC_AG_AAACGTGCCA-GC-ATGG
G
C C TG CC -G
T
-A A
A
Fig 4. Sequence analysis of the a1 and a2 genes from the (aaIRA
chromosome. (MI, Exons:(O). introns; and ( ) the 5' and 3' noncoding
regions. The local consensus sequences that are important for the regulation of gene expression' are indicated above. The only differences
noted between these genes end previously published sequences were beyond the polylA) addition site (marked by the arrow) as set out in
the figure. The sequence presentedcorresponds to the segment indicated by the black bar above. Two of the variants noted in the a1 gene
(indicated by asterisks) have also been observed in a functional -a3.'haplotype (Horst J. and Griese E.-U.. personal communication,
January 1990). Two other differences between these sequences and the published sequence of Michelson and OrkinJOwere also noted.
Codon 65 in both a1 and a2 genes was GCG not GCC. and position -76 with respect to the poly(A) addition site of the a2 gene was C. not
A. Although dHerent from the sequence of Michelson and Orkin. both of these sequences were identical to previously reported sequences
from normal individuals?'.J2
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
HATTON ET AL
226
from beyond coordinate -52 being juxtaposed close to the CY
genes. Alternatively, the large 62-kb deletion could perturb
the higher order chromatin structure around the CY globin
complex in a relatively nonspecific manner, although other
large insertions (+ 10 kb) and deletions (- 10 kb) within the
a complex do not appear to alter the expression of the CY genes
in a significant way.8,39-41
The third possible mechanism by which the deletion could
inactivate the CY genes is by the removal of a specific positive
regulatory element(s) that is essential for their expression.
The existence of such positive regulatory sequences is suggested by previous observations that when DNA fragments
containing just the a or @ globin genes are assayed in
experimental erythroid systems (transient assay^,^"^^ stable
transform ant^:^ or transgenic m i ~ e ,the
~ ~genes
, ~ ~are either
inactive or, at best, are expressed at a level that is considerably less (often less than 1%) than that of the endogenous
genes. Furthermore, the levels of expression are dependent on
the site of integration in the genome. However, a and @ genes
transferred to interspecific human x MEL cell hybrids on
chromosomes 16 and 11, respectively, are induced and
expressed at a level approximately equal to that of the
endogenous mouse globin genes.17334.45.48
The implications of
these observations are that additional cis-regulatory sequences, remote from the structural genes, are required to
produce high levels of tissue-specific expression that are
independent of the position of integration.
It has recently been demonstrated that such positive
regulatory sequences exist upstream of the human @ globin
gene cluster.49 Furthermore, three different deletions that
each remove these sequences severely downregulate 0 globin
gene expre~sion.~'-~*
The positive regulatory sequences in the
@ globin cluster (referred to as the @-dominant control
region[@-DCR]or p-locus activating region [@-LAR])confer high level and position independent expression on the
@-likegenes when constructs containing both the DCR and
the gene(s) are transfected and integrated into the genome of
MEL cells or transgenic mice.49s53-56
Recently, it has also
been shown that the @-DCRcan exert a similar effect on the
a globin genes in these experimental systems.46347
Therefore,
it seems probable that similar positive regulatory sequences
exist upstream of the human CY globin cluster and that these
sequences are deleted in the (aa)"" chromosome. Therefore,
the characterization of this naturally occurring mutant
points to the region to be investigated in the search for such
positive regulatory sequences in the CY globin complex.
ACKNOWLEDGMENT
We are grateful to D.J. Weatherall for his encouragement and
support. We also thank R.A. and his family for their help and
cooperation in this study. We thank Margaret Baron for kindly
supplying the plasmids used in the nuclease protection assays. We
are grateful to Professor J. Horst and Dr E.-U. Griese for communicating their unpublished sequence data from the -a3 determinant.
'
REFERENCES
1. Breuning MH, Madan K, Verjaal M, Wijnen JT, Meera Khan
P, Pearson PL: Human a-globin maps to pter-p13.3 in chromosome
16 distal to PGP. Hum Genet 76:287, 1987
2. Buckle VJ, Higgs DR, Wilkie AOM, Super M, Weatherall DJ:
Localisation of human a globin to 16~13.3-pter.J Med Genet
25347, 1988
3. Lauer J, Shen C-KJ, Maniatis T: The chromosomal arrangement of human a-like globin genes: Sequence homology and a-globin
gene deletions. Cell 20:119, 1980
4. Proudfoot NJ, Gil A, Maniatis T: The structure of the human
zeta-globin gene and a closely linked, nearly identical pseudogene.
Cell 31553, 1982
5. Hsu S-L, Marks J, Shaw J-P, Tam M, Higgs DR, Shen CC,
Shen C-KJ: Structure and expression of the human 8, globin gene.
Nature 331:94, 1988
6. Proudfoot NJ, Maniatis T: The structure of a human a-globin
pseudogene and its relationship to a-globin gene duplication. Cell
21537, 1980
7. Hardison RC, Sawada I, Cheng J-F, Shen C-KJ, Schmid CW:
A previously undetected pseudogene in the human alpha globin gene
cluster. Nucleic Acids Res 14:1903, 1986
8. Higgs DR, Vickers MA, Wilkie AOM, Pretorius IM, Jarman
AP, Weatherall DJ: A review of the molecular genetics of the human
a-globin gene cluster. Blood 73:1081, 1989
9. Nicholls RD, Fischel-Ghodsian N, Higgs DR: Recombination
at the human a-globin gene cluster: Sequence features and topological constraints. Cell 49:369, 1987
10. Weatherall DJ, Clegg JB: The Thalassaemia Syndromes (ed
3). Oxford, UK, Blackwell, 1981
11. Galanello R, Paglietti E, Melis MA, Giagu L, Cao A:
Hemoglobin inclusions in heterozygous alpha-thalassemia according
to their alpha-globin genotype. Acta Haematol (Basel) 72:34, 1984
12. Weatherall DJ, Clegg JB, Naughton MA: Globin synthesis in
thalassemia: An in vitro study. Nature 208:1061, 1965
13. Old JM, Higgs DR: Gene analysis. Methods in haematology,
vol 6, in Weatherall DJ (ed): The Thalassemias. Edinburgh, UK,
Churchill & Livingstone, 1983 p 74
14. Feinberg AP, Vogelstein B: A technique for radiolabelling
DNA restriction endonuclease fragments to high specific activity.
Anal Biochem 132:6,1983
15. Church GM, Gilbert W: Genomic sequencing. Proc Natl
Acad Sci USA 81:1991,1984
16. Deisseroth A, Hendrick D: Human a-globin gene expression
following chromosomal dependent gene transfer into mouse erythroleukemia cells. Cell 1555, 1978
17. Zeitlin HC, Weatherall DJ: Selective expression within the
human a globin gene complex following chromosome-dependent
transfer into diploid mouse erythroleukaemia cells. Mol Biol Med
1:489, 1983
18. Buckle VJ, Craig IW: In-situ hybridisation, in Davies KE
(ed): Human Genetic Diseases-A Practical Approach. Washington
DC, IRL, 1986, p 85
19. Maniatis T, Frisch EF, Sambrook J: Molecular Cloning: A
laboratory manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1982
20. Chomczynski P, Sacchi N: Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156, 1987
21. Zinn K, DiMaio D, Maniatis T. Identification of two distinct
regulatory regions adjacent to the human @-interferon gene. Cell
34365, 1983
22. Baron MH, Maniatis T: Rapid reprogramming of globin gene
expression in transient heterokaryons. Cell 46591, 1986
23. Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K,
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
A DELETION UPSTREAM OF THE a GLOBIN CLUSTER
Green MR: Efficient in vitro synthesis of biologically active RNA
and RNA hybridisation probes from plasmids containing a bacteriophage SP6 promotor. Nucleic Acids Res 12:7035, 1984
24. Krieg PA, Melton DA: Functional messenger RNAs are
produced by SP6 in vitro transcription of cloned cDNAs. Nucleic
Acids Res 12:7057, 1984
25. Kaiser K, Murray NE: The use of phage lambda replacement
vectors in the construction of representative genomic DNA libraries,
in Glover DM (ed): DNA Cloning-A Practical Approach. Washington, DC, IRL, 1988, p 1
26. Higgs DR, Hill AVS, Bowden DK, Weatherall DJ, Clegg JB:
Independent recombination events between duplicated human a
globin genes: Implications for their concerted evolution. Nucleic
Acids Res 12:6965, 1984
27. Kieny MP, Lathe R, Lecocq J P New versatile cloning and
sequencing vectors based on bacteriophage M13. Gene 26:91,1983
28. Maxam AM, Gilbert W: A new method for sequencing DNA.
Proc Natl Acad Sci USA 74:560,1977
29. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain-terminating inhibitors. Proc Natl Acad Sci USA 745463,
1977
30. Michelson AM, Orkin SH: Boundaries of gene conversion
within the duplicated human a-globin genes. Concerted evolution by
segmental recombination. J Biol Chem 258:15245, 1983
31. Liebhaber SA, Goossens M, Kan YW: Cloning and complete
nucleotide sequence of the human 5’ alpha globin gene. Proc Natl
Acad Sci USA 77:7054,1981
32. Liebhaber SA, Goossens M, Kan YW: Homology and concerted evolution at the a1 and a 2 loci of human a-globin. Nature
290:26, 198 1
33. Marks PA, Sheffrey M, Rikind RA: Induction of transformed cells to terminal differentiation and the modulation of gene
expression. Cancer Res 47:659, 1987
34. Anagnou NP, Yuan TY, Lim E, Helder J, Wieder S, Glaister
D, Marks B, Wang A, Colbert D, Deisseroth A: Regulatory factors
specific for adult and embryonic globin genes may govern their
expression in erythroleukemia cells. Blood 65:705, 1985
35. Pirastu M, Kan YW, Galanello R, Cao A: Multiple mutations
produce b$ thalassemia in Sardinia. Science 223:929, 1984
36. Baklouti F, Ouazana R, Gonnet C, Lapillone A, Delaunay J,
Godet J: @+-Thalassemiain cis of a sickle cell gene: Occurrence of a
promoter mutation on a Os chromosome. Blood 74:1817, 1989
37. Mode F, Lopez B, Henni T, Godet J: a-Thalassaemia
associated with the deletion of two nucleotides at position - 2 and
-3 preceeding the AUG codon. EMBO J 4:1245,1985
38. Flint J, Hill AVS, Weatherall DJ, Clegg JB, Higgs DR:
Alpha globin genotypes in two north European populations. Br J
Haematol63:796, 1986
39. Winichagoon P, Higgs DR, Goodbourn SEY, Clegg JB,
Weatherall DJ: Multiple arrangements of the human embryonic
zeta globin genes. Nucleic Acids Res 105853, 1982
40. Felice AE, Cleek MP, Marino EM, McKie K, McKie VC,
Change BK, Huisman THJ: Different zeta globin gene deletions
among black Americans. Hum Genet 73:221, 1986
41. Trent RJ, Mickelson KNP, Wilkinson T, Yakas J, Dixon
227
MW, Hill PJ, Kronenberg H: Globin genes in Polynesians have
many rearrangements including a recently described yyyy/. Am J
Hum Genet 39:350, 1986
42. Mellon P, Parker V, Gluzman Y, Maniatis T: Identification of
DNA sequences required for transcription of the human al-globin
gene in a new SV40 host-vector system. Cell 27:279, 198 1
43. Treisman R, Green MR, Maniatis T: Cis and trans activation
of globin gene transcription in transient assays. Proc Natl Acad Sci
USA 80:7428,1983
44. Humphries RK, Ley T, Turner P, Moulton AD, Nienhuis
AW: Differences in human a-,@- and &globin gene expression in
monkey kidney cells. Cell 30:173, 1982
45. Charnay P, Treisman R, Mellon P, Chao M, Axel R,
Maniatis T: Differences in human a-and &globin gene expression in
mouse erythroleukemia cells: The role of intragenic sequences. Cell
38:251, 1984
46. Ryan TM, Behringer RR, Townes TM, Palmiter RD, Brinster RL: High-level erythroid expression of human a-globin genes in
transgenic mice. Proc Natl Acad Sci USA 86:37, 1989
47. Hanscombe 0, Vidal M, Kaeda J, Luzzatto L, Greaves DR,
Grosveld F: High-level, erythroid-specific expression of the human
a-globin gene in transgenic mice and the production of human
hemoglobin in murine erythrocytes. Genes Dev 3:1572,1989
48. Deisseroth A, Hendrick D: Activation of phenotypic expression of human globin genes from non-erythroid cells by chromosomedependent transfer to tetraploid mouse erythroleukemia cells. Proc
Natl Acad Sci USA 76:2185,1979
49. Grosveld F, Blom Van Assendelft G, Greaves DR, Kollias G:
Position-independent, high-level expression of the human @-globin
gene in transgenic mice. Cell 51:975, 1987
50. Kioussis D, Vanin E, DeLange T, Flavell RA, Grosveld FG:
@-globin gene inactivation by DNA translocation in yo-thalassaemia. Nature 306:662, 1983
51. Curtin P, Pirastu M, Kan YW, Gobert-Jones JA, Stephens
AD, Lehmann H: A distant gene deletion affects @-globin gene
function in an atypical [email protected] Clin Invest 76:1554, 1985
52. Driscoll MC, Dobkin CS, Alter BP: $8-Thalassemia due to
a de novo mutation deleting the 5’ 8-globin gene-activation hypersensitive sites. Proc Natl Acad Sci USA 86:7470, 1989
53. Blom van Assendelft G, Hanscombe 0, Grosveld F, Greaves
DR: The @-globindominant control region activates homologous and
heterologous promotors in a tissue-specific manner. Cell 56:969,
1989
54. Forrester WC, Novak U, Gelinas R, Groudine M: Molecular
analysis of the human @-globinlocus activation region. Proc Natl
Acad Sci USA 865439, 1989
55. Ryan TM, Behringer RR, Martin NC, Townes TM, Palmiter
RD, Brinster RL: A single erythroid-specific DNAse I superhypersensitive site activates high levels of human 8-globin gene
expression in transgenic mice. Genes Dev 3:314, 1989
56. Talbot D, Collis P, Antoniou M, Vidal M, Grosveld F,
Greaves DR: A dominant control region from the human @-globin
locus conferring integration site-independent gene expression. Nature 338:352, 1989
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
1990 76: 221-227
Alpha-thalassemia caused by a large (62 kb) deletion upstream of the
human alpha globin gene cluster
CS Hatton, AO Wilkie, HC Drysdale, WG Wood, MA Vickers, J Sharpe, H Ayyub, IM Pretorius, VJ
Buckle and DR Higgs
Updated information and services can be found at:
http://www.bloodjournal.org/content/76/1/221.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.