Buffers
Buffers …………………………………………………………………… 343 Buffers Overview 바이오니아는 생명공학 연구 분야에서 필수적으로 사용되는 40 여종의 Buffer와 Chemical을 직접 생산하여 판매하고 있습니 다. 기초 실험용 Buffer 및 Chemical을 포함하여 전기영동에 필 수적인 Buffer 와 DNA/RNA 추출시 사용되는 phenol류 등을 생산하여 판매하고 있습니다. Sequencing Kit 및 Silver staining Kit는 염기서열 분석시에 필수적으로 사용 되는 제품으로 바이오니아의 20년 Knowhow 와 국내 및 국제 특허를 통하여 기술력을 인증받았습니다. 바이오니아에서 공급하는 모든 Buffer와 Chemical은 엄격한 품 질관리시스템 하에서 생산되었으며, 높은 수준의 품질검사를 거 쳐 고객 여러분에게 제공되고 있습니다. 고객 여러분의 연구현 장에 바이오니아의 Buffer와 Chemical이 늘 함께 하겠습니다 343 Buffers Product Cat. No. Price ( 500 mL For acrylamide gel electrophoresis Acrylamide Bis-acrylamide Filtered with 0.2 um pore size Store at 4°C C-9001 가격문의 1 Gal For agarose & acrylamide gel electrophoresis Trizma base Boric acid 0.5M EDTA (pH 8.0) Autoclaved and DNase, RNase free Store at room temperature C-9002 가격문의 500 mL For hybridization Sodium chloride Sodium citrate Adjust the pH to 7.0 with NaOH Autoclaved and DNase, RNase free Store at room temperature C-9003 가격문의 50X TAE 500 mL For agarose gel electrophoresis Trizma base Acetic acid 0.5M EDTA (pH 8.0) Autoclaved and DNase, RNase free Store at room temperature C-9004 가격문의 TE (pH 8.0) 500 mL 10 mM Tris-HCl (pH 8.0) 1 mM EDTA Autoclaved and DNase, RNase free Store at room temperature C-9005 가격문의 C-9005-1 가격문의 500 mL 10 mM Tris-HCl (pH 7.4) 1 mM EDTA Autoclaved and DNase, RNase free Store at room temperature C-9005-2 가격문의 500 mL Trizma base Adjust the pH to 8.0 with HCl Autoclaved and DNase, RNase free Store at room temperature C-9006 가격문의 40% Acrylamide 5X TBE 20X SSC TE (pH 7.6) TE (pH 7.4) 1M Tris-HCl(pH 8.0) 344 Size 500 mL Description 10 mM Tris-HCl (pH 7.6) 1 mM EDTA Autoclaved and DNase, RNase free Store at room temperature ) Buffers Product Size Description Cat. No. Price ( ) 500 mL Trizma base Adjust the pH to 7.6 with HCl Autoclaved and DNase, RNase free Store at room temperature C-9006-1 가격문의 500 mL Trizma base Adjust the pH to 7.4 with HCl Autoclaved and DNase, RNase free Store at room temperature C-9006-2 가격문의 500 mL EDTA Adjust the pH to 8.0 with NaOH Autoclaved and DNase, RNase free Store at room temperature C-9007 가격문의 500 mL Sodium acetate Adjust the pH to 5.2 with acetic acid Autoclaved and DNase, RNase free Store at room temperature C-9008 가격문의 3M Sodium Acetate (pH 7.0) 500 mL Sodium acetate Adjust the pH to 7.0 with acetic acid Autoclaved and DNase, RNase free Store at room temperature C-9008-1 가격문의 EtBr (10 mg/mL) 25 mL Ethidium bromide Distilled water Store at 4°C C-9009 가격문의 2 mL Deionized formamide 0.5M EDTA (pH8.0) 0.025% Xylene cyanol FF 0.025% Bromophenol blue Store at -20°C C-9010 가격문의 500 mL Third distilled Water Filtered with 0.2 um pore size Autoclaved and DNase, RNase free Store at room temperature C-9011 가격문의 500 mL Assay 99.7% Hygroscopic CH3NO/FW : 45.04 Store at 4°C C-9012 가격문의 500 mL Redistilled and collected at 182°C Mp : 40±2°C / bp : 182°C Flash point : + 79°C Density : 1.0710 C6H6O/FW : 94.1 Store at -20°C C-9013 가격문의 1M Tris-HCl (pH 7.6) 1M Tris-HCl (pH 7.4) 0.5M EDTA (pH 8.0) 3M Sodium Acetate (pH 5.2) Sequencing gel loading buffer Deionized sterile DW Deionized Formamide Phenol 345 Buffers Product Cat. No. Price ( 500 mL Suitable for use in RNA purification Saturated with 0.1M citrate buffer (pH 4.3) Phenol phase is pH 4.3±0.2 C6H6O/FW : 94.1 Store at 4°C C-9014 가격문의 Equilibrated Phenol B 500 mL Suitable for use in DNA purification Saturated with 0.1M Tris-HCl (pH 8.0) 1 mM EDTA, phenol phase is pH 8.0±0.2 C6H6O/FW : 94.1 Store at 4°C C-9015 가격문의 5:1 Phenol:Chloroform 500 mL Suitable for use in RNA purification Saturated with 0.1M citrate buffer (pH 4.3) Phenol phase is pH 4.3±0.2 C6H6O/FW : 94.1 Store at 4°C C-9016 가격문의 500 mL Suitable for use in DNA purification Saturated with 0.1M Tris-HCl (pH 8.0) 1 mM EDTA, phenol phase is pH 8.0±0.2 Phenol:Chloroform:Isoamylalcohol(25:24:1) Store at 4°C C-9017 가격문의 C-9018 가격문의 Equilibrated Phenol A 25:24:1 Phenol : Chloroform : Isoamylalcohol Description For slab gel type polyacrylamide gel (for HT-GA) UV-Gel Mix A(250 ml bottle) 5X4 reactions UV-Gel Mix B(125 ml bottle) 5X4 reactions disc filter 0.2 5 ea 50 ml syringe 5 ea 50 ml squeeze bottle 2 ea Protect from sun light Store at room temperature ) Accu-UV Gel Mix 30 mL 10M Ammonium acetate 500 mL Ammonium acetate Filtered with 0.45 um pore size Store at 4°C C-9019 가격문의 1M Potassium acetate (pH 7.5) 500 mL Potassium acetate Adjust the pH to 7.5 with 2M acetic acid Autoclaved and DNase, RNase free Store at 4°C C-9020 가격문의 500 mL For preparing competent cells CaCl2·2H2O Filtered with 0.2 um pore size Store at 4°C C-9021 가격문의 500 mL MgCl2·6H2O Autoclaved and DNase, RNase free Dispense into aliquots Store at 4°C C-9022 가격문의 1M CaCl2 (Calcium Chloride) 1M MgCl2 (Magnesium Chloride) 346 Size Buffers Product Size Description Cat. No. Price ( ) 500 mL MgSO4·7H2O Autoclaved and DNase, RNase free Store at room temperature C-9023 가격문의 Phosphate-buffered saline(PBS) 500 mL Sodium chloride Potassium chloride Na2HPO4 KH2PO4 Adjust the pH to 7.4 with HCl Autoclaved and DNase, RNase free Store at room temperature C-9024 가격문의 5M NaCl (Sodium chloride) 500 mL Sodium chloride Autoclaved and DNase, RNase free Store at room temperature C-9025 가격문의 1M KCl (Potassium chloride) 500 mL Potassium chloride Autoclaved and DNase, RNase free Store at room temperature C-9026 가격문의 500 mL SDS Heat to 68°C to assist dissolution Adjust the pH to 7.2 with HCl Store at room temperature C-9027 가격문의 500 mL For hybridization Sodium chloride NaH2PO4·H2O EDTA Adjust the pH to 7.4 with NaOH Autoclaved and DNase, RNase free Store at room temperature C-9028 가격문의 2 mL For DNA electrophoresis 40 % Sucrose 0.05 % Bromophenol blue 0.05 % Xylene cyanol FF Store at -20°C C-9029 가격문의 500 mL For RNA Water DEPC(Diethyl pyrocarbonate) Stirred for overnight Autoclaved and DNase, RNase free Store at room temperature C-9030 가격문의 500 mL For denaturing agarose gel electrophoresis(for RNA) 200 mM MOPs 50 mM Sodium acetate (pH 7.0) 10 mM EDTA Autoclaved and DNase, RNase free Store at room temperature C-9031 가격문의 1M MgSO4 (Magnesium sulfate) 10% Sodium dodecyl sulfate(SDS,Sodium lauryl sulfate) 20X SSPE 6X Agarose Gel Loading Buffer DEPC-DW 10X MOPs Buffer 347 Buffers Product 348 Size Description RNA Loading Buffer (without EtBr) 2 mL For RNA electrophoresis Deionized formamide Formaldehyde 10X MOPs buffer 500mM EDTA (pH7.4) 0.025% Xylene cyanol FF 0.025% Bromophenol blue Store at -20°C 10N NaOH (Sodium hydroxide) 500 mL Sodium hydroxide Store at room temperature Cat. No. Price ( ) C-9032 가격문의 C-9034 가격문의 Chemicals ……………………………………………………………… 350 Chemicals IPTG(Isopropyl-ß-D-thiogalactopyranoside) 의 inducer로써 되어있는 gene 발현을 유도하는데 사용됩니다. -galactosidase activity Product Size Description Cat. No. Price ( ) C-8001 가격문의 IPTG, 99% (Isopropyl- -D -thiogalactopyranoside) 1g Formula : C9H18O5S M.W. : 238.3 Form : Dry powder Store at 4°C IPTG, 99% (Isopropyl- -D thiogalactopyranoside) 5g 동일 C-8001-1 가격문의 IPTG, 99% (Isopropyl- -D thiogalactopyranoside) 25 g 동일 C-8001-2 가격문의 X-Gal (5-Bromo-4chloro-3-indolyl-ß-D-galactopyranoside) 와 함께하는 galactosidase activity를 확인하는데에 사용되는 lacZ 또는 lacZ α-peptide gene을 가지는 vector로 형 질 전환딘 균주를 선별 할 수 있다. IPTG Product Size Description X-Gal(5-Bromo-4chloro-3indolyl- -D -galactopyranoside) 100 mg Formula : C14H15BrCINO6 M.W. : 408.6 Concentration: 50 mg/mL in dimethylformamide Store at -20°C X-Gal(5-Bromo-4chloro-3indolyl- -D -galactopyranoside) 500 mg 동일 Cat. No. Price ( ) C-8002 가격 문의 C-8002-1 가격 문의 Agarose Product 350 Size Description Cat. No. Price ( ) Agarose 100 g Form : White powder Sulphate <0.01% Gel strength (1.5 %)>1,600 g/cm2 Melting temp (1.5 %) 88~90°C Gel temp (1.5 %) 37~39°C Store at room temperature C-9100 가격 문의 Agarose 500 g 동일 C-9100-1 가격 문의 …………………………………… …………………………………………… ……………………………………………… AccuPower DNA Sequencing Kit TopTM DNA Sequencing Kit SilverStar Staining Kit 352 354 355 AccuPower DNA Sequencing Kit Overview 는 에 필요한 모든 성분이 으로 하나의 에 동결건조 처리된 로서 빠르고 정확하게 염기서열을 분석할 수 있 습니다 주형 를 증폭시키기 위해 을 사용하여 고온에서 반응을 수행하므 로 의 과정이 필요 없을 뿐만 아니라 주형 의 차 구조나 높은 함량에 의 한 문제점을 최소화 시킬 수 있습니다 또한 를 포함하고 있어 의 을 최소화 시킬 수 있습니 다 의 을 에 한 다음 유전자조작에 의해 의 활성을 제거시킨 를 사용함으로써 가 최소화되어 최상의 결과를 얻을 수 있습니다 는 에 필요한 모든 성분이 공급되는 로서 빠르고도 안전한 에 의해 유전자 서열을 분석할 수 있습니 다 의 을 에 한 다음 유전자 조작에 의해 의 활성을 제거시 킨 를 사용함으 로써 일정한 와 를 최소화시킨 최 상의 결과를 얻을 수 있습니다 AccuPower짋 DNA Sequencing Kit sequencing premix type tube sequencing kit . DNA thermalcyclic technique sequencing double strand DNA alkaline denaturation DNA 2 GC . 7-deaza dGTP band compression . Thermus thermophilus DNA polymerase gene E.coli cloning 5'->3' sequencing grade TopTM exonuclease DNA polymerase band intensity background sequencing . TopTM DNA Sequencing Kit Sequencing solutin type sequencing kit silver staining . Thermus thermophilus DNA polymerase sequencing grade (TopTM DNA polymerase) gene E.coli cloning 5'->3' exonuclease Sequencing grade TopTM DNA polymerase band intensity background sequencing . Features and Benefits 쪾Sensitivity & reproducibility 모든 구성성분을 동결 건조시켜 1회분씩 제공됨으로 편리하게 사용 할 수 있으며, 특허 받은 물질이 첨가되어 있어 제품의 안 정성이 높고, 보관성이 뛰어나며 실험 재현성을 최대화 합니다. G/A/T/C 각 tube에 반응에 필요한 모든 구성성분이 premix되 어 동결건조상태로 존재합니다. G mix : ddGTPs/dNTPs A mix : ddATPs/dNTPs T mix : ddTTPs/dNTPs C mix : ddCTPs/dNTPs 각 mix는 buffer, Top DNA polymerase를 모두 포함되어 있 습니다. **Sequencing 반응에 영향을 주지 않는 특정 dye를 포함하여, mix과정을 직접 확인, 반응액의 손실 우려에 대한 모니터링이 가능합니다. **반복적이고 번거로운 pipetting 조작을 최소화, mixing time 축소 및 이에 따른 실험 오류를 방지합니다. TM 352 Storage Store at -20°C Exiperimental data Figure. 1. The sequence analysis of plasmid DNA. DNA sequence analysis of purified plasmid DNA 1 ug of the purified sample was sequenced using AccuPower DNA Sequencing Kit (K-1010) and stained by Silverstar Staining Kit (K-1050) 와 적정농도 References1. Template DNA primer PCR product(200 bp ± ) Primer(17-24mer) ) Plasmid DNA(3,000 bp ± Primer(17-24mer) 기준 기준 100~300 ng 20~30 pmoles 1~2 ug 20~30 pmoles References2. Primer Sequences M13/pUC(-47) Forward Primer 24mer 5' d(CGCCAGGGTTTTCCCAGTCACGAC)-3' M13/pUC(-48) Reverse Primer 24mer 5' d-d(AGCGGATAACAATTTCACAGGA)-3' AccuPower DNA Sequencing Kit Ordering Information Cat. No. Product Description K-1010 AccuPower DNA Sequencing Kit, 25 rxns, 0.5 ml tube PreMix type K-1010-1 AccuPower DNA Sequencing Kit, 24 rxns, 0.2 ml 8-strip tube PreMix type Price 가격 문의 가격 문의 353 TopTM DNA Sequencing Kit Features and Benefits 을 반응할 수 있는 양 Cat. No. K-1020 Contents : 100 samples 500 U TopTM DNA polymerase 200 uL 4d/ddNTP Mixes(7-Deaza dGTP), each 500 uL 10 x Reaction Buffer 1.6 mL Stop Solution 100 uL M13/pUC(-47) forward primer(10 pmoles/ ul) 1 ea Technical Manual 을 반응할 수 있는 양 Cat. No. K-1021 Contents : 500 samples 2,500 U TopTM DNA polymerase 1 mL 4d/ddNTP Mixes(7-Deaza dGTP), each 2.5mL 10 x Reaction Buffer 8 mL Stop Solution 500 uL M13/pUC(-47) forward primer(10 pmoles/ ul) 1 ea Technical Manual Storage Condition 。 Store at -20 C . Caution 녹일 시에는 ice 상태에서 온도를 유지시켜 주십시오. Enzyme 은 첨가된 안정화 물질에 의해 장기 보관 시 안정합니다. Table1. Comparison of TopTM DNA polymerase with other sequencing grade enzymes TopTM DNA polymerase Sequencing Grade Enzyme polymerase T7 Sequenase Klenow Fragment Processivity High High Moderate Low Rate of incorporation (dNTPs/sec) >600 >600 >300 12 Exonuclease activity 5’->3’ exonuclease inactivated by deletion 5’->3’ exonuclease inactivated by deletion 3’->5’ exonuclease inactivated by deletion 3’->5’ exonuclease inactivated by deletion MW(Dalton) 60,000 80,000 84,000 75,000 Readable data(bp) 10-600 10-500 -700 Organism Thermus thermophilus HB7 Thermus aquaticus T7 bacteriophage E.coli Ordering Information Cat. No. 354 Product Description K-1020 TopTM DNA Sequencing Kit, 100 rxns, Each tube K-1021 Top DNA Sequencing Kit, 500 rxns, Each tube TM Price 가격 문의 가격 문의 SilverStar Staining Kit Overview 기존의 Silver staining system보다 DNA검출 민감도를 20배 이상 높일 수 있도록 고안된 Enhancing solution*을 포함하는 제품입니다. Enhancing solution에 의해 높은 민감도를 가지 는 Silverstar짋 Staining Kit는 적은 양(1 pg DNA/mm2 band cross-selection)의 DNA도 검출가능하며, DNA sequencing 용 gel뿐만 아니라 DDRT, SSCP, VNTR, RAPD 등 다양한 분 석에 적용할 수 있습니다. 방사선 동위원소를 사용하지 않으므 로 안전하게 실험을 할 수 있을 뿐만 아니라, Kit를 구성하는 각각의 시약들이 1회용으로 개별 포장되어 있어 사용하기에 편 리합니다. Silver에 의한 DNA분석의 또 하나의 장점은 신속한 결과 확인에 있습니다. 방사선 동위원소에 의한 detection 결 과는 하루 이상의 시간이 경과된 후 확인이 가능한 반면 gel의 fixing, staining, developing 3단계에 의해 이루어지는 DNA silver staining은 1시간 30분 안에 결과를 확인할 수 있습니다. Storage Condition Store at room temperature Silver Staining . 십시오 에 사용되는 물은 반드시 3차 증류수를 이용하 * Licensed from Bioneer Corporation under U.S. Pat. No. 6,127,122 * Licensed from Bioneer Corporation under Korea. 229508 제 특허 Exiperimental data Features and Benefits Procedures 1. Glass Coat Treatment: for long glass(separation) 15 min 2. Glass Bind Treatment: for short glass(binding) 15 min 3. Gel making & Pre-running/Running 2-4 hr 4. Fixing: by 10% acetic acid 30 min 5. Enhancing: by Enhancing solution 30 min 6. Staining: by Silver Nitrate 30 min 7. Developing: by Sodium Carbonate 5-10 min 8. Stopping & Washing: 10% acetic acid 5 min 9. Drying: on finish Figure1. Patten of differentially displayed mRNA using RT/PCR PreMix. A total RNA was purified from endothelial cell(-) and Rsa. induced endothelial cell(R). dT-(G/AC) indicates oligo dT11-(G/AC) primer and AP1indicates arbitrary primer1. Ordering Information Cat. No. Product Description K-1050 Silverstar Staining Kit, 20 gels K-1050-1 Glass Coat, 25 mL x 2 ea K-1050-2 Glass Bind, 25 mL x 2 ea Price 가격 문의 가격 문의 가격 문의 355 356
© Copyright 2024