1. No category

http://researchspace.auckland.ac.nz
ResearchSpace@Auckland
Copyright Statement
The digital copy of this thesis is protected by the Copyright Act 1994 (New
Zealand).
This thesis may be consulted by you, provided you comply with the
provisions of the Act and the following conditions of use:
•
•
•
Any use you make of these documents or images must be for
research or private study purposes only, and you may not make
them available to any other person.
Authors control the copyright of their thesis. You will recognise the
author's right to be identified as the author of this thesis, and due
acknowledgement will be made to the author where appropriate.
You will obtain the author's permission before publishing any
material from their thesis.
To request permissions please use the Feedback form on our webpage.
http://researchspace.auckland.ac.nz/feedback
General copyright and disclaimer
In addition to the above conditions, authors give their consent for the
digital copy of their work to be used subject to the conditions specified on
the Library Thesis Consent Form.
AAV-vector Mediated Gene Delivery
for Huntington’s Disease:
An Investigative Therapeutic Study
Adrian P. Kells
A thesis submitted in fulfillment of the requirements for the
Degree of Doctor of Philosophy in Pharmacology
at The University of Auckland, March, 2007.
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Abstract
Progressive degeneration in the central nervous system (CNS) of Huntington’s disease (HD) patients is
a relentless debilitating process, resulting from the inheritance of a single gene mutation. With limited
knowledge of the underlying pathological molecular mechanisms, pharmaceutical intervention has todate not provided any effective clinical treatment strategies to attenuate or compensate the neuronal
cell death. Attention has therefore turned to biotherapeutic molecules and novel treatment approaches
to promote restoration and protection of selectively vulnerable populations of neurons in the HD brain.
Rapid advances in vectorology and gene-based medicine over the past decade have opened the way for
safe and efficient delivery of biotherapeutics to the CNS. With numerous factors known to regulate
the development, plasticity and maintenance of the mammalian nervous system many proteins have
emerged as potential therapeutic agents to alleviate HD progression. This investigative study utilised
gene delivery vectors derived from the non-pathogenic adeno-associated virus (AAV) to direct highlevel expression of brain-derived neurotrophic factor (BDNF), glial cell-line derived neurotrophic
factor (GDNF), Bcl-xL or X-linked inhibitor of apoptosis protein (XIAP) within the rodent striatum.
Maintenance of the basal ganglia and functional behaviour deficits were assessed following excitotoxic
insult of the striatum by quinolinic acid (QA), a neurotoxic model of HD pathology.
Enhanced striatal expression of BDNF prior to QA-induced lesioning provided maintenance of the
striosome-matrix organisation of the striatum, attenuating impairments of sensorimotor behaviour with
a 36-38% increase in the maintenance of DARPP-32 / krox-24 expressing striatal neurons, reduced
striatal atrophy and increased maintenance of striatonigral projections.
Higher levels of BDNF
however induced seizures and weight-loss highlighting the need to provide regulatable control over
biotherapeutic protein expression.
Continuous high-expression of BDNF or GDNF resulted in a
downregulation of intracellular signal mediating proteins including DARPP-32, with AAV-GDNF not
found to enhance the overall maintenance of striatal neurons. Neither of the anti-apoptotic factors
provided significant protection of transduced striatal neurons but tended towards ameliorating QAinduced behavioural deficits, displaying behaviour – pathology correlations with the survival of
parvalbumin-expressing neurons in the globus pallidus. The results of this thesis suggest BDNF as a
promising putative biotherapeutic for HD, but emphasises the requirement to control expression
following gene delivery, and for further elucidation of the physiological impact that enhanced
expression of endogenous factors has on the host cells.
Additionally the maintenance of neural
networks beyond the caudate-putamen will be vital to ensuring efficient clinical outcomes for HD.
II
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Acknowledgements
I wish to specifically convey my gratitude to a number of people who have assisted either directly or
indirectly over the past four years to ensuring the completion of this thesis.
Specifically I would like to thank my supervisor Dr Bronwen Connor for having provided the
opportunity to have conducted this research. Bronwen has always been optimistic towards all aspects
of the research providing valuable rationality to study design and assessment, while always
encouraging self belief to pursue my own initiatives.
Thanks to Professor Richard Faull, my co-supervisor. A radiating enthusiasm for life and Richard’s
passion to unravel the workings of the human brain was a constant inspiration. His interest in this
study and vast knowledge of neuroanatomy always provided a fresh perspective to my evaluation.
To Andrew, Rebecca, Kevin and Elena, your company as fellow PhD students throughout the highs
and lows of our complementary investigations has been truly invaluable, and I sincerely wish you each
the best in all your future endeavours. Particular thanks to Rebecca for patiently guiding me around
the invisible barriers of molecular biology, and to Andrew for assistance with animal modelling and
numerous discussions of the subsequent neurogenic phenomena – a welcome distraction.
Dr Stephanie Hughes, for your counsel surrounding methodology and constructive feedback on written
aspects of this thesis, I extent my gratitude. And to my remaining colleagues in the Neural Repair and
Neurogenesis Laboratory and wider HRC Neuroscience collaboration that have provided advice,
support and friendship, thank you.
To all the staff of the Animal Resource Unit, your always willing assistance to ensure the greatest of
care was provided for the multitude of rats that enabled these investigations to be conducted has been
greatly appreciated.
Finally to my Parents who have provided unwavering moral support throughout all of my university
studies and have always encouraged me to pursue my own interests, without your loving support this
thesis would not have been possible. And lastly to Petrea for your loyal friendship and patience in
enduring with me through the final year of this thesis – this journey is now complete.
Financial support of this thesis was provided by an Auckland Medical Research
Foundation research grant, and scholarships awarded by both the NZ Foundation for
Research Science and Technology, and The University of Auckland.
III
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Journal Publications
Research Articles
Kells AP, Henry RA, Connor B. (2007) AAV-BDNF Mediated Attenuation of QA-Induced
Neuropathology and Motor Function Impairment. Submitted to Gene Therapy.
Kells AP, Henry RA, Connor B. (2007) AAV-Mediated Expression of Bcl-xL or XIAP Fails to
Increase Neuronal Resistance against QA-induced Striatal Lesioning. Submitted to Experimental
Neurology.
Kells AP, Henry RA, Hughes SM, Connor B. (2006) Verification of Functional AAV-mediated
Neurotrophic and Anti-apoptotic Factor Expression. Journal of Neuroscience Methods. 161(2):
291-300
Abstracts
Kells AP, Henry RA, Hughes SM, Faull, RLM, Connor B. (2007) Attenuation of Functional Deficits
in the QA Model of Huntington’s Disease following AAV Vector Delivery. 10th Annual Meeting of
the American Society of Gene Therapy, Seattle, WA, USA. Molecular Therapy 15: S209
Kells AP, Henry RA, Hughes SM, Faull, RLM, Connor B. (2006) Protection against Huntington’s
Disease Progression: AAV-mediated Delivery of Biotherapeutics. 9th Annual Meeting of the
American Society of Gene Therapy, Baltimore, MD, USA. Molecular Therapy 13: S96
Kells AP, Henry RA, Hughes SM, Faull, RLM, Connor B. (2005) Investigating the Protective Effect
of GDNF and Bcl-xL Gene Delivery in a Rat Model of Huntington’s Disease. 9th International
Conference on Neural Transplantation and Repair, Taipei, Taiwan.
IV
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Table of Contents
Abstract
II
Acknowledgements
III
Journal Publications
IV
List of Figures
XII
List of Tables
XV
Abbreviations
XVI
Chapter 1
Review of Published Literature
1
1.1
Huntington’s Disease ..........................................................................................................1
1.2
Huntington’s Disease: Neuropathology .............................................................................2
1.3
Animal Models of Huntington’s Disease............................................................................5
1.3.1
Transgenic models of Huntington’s disease
5
1.3.2
Chemical neurotoxin models of Huntington’s disease
6
1.4
Therapeutic Intervention for Huntington’s Disease..........................................................8
1.5
In vivo Gene Delivery Vectors ..........................................................................................10
1.6
1.7
1.8
1.5.1
Herpes simplex and adeno viral vectors
10
1.5.2
Adeno-associated viral vectors
11
1.5.3
Lentiviral vectors
13
Neurotrophic Factors as Biotherapeutic Agents for HD.................................................13
1.6.1
Nerve growth factor
15
1.6.2
Brain derived neurotrophic factor
16
1.6.3
Glial cell-line derived neurotrophic factor
22
1.6.4
Ciliary neurotrophic factor
23
Apoptosis and Huntington’s Disease Neurodegeneration ...............................................24
1.7.1
Anti-apoptotic Bcl-2 and Bcl-xL proteins
29
1.7.2
Inhibitors of apoptosis
30
Summary...........................................................................................................................31
V
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
1.9
Thesis Objectives ..............................................................................................................33
Chapter 2
Adeno-Associated Viral Vectors: Plasmid Cloning,
Vector Packaging and In Vitro Functional Testing
35
2.1
Overview ...........................................................................................................................35
2.2
AAV Vector Development and Production Procedures ..................................................35
2.3
2.4
2.2.1
Molecular biology protocols
2.2.1.1 PCR Cloning
2.2.1.2 Agarose Gel Extraction
2.2.1.3 p-GEM®-T Easy Vector
2.2.1.4 Heatshock Transformation
2.2.1.5 Colony PCR
2.2.1.6 Restriction Enzyme Digestions
2.2.1.7 Ligation into the AAV Expression Cassette
2.2.1.8 Plasmid Amplification and Purification
2.2.1.9 DNA Sequencing
36
36
37
38
38
38
38
39
39
40
2.2.2
AAV plasmid construction
40
2.2.3
Mammalian cell culture and analysis protocols
2.2.3.1 HEK 293 and HT-1080 Cell Culture
2.2.3.2 In Vitro Immunocytochemistry
2.2.3.3 Hoechst Nuclear Staining
44
44
45
45
2.2.4
AAV expression cassette transfection testing
46
2.2.5
AAV vector production
2.2.5.1 Packaging and Purification of AAV Vector Particles
2.2.5.2 Genomic Particle Titre
46
46
47
2.2.6
In vitro transduction testing
48
Functional AAV-Mediated Protein Expression Testing In Vitro ....................................49
2.3.1
Isolating and culturing primary cells
49
2.3.2
AAV-BDNF
50
2.3.3
AAV-GDNF
50
2.3.4
AAV-Bcl-xL
51
2.3.5
AAV-XIAP
52
Results ...............................................................................................................................52
2.4.1
AAV plasmid construction
52
2.4.2
AAV vector production
54
2.4.3
AAV vector transduction
54
2.4.4
Functional protein expression
2.4.4.1 Brain Derived Neurotrophic Factor
2.4.4.2 Glial cell-lne Derived Neurotrophic Factor
56
56
56
VI
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
2.4.4.3 Bcl-xL
2.4.4.4 X-linked Inhibitor of Apoptosis Protein
2.5
59
61
Discussion..........................................................................................................................64
2.5.1
AAV vector construction
2.5.2
Functional protein expression
65
2.5.2.1 Differentiation Assays to Confirm Neurotrophic Factor Activity 65
2.5.2.2 Cell-Survival Assays to Confirm Anti-Apoptotic Protein Function 68
2.5.3
Summary
Chapter 3
64
69
Rodent Model of Huntington’s Disease: Quinolinic
Acid Lesion
71
3.1
Introduction ......................................................................................................................71
3.2
Optimisation and Characterisation Procedures ..............................................................71
3.3
3.4
3.2.1
Animals and surgeries
71
3.2.2
Behavioural assessment
72
3.2.3
Neuropathological analysis
72
QA Lesion Optimisation Analysis ....................................................................................73
3.3.1
Initial QA trial
73
3.3.2
Trial 2: Lower QA quantity
74
3.3.3
Trial 3: Behaviour testing – 30nmol QA
76
3.3.4
QA lesion model characterisation – 50nmol QA
76
3.3.4.1 Functional Behaviour Assessment of Unilateral QA Lesioned Rats 77
3.3.4.2 Neuropathological Assessment of QA Lesion
79
Discussion..........................................................................................................................82
3.4.1
QA-induced neuropathology
82
3.4.2
QA-induced behavioural impairments
83
Chapter 4
Neuroprotective Study Methods
85
4.1
Overview ...........................................................................................................................85
4.2
Neuroprotective Investigations ........................................................................................86
4.3
4.2.1
In vivo expression testing
86
4.2.2
Initial investigations: AAV-BDNF (high-titre), AAV-GDNF, AAV-Bcl-xL
86
4.2.3
Follow-up investigations: AAV-BDNF (diluted), AAV-Bcl-xL, AAV-XIAP
87
Animals .............................................................................................................................88
VII
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
4.4
4.5
Stereotaxic Surgeries: AAV Vector Delivery and QA Injection .....................................89
4.4.1
Operating procedure
89
4.4.2
Determination of initial AAV vector injections parameters
90
Functional Behavioural Analysis .....................................................................................92
4.5.1
Spontaneous exploratory forelimb use
92
4.5.2
“Corridor” task
93
4.5.3
Drug-induced rotational analysis
94
4.6
Quantitative Transgene ELISA........................................................................................95
4.7
Immunohistochemical Analysis........................................................................................96
4.8
4.7.1
Brain tissue collection and processing
96
4.7.2
DAB-staining immunocytochemistry protocol
97
4.7.3
Fluorescent immunocytochemistry analysis
98
4.7.4
Microscopy and stereology
4.7.4.1 Striatal Neuron Stereology
4.7.4.2 Striatal Atrophy
4.7.4.3 Striatal TH-Staining Intensity
4.7.4.4 Maintenance of Striatonigral Projections
4.7.4.5 Pallidal Neuron Stereology
4.7.4.6 Confocal Microscopy
99
99
100
100
100
100
100
Statistical Analysis ..........................................................................................................101
Chapter 5
Neurotrophic Factor Delivery: AAV-BDNF and AAVGDNF
102
5.1
Overview .........................................................................................................................102
5.2
Procedures ......................................................................................................................102
5.3
Animal Welfare...............................................................................................................103
5.4
In Vivo AAV Vector Testing...........................................................................................104
5.5
BDNF and GDNF Expression Level ..............................................................................106
5.6
Functional Behaviour Assessment .................................................................................107
5.6.1
Spontaneous forelimb use
108
5.6.2
Drug-induced rotational behaviour
5.6.2.1 Apomorphine
5.6.2.2 Amphetamine
111
111
113
5.6.3
Sensorimotor “corridor” task
114
VIII
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
5.7
5.8
Immunocytochemical Analysis.......................................................................................115
5.7.1
AAV-mediated transgene expression and QA lesioning of the striatum
5.7.1.1 Initial Study – AAV-BDNF and AAV-GDNF Delivery
5.7.1.2 Study 2 – Reduced Titre AAV-BDNF Delivery
5.7.1.3 Stereological Analysis – DARPP-32
5.7.1.4 Striatal Atrophy
116
117
119
120
122
5.7.2
Krox-24 expression
123
5.7.3
Analysis of transduced striatal cells
127
5.7.4
Dopaminergic innervations of the striatum
131
5.7.5
Cortical projection fibres in the striatum
133
5.7.6
Striatal projection nuclei
5.7.6.1 Substantia Nigra
5.7.6.2 Globus Pallidus
134
134
137
5.7.7
Pathological correlations with functional behaviour impairments
5.7.7.1 Spontaneous Ipsilateral Forelimb Use Bias
5.7.7.2 Contralateral Sensorimotor Neglect
5.7.7.3 Apomorphine-Induced Rotations
140
140
141
142
Discussion........................................................................................................................144
5.8.1
AAV-mediated BDNF or GDNF expression prior to QA
5.8.1.1 Undiluted AAV-BDNF
5.8.1.2 AAV-GDNF
144
144
146
5.8.2
Reduced-titre AAV-BDNF behavioural and pathological protection
5.8.2.1 Behavioural Protection
5.8.2.2 Neuropathological Protection
5.8.2.3 Pathological and Behavioural Correlations
149
149
151
153
5.8.3
Conclusion
155
Chapter 6
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAVXIAP
156
6.1
Overview .........................................................................................................................156
6.2
Procedures ......................................................................................................................156
6.3
In Vivo AAV Vector Testing...........................................................................................157
6.4
Bcl-xL and XIAP Expression Level ................................................................................160
6.5
Functional Behaviour Assessment .................................................................................161
6.5.1
Spontaneous forelimb use
161
6.5.2
Drug-induced rotational behaviour
6.5.2.1 Apomorphine
6.5.2.2 Amphetamine
164
165
166
IX
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
6.5.3
6.6
6.7
Sensorimotor “corridor” task
167
Immunocytochemical Analysis.......................................................................................168
6.6.1
AAV-mediated transgene expression and QA lesioning of the striatum
6.6.1.1 Study 1 – AAV-Bcl-xL Delivery
6.6.1.2 Study 2 – AAV-Bcl-xL and AAV-XIAP Delivery
6.6.1.3 Stereological Analysis – DARPP-32
6.6.1.4 Striatal Atrophy
168
168
170
171
173
6.6.2
Krox-24 expression
174
6.6.3
Analysis of transduced striatal cells
176
6.6.4
Dopaminergic innervations of the striatum
178
6.6.5
Cortical projection fibres in the striatum
179
6.6.6
Striatal projection nuclei
6.6.6.1 Substantia Nigra
6.6.6.2 Globus Pallidus
181
181
184
6.6.7
Pathological correlations with functional behaviour impairments
6.6.7.1 Spontaneous Forelimb Use
6.6.7.2 Sensorimotor Neglect
6.6.7.3 Apomorphine-Induced Rotations
187
187
188
189
Discussion........................................................................................................................190
6.7.1
AAV-mediated Bcl-xL or XIAP expression prior to QA
6.7.1.1 Neuropathological Changes
6.7.1.2 Behavioural Protection
190
191
192
6.7.2
Comparison with previous studies
194
6.7.3
Conclusion
194
Chapter 7
General Discussion
196
7.1
AAV-mediated Gene Delivery........................................................................................196
7.2
Preventative Therapy for Huntington’s Disease ...........................................................198
7.3
Conclusion.......................................................................................................................204
Appendix A: Gene Sequences and DNA Plasmids
A.1
206
cDNA Gene Sequences....................................................................................................206
A.1.1
Brain Derived Neurotrophic Factor
206
A.1.2
Glial cell-line Derived Neurotrophic Factor
207
A.1.3
Bcl-xL
208
A.1.4
X-linked Inhibitor of Apoptosis
208
X
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
A.2
DNA Plasmid Maps ........................................................................................................210
A.2.1
AAV Backbone Plasmid
210
A.2.2
AAV-Luciferase
211
A.2.3
AAV Helper Plasmids
A.2.3.1 AAV rep and cap genes
A.2.3.2 Adenoviral packaging genes
212
212
213
Appendix B: General Materials & Protocols
214
B.1
Molecular Biology...........................................................................................................214
B.2
Cell Culture.....................................................................................................................215
B.2.1
Tissue culture media
215
B.2.2
Cell counting
215
B.3
AAV Vector Genomic Titering ......................................................................................216
B.4
Immunocytochemistry Buffers.......................................................................................216
B.5
Antibodies .......................................................................................................................217
Literature References
218
XI
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
List of Figures
Chapter 1
Review of Published Literature
Figure 1-1
Potential mechanisms of mutant huntingtin induced cellular pathogenesis.....................4
Figure 1-2
Co-transfection rAAV packaging ................................................................................12
Figure 1-3
TrkB signalling pathways controlling dendritic protein synthesis ................................18
Figure 1-4
Mutant huntingtin disrupts transcription of BDNF and vesicle transportation from
the cortex to the striatum. ............................................................................................20
Figure 1-5
Potential involvement of Ca2+ signalling in the induction of apoptosis in HD ..............26
Figure 1-6
Mitochondrial permeabilisation in intrinsic apoptosis..................................................27
Figure 1-7
Model of neurotrophic factor and anti-apoptotic factor supplied protection. ................32
Chapter 2
Adeno-associated Viral Vectors
Figure 2-1
AAV expression plasmid ............................................................................................41
Figure 2-2
Transfection of AAV backbone plasmids ....................................................................53
Figure 2-3
AAV vector transduction in vitro ................................................................................55
Figure 2-4
Phenotypic differentiation of primary striatal cultures .................................................57
Figure 2-5
AAV-BDNF induced calbindin expression in embryonic striatal cultures....................57
Figure 2-6
Phenotypic differentiation of primary ventral mesencephalon cultures ........................58
Figure 2-7
AAV-GDNF induced TH expression in ventral mesencephalon cultures .....................58
Figure 2-8
AAV-Bcl-xL reduced staurosporine-induced apoptosis ................................................59
Figure 2-9
AAV-Bcl-xL transduced cortical cells following staurosporine-induced apoptosis .......60
Figure 2-10
AAV-XIAP reduced staurosporine-induced apoptosis .................................................61
Figure 2-11
Enhanced survival of AAV-XIAP transduced HT-1080 cells ......................................63
Chapter 3
Rodent Model of Huntington's Disease
Figure 3-1
Initial 100 and 50 nmol QA lesion assessment ............................................................74
Figure 3-2
QA lesion testing: 50 and 30 nmol intrastriatal QA injections .....................................75
Figure 3-3
QA lesioning induced behavioural deficits ..................................................................78
Figure 3-4
Pathological characterisation of the 50nmol QA lesion................................................80
Figure 3-5
Striatal interneurons following QA lesioning...............................................................81
Chapter 4
Neuroprotective Study Methods
Figure 4-1
Neuroprotective study timeline ...................................................................................85
Figure 4-2
Intrastriatal AAV vector delivery ................................................................................91
XII
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Figure 4-3
Spontaneous exploratory forelimb use.........................................................................92
Figure 4-4
Sensorimotor “corridor” task.......................................................................................94
Figure 4-5
Drug-induced rotational behaviour ..............................................................................95
Chapter 5
Neurotrophic Factor Delivery
Figure 5-1
Spread of undiluted AAV-BDNF transduction and BDNF expression .......................104
Figure 5-2
Spread of AAV-GDNF transduction and GDNF expression ......................................105
Figure 5-3
Spread of the reduced-titre AAV-BDNF transduction and BDNF expression ............106
Figure 5-4
ELISA quantification of BDNF and GDNF expression in the striatum ......................107
Figure 5-5
Spontaneous ipsilateral forelimb use asymmetry score ..............................................109
Figure 5-6
Spontaneous exploratory rearing activity...................................................................110
Figure 5-7
Apomorphine-induced rotational behaviour ..............................................................112
Figure 5-8
Total apomorphine-induced rotations ........................................................................113
Figure 5-9
Amphetamine-induced rotational behaviour ..............................................................114
Figure 5-10
Preferential food selection in the sensorimotor “corridor” task ..................................115
Figure 5-11
High-titre AAV-BDNF transduction and striatal cell maintenance ............................116
Figure 5-12
AAV-GDNF transduction and striatal cell maintenance ............................................117
Figure 5-13
AAV-Luciferase transduction and striatal cell maintenance.......................................118
Figure 5-14
Diluted AAV-BDNF administration and striatal cell maintenance .............................119
Figure 5-15
Two-site AAV-Luciferase injection and striatal cell maintenance..............................120
Figure 5-16
Maintenance of DARPP-32 positive striatal projection neurons.................................121
Figure 5-17
Atrophy of the lesioned striatum ...............................................................................123
Figure 5-18
Double-immunofluorescent labelling of striatal neurons............................................124
Figure 5-19
Krox-24 expression in the striatum............................................................................125
Figure 5-20
Maintenance of krox-24 expressing striatal neurons ..................................................126
Figure 5-21
Immunofluorescent analysis of AAV-Luciferase transduced cells .............................128
Figure 5-22
Immunofluorescent analysis of AAV-BDNF transduced cells in the striatum ............129
Figure 5-23
Immunofluorescent analysis of AAV-GDNF transduced cells in the striatum............130
Figure 5-24
Tyrosine hydroxylase expression in the striatum .......................................................131
Figure 5-25
Maintenance of tyrosine hydroxylase striatal innervations.........................................132
Figure 5-26
SMI32 expression in the cortex and striatum.............................................................133
Figure 5-27
Visual assessment of the substantia nigra in control AAV-Luciferase treated rats......135
Figure 5-28
Visual assessment of the substantia nigra in reduced-titre AAV-BDNF treated rats...136
Figure 5-29
DARPP-32 innervations of the substantia nigra.........................................................137
Figure 5-30
Visual assessment of the globus pallidus following AAV-Luciferase treatment .........138
XIII
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Figure 5-31
Visual assessment of the globus pallidus following reduced-titre AAV-BDNF
treatment...................................................................................................................139
Figure 5-32
Survival of parvalbumin-positive neurons in the globus pallidus ...............................140
Figure 5-33
Preferential forelimb use correlation with striatum and globus pallidus cell loss........141
Figure 5-34
Sensorimotor neglect correlation with striatal and pallidal neuronal cell loss.............142
Figure 5-35
Correlation of apomorphine-induced rotational behaviour with striatal and pallidal
neuronal cell loss ......................................................................................................143
Chapter 6
Anti-apoptotic Factor Delivery
Figure 6-1
Single delivery site for AAV-Bcl-xL transduction and subsequent Bcl-xL expression 157
Figure 6-2
AAV-Bcl-xL transduction and Bcl-xL expression following two-site striatal delivery 158
Figure 6-3
Spread of AAV-XIAP transduction and subsequent XIAP expression .......................159
Figure 6-4
ELISA quantification of Bcl-xL and XIAP expression in the striatum ........................161
Figure 6-5
Spontaneous ipsilateral forelimb use asymmetry scores.............................................162
Figure 6-6
Spontaneous exploratory rearing activity...................................................................163
Figure 6-7
Apomorphine-induced rotational behaviour ..............................................................164
Figure 6-8
Total apomorphine-induced rotations ........................................................................165
Figure 6-9
Amphetamine-induced rotational behaviour ..............................................................166
Figure 6-10
Preferential food selection in the sensorimotor “corridor” task ..................................167
Figure 6-11
Single injection site AAV-Bcl-xL transduction and striatal cell maintenance..............169
Figure 6-12
Dual injection site AAV-Bcl-xL transduction and striatal cell maintenance ................170
Figure 6-13
Dual injection site AAV-XIAP transduction and striatal cell maintenance.................171
Figure 6-14
Maintenance of DARPP-32 striatal projection neurons..............................................172
Figure 6-15
Atrophy of the lesioned striatum ...............................................................................173
Figure 6-16
Krox-24 expression in the striatum............................................................................175
Figure 6-17
Maintenance of krox-24 expressing striatal neurons ..................................................176
Figure 6-18
Immunofluorescent double-labelling of AAV-Bcl-xL transduced striatal neurons ......177
Figure 6-19
Immunofluorescent double-labelling of AAV-XIAP transduced striatal neurons .......178
Figure 6-20
Tyrosine hydroxylase expression in the striatum .......................................................179
Figure 6-21
SMI32 expression in the striatum ..............................................................................180
Figure 6-22
DARPP-32 innervations of the substantia nigra.........................................................181
Figure 6-23
Visual assessment of the substantia nigra in AAV-Bcl-xL treated rats........................182
Figure 6-24
Visual assessment of the substantia nigra in AAV-XIAP treated rats.........................183
Figure 6-25
Survival of parvalbumin-positive neurons in the globus pallidus ...............................184
Figure 6-26
Visual assessment of the globus pallidus following AAV-Bcl-xL treatment ...............185
Figure 6-27
Visual assessment of the globus pallidus following AAV-XIAP treatment ................186
XIV
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Figure 6-28
Preferential forelimb usage correlation with neuron loss in the striatum and globus
pallidus .....................................................................................................................187
Figure 6-29
Sensorimotor neglect correlation with striatal and pallidal neuronal cell loss.............188
Figure 6-30
Correlation of apomorphine-induced rotational behaviour with striatal and pallidal
neuronal cell loss ......................................................................................................189
List of Tables
Chapter 1
Table 1-1
Chapter 2
Review of Published Literature
Neuronal phenotypes within the striatum.......................................................................3
Adeno-associated Viral Vectors
Table 2-1
Source of cDNA sequences and AAV Plasmids ..........................................................41
Table 2-2
PCR primer sequences ................................................................................................42
Table 2-3
Genes-of-interest.........................................................................................................43
Table 2-4
New England Biolabs (NEB) restriction enzymes and buffers .....................................43
Table 2-5
Primary antibodies for in vitro immunocytochemistry.................................................45
Table 2-6
Genomic titres of AAV vector stocks..........................................................................54
Chapter 3
Table 3-1
Chapter 4
Rodent Model of Huntington's Disease
QA lesion optimisation trials.......................................................................................72
Neuroprotective Study Methods
Table 4-1
Stereotaxic injection coordinates for AAV vector delivery ..........................................86
Table 4-2
First neuroprotective investigation timeline.................................................................87
Table 4-3
Second neuroprotective investigation timeline.............................................................87
Table 4-4
Allocation of animals ..................................................................................................88
Table 4-5
Dilutions used for ELISA quantification of in vivo transgenic protein expression. .......96
Table 4-6
Primary antibodies for DAB-staining immunocytochemistry.......................................98
Table 4-7
Antibodies for co-immunofluorescent labelling...........................................................99
XV
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
Abbreviations
3-NP
AAV
ABTS
Ad
Amp
ANOVA
A-P, M-L, D-V
BCA
Bcl-xL
BDNF
BSA
CAG
CBA
cDNA
ChAT
CIP
CMV
CNS
CNTF
Ct
DAB
DARPP-32
DMEM
DNA
E14/15
EDTA
E. coli
FBS
GABA
GDNF
GFRα1
GPe
GPi
HA
HD
Hdh
3-nitropropionic acid
Adeno-associated virus
2,2-Azino-di-3-ethylbenzthiazoline sulfonate
Adenovirus
Ampicillin
Analysis of variance
Anterior-Posterior, Medial-Lateral, Dorsal-Ventral
Bicinchinonic acid
Bcl-2-like protein long
Brain derived neurotrophic factor
Bovine serum albumin
Cytosine-adenine-guanine
Chicken-β-actin
Complementary DNA
Choline acetyltransferase
Calf intestinal phosphatase
Cytomegalovirus
Central nervous system
Ciliary neurotrophic factor
Cycle time
3-3 diaminobenzidine tetrahydrochloride
Dopamine- and adenosine 3', 5'-monophosphate-regulated phosphoprotein of 32 kDa
Dulbecco's Modified Eagle's Medium
Deoxyribonucleic acid
Embryonic day 14/15
Ethylenediaminetetraacetic acid
Escherichia coli
Fetal bovine serum
Gamma-amino butyric acid
Glial cell-line derived neurotrophic factor
GDNF family receptor α-1
Globus pallidus external segment
Globus pallidus internal segment
Hemagglutinin
Huntington’s disease
Huntingtin gene
XVI
AAV-vector Mediated Gene Delivery for Huntington’s Disease: An Investigative Therapeutic Study
HEK293
HIAP
HSV
HT-1080
IAP
IMDM
ITR
LB
Luc
LV
MAPK
N171-82Q
NADPHd
NAIP
NEB
NeuN
NGF
NMDA
NOS
NR2B
p75NTR
PBS
PCR
Pen
PNS
poly-Q
QA
R6/2
rh
RM ANOVA
SNc
SNr
ssDNA
Strep
STS
TE
TH
WPRE
XIAP
Human embryonic kidney 293 cells
Human inhibitor of apoptosis
Herpes simplex virus
Human osteosarcoma cells
Inhibitor of apoptosis protein
Iscove’s Modified Dulbecco’s Media
Inverted terminal repeats
Luria-Bertani broth
Luciferase
Lentivirus
Mitogen-activated protein kinase
Transgenic mice with 171aa N-terminal fragment of Hdh with 82 CAG repeats
Nicotinamide adenine diphosphate diaphorase
Neuornal apoptosis inhibitor protein
New England Biolabs
Neuronal nuclei
Nerve growth factor
N-methly-D-aspartate
Nitric oxide synthase
NMDA receptor 2B subunit
p75 neurotrophin receptor
Phosphate buffered saline
Polymerase chain reaction
Penicillin
Peripheral nervous system
poly-glutamine tract
Quinolinic acid
Transgenic mice with exon 1 of Hdh containing ~150 CAG repeats
Recombinant human
Repeated measures analysis of variance
Substantia nigra pars compacta
Substantia nigra pars reticulata
Single-stranded DNA
Streptomycin
Staurosporine
Tris-EDTA buffer
Tyrosine hydroxylase
Woodchuck hepatitis post-transcriptional regulatory element
X-linked inhibitor of apoptosis
XVII
Review of Published Literature
Chapter 1
Review of Published Literature
1.1 Huntington’s Disease
Huntington’s disease (HD) is an autosomal dominant genetic disorder that causes relentless
neurodegeneration resulting in a progressive decline of physical motor function, cognitive abilities,
and psychiatric disturbances first described by George Huntington (1872). Affecting up to 1 in
10,000 people depending on geographical location, physical HD symptom onset is generally between
30 and 50 years of age. While genetic testing is widely available to “at risk” relatives of HD
patients, no effective treatment exists to prevent the onset, slow the progression, or alleviate the
symptoms of HD.
Despite the identification of the causative genetic defect – a trinucleotide
cytosine-adenine-guanine (CAG) repeat expansion (>36 repeats) in exon-1 of the Hdh gene encoding
a 350kDa protein termed huntingtin (Huntington's Disease Collaborative Research Group 1993), it
remains elusive how this single gene defect results in the complex but selective pattern of HD
neurodegeneration (Borrell-Pages et al. 2006). Huntingtin protein is widely expressed within the
central nervous system (CNS) with the disease form containing an elongated polyglutamine (poly-Q)
tract within the N-terminal domain (Trottier et al. 1995). With the lack of a clear understanding as to
the molecular mechanisms connecting the selective cell death with the genetic defect, research
towards therapeutic treatment has been focused on pharmacological intervention in general cell death
processes, restoration of lost brain function by cellular transplantation, and genetic intervention to
reduced the susceptibility of affected neurons (for review see (Handley et al. 2006)).
Neurodegeneration generally occurs via three main mechanisms; metabolic compromise,
excitotoxicity, or oxidative stress, acting independently or cooperatively (Alexi et al. 1997).
Interfering with these processes or increasing the resistance of the neurons using neurotrophic factors
has shown encouraging results in improving behavioural function and preventing neurodegeneration
in HD models, thus providing hope that effective therapeutic treatment will soon become a reality for
HD patients and their families.
1
Review of Published Literature
1.2 Huntington’s Disease: Neuropathology
HD pathology is evident at a gross anatomical level by severe bilateral atrophy of the striatum and
neocortex.
Microscopically, neurodegeneration is most pronounced within the striatum where
GABAergic projection neurons are selectively lost while interneurons resist degeneration (Reiner et
al. 1988; Glass et al. 2000). The striatum is a highly organised structure receiving glutamatergic
innervations from all cortical regions in a topographical arrangement (McGeorge and Faull 1989),
and sending GABAergic efferent projections to the globus pallidus and substantia nigra, influencing
basal ganglia output, thereby making the striatum a vital processing centre coordinating mood and
movement (Selemon and Goldman-Rakic 1985; Alexander et al. 1986; Penney and Young 1986;
Brown et al. 1997; Smith et al. 1998). Disruption of striatal function, responsible for the
characteristic HD choreiform movements, is also likely to be the cause of the non-motor cognitive
and emotional symptoms of HD (Penney and Young 1986; Reiner et al. 1988; Mitchell 1990).
Vonsattel established a grading scale of end-point HD pathology based on post-mortem
histopathological examination of the caudate nucleus and putamen (Vonsattel et al. 1985). This fivepoint grading scale provides a semi-quantitative assessment of the extent of neuronal cell loss in the
caudate-putamen, and associated atrophy; with up to 30% neuronal loss but no apparent striatal
atrophy in Grade 0, through to a 95% depletion of striatal neurons, severe atrophy and extensive
gliosis in Grade 4.
Immunohistochemical studies of the striatum have identified a number of distinct populations of
neurons distinguishable by various neurochemical markers. The highly vulnerable GABAergic
medium spiny projection neurons, comprising up to 95% of all striatal neurons, are divided into two
groups by their neuro-modulatory transmitters’ enkephalin and substance P – corresponding with
different projection targets (Table 1-1). The vast majority of these GABAergic projection neurons
also contain the calcium binding protein calbindin, which is commonly used to visualise the extent of
neurodegeneration within post-mortem HD human brains and in animal models of HD. The high
expression of dopamine- and cAMP-regulated phosphoprotein of 32 kDa (DARPP-32) by
dopaminoceptive neurons can also be used as a general marker of the medium spiny projection
neurons and their terminal projections (Ouimet et al. 1984; Ouimet et al. 1998). In addition to the
projection neurons, the striatum also contains a varied population of interneurons of which the
majority are also GABAergic and the remaining neurons being large aspiny cholinergic interneurons
expressing the neurochemical marker choline acetyltransferase (ChAT). Aspiny GABAergic
interneurons are divided into three subpopulations determined by their expression of the
neurochemical markers calretinin, parvalbumin, or the co-expression of nicotinamide adenine
2
Review of Published Literature
diphosphate diaphorase (NADPHd), nitric oxide synthase (NOS), neuropeptide Y and somatostatin
(Table 1-1; (Alexi et al. 2000)).
Neurons
Transmitter
Neurochemical markers
Medium spiny projection neurons
- Striatopallidal (GPe)
GABA
Enkephalin, calbindin, DARPP-32
- Striatoentopenduncular (GPi)
and Striatonigral (SNr)
GABA
Substance P, dynorphin, calbindin,
DARPP-32
- Striatonigral (SNc)
GABA
Substance P, dynorphin, DARPP-32
- Large aspiny
ACh
ChAT
- Medium aspiny
GABA
NADPHd, NOS, neuropeptide Y,
somatostatin
- Medium aspiny
GABA
Parvalbumin
- Small aspiny
GABA
Calretinin
Aspiny interneurons
Table 1-1
Neuronal phenotypes within the striatum
Table modified from (Alexi et al. 2000) Progress in Neurobiology. Abbreviations: GPe, globus
pallidus external segment; GPi, globus pallidus internal segment; SNc, substantia nigra pars
compacta; GABA, γ-aminobutyric acid; ACh, acetylcholine; ChAT choline acetyltransferase;
DARPP-32, dopamine- and cAMP-regulated phosphoprotein of 32 kDa; NADPHd, nicotinamide
adenine diphosphate diaphorase; NOS nitric oxide synthase.
HD involves a complex pattern of striatal degeneration in which there is not uniform degeneration
throughout the striatum, but a “wave of degeneration” spreading laterally and ventrally through the
caudate nucleus, putamen and nucleus accumbens in succession (Vonsattel et al. 1985). Enkephalin
positive GABAergic medium spiny projection neurons projecting to the external globus pallidus are
usually the first to degenerate correlating with the appearance of choreiform movements and early
cognitive and psychiatric symptoms and indicating the degeneration / dysfunction of neurons within
the caudate nucleus, which are largely involved in cognitive functions as well as motor control
(Alexander et al. 1986; Reiner et al. 1988; Glass et al. 2000). Subsequent degeneration of substance
P / dynorphin positive GABAergic medium spiny projection neurons correlates more with the onset
of muscle dystonia (Reiner et al. 1988; Glass et al. 2000). Striatal interneurons are the least
vulnerable with several subpopulations relatively spared in HD, specifically the somatostatin,
neuropeptide Y, NADPHd positive and cholinergic interneurons (Reiner et al. 1988; Glass et al.
2000). Cortical neurons in layer III, V and VI of the cerebral cortex are also seen to degenerate in
HD (Vonsattel et al. 1985; Hedreen et al. 1991; Macdonald and Halliday 2002). With layer III and
V pyramidal neurons projecting to the striatum it is possible that the neurons are undergoing
3
Review of Published Literature
secondary neurodegeneration following the loss of striatal connections, however with layer VI
projecting to non-degenerative regions it would appear that independent degeneration is occurring
within the cortex (Hedreen et al. 1991). In more severe grades of HD, neuronal cell loss occurs in
many regions of the brain including the globus pallidus, subthalamic nucleus, cerebellum and
thalamus (Vonsattel and DiFiglia 1998).
This complex pattern of neurodegeneration does not reflect the expression pattern of huntingtin, nor
the pattern of neuronal intranuclear inclusion or neuropil aggregate formation, suggesting that other
Figure 1-1
Potential mechanisms of mutant huntingtin induced cellular pathogenesis
Huntingtin is predominantly a cytoplasmic protein involved in numerous processes including vesicle
transport of BDNF along microtubules through interaction with motor proteins which is inhibited by
the expanded poly-Q tract causing abnormal protein folding. Mutant huntingtin also undergoes
enhanced proteolytic cleavage with the N-terminal fragment containing the poly-Q repeat forming a
β-sheet structure that can cause cellular disruption either as soluble monomers, oligomers or as
insoluble aggregates. Toxicity in the cytoplasm may be induced via potentiation of NMDA
glutamate receptors, mitochondrial effects, caspase activation or cellular disruption by perinuclear or
neuritic aggregate formation. N-terminal fragments are also translocated to the nucleus where they
form intranuclear inclusions can interfere with gene transcription of neuroprotective molecules
including BDNF. (Reproduced from (Marx 2005), Science)
4
Review of Published Literature
factors contribute to the selective vulnerability of the GABAergic medium spiny projection neurons
(Saudou et al. 1998; Gutekunst et al. 1999). Although the molecular mechanism leading to HD
neurodegeneration are not fully understood, the wild-type huntingtin protein has been shown to have
clear roles in gene transcription, intracellular transport, and possesses anti-apoptotic properties; all of
which are disrupted by the expanded poly-Q tract (Figure 1-1; (Borrell-Pages et al. 2006)). The
disrupted regulation of transcription has been demonstrated by the reduced cytoplasmic sequestration
of the transcription factor that inhibits BDNF transcription leading to a reduction in BDNF
expression (Zuccato et al. 2001; Zuccato et al. 2003).
Following N-terminal cleavage and
translocation to the nucleus, a proposed requirement for HD neurodegeneration (Saudou et al. 1998),
the poly-Q-huntingtin fragment can interfere with the regulation of transcription across a broad range
of genes, inducing apoptosis (Luthi-Carter et al. 2000; Steffan et al. 2000; Nucifora et al. 2001).
Intracellular microtubule-based vesicle transportation mediated by the binding of huntingtin with
huntingtin-associated protein-1 and other components of the molecular motor machinery is disrupted
by the expanded poly-Q tract causing a reduction in the vesicular transportation of BDNF
(Engelender et al. 1997; Gauthier et al. 2004). Axonal transportation can also be physically blocked
by the formation of N-terminal huntingtin aggregates within the axons (Li et al. 2000; Gunawardena
et al. 2003).
1.3 Animal Models of Huntington’s Disease
Animal models of neurodegenerative diseases are vital for advancing the development of therapeutic
treatment strategies aimed at both preventing the degenerative progression and replacing the lost
neurons. The development of genetic models of HD since the identification of the causative CAG
repeat expansion in Hdh has greatly aided elucidation of pathological mechanisms and offer
alternative cellular and animal models of HD to the acute neurotoxin induced mimicking of
pathological neurodegeneration. Here I review current rodent models of HD with particular focus on
their suitability for investigation of preventative therapeutic strategies to attenuate HD-induced
neurodegeneration. The excitotoxic QA lesion model was ultimately selected as the most suitable
model readily available for this thesis neuroprotective investigation.
1.3.1
Transgenic models of Huntington’s disease
For HD, a single gene disorder, the possibility exists in theory that the exact neurodegenerative
processes should be replicable in transgenic models. Numerous transgenic mice have been generated
with either an N-terminal Hdh fragment containing an expanded CAG repeat in exon 1 (Mangiarini
5
Review of Published Literature
et al. 1996; Schilling et al. 1999; Laforet et al. 2001), full-length Hdh (Reddy et al. 1998; Hodgson
et al. 1999), or knock-in mice with additional CAG repeats inserted into the murine Hdh gene
(Shelbourne et al. 1999; Wheeler et al. 2000; Lin et al. 2001). However to date these transgenic
mice have not proven to completely replicate the specific neuronal cell death with only two lines
showing significant striatal cell loss (Reddy et al. 1998; Laforet et al. 2001), although they do
displayed some progressive phenotypic behaviours indicative of neurological impairment.
Specifically the transgenic R6/2 mice progressively develop an irregular gait, resting tremor,
stereotypic and abrupt irregularly timed movements, and epileptic seizures from nine weeks of age
coinciding with a loss in body weight leading to death at 10-13 weeks (Mangiarini et al. 1996).
Others show early hyperactivity followed by end stage hypoactivity (Reddy et al. 1998; Hodgson et
al. 1999; Laforet et al. 2001). The restricted lifespan of these models may explain the absence of cell
death despite neurological impairments and the presence of neuronal intranuclear inclusions,
consisting of N-terminal fragments of the expanded huntingtin protein, similar to those found in the
cortex and striatum of HD patients although these inclusions are more widespread in the transgenic
mice (Morton et al. 2000). More recently a transgenic rat model of HD has been developed that
better replicates the slow phenotypic progression of HD with emotional and cognitive impairments
proceeding motor impairments (von Horsten et al. 2003). Specific loss of striatal neurons and
intranuclear inclusions were evident from 12 months of age but not at six months, with no loss of
cortical neurons never seen (Kantor et al. 2006). While transgenic models have become very
valuable in elucidating the etiology of HD and the role of wild-type huntingtin, until recently they
have been of restricted use for neuronal rescue / repair studies in which neuronal loss and function
are the primary outcome measures.
Overall it has become apparent that the more genetically
accurate the model, the more subtle and variable the model becomes, and the greater it reflects the
variability that is seen amongst HD patients (Hersch and Ferrante 2004).
1.3.2
Chemical neurotoxin models of Huntington’s disease
As a substitute to genetic modelling, animal models that closely replicate the neuronal cell loss of
HD can be generated through either excitotoxic lesioning of the striatum or metabolic impairment via
mitochondrial disruption.
Early hypotheses of HD etiology suggested the involvement of
excitotoxins, with numerous studies using various excitotoxins to try and mimic the selective
neurodegeneration (Beal et al. 1986; Schwarcz et al. 1988; Bruyn and Stoof 1990; DiFiglia 1990;
Beal 1992a; Beal 1992b). Quinolinic acid (QA), an endogenous tryptophan metabolite present in the
human brain at low concentrations, has proved to be the most successful excitotoxin at reproducing
the selective degeneration of GABAergic medium spiny striatal projection neurons, while selectively
6
Review of Published Literature
sparing somatostatin / neuropeptide Y striatal interneurons and fibres of passage (Schwarcz and
Kohler 1983; Schwarcz et al. 1984; Beal et al. 1991; Brickell et al. 1999). Other excitotoxins, kanic
acid, ibotenic acid, and N-methly-D-aspartate (NMDA), do not produce the selective sparing
observed with QA (Beal et al. 1986). The resistance of neonatal animals and the high vulnerability
of GABAergic medium spiny striatal projection neurons to QA gives support to the QA excitotoxin
hypothesis of HD (Schwarcz et al. 1984). Neurons containing somatostatin or neuropeptide Y also
express NADPHd, which could conceivably contribute to their survival in HD by allowing these
neurons to take-up and metabolise QA (Schwarcz et al. 1984). This hypothesis that QA contributes
to HD pathogenesis was recently supported by van Horsten and colleagues (2003) suggesting from
indirect neurochemical data that QA synthesis may potentially be increased in their HD transgenic
rats, which also maintain susceptibility to the excitotoxicity of QA (Winkler et al. 2006). Similarly,
the chronic exposure to very low concentrations of QA has been shown to induce neuronal cell death
(Chiarugi et al. 2001), and just recently it has been reported that wild-type huntingtin protects striatal
neurons from QA-induced excitotoxicity (Leavitt et al. 2006).
While the extent to which QA contributes to clinical HD is still to be conclusively determined, QA
lesioned animals have been extensively used as models of HD pathology. Unfortunately while QA
generates some of the behavioural and pathological changes observed in HD, the progressive nature
of HD is not easily reproduced (Tobin and Signer 2000), with the majority of cell death occurring in
the three days following intrastriatal injection (Portera-Cailliau et al. 1995; Hughes et al. 1996), and
no further loss of phenotypic neuronal markers after seven days (Bazzett et al. 1994). Two models of
chronic QA administration – microdialytic pump (Bazzett et al. 1993; Bazzett et al. 1994), and
gradual release from polymeric implants (Haik et al. 2000) – have been developed and produce a
progressive lesion more characteristic of HD, however the acute intrastriatal QA injection protocol is
still widely utilized and readily produces consistent unilateral or bilateral striatal lesions.
The progressive nature of HD is slightly better mimicked by 3-nitropropionic acid (3-NP), an
irreversible inhibitor of succinate dehydrogenase that is commonly used as an alternative to
excitotoxic animal models (Alexi et al. 1998).
Inhibition of succinate dehydrogenase disrupts
mitochondrial respiration and prevents ATP synthesis causing cell death by both apoptotic and
necrotic mechanisms. The systemic administration of 3-NP via subcutaneously implanted minipumps causes the selective bilateral death of striatal GABAergic medium spiny projection neurons
while relatively sparing the striatal interneurons and fibres of passage and thereby closely mimicking
the pathology of HD (Borlongan et al. 1997). Systemic delivery allows for prolonged administration
and therefore generates a prolonged insult, causing progressive neurodegeneration somewhat
7
Review of Published Literature
reminiscent of the slow neuropathological progression of HD (Borlongan et al. 1997).
This
preferential loss of striatal projection neurons, over all other cell types following chronic systemic
delivery of 3-NP, gives significant support to the hypothesis that energy impairment plays a major
role in the etiology of HD. 3-NP does not however replicate the “wave of degeneration” or the
sequential loss of subpopulations of striatal GABAergic projection neurons that occurs in HD (Sun et
al. 2002). The striatal lesion is instead centred round the medial striatal artery and uniformly kills
the projection neurons regardless of their target efferent nuclei (Nishino et al. 1995).
In addition to the pathological neurodegeneration, the excitotoxic (QA) and energy impaired (3-NP)
animal models also show varying degrees of behavioural deficits (Shear et al. 1998). A range of
motor skill and cognitive function tests have been developed in addition to general open field
observational tests to quantify behavioural impairments following unilateral or bilateral striatal
lesions. Unilateral striatal lesions generally cause contralateral impairments of motor and sensory
function which are commonly assessed by forelimb akinesia (Olsson et al. 1995), “staircase” testing
– a measure of lateralised forelimb reaching and dexterity (Montoya et al. 1990; Montoya et al.
1991; Abrous et al. 1993), spontaneous exploratory forelimb use (Schallert et al. 2000), and sensory
neglect (Salzberg-Brenhouse et al. 2003; Dowd et al. 2005).
Amphetamine and apomorphine
induced ipsilateral rotational behaviour is also characteristic of unilateral lesions resulting from an
imbalance in striatal projection neurons or more specifically their dopamine receptors (Ungerstedt
1971; Schwarcz et al. 1979). Bilateral lesions show greater impairments in tests of cognitive ability
(e.g. alternation T-maze and Morris water maze) than unilateral lesions in which the unlesioned
hemisphere is though to be largely compensatory against the loss in cognitive ability (Pisa et al.
1981; Isacson et al. 1986; Popoli et al. 1994; Emerich et al. 1997a).
1.4 Therapeutic Intervention for Huntington’s Disease
The development of efficient therapeutic treatment strategies for neurodegenerative diseases has
been slow and relatively unsuccessful in generating long-term clinical benefits. The absence of longterm results for HD is thought to be related to the progressive nature of neurodegeneration, which is
not addressed by any currently available pharmacological treatments that provide some symptomatic
relief from the psychiatric disturbances, choreiform movements and cognitive deficits (Handley et al.
2006).
As the molecular mechanisms by which mutant huntingtin appears to elicit neurodegeneration are
pieced together, novel therapeutic approaches that directly interfere with the processing and
8
Review of Published Literature
abnormal function of mutant huntingtin are beginning to be investigated (Qin et al. 2005). However
with excitotoxicity appearing to play an important role in the selective pathology of HD, treatment
strategies directed at intervening in general processes of cell death – including caspase activation,
mitochondrial dysfunction and oxidative stress – may well hold significant clinical benefits for
preventative therapy (Leegwater-Kim and Cha 2004; Handley et al. 2006). Independent of the
specific therapeutic compound, efficient treatment against HD neurodegeneration will clearly require
continuous supply of the therapeutic to the vulnerable neurons. This poses challenges associated
with the need to cross the blood brain barrier, while avoiding deleterious side effects resultant from
interactions with non-targeted cells, effectively preventing systemic delivery of many potentially
beneficial compounds (Barinaga 1994; Tan and Aebischer 1996).
However a number of
pharmaceutical drugs – caspase inhibitors, mitochondrial enhancers and glutamate receptor blockers
– have now been examined in clinical trials, having previously shown sufficient efficacy in
preclinical research (Bonelli et al. 2004; Handley et al. 2006). With direct intraparenchymal infusion
of therapeutic agents limited by the physical requirements necessary to achieve long-term
administration, attention has been directed to the use of novel gene transfer techniques and cellular
transplantation to produce biotherapeutics in situ.
The use of encapsulated cells – ciliary neurotrophic factor (CNTF)-producing fibroblasts (Emerich et
al. 1996; Emerich et al. 1997b; Mittoux et al. 2000) or choroid plexus cells (Borlongan et al. 2004;
Emerich et al. 2006) – implanted into the striatum have provided protection against excitotoxic
neuronal death and behavioural deficits in both rodent and primate studies.
The in vitro
manipulation of cells prior to implantation in semi-permeable capsules allows direct assessment of
the secreted factors before implanting, with the encapsulation preventing host immune rejection and
also allowing for graft recovery (Tan and Aebischer 1996; Emerich 2004b). Encapsulated cell
implants do however suffer from limited diffusion and down-regulation of transgene protein
expression (Emerich et al. 1996; Emerich and Winn 2004a). Alternatively direct transplantation of
genetically modified cells (ex vivo gene therapy) can be performed with the potential for migration
throughout the striatum, thereby reducing required diffusion distances (Martinez-Serrano and
Bjorklund 1996). Transplantation of neuronal progenitor cells may also provide a method for
replacing lost neurons in a potential joint protection-restoration treatment approach (Fallon et al.
2000; Hsich et al. 2002). However cell grafts cannot be recovered in the event of adverse reactions,
although the incorporation of a suicide gene may allow for graft elimination (Garin et al. 2001).
In vivo gene delivery is appealing in that it potentially avoids a number of problems associated with
other methods of delivery, including the need for any permanent delivery device or the use of
9
Review of Published Literature
immortalized cell-lines and their potential adverse effects (Hsich et al. 2002). However, in vivo gene
delivery does rely on engineering the patients own host cells to drive production of the therapeutic
proteins and is not without its own disadvantages, including potential adverse toxicity, immune
responses, or oncogenic potential due to insertional mutagenesis (Monahan and Samulski 2000;
Hsich et al. 2002). The ongoing development of in vivo vectors with improved safety, control and
stability of transgene expression, and reduced pathogenicity / toxicity all increase the appeal of in
vivo gene therapy for long-term delivery of therapeutic proteins directly to vulnerable neurons.
With both ex vivo and in vivo gene therapy techniques showing promise for delivering
biotherapeutics to the CNS, I elected to employ a direct in vivo gene delivery technique allowing
direct manipulation of the vulnerable striatal neurons and thereby enabling the investigation of both
secreted and non-secreted intracellular acting therapeutic molecules using the same gene therapy
protocols.
1.5 In vivo Gene Delivery Vectors
The main requirement of vectors used for in vivo gene delivery to the CNS is their ability to
efficiently deliver transgenes to terminally differentiated neurons, generating stable protein
expression while avoiding the stimulation of inflammation and immunogenic host responses (Hsich
et al. 2002).
Viral-derived vectors have become the vectors of choice for many neurological
applications due to their natural inclination to transfer their genetic material to targeted cells
(Bjorklund et al. 2000; Hsich et al. 2002). The most promising vectors for direct CNS gene delivery
are derived from human viruses including herpes simplex virus (HSV), adenovirus (Ad), adenoassociated virus (AAV), and lentivirus (LV) (Thomas et al. 2003). Each of these vectors are briefly
reviewed here with particular emphasise on the properties of AAV vectors which I utilised for in vivo
transduction of the rodent striatal neurons in the neuroprotective investigations.
1.5.1
Herpes simplex and adeno viral vectors
First generation HSV and Ad vectors with large transgene capacities (HSV ~50kb, Ad 7.5kb) are
efficient for gene delivery to many brain cell types, however the expression of viral proteins
stimulate adverse immune reactions (Hsich et al. 2002). Elimination of viral genes has led to the
development of HSV amplicon vectors with essentially no toxicity, and “gutless” Ad vectors with
greatly reduced toxicity and immunogenicity (Thomas et al. 2000; Hsich et al. 2002). However,
transgene expression following Ad-mediated gene delivery is not long-lasting and the presence of
10
Review of Published Literature
neutralising antibodies against the Ad structural proteins block transduction following readministration of the same serotype vector (Zoltick et al. 2001). Pre-exiting immunity to HSV is
also a limiting factor for HSV vectors (Lauterbach et al. 2005), which also only generate transient
expression after elimination of the viral genes (Samaniego et al. 1997).
1.5.2
Adeno-associated viral vectors
AAV is a very small (25nm) non-pathogenic parvovirus dependent on a helper virus, usually
adenovirus, to proliferate. The wild-type AAV genome contains two open-reading frames rep (genes
required for replication) and cap (genes encoding the capsid proteins) flanked by 145 bp inverted
terminal repeat sequences (ITR; (Srivastava et al. 1983)). However only the ITR sequences are
required in cis for replication and encapsulation of single stranded DNA, up to ~4.7kb, into the
icosahedral AAV virion particle of 60 capsid proteins (Monahan and Samulski 2000; Hsich et al.
2002). This allows for the complete removal of viral genes in recombinant AAV (rAAV) vectors
eliminating the potential for an immune response against the expression of viral proteins (Jooss et al.
1998), although the production of neutralising antibodies against the capsid proteins is still a
concern, particularly for repeat vector delivery (Halbert et al. 2006). Production of rAAV vectors is
typically undertaken by DNA plasmid co-transfection of a packaging cell line, usually human
embryonic kidney 293 cells (HEK293), with the AAV-rep and -cap genes plus the necessary Ad
genes supplied on separate constructs in trans to the ITR-flanked AAV expression cassette (Figure
1-2; (Xiao et al. 1998)). With the characterisation of at least eight distinct serotypes of AAV
showing different host cell tropisms, and recent identification of over 100 additional variants (Gao et
al. 2004), the majority of attention for gene transfer has been given to serotype-2 as the first serotype
fully characterised (AAV2; (Samulski et al. 1982; Srivastava et al. 1983); for current review see (Wu
et al. 2006)). AAV2 alone presents strong affinity for the heparan sulphate proteoglycan receptor
which appears to mediate its binding-to and transduction of host cells (Summerford and Samulski
1998), and also allows heparin affinity column purification to produce high-titre recombinant vectors
(Zolotukhin et al. 1999). The apparent clinical safety of AAV2 as a gene delivery vector has now
been well tested in clinical trials (Carter 2005). With different serotype capsid proteins conferring
selective tissue and cellular tropism, attention has been directed to altering the tropism and
transduction efficiency of AAV2 and other AAV serotypes by either genetic alteration of the capsid
proteins (Muzyczka and Warrington 2005) or production of chimeric (also called mosaic) rAAV
virions containing a mixture of different capsid proteins to combine the transduction properties of
different serotypes (Hauck et al. 2003; Rabinowitz et al. 2004). In respect to the transduction of
neurons in the CNS, serotype-1 and -5 rAAV vectors display higher transduction efficiencies than
11
Review of Published Literature
AAV2 vectors (Davidson et al. 2000; Burger et al. 2004). Recent production of chimeric vectors
with serotype-1 and -2 capsid proteins (AAV1/2), combined in a 1:1 ratio and retaining the ability to
be purified by heparin column, show enhanced neuronal transduction over standard AAV2 vectors
(Hauck et al. 2003; Richichi et al. 2004).
In general the serotype-2 ITR sequences flanking the expression cassette have been retained, as the
cis-acting element to direct replication and packaging of the vector genome, irrespective of the
packaging capsids. While wild-type serotype-2 AAV can integrate into the human genome at a
specific site on chromosome 19 (Kotin et al. 1992), the rAAV vectors have been observed to
integrate at non-specific sites (Linden et al. 1996; Ponnazhagan et al. 1997; Yang et al. 1997)
however, the predominant persistence of the AAV genome in vivo is extrachromosomal as circular
monomeric or multimeric structures with enhanced episomal stability (Clark et al. 1997; Duan et al.
1998; Duan et al. 1999; Schnepp et al. 2005). With the high stability of AAV genome in host cells
the persistence of transgene expression following rAAV transduction appears dependent on the
regulatory elements controlling transgene expression. Transgene expression from the hybrid CMV-
Figure 1-2
Co-transfection rAAV packaging
Production of rAAV is typically undertaken by co-transfection of HEK293 cells with separate
plasmids containing the recombinant AAV genome (pAAV) with the expression cassette flanked by
ITRs (red), the AAV rep and cap genes (pHelper), and a plasmid containing the necessary Ad viral
genes (pAd). The trans acting AAV rep and Ad genes direct replication of single stranded rAAV
genome and encapsulation into AAV virions constructed following expression of the AAV capsid
proteins (Capx). Vector serotype is determined by the cap genes in the pHelper plasmid (Modified
from (Merten et al. 2005), Gene Therapy).
12
Review of Published Literature
chicken-β-actin (CBA) promoter was still stable in the rat brain after 25 months (Klein et al. 2002),
however the CMV promoter has shown susceptibility to silencing by hypermethylation in some cells
(Prosch et al. 1996). A major limiting factor for rAAV vectors is the relatively small transgene
capacity (~4.7 kb), restricting delivery of larger transgenes and the incorporation of regulatory
elements that will be vital for controlling expression in some clinical applications (Monahan and
Samulski 2000; Hsich et al. 2002).
Delivery of rAAV vectors to the CNS through direct intracranial injection allows targeting of
specific populations of cells, however for larger structures the transduction efficiency can be
hindered by limited vector spread, requiring multiple injection sites (Bjorklund et al. 2000).
Ultraslow injections and co-infusion of mannitol or heparin have both been shown to increase
transduction efficiency and distribution of transduced neurons by 200-300% (Mastakov et al. 2001;
Nguyen et al. 2001). More recently, systemic delivery of mannitol has shown to provide even
greater enhancement of rAAV vector spread and transduction efficiency (Burger et al. 2005).
1.5.3
Lentiviral vectors
LV vectors are retroviral vectors derived from the immunodeficiency viruses HIV (human) and FIV
(feline) (Poeschla 2003; Wiznerowicz and Trono 2005). In contrast to other retroviral vectors, LV
can stably integrate into non-dividing cells as well as dividing cells, therefore generating long-term
transgene expression (Wong et al. 2006). Extensive use of LV vectors has been delayed due to
safety issues surrounding the production and application of vectors derived from such a highly
pathogenic virus. However these biosafety issues have been addressed with further elimination of
viral genes and the development of a self-inactivating (SIN) version (Miyoshi et al. 1998; Zufferey et
al. 1998).
LV vectors have a transgene capacity of at least 8kb and have high affinity and
transduction efficiency for fully differentiated neurons (Watson et al. 2002; Wong et al. 2004).
Primate studies have reported the absence of toxicity or inflammatory responses (Kordower et al.
1999; Bjorklund et al. 2000; Kordower et al. 2000; Palfi et al. 2002). Thus, as safety concerns are
minimized, LV becomes a very attractive vector for long-term transgene expression in the CNS.
1.6 Neurotrophic Factors as Biotherapeutic Agents for HD
Neurotrophic factors are proteins produced and secreted by neurons and glia that regulate the
development, survival and function of neurons within the developing central and peripheral nervous
system (Huang and Reichardt 2001). In addition, neurotrophic factors also contribute to activity13
Review of Published Literature
dependant neuronal plasticity, biochemical function and survival of neurons within the mature adult
nervous systems (Sofroniew et al. 2001). Expressed heterogeneously within the CNS, neurotrophic
factors function through specific receptors differentially expressed by various neuronal and nonneuronal populations of cells (Mufson et al. 1999). Target-derived support appears vital in directing
the development of neuronal circuits with growing axons expressing receptors that compete for
limited neurotrophic factor expression in the target nuclei, thereby promoting neurite growth,
synapse formation and regulating neuron survival to limit the number of neurons (Purves 1988;
Burke 2006). While target-derived support is essential in the developing CNS, the degree to which
mature, terminally differentiated neurons depend on target-derived trophic support is unclear with
autocrine / paracrine activities potentially more important, although the ability to retrogradely
transport neurotrophic factors is still maintained (Mufson et al. 1999; Murer et al. 2001).
Widespread CNS neurotrophic factor expression, in addition to regions of abundant expression, and
co-localization with neurotrophic factor receptors support proposed autocrine / paracrine interaction
in promoting neuronal function and survival (Connor and Dragunow 1998).
Increases in
neurotrophic factor expression within adult animals following a neuronal degenerative event or
neuronal injury is indicative of the support role that neurotrophic factors play in the adult CNS where
they can act as anti-excitotoxins and antioxidants or can up-regulate calcium binding proteins and
anti-apoptotic signals (Alexi et al. 2000; Alberch et al. 2004). Neurotrophic factor deprivation has
also been shown to cause up-regulation of pro-apoptotic gene transcription, indicating the
neurotrophic factor dependence of some mature neurons to survive and maintain neuronal function
(Johnson et al. 1989; Oppenheim 1991).
The expression of neurotrophic factors in the striatum and their modified expression in response to
striatal lesioning (Marco et al. 2002), and in neurological diseases including HD (Ferrer et al. 2000),
has led to neurotrophic factors being viewed as potential therapeutic agents (Alexi et al. 2000;
Alberch et al. 2004). Administration of neurotrophic factors to the striatum in animal models of HD
have been investigated via three broad techniques: direct intracerebellar infusion, transplantation of
neurotrophic factor producing cells, or in vivo gene delivery.
Four neurotrophic factors – the
neurotrophins nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF), glial cellline derived neurotrophic factor (GDNF), and CNTF – have received significant attention in relation
to their potential therapeutic value as neuroprotective agents for HD (Alberch et al. 2004) and are
reviewed here with particular focus on BDNF and GDNF which I selected to investigate further with
in vivo AAV-mediated gene delivery prior to QA lesioning. Additionally many other neurotrophic
factors have been demonstrated to have neuroprotective actions on striatal neurons including
neurotrophin 4/5 (Alexi et al. 1997), neurturin (Perez-Navarro et al. 2000), transforming growth
14
Review of Published Literature
factor-α (Alexi et al. 1997), basic fibroblast growth factor (Frim et al. 1993b; Kirschner et al. 1995)
and activin-A (Hughes et al. 1999). The method of neurotrophic factor delivery to the striatal
neurons has proven to be highly influential on the ultimate capacity to impart potent neuroprotection,
with the prospect of efficient clinical treatment becoming reality, proved safe and efficient delivery
procedures are developed.
1.6.1
Nerve growth factor
NGF, the first identified neurotrophic factor (Levi-Montalcini and Hamburger 1953), is widely
expressed throughout the CNS with high expression in regions of the CNS innervated by cholinergic
neurons of the basal forebrain, particularly the hippocampus, olfactory bulb and neocortex (LeviMontalcini 1987; Mufson et al. 1994; Das et al. 2001). Expression of NGF in the developing
striatum is seen to correlate with the differentiation of cholinergic interneurons which express the
high-affinity NGF receptor TrkA and low-affinity p75 receptor (Mobley et al. 1989; Ringstedt et al.
1993; Steininger et al. 1993; Barbacid 1994). Co-localization of NGF and TrkA in the CNS (Barde
1989) and high NGF expression throughout adulthood, suggests NGF regulates maintenance and
survival of adult neurons through autocrine / paracrine activity (Kokaia et al. 1993; Miranda et al.
1993). Enhanced striatal NGF levels following injection of glutamate receptor agonists further
support the suggestion that NGF provides endogenous neuroprotection of the cholinergic neurons
(Perez-Navarro et al. 1994; Strauss et al. 1994; Canals et al. 1998).
NGF has been investigated in several animal models of HD (Alberch et al. 2004) with significant
neuronal protection observed when released from NGF-producing cells transplanted into the striatum
or corpus callosum prior to ipsilateral QA (Schumacher et al. 1991; Frim et al. 1993a; MartinezSerrano and Bjorklund 1996; Kordower et al. 1997), 3-NP (Frim et al. 1993c) or NMDA-agonist
(Frim et al. 1993b) induced lesioning. These studies have demonstrated that locally produced NGF
results in a significant reduction in striatal lesion volumes by 60-80% compared with untreated
animals (Schumacher et al. 1991; Frim et al. 1993a; Frim et al. 1993b; Frim et al. 1993c; MartinezSerrano and Bjorklund 1996; Kordower et al. 1997). Martinez-Serrano and Bjorklund (1996) also
observed protection of striatal neurons and their efferent projections to the substantia nigra and
globus pallidus. Complete sparing of ChAT-immunoreactive cholinergic interneurons and sparing of
NADPH histochemically stained neurons was reported following transplantation of NGF-producing
cells (Schumacher et al. 1991; Frim et al. 1993a; Martinez-Serrano and Bjorklund 1996; Kordower
et al. 1997). In contrast, direct intrastriatal NGF protein injections (Davies and Beardsall 1992) or
prolonged infusions (Davies and Beardsall 1992; Venero et al. 1994; Anderson et al. 1996) failed to
15
Review of Published Literature
protect the vulnerable striatal GABAergic projection neurons, but selectively protected cholinergic
interneurons (Altar et al. 1992a; Perez-Navarro et al. 1994). The lack of NGF receptor expression by
the GABAergic medium spiny projection neurons suggests that the neuroprotection of striatal
GABAergic neurons, reportedly provided by NGF-producing cells, is not directly due to the actions
of NGF, but possibly related to other factors secreted by the grafted cells, such as basic fibroblast
growth factor that has been demonstrated to provide significant neuroprotection (Frim et al. 1993b;
Kirschner et al. 1995), or the antioxidant properties of the grafted cells (Galpern et al. 1996).
However both Frim et al. (1993b) and Martinez-Serrano and Bjorklund (1996) reported considerably
less protection of the medium spiny projection neurons in their parallel investigations of BDNF ex
vivo gene therapy than was provided by NGF-secreting cellular grafts, indicating a differential effect
of the NGF or BDNF transgenic protein secretion.
1.6.2
Brain derived neurotrophic factor
Closely related to NGF, BDNF is widely expressed throughout the CNS with expression increasing
during fetal and early postnatal development, and is maintained throughout adult life (Friedman et al.
1991; Connor and Dragunow 1998). Increasing expression as CNS regions mature suggests BDNF
plays a greater role in the maintenance and plasticity of the adult CNS than in development (Altar et
al. 1997).
Abundant BDNF expression in the hippocampus is thought to be important for
maintaining a high degree of neuronal plasticity vital for the hippocampus’s role in learning and
memory (Lindsay et al. 1994). Expression and secretion of BDNF is modified by numerous events
including bioelectrical activity, neurotransmitters, hormones and cellular insults (Dragunow et al.
1993; Marty et al. 1997; Hughes et al. 1999; Murer et al. 2001). Activity-dependant release of
BDNF from neurons (Allendoerfer et al. 1994) is proposed to be induced by depolarisation through a
calcium-dependent mechanism – glutamate receptor agonists induce BDNF, while GABAA receptor
agonists inhibit BDNF expression (Goodman et al. 1996; Marty et al. 1997). Cellular insults –
hypoxia-ischemia and hypoglycaemic coma – have also been observed to increase both BDNF and
TrkB receptor expression suggesting that endogenous BDNF plays a significant role in the general
protection of the CNS (Merlio et al. 1993). More specifically related to HD, an intrastriatal injection
of QA was found to induce an up-regulation of BDNF in cortical layers II, III, V and VI due to
damage in the striatal target area (Canals et al. 2001), but no BDNF increase in the striatum (Canals
et al. 1998). The TrkB receptor was also up-regulated by cortical neurons following intrastriatal QA
injection (Checa et al. 2001), suggesting an endogenous mechanism to support cortical neurons
following striatal damage.
16
Review of Published Literature
High affinity TrkB receptors for BDNF are found throughout the CNS on both neurons and glia.
Receptors are mostly localized to the axons, synaptic terminals and dendritic spines supporting the
proposal that synapses are the main site at which BDNF functions in the CNS, with TrkB mediating
synaptic plasticity and retrograde transport of BDNF (Drake et al. 1999; Watson et al. 1999; Aoki et
al. 2000). It has been demonstrated that glial cells have the ability to internalise BDNF via truncated
TrkB receptors lacking catalytic kinase activity, thus regulating BDNF availability and restricting
diffusion (Yan et al. 1994; Biffo et al. 1995; Rubio 1997; Altar 1999). Although lacking catalytic
kinase activity a truncated TrkB receptor isoform is the predominantly expressed isoform in the adult
brain and is hypothesised to regulate BDNF signalling by impairing catalytic TrkB receptors and
may also act as a cellular adhesion molecule regulating synapse plasticity and axonal outgrowth
(Armanini et al. 1995; Murer et al. 2001). TrkB receptor expression appears to be regulated by
mechanisms similar to those that also regulate BDNF expression, including bioelectrical activity and
cellular insults – hypoxia-ischemia, hypoglycaemic coma and axotomy (Merlio et al. 1993). The
dendritic targeting of BDNF and TrkB induced by bioelectrical activity suggests that autocrine
activity is important in maintaining and regulating dendritic tree function (Tongiorgi et al. 1997).
Intracellular TrkB receptors are also translocated to the plasma membrane in response to
depolarisation, thus rapidly increasing responsiveness to BDNF potentially important for maintaining
synapses (Meyer-Franke et al. 1998). Prolonged BDNF exposure however causes a down-regulation
of catalytic TrkB receptors (Frank et al. 1996).
In addition to the high affinity TrkB receptor, BDNF also binds to p75 neurotrophin receptor
(p75NTR) which has traditionally been viewed as a coreceptor for the Trk neurotrophic factor
receptors facilitating Trk dimerisation to allow high-affinity neurotrophin binding and modulation of
Trk signalling (Chao 1994; Chao and Hempstead 1995). More recently however, p75NTR, a member
of the tumor necrosis factor receptor family, has been demonstrated to elicit biological functions
following neurotrophic factor binding including the induction of apoptosis in the absence of Trk
receptors (Dobrowsky et al. 1994; Bamji et al. 1998; Boyd and Gordon 2002; Troy et al. 2002).
As with all neurotrophins, BDNF is synthesised as a pro-neurotrophin which undergoes proteolytic
cleavage by furin or proconvertases to produce the mature form of BDNF protein. However a
number of recent studies have demonstrated that proneurotrophins are also physiologically active
(Nykjaer et al. 2004), are endogenously secreted by neurons (Mowla et al. 2001; Chen et al. 2004;
Teng et al. 2005), and can be cleaved extracellularly by plasmin and metalloproteinases (Lee et al.
2001).
ProBDNF itself however does not stimulate TrkB phosphorylation or promote neurite
outgrowth, but rather can induce apoptosis through activation of p75NTR and the coreceptor sortilin
17
Review of Published Literature
(Teng et al. 2005). The induction of apoptosis appears to be dependent on the presence of the highaffinity sortilin receptor, with extracellular proteolytic cleavage to mature BDNF occurring in the
absence of sortilin (Nykjaer et al. 2004). These entirely opposing actions of pro- and mature forms
of BDNF indicate the delicate role that this neurotrophic factor plays in facilitating the survival and
plasticity of BDNF dependent neurons in the mature CNS, with an ability to respond rapidly to a
wide range of stimuli.
In order to modulate neuronal plasticity BDNF acts in a localised synapse-specific manner that is
thought to be regulated by the activity level of individual synapses potentially influencing the
dendritic targeting of BDNF mRNA, the secretion of BDNF at active synapses, TrkB receptor
expression and receptor-neurotrophin internalisation (for reviews see (Lu 2003; Kuipers and
Bramham 2006)). Mature BDNF acting through the TrkB receptor appears to be a vital protein in
the establishment of late-phase long-term potentiation (Pang et al. 2004) through the activation of the
microtubule-associated protein (MAP) kinase cascade enhancing the transcription of several
immediate early genes which are responsible for controlling specific neuronal function (Friedman
and Greene 1999; Bolton et al. 2000). The synthesis of proteins within dendritic regions is activitydependent with BDNF-TrkB signalling central to regulating the translation of mRNA through
phosphorylation of the eukaryotic initiation
factor 4E (eIF4E) and eukaryotic elongation
factor 2 (eEF2; Figure 1-3; (Bramham and
Messaoudi 2005; Soule et al. 2006)).
Figure 1-3
TrkB signalling pathways
controlling dendritic protein synthesis
BDNF binding to postsynaptic TrkB
receptors activates a number of major
signalling pathways which ultimately
provide control over dendritic translation.
BDNF-TrkB activation of PI3K and ERK
cascades causes phosphorylation of eIF4E
and enhances the initiation of cap-dependent
mRNA translation. Bi-directional control
over eEF2 phosphorylation state by TrkB
signalling provides control over mRNA
translation with phosphorylated eEF2
inhibiting
peptide
chain
elongation.
(Reproduced from (Soule et al. 2006))
18
Review of Published Literature
BDNF has also been demonstrated to play an important role in the promotion of neurogenesis in the
adult brain, enhancing neuron generation and the migration of neuroblasts from the sub ventricular
zone to the striatum and olfactory bulb (Zigova et al. 1998; Benraiss et al. 2001; Chmielnicki et al.
2004; Chen et al. 2007; Henry et al. 2007). BDNF-stimulated promotion of neurogenesis appears to
be mediated via p75NTR signalling, with neurogenic precursor cells in the adult sub ventricular zone
expressing the p75NTR receptor (Young et al. 2007). Survival and maturation of neuroblasts by
BDNF has been shown to occur through TrkB signalling (Benraiss et al. 2001), however neurogenic
precursor cells do not express Trk receptors suggesting that BDNF interacts with p75NTR to direct
differentiation of precursor cells into neuroblasts by promoting withdrawal from the cell cycle and
terminal differentiation (Cattaneo and McKay 1990; Ito et al. 2003; Chittka et al. 2004; Young et al.
2007). Although known primarily as a cell death inducing receptor, p75NTR expression by precursor
cells in the sub ventricular zone does not appear to affect survival of precursor cells in the presence
or absence of BDNF (Young et al. 2007), but has been shown to stimulate cell death in neuroblasts
which are prevented from migrating (Gascon et al. 2007). Within both the developing and adult
striatum, medium spiny neurons rely on BDNF to maintain their phenotype, function and survival
(Mizuno et al. 1994; Ivkovic and Ehrlich 1999; Baquet et al. 2004) through activation of TrkB
mediated signalling (Hetman et al. 1999; Vaillant et al. 1999; Gavalda et al. 2004). In addition,
BDNF also supports neuronal survival by up-regulating anti-apoptotic Bcl-2 expression via TrkB
mediated Akt activation (Schabitz et al. 2000; Almeida et al. 2005; Perez-Navarro et al. 2005).
High levels of BDNF are present in the striatum with the striatal projection neurons expressing TrkB
receptors (Costantini et al. 1999) and displaying a dependence on BDNF for survival (Saudou et al.
1998; Baquet et al. 2004). However with low levels of BDNF mRNA in the striatum, the majority of
striatal BDNF is thought to be produced in the cortical neurons and anterogradely transported to the
striatum ((Altar et al. 1997); Figure 1-4). Normal aged rats display a reduction by half in striatal
BDNF levels (Katoh-Semba et al. 1998) suggesting a normal decline with aging that may increase
the vulnerability of the striatal neurons. BDNF protein expression in HD has been investigated by
Ferrer et al. (2000) using human post-mortem samples from grade-3 HD patients and age-matched
non-neurological controls. BDNF protein expression was found to be reduced 53-82% in the caudate
nucleus and putamen of the HD patients, but preserved in the parietal cortex, temporal cortex, and
hippocampus.
Most striatal BDNF is contained within the corticostriatal projections following
anterograde transport, however the density of synaptic terminals in the HD striatum were unchanged
and BDNF-positive fibres were still observed in HD patients (Ferrer et al. 2000). While this
suggested a selective defect of striatal neurons and not a loss of cortical BDNF input, more recent
investigation has shown mutant huntingtin both disrupts the transcription of BDNF (Zuccato et al.
19
Review of Published Literature
2001; Zuccato et al. 2003) and reduces the axonal trafficking of BDNF vesicles along microtubules
((Gauthier et al. 2004); Figure 1-4). Therefore maintaining or increasing BDNF protein expression
directly within the caudate nucleus and putamen of HD patients may potentially be of therapeutic
benefit in preventing or slowing the progression of neurodegeneration in HD.
A
B
C
D
Figure 1-4
Mutant huntingtin disrupts transcription of BDNF and vesicle transportation
from the cortex to the striatum.
A large proportion of striatal BDNF is produced by the cortical neurons and anterogradely
transported via corticostriatal projections and released at synapses in the striatum. Wild-type
huntingtin is crucial for the transcription and transportation of BDNF, both of which are impaired by
the expanded poly-Q tract. BDNF expression is regulated by a neuron-restrictive silencer element
(NRSE) in the promoter region that facilitates the blocking of transcription through association with
a repressor complex. The normal sequestration of Repressor element 1-silencing transcription factor
(REST) by huntingtin in the cytoplasm prevents repressor complex formation allowing BDNF
transcription (A). Mutant huntingtin is less capable of preventing REST from entering the nucleus
and silencing the expression of NRSE regulated genes (B). Huntingtin is also involved in controlling
microtubule transportation of BDNF vesicles through association with motor protein complexes (C).
Mutant huntingtin is thought to cause a conformational change through enhanced binding to
huntingtin-associated protein 1 (HAP1) attenuating movement along microtubules (D). coREST,
REST co-repressor; HDAC, histone deacetylase; SIN3A, SIN3 homologue A, a transcription
regulator. (Modified from (Cattaneo et al. 2005), Nature Reviews: Neuroscience).
20
Review of Published Literature
In vitro studies of striatal neurons have shown BDNF to be a potent neurotrophic factor for
GABAergic striatal neurons, promoting differentiation, increasing soma size, and increasing neurite
branching (Mizuno et al. 1994; Widmer and Hefti 1994; Ventimiglia et al. 1995). BDNF has also
been demonstrated in vitro to protect GABAergic striatal medium spiny projection neurons against
excitotoxic stress and to inhibit apoptosis in striatal cells engineered to express huntingtin with an
expanded CAG repeat sequence (Nakao et al. 1995; Saudou et al. 1998). Despite the promising
neuroprotective actions of BDNF observed in vitro, direct infusion of BDNF protein into the rat
striatum failed to provide any neuronal protection against QA lesioning (Anderson et al. 1996).
Transplantation of BDNF-producing fibroblasts to the corpus callosum failed to supply protection
against excitotoxic insult of the striatum (Frim et al. 1993b), however similar transplantation into the
striatum prior to QA injection resulted in a reduced lesion size and increased survival of the striatal
projection neurons (Perez-Navarro et al. 2000a). Martinez and Bjorklund (1996) using BDNFproducing neural stem cells observed a partial protection of DARPP-32 expressing striatal projection
neurons.
The use of direct in vivo gene transfer to direct the expression of BDNF in the striatum has also been
previously investigated using an Ad-BDNF vector injected intrastriatally prior to QA lesioning
(Bemelmans et al. 1999). They reported a 55% reduction in QA lesion size with an increase in the
survival of DARPP-32 striatal projection neurons from 46% in control Ad-βGal treated animals to
64% survival in the Ad-BDNF animals. A slight shrinkage of the striatum was attributed to the
toxicity of the first-generation adenoviral vector, which possibly restricted transgene expression, thus
potentially limiting neuroprotection (Bemelmans et al. 1999). An earlier investigation conducted by
my colleagues and I (Kells et al. 2004) showed AAV-BDNF mediated partial protection of striatal
projection neurons and NOS expressing striatal interneurons against QA-induced excitotoxicity.
The spectrum of neuroprotection observed across the different BDNF delivery procedures highlights
the importance of the delivery method in determining the ability for the neurotrophic factors to
provide efficient neuronal protection. Together the previous studies suggest that continuous local
production of BDNF is vital for this neurotrophic factor to provide neuronal protection, possibly
explaining the lack of efficacy for direct BDNF injection (Anderson et al. 1996) and BDNFproducing fibroblast transplanted into the corpus callosum (Frim et al. 1993b). The necessity for
high level, local production of BDNF is possibly explained by its limited penetration / diffusion of
BDNF through the brain parenchyma or rapid clearance, most likely due to the high density of
BDNF receptors in the striatum and glial cell uptake via truncated trkB receptors (Mufson et al.
1999).
21
Review of Published Literature
1.6.3
Glial cell-line derived neurotrophic factor
A potent neurotrophic factor for dopaminergic neurons (Lin et al. 1993), GDNF is globally
expressed throughout the CNS, with the highest expression occurring in regions receiving dense
dopaminergic innervations including the developing striatum, ventral pallidum, olfactory tubercle,
and piriform cortex (Bohn 1999). The developing striatum exhibits the highest level of GDNF with
mRNA expression peaking at birth before rapidly declining and becoming undetectable by in situ
hybridisation after 4 weeks (Stromberg et al. 1993; Choi-Lundberg and Bohn 1995). Sensitive RTPCR assays have however reported that a low level of GDNF mRNA expression is maintained in the
adult rat and human striatum (Schaar et al. 1993; Springer et al. 1994; Choi-Lundberg and Bohn
1995), with neuronal expression localised to large cholinergic interneurons (Pochon et al. 1997;
Trupp et al. 1997). This expression pattern illustrates the target-derived role of GDNF in directing
development of the nigrostriatal dopaminergic connections, with the dopaminergic neurons in the
substantia nigra pars compacta (SNc) expressing high GDNF expression in the adult brain providing
long-term autocrine / paracrine maintenance (Pochon et al. 1997; Marco et al. 2002). GDNF
signalling is mediated by the ret receptor but requires the initial binding to the GDNF specific coreceptor GDNF family receptor α-1 (GFRα1) (Jing et al. 1996; Treanor et al. 1996). Both ret and
GFRα1 show similar striatal localisation to GDNF, with low expression in the striatal projection
neurons (Marco et al. 2002).
However, following excitotoxic lesioning, GDNF and GFRα1
expression is largely localised to astrocytes with the suggestion that reactive astrocytes may present
the GFRα1/GDNF complex to the striatal neurons thereby enhancing ret-mediated signalling to
promote neuron survival (Trupp et al. 1997; Yu et al. 1998; Marco et al. 2002).
The therapeutic effects of GDNF have been extensively investigated in animal models of Parkinson’s
disease and amyotrophic lateral sclerosis. GDNF delivery can both prevent the degeneration and
promote the regeneration of dopaminergic neurons, and enhance survival of motorneurons (Bohn
1999; Bjorklund et al. 2000; Bohn et al. 2000a; Bohn et al. 2000b). Enhanced survival of motor
neurons by GDNF has been shown to be dependent on anti-apoptotic caspase inhibitors ((Perrelet et
al. 2002), refer Section 1.7.2). GDNF also shows promise for HD with both direct intraventricular
GDNF protein infusions (Araujo and Hilt 1997) and striatal transplantation of GDNF-secreting
fibroblasts (Perez-Navarro et al. 1996; Perez-Navarro et al. 1999) partially rescuing striatal medium
spiny projection neurons from QA induced cell death. Only striatonigral projection neurons were
maintained by the GDNF-producing fibroblasts, with the striatopallidal projection neurons and
striatal parvalbumin-positive interneurons not surviving QA lesioning (Perez-Navarro et al. 1996;
Perez-Navarro et al. 1999).
Araujo and colleagues (1997) reported that in addition to partial
22
Review of Published Literature
protection of medium spiny projection neurons, an intraventricular infusion of GDNF protein prior to
QA lesioning significantly reduced amphetamine-induced rotational asymmetry and attenuated the
numerous neurochemical deficits caused by the QA lesions. They also found that GDNF infusion
provides protection against 3-NP induced neuronal cell loss in the striatum and associated
locomotion deficits (Araujo and Hilt 1998).
More recently, GDNF-derived support of striatal
neurons was demonstrated following in vivo AAV-GDNF gene delivery to the striatum prior to 3-NP
administration (McBride et al. 2003) and QA lesioning (Kells et al. 2004). McBride and colleagues
(2003) reported a 70% increase in surviving NeuN immunopositive striatal neurons accompanied by
significant preservation of motor performance following overexpression of GDNF in the striatum.
This has been followed up with an investigation in a transgenic mouse model of HD (N171-82Q)
where the presymptomatic mice received AAV-GDNF to enhance GDNF expression in the striatum,
and showed significant protection of the striatal neurons and attenuated behavioural deficits
(McBride et al. 2006). In contrast, LV-GDNF delivery to the R6/2 mouse model of HD failed to
protect against striatal cell loss or functional behaviour impairments (Popovic et al. 2005). The
conflicting results of these investigations were proposed to have arisen due to the greater severity of
the R6/2 model or possibly the need for presymptomatic delivery of the GDNF vectors (McBride et
al. 2006).
1.6.4
Ciliary neurotrophic factor
Although beyond the focus of this thesis, CNTF has shown considerable promise for treating HD.
While not vital for CNS development (Takahashi et al. 1994; DeChiara et al. 1995), CNTF
expressed by glia enhances survival and differentiation of neurons in the CNS and PNS (Conover et
al. 1993; Helgren et al. 1994; Sleeman et al. 2000). CNTF deficiency is associated with motor
neuron degeneration (Masu et al. 1993) and is up-regulated in astrocytes following neuronal injury
(Friedman et al. 1992; Ip et al. 1993; Rudge et al. 1995). Therefore CNTF is proposed to play a
critical role in maintaining and possibly restoring neuronal function following CNS injury (Rudge et
al. 1995). Abundant expression of CNTF receptors in the striatum (Ip et al. 1993; Rudge et al. 1995)
suggest striatal neurons may rely on CNTF for survival (Choi 1988; Rudge et al. 1994).
In contrast to most other neurotrophic factors, significant protection of GABAergic striatal neurons
has been achieved by direct intrastriatal protein infusion of CNTF starting 3-4 days prior to QA
injection, with 69 ± 17% maintenance up from 29 ± 11% survival in untreated animals (Anderson et
al. 1996). Implantation of CNTF-secreting cells into the lateral ventricle in rat (Emerich et al. 1996;
Emerich et al. 1997a) and primate (Emerich et al. 1997b) models of HD have been extensively
23
Review of Published Literature
investigated with the continuous supply of CNTF providing significant protection to striatal neurons
(Emerich 1999). Behavioural studies undertaken in both unilaterally and bilaterally QA-lesioned rats
with CNTF-secreting implants displayed improvement in both locomotor and cognitive functions to
the extent that bilaterally lesioned rats with CNTF secreting implants were non-distinguishable from
sham-lesioned animals (Emerich et al. 1996; Emerich et al. 1997a). Emerich and colleagues showed
additional protection of layer V motor cortex neurons and maintenance of GABAergic innervations
of the globus pallidus and substantia nigra pars reticulata using a primate model of HD (Emerich et
al. 1997b). Mittoux et al. (2000) reported similar results using encapsulated CNTF-secreting cells
implanted bilaterally into the striatum of a primate 3-NP model of HD, with secretion of CNTF
beginning at symptom onset providing restoration of cognitive and motor functions associated with
persistent neuronal loss or dysfunction (Mittoux et al. 2000).
Direct in vivo gene delivery to direct enhanced CNTF expression throughout the striatal parenchyma
has also been investigated. LV-CNTF vector delivery prior to QA lesioning significantly prevented
neurodegeneration of DARPP-32 striatal projection neurons, cholinergic neurons and NADPHd
containing interneurons, significantly attenuating apomorphine-induced rotational behaviour (de
Almeida et al. 2001).
Assessment of Ad-CNTF gene delivery to the striatum demonstrated
retrograde vector transport and anterograde CNTF transport resulting in widespread distribution of
CNTF protecting the integrity of the cortical-striatal-pallidal connections from 3-NP induced cell
death (Mittoux et al. 2002).
1.7 Apoptosis and Huntington’s Disease Neurodegeneration
With the molecular mechanisms underlying HD neurodegeneration not yet fully elucidated, the
extent to which apoptotic mechanisms contribute to the selective neuronal cell loss remains to be
conclusively determined. While the expression of mutant huntingtin – both in cell culture and in
transgenic mice – induces apoptotic cell death (Reddy et al. 1998; Hodgson et al. 1999; Wang et al.
1999; Li et al. 2000; Rigamonti et al. 2000; Jana et al. 2001), the relative lack of clear apoptotic
features in HD brains has caused controversy over whether the neurons die by apoptotic or necrotic
cell death (Hickey and Chesselet 2003; Sawa et al. 2003).
Apoptosis is typically characterised by nuclear and cytoplasmic condensation, DNA fragmentation,
membrane blebbing and finally the phagocytosis of membrane-bound apoptotic bodies (Kerr et al.
1972). This programmed cell death commonly occurs in isolated cells requiring the initiation of a
cell death pathway to induce the expression and activation of pro-apoptotic proteins including
24
Review of Published Literature
numerous proteases (e.g. caspases) and endonucleases (Martin and Green 1995; Sastry and Rao
2000). DNA fragmentation has been commonly used to study apoptosis by in situ TUNEL labelling
of DNA fragments (Gavrieli et al. 1992), however random DNA cleavage is often observed in
neurotic tissue making apoptotic and necrotic cell death indistinguishable by DNA fragment
labelling alone (Charriaut-Marlangue and Ben-Ari 1995). Therefore while TUNEL labelling has
been observed in the post-mortem striatum of HD patients (Dragunow et al. 1995; Portera-Cailliau et
al. 1995; Thomas et al. 1995; Butterworth et al. 1998), the lack of typical apoptotic DNA laddering
(Cohen et al. 1994) suggests these cells may not be undergoing apoptotic cell death (Dragunow et al.
1995; Portera-Cailliau et al. 1995).
More recently the implication of apoptotic mechanisms
contributing to HD has been indicated by an increase in the expression of pro-apoptotic proteins in
post-mortem HD brains, including caspase-9, Bax, cytochrome c and poly(ADP-ribose) polymerase
(Kiechle et al. 2002; Vis et al. 2005). Vis and colleagues (2005) suggested that the difficulties which
have been encountered in positively identifying neurons exhibiting typical apoptotic morphology are
due to the slow progressive nature of HD, meaning that only a few cells are likely to be undergoing
cell death at any one time.
Apoptosis of striatal neurons has been found to occur in the excitotoxic QA lesion model of HD
(Dure et al. 1995; Portera-Cailliau et al. 1995; Hughes et al. 1996; Qin et al. 1996; Bordelon et al.
1999; Nakai et al. 1999), and also in full-length transgenic animal models which display neuronal
cell loss (Reddy et al. 1998; Hodgson et al. 1999). Following QA injection into the rat striatum both
apoptotic and necrotic cell death is observed to occur, with the apoptotic cells observed mainly in the
dorsomedial striatum (Bordelon et al. 1999). Portera-Cailliau and colleagues (1995) found typical
apoptotic DNA laddering in the hours following QA lesioning but not at later time points suggesting
that both apoptotic and necrotic mechanisms may contribute towards the QA induced cell death
process. Investigations with genetic models of HD, including the YAC transgenic mice (full-length
huntingtin with 46, 72 or 128 poly-Q repeats; (Hodgson et al. 1999)), have demonstrated greater
vulnerability to excitotoxic death mediated by an enhancement of NMDA receptor activity resulting
in increased intracellular calcium levels (Levine et al. 1999; Cepeda et al. 2001; Laforet et al. 2001;
Zeron et al. 2002). More specifically the poly-Q huntingtin protein induces potentiation of the
NR2B receptor subunit which is predominantly expressed by the selectively vulnerable striatal
projection neurons (Landwehrmeyer et al. 1995; Testa et al. 1995; Chen et al. 1999; Sun et al. 2001;
Zeron et al. 2001; Zeron et al. 2002). Increased calcium levels have been well established to induce
apoptosis via the intrinsic, mitochondrial regulated apoptotic pathway (Figure 1-5; (Hajnoczky et al.
2003; Orrenius et al. 2003)).
25
Review of Published Literature
Molecular mechanisms responsible for triggering apoptosis are dependant on the specific apoptotic
stimuli with different cell death pathways being activated by different insults, although most
ultimately lead to the activation of an “executioner” caspase (Adams 2003). The two most well
understood pathways are the extrinsic death-receptor pathway and the intrinsic apoptotic pathway.
The extrinsic pathway requires activation of death receptors, such as tissue necrosis factor or Fas,
which in turn activate “initiator” caspases (caspase-8 and -10), subsequently leading to the activation
of the executioner caspases-3 and / or -7 (Ashkenazi and Dixit 1998). Intrinsic apoptosis is initiated
Figure 1-5
Potential involvement of Ca2+ signalling in the induction of apoptosis in HD
Excessive cytosolic Ca2+ can lead to mitochondrial Ca2+ overload and the release of apoptogenic
factors, including cytochrome c, inducing intrinsic apoptosis. Striatal neurons abundantly express
NDMA receptors (NMDAR) and mGluR5 which when stimulated by corticostriatal glutamate (Glu)
release cause an increase in cytosolic Ca2+ – NMDAR directly through allowing Ca2+ entry, and
mGluR5 via inositol 1,4,5-trisphosphate (InsP3) signalled release of Ca2+ from intracellular storage
organelles. In HD, expanded huntingtin (Httexp) disrupts Ca2+ signalling through potentiation of the
2B subunit of NMDAR, sensitisation of InsP3 receptors (InsP3R1), and destabilisation of
mitochondrial handling. Therefore normal glutamate stimulation of striatal neurons can result in
supranormal Ca2+ responses contributing to the vulnerability of medium spiny neurons (MSN) to HD
induced degeneration. Although not directly targeted at the disrupted Ca2+ signalling, anti-apoptotic
factors may potentially attenuate the induction of apoptosis of striatal neurons through maintaining
mitochondrial membrane integrity – Bcl-xL – or inhibiting caspase activation – XIAP. Mito,
mitochondria; MCU, mitochondrial Ca2+ uniporter. (Modified from (Tang et al. 2005), PNAS).
26
Review of Published Literature
internally by cellular stress causing increased free calcium uptake into the mitochondria and opening
of the mitochondrial permeability transition pores allowing the release of pro-apoptotic factors,
including cytochrome c, from the mitochondria (Figure 1-5 and 1-5; (Hajnoczky et al. 2003;
Orrenius et al. 2003)). Pro-apoptotic Bcl-2 family proteins such as Bax and Bak also appear to be
critical for inducing apoptosis through recruitment to the outer mitochondrial membrane inducing the
release of apoptotic factors, although there is still considerable question over how this occurs (Figure
1-6; (Gross et al. 1999; Martinou and Green 2001; Newmeyer and Ferguson-Miller 2003)).
Cytochrome c is a co-factor for apoptotic protease activating factor-1 which can bind procaspase-9 in
the presence of cytochrome c allowing the formation of large apoptosomes and the activation of
bound caspase-9 leading to the subsequent activation of caspases-3 and -7 (Zimmermann et al.
2001). Additional death-promoting factors released from the mitochondria include Smac/DIABLO
Figure 1-6
Mitochondrial permeabilisation in intrinsic apoptosis
In healthy cells the integrity of the mitochondrial outer membrane is maintained by anti-apoptotic
Bcl-2-like proteins (Bcl-2) with caspases in the cytosol present as inactive pro-proteins. Apoptotic
signalling causes release of sequested BH3-only proteins to interact with Bcl-2, allowing the
recruitment of pro-apoptotic Bcl-2 family proteins (Bax, Bak) to the mitochondrial membrane
facilitating release of apoptogenic proteins. Cytochrome c induces binding of Apaf-1 and
procaspase-9 to form apoptosomes activating procaspase-9 (c9) and subsequently caspase-3 (c3).
Cytosolic IAP are inhibited and degraded by the release of Smac/DIABLO (Diablo) and HtrA2/OMI
(Omi) proteins, while further apoptogenic proteins (apoptosis inducing factor (AIF), endonuclease G
(endoG)) can enter the nucleus inducing DNA degradation. (Reproduced from (Adams 2003), Genes
and Development)
27
Review of Published Literature
and HtrA2/OMI proteins that bind and degrade inhibitor of apoptosis proteins (IAP), preventing
caspase sequestration and inhibition (Figure 1-6; (Srinivasula et al. 2003; Saelens et al. 2004)).
In addition to the potentiation of NMDA receptor signalling, the poly-Q huntingtin protein has been
shown to directly impair mitochondrial function (Figure 1-5; (Sawa et al. 1999; Panov et al. 2002;
Choo et al. 2004)) and initiate cytotoxic mechanisms following N-terminal caspase cleavage
(Wellington et al. 2002) including transcriptional dysregulation, protesome inhibition and the
formation of aggregates and neuronal intranuclear inclusions (Figure 1-1; (Sawa et al. 2003)).
Rigamonti and colleagues have shown that wild-type huntingtin has pro-survival properties that
protect neurons against apoptotic cell death at the level of procaspase-9 processing (Rigamonti et al.
2000; Rigamonti et al. 2001), suggesting that the expanded poly-Q tract not only has toxic “gain-offunction” consequences, but normally occurring anti-apoptotic functions are also impaired. A recent
investigation
found
enhanced
expression
of
full-length
wild-type
huntingtin
provided
neuroprotection against QA-induced excitotoxicity with reduced activation of caspase-3 (Leavitt et
al. 2006). Activation of caspase-3 has been shown to be induced by mutant N-terminal huntingtin
fragments suggesting a destructive feedback loop maybe initiated resulting in extensive activation of
caspase-3 (Wellington et al. 2002; Gafni et al. 2004). Induced activation of caspase-3 in HD
suggests that whether or not the striatal projection neurons die strictly by apoptosis, apoptotic
mechanisms are likely to underlie the neurodegeneration by stressing normal cellular functions and
increasing the neurons sensitivity to other potentially neurotoxic insults. Therefore an enhancement
of endogenous anti-apoptotic factors or administration of apoptotic inhibitors could conceivably be
of therapeutic benefit by preventing the caspase-mediated cleavage of huntingtin, thereby reducing
the production of toxic N-terminal fragments and maintaining pro-survival function, or via general
augmentation of the cells ability to withstand cellular stress.
With the pathogenesis of HD appearing to involve disruptions to numerous cellular processes
involved in the induction of apoptotic related neurodegeneration, a number of targets have been
identified for potential therapeutic intervention including NMDA receptor-mediated excitotoxicity,
mitochondrial dysfunction, transcriptional dysregulation, and apoptotic executing caspases.
A
number of pharmaceuticals have shown efficacy in attenuating HD neuronal death in preclinical
trials, with some clinical trials currently being conducted (Leegwater-Kim and Cha 2004; Handley et
al. 2006). However a less studied approach is the use of gene delivery to enhance the expression of
naturally occurring anti-apoptotic factors that may counteract pro-apoptotic mechanisms while
additionally increasing the capacity of the neurons to handle neurotoxic insult (Mochizuki et al.
2002).
28
Review of Published Literature
1.7.1
Anti-apoptotic Bcl-2 and Bcl-xL proteins
Bcl-2 family proteins are involved in regulating the release of mitochondrial pro-apoptotic factors,
including cytochrome c, which is a key event in the initiation of the intrinsic apoptotic pathway
(Figure 1-6; (Cory and Adams 2002)). There are three groups of Bcl-2-like proteins: anti-apoptotic
proteins (e.g. Bcl-2, Bcl-xL), pro-apoptotic proteins (e.g. Bax, Bak) and BH3-only proteins (e.g. Bid,
Bad). Anti-apoptotic Bcl-2 and Bcl-xL are integral membrane proteins located on the mitochondrial,
endoplasmic reticulum and nuclear membranes that are thought to preserve the permeability of the
membranes against the potential pore-forming pro-apoptotic proteins, although the actual molecular
mechanisms remain controversial (Martinou and Green 2001; Kuwana et al. 2002; Newmeyer and
Ferguson-Miller 2003).
The pro-apoptotic proteins appear to be recruited to the membranes
following a cellular apoptotic stimulus to facilitate the release of pro-apoptotic factors (Figure 1-6).
However in order for apoptosis to occur, the inhibitory effects of the anti-apoptotic proteins need to
be overcome; this is thought to involve interactions with BH3-only proteins (Huang and Strasser
2000; Gross 2001). Over-expression of Bcl-2 or Bcl-xL can prevent apoptosis occurring following a
variety of cytotoxic stimuli including neurotrophic deprivation, ionizing radiation and oxidative
stress. There does not appear to be a significant difference in the protective effects of Bcl-2 and BclxL, however endogenous expression of Bcl-2 is seen to peak during embryonic development while
Bcl-xL expression continues to increase postnatally, reaching peak expression in the adult CNS
(Gonzalez-Garcia et al. 1994; Gonzalez-Garcia et al. 1995).
The therapeutic potential for using Bcl-2 or Bcl-xL in neurodegenerative diseases has been shown by
a few studies using viral vectors to cause overexpression in the CNS. HSV vector delivery of Bcl-2
to the substantia nigra prior to 6-hydroxydopamine lesioning doubled the survival rate of
dopaminergic neurons (Yamada et al. 1999). Similarly AAV-mediated overexpression of Bcl-2 in
the CA1 hippocampal neurons attenuated cell death and reduced DNA fragmentation following
ischemia even when AAV delivery was delayed until one hour after the ischemic insult (Shimazaki
et al. 2000). Motor neuron survival in a transgenic mouse model of amyotrophic lateral sclerosis
was also increased by AAV mediated delivery of Bcl-2 which consequently delayed the onset of
muscular deficits (Azzouz et al. 2000). The LV vector mediated overexpression of Bcl-xL in septal
cholinergic neurons was highly efficient in preventing axotomised cell death of transduced neurons
(Blomer et al. 1998), while AAV-Bcl-xL retrogradely delivered to entorhinal projection neurons also
protected against axotomy-induced apoptosis (Kaspar et al. 2002). A limitation of anti-apoptotic
factor mediated protection is that only the individual transduced cells that are over-expressing the
anti-apoptotic protein can be expected to show increased resistance to an apoptotic stimulus in
29
Review of Published Literature
contrast to a secreted neuroprotective molecule that can have paracrine activity and therefore provide
assistance to neighbouring cells. The simultaneous delivery of a neurotrophic factor and an antiapoptotic factor as investigated by Natsume and colleagues (2001) using HSV vector delivery of
both Bcl-2 and GDNF to the substantia nigra ensured that secreted GDNF may at least provide some
protective support to those neurons not expressing the anti-apoptotic factor. Co-injection of HSV
vectors encoding Bcl-2 and GDNF resulted in the additive survival rate of dopaminergic neurons
following 6-hydroxydopamine induced degeneration (Natsume et al. 2001).
More recently neuroprotection against glutamate excitotoxicity has been reported following AAVBcl-xL transduction of neuroblastoma cells and primary motor neurons as a model of amyotrophic
lateral sclerosis (Garrity-Moses et al. 2005). Similarly, LV-Bcl-2 delivery to the CA1 region of the
hippocampus attenuated neuronal cell death following an excitotoxic NMDA injection (Wong et al.
2005). While these studies have indicated Bcl-2 / Bcl-xL is capable of imparting neuroprotection
against excitotoxic insult, an earlier investigation of QA-induced cell death in the striatum of
transgenic mice over-expressing Bcl-2 reported no attenuation of the loss of DARPP-32 expressing
striatal projection neurons (Maciel et al. 2003).
1.7.2
Inhibitors of apoptosis
With caspases playing a vital role in the initiation and physical execution of apoptosis, they present a
reasonably specific target for inhibiting apoptosis independent of the apoptotic pathway that is
initiated. The function of inhibiting caspases is carried out in healthy cells by a family of proteins
known as inhibitors of apoptosis (IAP) (Robertson et al. 2000). Six members of this family have
been identified in humans: Neuronal apoptosis inhibitor protein (NAIP), X-chromosome-linked IAP
(XIAP), Human IAP-1 (HIAP-1), HIAP-2, Survivin and Bruce (Deveraux and Reed 1999). The
neuroprotective properties of these IAPs have been investigated with the most potent caspase
inhibitor proving to be XIAP (Simons et al. 1999) which has two sites capable of inhibiting caspase
activity – one site that is specific for caspase-3 and -7, and the other a specific inhibitor of caspase-9
(Deveraux et al. 1999). By inhibiting the initiator caspase-9, XIAP is capable of inhibiting both the
activation and the activity of the executioner caspases-3 and -7.
Robertson and colleagues have reported that NAIP is up-regulated in cholinergic striatal interneurons
following ischemic insult, suggesting that the neuronal resistance to ischemia and excitotoxicity may
be related to the inhibition of caspases (Xu et al. 1997). Ad-vector mediated delivery of NAIP prior
to 6-OHDA lesioning provided protection to nigrostriatal dopaminergic neurons, attenuating the
amphetamine-induced motor deficits (Crocker et al. 2001). Over-expression of NAIP (Xu et al.
30
Review of Published Literature
1997) or XIAP (Xu et al. 1999) in hippocampal CA1 neurons prevented ischemic-induced apoptosis
by inhibiting caspase-3 activation. The Ad-XIAP delivery to CA1 neurons increased survival 5-6
fold and attenuated the loss of spatial memory as measured in the Morris water maze (Xu et al.
1999), while delivery to retinal ganglion cells after axotomy of the optic nerve prevented any
secondary apoptotic cell death (Kugler et al. 2000). More recently a reduction in DNA methylationinduced apoptosis in photoreceptors has been shown following AAV-XIAP transduction (Petrin et
al. 2003a; Petrin et al. 2003b).
Perrelet and colleagues have similarly shown that the adenoviral mediated overexpression of NAIP,
HIAP-1 or HIAP-2 are each capable of attenuating the degeneration of motor neurons following
sciatic nerve axotomy (Perrelet et al. 2000). In addition they have demonstrated by selective
antisense inhibition of IAPs the absolute requirement of XIAP and NAIP to mediate the
neuroprotective effects of GDNF, but not BDNF or CNTF (Perrelet et al. 2002). Only GDNF
treatment upregulated XIAP and NAIP expression showing the stimulation of anti-apoptotic
pathways in GDNF mediated neuroprotection (Perrelet et al. 2002). Ad-mediated over-expression of
XIAP and GDNF have also been shown to act synergistically to protect nigrostriatal dopaminergic
neurons against 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced cell death and
maintain striatal dopamine levels (Eberhardt et al. 2000). While XIAP alone was sufficient to rescue
the nigrostriatal neurons from cell death, the dopaminergic striatal terminals degenerated in the
absence of GDNF (Eberhardt et al. 2000).
Recent evidence that XIAP and HIAP-1 undergo
degradation in the HD caudate, following aberrant release of pro-apoptotic mitochondrial proteins
Smac/DIABLO and HtrA2/OMI, further suggests upregulation of IAP may be therapeutically
beneficial for HD (Goffredo et al. 2005).
1.8 Summary
The growing understanding of pathogenic processes initiated in HD by an expanded poly-Q tract in
huntingtin, has provided an opportunity to develop therapeutic intervention tailored towards either
the potentiation of an impaired cellular mechanism, or conversely the attenuation of acquired
cytotoxic functions. With a large pre-symptomatic window-of-opportunity available through genetic
testing for HD in “at-risk” individuals, preventative therapeutic intervention instigated prior to the
initiation of neuronal dysfunction leading to selective neurodegeneration is a serious proposition for
HD patients. Excitotoxicity appears to play a significant role in the ultimate death of the vulnerable
striatal neurons with mutant huntingtin causing a reduction in vital neurotrophic support through
interruption of BDNF transcription and transportation, and interference with the molecular
31
Review of Published Literature
machinery of programmed cell death resulting in impaired ability to handle the naturally high
corticostriatal glutamate stimulation.
Figure 1-7
Model of neurotrophic factor and anti-apoptotic factor supplied protection.
AAV-mediated gene delivery to targeted striatal neurons and possibly adjacent glial cells results in
stable biotherapeutic protein expression within the striatum. Non-secreted anti-apoptotic factors –
Bcl-xL and XIAP – remain contained within the transduced cells acting in the cytosol and at the
mitochondrial membrane to inhibit apoptotic mechanisms. Only directly transduced neurons are
exposed to enhanced anti-apoptotic factor expression. Neurotrophic factors – BDNF and GDNF –
are secreted following production within transduced cells providing autocrine and paracrine actions
on the target striatal neurons through cell surface receptors and therefore providing trophic support to
a greater number of neurons than actually transduced. The transduction of cells in the projection
nuclei may additionally provide target-derived trophic support through retrograde transportation of
the neurotrophic factors. (Modified from (Blomer et al. 1998), PNAS)
From current research it appears that while neurotrophic factors and anti-apoptotic factors hold real
potential as therapeutic agents, the need for a continuous supply across the entire striatum makes the
mechanism of delivery vitally important for the success of these factors as effective therapeutic
agents. Cellular transplantation and direct in vivo gene delivery techniques appear to be the most
promising delivery methods for neurotrophic factors, as physiologically relevant concentrations can
be continuously produced locally within the striatum directly supplying support to surrounding
striatal neurons, while limiting any adverse effects resultant of activity in non-targeted regions. Nonsecreted biotherapeutics, such as anti-apoptotic factors, require very efficient delivery techniques,
generally requiring in vivo gene delivery vectors, as only cells directly expressing / receiving the
32
Review of Published Literature
therapeutic agent will benefit from any effects. Therefore further research and development of
effective gene delivery techniques are vital for pursuing the true potential of targeted biotherapeutics
for attenuating the insidious progression of HD.
1.9 Thesis Objectives
This thesis set out to investigate if continuous neurotrophic factor or anti-apoptotic factor expression
achieved via in vivo gene delivery can attenuate neuronal cell loss and behavioural deficits in the
excitotoxic QA lesion animal model of HD.
Although neurotrophic factors have been previously demonstrated to partially prevent the death of
striatal projection neurons, difficulties in achieving efficient delivery of neurotrophic factors to the
striatum in vivo may limit the true potential that neurotrophic factors hold for counteracting the
neurodegenerative process of HD. Ongoing improvement in non-toxic, non-immunogenic viral
based vectors has allowed for the efficient delivery of therapeutic proteins to the CNS following in
vivo gene transfer. In vivo gene delivery is suited to the continuous production of therapeutic
proteins within a specific population of cells such as the neurons of the striatum, and this local
production of neurotrophic factors at physiologically effective concentrations across the entire
striatum may prove to be therapeutically beneficial at preventing or slowing the progression of HD.
Construction of recombinant AAV vectors and the verification of functional transgenic protein
expression is detailed in Chapter 2 (Kells et al. 2006).
With a large number of neuroprotective compounds currently under investigation following the
ongoing elucidation of molecular mechanisms underlying HD, it has been recently suggested that
preclinical studies of pharmaceutical and biotherapeutic agents for HD should be proven efficacious
in transgenic models of HD, by two independent research groups, prior to moving forward into nonhuman primate and clinical trials (Bates and Hockly 2003). However the increasing evidence that
excitotoxic mechanisms contribute to HD neurodegeneration ensure that the QA model is still a
relevant research tool to investigate neuroprotective agents. Chapter 3 covers the optimisation and
characterisation of a unilateral QA lesion rat model of HD.
Previous in vivo gene delivery mediated expression of neurotrophic factors in the striatum has
demonstrated the protection of striatal neurons by BDNF, GDNF and CNTF (Bemelmans et al. 1999;
de Almeida et al. 2001; Mittoux et al. 2002; McBride et al. 2003; Kells et al. 2004). While
neurotrophic factors show promise in these studies, there is a need for further investigation of more
efficient gene delivery vectors, assessment of functional behavioural protection and determination of
33
Review of Published Literature
neuronal fibre protection in order to fully evaluate the most promising approaches to advance
through to primate studies and clinical trials. Preventative therapeutic delivery of BDNF or
GDNF prior to QA striatal lesioning is investigated in Chapter 5.
Targeted delivery of anti-apoptotic factors to the striatum in an attempt to prevent striatal cell death
has not previously been investigated as a potential treatment for HD, although in vivo gene delivery
of Bcl-2-like proteins (Bcl-2 and Bcl-xL) and IAPs (XIAP and NAIP) have provided protection to
other neurons following apoptotic stimulating insult. With apoptotic mechanisms being induced in
HD, anti-apoptotic factor expression may hold therapeutic potential to enhance the survival of striatal
neurons. In Chapter 6 I investigate if enhanced Bcl-xL or XIAP expression can attenuate QAinduced excitotoxic neuronal cell death.
Ultimately this thesis research aimed to investigate whether the use of chimeric AAV1/2 vectors for
the in vivo gene delivery of the neurotrophic factors BDNF or GDNF, or the anti-apoptotic factors
Bcl-xL or XIAP could efficiently generate continuous production within the rat striatum at a level
that is sufficient to maintain the functional integrity of the striatal neurons in the face of an acute
excitotoxic insult. This was achieved by assessment of neuropathological changes and functional
behavioural impairments.
34
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Chapter 2
Adeno-Associated Viral Vectors:
Plasmid Cloning, Vector Packaging
and In Vitro Functional Testing
*†
2.1 Overview
AAV derived recombinant vectors have become the vector of choice for many investigators studying
potential clinical applications of gene delivery primarily due to their efficient stable transduction of
post-mitotic cells and non-pathogenic viral origin (Peel and Klein 2000). To mediate gene transfer to
striatal neurons I produced high-titre recombinant AAV vectors containing cDNA sequences for each
of the potential biotherapeutic proteins. It is clearly essential for gene delivery applications that the
protein products expressed following gene transfer into the target cells are correctly translated and
processed into functionally active molecules capable of influencing cellular activity. Therefore it was
important that I developed procedures to assess the functional impact of each transgenic protein
following rAAV vector transduction.
Given the well characterised functional activity of the
neurotrophic factors and anti-apoptotic proteins under investigation, I devised efficient in vitro assays
to demonstrate the expected functional impact of each protein.
2.2 AAV Vector Development and Production Procedures
Production of recombinant AAV vectors was undertaken in vitro by co-transfection into HEK293
cells of a plasmid containing my AAV vector expression cassette along with helper plasmids
encoding AAV rep and cap proteins and adenoviral genes essential for AAV production. The use of
separate helper plasmids supplying the necessary AAV replication and packaging proteins in trans
ensures the production of replication deficient vectors with only the expression cassette DNA flanked
by AAV specific inverted terminal repeat (ITR) sequences being packaged into the AAV particles.
*
The functional assessment of AAV vectors has been published in Journal of Neuroscience Methods Kells, A.P., Henry,
R.A., Hughes, S.M. and Connor, B. (2006). Verification of functional AAV-mediated neurotrophic and anti-apoptotic
factor expression. Journal of Neuroscience Methods: doi:10.1016/j.jneumeth.2006.11.006.
Note: Production of the AAV-BDNF plasmid construct was kindly undertaken by Rebecca Henry, Department of
Pharmacology, The University of Auckland.
Functional testing of the AAV-BDNF vector was performed in conjunction with Rebecca Henry.
35
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Replication deficient viral particles were subsequently harvested from the HEK293 cells, purified by
heparin affinity column and centrifuge concentrated to provide high titre stocks for in vivo gene
delivery.
Development of rAAV vectors for the neuroprotective gene delivery investigations involved cloning
the therapeutic genes-of-interest into a previously constructed AAV expression cassette (Klugmann et
al. 2005), packaging and purifying the AAV vector particles, testing for efficient AAV transduction
and assaying for functional transgenic protein expression in vitro.
2.2.1
Molecular biology protocols
2.2.1.1
PCR Cloning
To facilitate ligation of the genes-of-interest into AAV expression cassettes I PCR amplified the
cDNA sequences from source plasmids (Table 2-1) using customised primer pairs (Table 2-2)
incorporating unique restriction sites to flank the cDNA sequences and complement the restriction
sites at the insertion site of the AAV backbone plasmid. Direct replacement of the cDNA stop
codons with either an EcoRI or BglII restriction site sequence allowed in-frame ligation with the
downstream HA-tag sequence.
The PCR program to clone each gene-of-interest was tested using Red Hot® DNA polymerase
(ABgene) to optimise the primer annealing temperature and cycle number required to produce a
single clean DNA product. Each reaction was setup with 2.5µL Red Hot® PCR Reaction buffer
(ABgene), 2.0µL MgCl2 (25mM; ABgene), 1.0µL dNTPs (2.5mM; Invitrogen), 0.2µL forward
primer (10µM; Invitrogen), 0.2µL reverse primer (10µM; Invitrogen), 1.0µL miniprep DNA plasmid
template, 0.25µL Red Hot® DNA Polymerase (ABgene) and made up to 25.0µL with sterile dH2O.
Reactions were run in a GeneAmp® PCR System 9700 (Applied Biosystems) thermal cycler
programmed for:
Initial denaturing
Denaturing
Annealing
Elongation
Final Elongation
Hold
95°C
5 min
1 cycle
30 sec
30 sec
60 sec
35 cycles
72°C
10 min
1 cycle
4°C
∞_-
95°C
56 / 60 / 65°C
72°C
PCR products were visualised on a 1% agarose gel against a 1kb Plus DNA ladder (Invitrogen).
36
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Following optimisation of the PCR program with Red Hot® DNA polymerase a larger scale PCR was
performed using an Expand High Fidelity PCR System (Roche). Each PCR was setup with 5.0µL
Expand High Fidelity Buffer containing 15mM MgCl2 (Roche), 4.0µL dNTPs (2.5mM; Invitrogen),
1.5µL forward primer (10µM; Invitrogen), 1.5µL reverse primer (10µM; Invitrogen), 1.0µL miniprep
DNA plasmid template, 1.0µL Expand High Fidelity Enzyme mix (Roche) and made up to 50.0µL
with sterile dH2O. PCR program:
Initial denaturing
94°C
2 min
Denaturing
Annealing
Elongation
94°C
62°C
72°C
15 sec
60 sec
90 sec
Final Elongation
Hold
72°C
7 min
4°C
∞±-
1 cycle
30–35 cycles
1 cycle
PCR products were visually checked by running a sample on a 1% agarose gel and then separated out
by gel extraction or with a Wizard® SV Gel and PCR Clean-Up System kit (Promega).
2.2.1.2
Agarose Gel Extraction
The extraction of DNA fragments from agarose gel was performed to isolate a specific length DNA
product following PCR or restriction digests. Reaction mixtures were run on a 1% low melting point
agarose gel in TAE buffer. A single band containing the DNA product-of-interest was excised,
transferred to a Costar Spin-X column (Corning) and frozen at -80°C for 5mins. The DNA was
eluted through the column by centrifugation at 12,000rpm for 10mins (Heraeus Biofuge Stratos).
Spin-X column was discarded and 600µL phenol:chloroform:isoamyl alcohol mixture (SigmaAldrich) added to separate out DNA by further centrifugation at 12,000rpm for 10mins. The top
layer containing my DNA product was transferred to a new centrifuge tube and made up to 150µL
with NaCl solution to give a final concentration of 200nM NaCl. DNA was precipitated and pelleted
by adding 375µL 95% ethanol, centrifuging at 12,000rpm for 2min and carefully discarding
supernatant.
The DNA was washed with 70% ethanol and dried at room temperature before
resuspending in 20µL sterile dH2O and storing at -20°C.
The Wizard® SV Gel and PCR Clean-Up System (Promega) was also used as an alterative to the
Costar Spin-X columns for agarose gel extraction or for direct PCR product purification. Briefly the
gel band or PCR mixture was incubated with a Membrane Binding Solution and loaded onto a SV
Minicolumn by centrifugation. The DNA bound to the SV Minicolumn was washed with an ethanol
based Membrane Wash Solution and then eluted with 50µL sterile dH2O.
37
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.2.1.3
p-GEM®-T Easy Vector
PCR products encoding single cDNA gene sequences flanked by unique restriction sites were ligated
into pGEM®-T Easy TA cloning vectors (Promega) as per the suppliers’ instructions. Ligations were
setup with 5.0µL Rapid Ligation Buffer, 1.0µL pGEM®-T Easy vector, 3.0µL PCR product, 1U T4
DNA ligase and incubated overnight at 4°C. Overnight ligation mixture was used to heatshock
transform Escherichia coli (E. coli) competent cells (Section 2.2.1.4). Insertional disruption of the
LacZ gene spanning the pGEM®-T Easy vector ligation site provides ready identification of colonies
containing an insert by their white appearance when grown on LB agar (USB) plates containing
ampicillin (amp; 50 µg/mL; Sigma-Aldrich) and X-gal (20 mg/mL; Sigma-Aldrich).
A single
transformed colony containing the correct insert was selected by colony PCR screening and used to
inoculate overnight cultures for plasmid mini prep and for long-term storage as a 30% glycerol stock.
2.2.1.4
Heatshock Transformation
Transformation of E. coli cells was performed by mixing the plasmids with competent cells and
providing a heatshock stimulus to induce plasmid uptake. A vial of DH5α E. coli Max Efficiency
Competent cells (500µL; Invitrogen) was thawed on ice from -80°C and gently mixed with 0.1µL
plasmid mini-prep. After 30mins incubation on ice the cells were heatshocked at 42°C for 60secs and
placed back on ice for 1-2mins before transferring to a centrifuge tube with 450µL LB and incubating
at 37°C for 1hr. The cells were then plated overnight at 37°C on LB agar containing ampicillin, with
or without X-gal, to select for transformed E. coli colonies.
2.2.1.5
Colony PCR
Colony PCRs were used to screen E. coli colonies following heatshock transformation for the
presence of a plasmid containing a cDNA sequence of the specific gene-of-interest. Individual
colonies were picked off an LB agar / amp plate with a sterile tip, streaked gently across a fresh LB
agar / amp plate and then suspended in 20µL LB. Using 2.5µL of the resuspended culture for the
DNA plasmid template I performed PCRs to amplify the gene-of-interest using the Red Hot® DNA
polymerase protocol as described in Section 2.2.1.1.
2.2.1.6
Restriction Enzyme Digestions
Complementary restriction digests were performed in preparation for transferring the genes-ofinterest from the pGEM®-T Easy vectors into the AAV expression cassette. Digests were setup in
1.5mL eppendorf tubes using 2.0µL DNA plasmid prep, 2.0µL NEB Buffer (Table 2-4), 2.0µL BSA
(NEB), 20U of each restriction endonuclease (Table 2-4), made up to 20µL with sterile dH2O and
incubated at 37°C for 2-3hrs. Following restriction digestion the desired DNA fragment was gel
38
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
extracted on a low melting point 1% agarose gel using the Wizard® SV Gel and PCR Clean-Up
System.
2.2.1.7
Ligation into the AAV Expression Cassette
Ligation of the gene-of-interest into the AAV expression cassette was facilitated by complimentary
ssDNA “sticky” ends on the AAV vector and DNA inserts generated by the restriction digests. To
restrict self ligation of the AAV backbone vector it was treated with calf intestinal phosphatase (CIP)
to remove the 5’ phosphate groups. Following restriction digest of the AAV vector the restriction
enzymes were inactivated by incubation at 65°C for 20mins, 1.0µL of CIP was added to the digestion
reaction mix and incubated at 37°C for 30min. CIP was inactivated by incubation at 75°C for
30mins.
Ligation reactions were setup with 1.0µL CIP treated AAV expression cassette digest, 5.0µL
insertion DNA, 1.0µL T4 ligase buffer (Invitrogen), 2.0µL dH2O, 1.0µL T4 ligase enzyme
(Invitrogen) and incubated overnight at 4°C.
2.2.1.8
Plasmid Amplification and Purification
DNA plasmid mini-prep
Small-scale plasmid purifications were undertaken with a High Pure Plasmid Isolation kit (Roche).
E.coli cells containing the plasmid-of-interest were pelleted from a 3-4mL overnight LB / amp culture
by centrifugation at 9,000rpm for 30secs. Cells were resuspended in 250µL Suspension Buffer
containing RNase and lysed by the addition of 250µL Lysis Buffer. Chromosomal DNA and cellular
debris was precipitated by adding chilled Binding Buffer and separated by centrifugation at
13,000rpm for 10min. Supernatant containing the DNA plasmid was transferred to a High Pure filter
tube and centrifuged at 13,000rpm for 1min.
The bound plasmids were washed twice by
centrifugation with Wash Buffers before eluting the plasmid DNA with 100µL Elution Buffer (10mM
Tris-HCl). Samples of the mini-preps were run on 1% agarose gel to check plasmid yield. DNA
plasmid preps were stored at -20°C.
DNA plasmid maxi-prep
Large-scale plasmid purifications were performed using a QIAGEN® Plasmid Maxi Kit. An E.coli
culture containing the plasmid to be amplified was used to inoculate 500mL LB / amp and incubated
overnight at 37°C with vigorous shaking. The overnight culture was transferred to 250mL centrifuge
bottles and the E.coli cells harvested by centrifugation at 4,300rpm for 15mins (Sorvael RT7Plus).
The supernatant was discarded and the E. coli cells resuspended in buffer solution containing RNase
(Buffer P1: 50mM Tris-Cl, 10mM EDTA, 100µg/mL RNase A, pH 8.0). Cells were lysed by
39
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
addition of lysis buffer (Buffer P2: 200mM NaOH, 1% SDS) and the cellular debris precipitated by
neutralization buffer (Buffer P3: 3.0M potassium acetate). Following centrifugation the plasmid
containing supernatant was transferred to an equilibrated QIAGEN-tip.
The QIAGEN-tip was
washed (Buffer QC: 1.0M NaCl, 50mM MOPS, 15% isopropanol, pH 7.0) and the plasmid eluted
(Buffer QF: 1.25M NaCl, 50mM Tris-Cl, 15% isopropanol, pH 8.5). DNA was precipitated with
isopropanol and pelleted by centrifugation at 11,000rpm for 30mins. The pelleted DNA was washed
with 70% ethanol and air-dried before reconstituting in Tris-EDTA (TE) buffer and stored at -20°C.
The plasmid concentration was measured by DNA spectrophotometry (Ultrospec™ 2100, Biochrom).
2.2.1.9
DNA Sequencing
All DNA sequencing was performed on a 3100 capillary sequencer (Applied Biosystems) by the
Genomics Unit, Centre for Genomics and Proteomics, School of Biological Sciences, The University
of Auckland.
2.2.2
AAV plasmid construction
DNA plasmids containing an empty AAV expression cassette, AAV rep and cap genes and the Ad
helper genes required for AAV packaging were made available by Professor Matthew J. During and
Dr Deborah Young, Department of Molecular Medicine and Pathology, FMHS, The University of
Auckland (Table 2-1, Appendix A.2). The AAV backbone plasmid (Figure 2-1) contained an AAV
expression cassette regulated by a strong constitutively active chicken-β-actin (CBA) /
cytomegalovirus (CMV) hybrid enhancer-promoter to drive continuous stable expression in all
transduced cells (Xu et al. 2001), a woodchuck post-transcriptional regulatory element (WPRE) to
further enhance the transgene expression level (Loeb et al. 1999; Paterna et al. 2000) and a bovine
growth hormone poly-A (bGH poly-A) tail sequence. Inverted terminal repeat (ITR) sequences from
AAV serotype-2 flanked the expression cassette to direct ssDNA packaging into the vector particles.
The multiple cloning site for transgene insertion was directly adjacent to a nine amino acid HA
sequence that allowed in-frame fusion of an HA epitope-tag to the 3’-end of the transgene by direct
replacement of the stop codon with either an EcoRI or BglII restriction enzyme recognition site.
Incorporation of the short HA-tag at the C-terminal allowed for unequivocal immunocytochemical
staining of the transgenic protein expression, distinct from endogenous neurotrophic factor or antiapoptotic factor expression.
A fully constructed AAV-Luciferase plasmid containing a Firefly
Luciferase cDNA sequence with the same regulatory elements, but without an HA-tag, was also
supplied by MJ During and D Young to be used as a control for AAV transduction and transgenic
protein expression (Appendix A.2.2).
40
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Plasmid Construct
Supplier
BDNF
pAM/CRE-BDNF-WPRE-bGHpA
During
GDNF
AAV/NSE-GDNF-WPRE-bGHpA
During
Bcl-xL
pcDNA3-HA-Bcl-xL
Science Reagents
XIAP
pCI-neo-Flag-XIAP
Science Reagents
Empty AAV backbone
pAM/CAG-C-termHA-WPRE-bGHpA
During
AAV-Luciferase
pAM/CBA-Luciferase-WPRE-bGHpA
During
AAV-2 rep and AAV-2 cap
pRV1
During
AAV-2 rep and AAV-1 cap
pH21
During
Adenovirus E2A, E4, VA
pF∆6
During
Transgene cDNA Sequences*
AAV Expression Cassettes†
AAV Packaging Plasmids†
Table 2-1
Source of cDNA sequences and AAV Plasmids
cDNA sequences of the genes-of-interest were sourced from either expression cassette plasmids
previously constructed by the MJ During and D Young laboratory group, Department of Molecular
Medicine and Pathology, The University of Auckland; or commercially sourced from Science
Reagents. The empty AAV expression cassette, control AAV-Luciferase and AAV helper packaging
plasmids were all kindly supplied by MJ During and D Young.
* Full sequences in Appendix A.1. † Plasmid maps in Appendix A.2.
Figure 2-1
AAV expression plasmid
Diagrammatic representation of the AAV expression cassette plasmid showing the location of the
inserted transgene between the CBA/CMV promoter and WPRE sequence. Left and right ITR
sequences flanking the expression cassette direct packaging of ssDNA into the rAAV particles.
41
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
To investigate the neuroprotective potential of the four proteins-of-interest, BDNF, GDNF, Bcl-xL
and XIAP, cDNA sequences for each were transferred into separate AAV expression cassettes. Each
of the cDNA sequences were PCR cloned out of their source plasmids (Table 2-1; Appendix A.1)
using customised primers (Table 2-2) to add unique restriction sites to each end of the cDNA
sequence in preparation for ligation into the AAV expression cassette. All of the forward primers
were constructed with a XhoI restriction site (CTCGAG) upstream of the ATG methionine start
codon. Reverse primers were designed to allow fusion of the transgene protein with the C-terminal
HA-tag by replacing the stop codons with a BglII restriction site (AGATCT) for the BDNF, GDNF
and Bcl-xL cDNA sequences. Reverse primer for the XIAP sequence incorporated a EcoRI restriction
sequence (GAATTC) due to the presence of a BglII recognition site within the XIAP cDNA
sequence.
Primer
Sequence 5’ → 3’
TM
BDNF – Forward
CAACTCGAGCACCAGGTGAGAAGAGTGATGAC
82
BDNF – Reverse
CTAGATCTTCTTCCCCTTTTAATGGTCAATG
75
GDNF – Forward
GAACTCGAGCGGACGGGACTCTAAGATGAAG
82
GDNF – Reverse
CAAGATCTGATACATCCACACCGTTTAGCG
78
Bcl-xL – Forward
GCCCTCGAGTTATAAAAATGTCTCAGAGC
77
Bcl-xL – Reverse
GAAGATCTGCGGTTGAAGCGTTCCTGGCC
82
XIAP – Forward
GCGCTCGAGAATGACTTTTAACAGTTTTGAAGG
78
XIAP – Reverse
CGAATTCGCGAGACATAAAAATTTTTTGCTTG
75
Table 2-2
PCR primer sequences
Customised primer pairs were designed to PCR amplify the cDNA sequences from plasmid
templates. The forward primers incorporated a unique XhoI restriction site (underlined) upstream of
the cDNA coding region (bold). Reverse primers complimentary to the 3’ end of the cDNA gene
sequence contained a BglII or EcoRI restriction site (underlined) in place of the stop codon.
Optimisation of PCR programs to clone the cDNA sequences from source plasmid was performed
using Red Hot DNA polymerase with annealing temperatures of 56, 60 and 65°C (Section 2.2.1.1).
The cleanest PCR fragments were produced with the 65°C annealing temperature, however product
yield was reduced compared with 60°C annealing. Reducing the number of cycles for XIAP from 35
to 30 and diluting the template DNA mini-prep 1:200 in dH2O resulted in a cleaner PCR product.
After PCR program optimisation, High Fidelity DNA Polymerase was used to ensure accurate
cloning of the cDNA sequences. High Fidelity PCRs were run with an annealing temperature of
62°C cycling 35 times for the BDNF, GDNF and Bcl-xL sequences and 30 times for XIAP.
42
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Following PCR cloning of each cDNA sequence I ligated the PCR products into pGEM cloning
vectors for long-term storage and easy handling (Section 2.2.1.3).
The pGEM plasmids were
heatshock transformed into competent E. coli cells (Section 2.2.1.4) and individual colonies screened
by colony PCR with the same primers (Table 2-2) to confirm insertion of the correct gene-of-interest
(Section 2.2.1.5). A single colony generating the correct length PCR product for each gene-ofinterest was used to inoculate an LB culture for DNA plasmid mini-prep and storage as a glycerol
stock (Section 2.2.1.8). DNA sequencing from plasmid mini-preps to confirm error-free cloning of
each cDNA gene sequence was performed using T7 and Sp6 primers to sequence bidirectionally
across the pGEM®-T Easy vector insertion site (Section 2.2.1.9). The cDNA sequences were each
fully BLAST aligned with matching mRNA database sequences to confirm sequence homology
(Table 2-3; Appendix A.1). The Bcl-xL sequence had a C-terminal truncation of the last 21 amino
acids containing a transmembrane domain for mitochondrial targeting which has previously been
shown to retain anti-apoptotic properties (Fang et al. 1994; Muchmore et al. 1996). BDNF, GDNF
and XIAP cDNA sequences had full homology with database mRNA sequences (Table 2-3).
Gene-of-Interest
Description
Accession Number
BDNF
Homo sapiens BDNF mRNA
NM 170735.4
GI: 60218885
GDNF
Rattus norvegicus GDNF mRNA
NM 019139.1
GI: _9506720
Bcl-xL*
Homo sapiens Bcl-2-like 1 mRNA
NM 138578.1
GI: 20336334
XIAP
Homo sapiens BIRC4 mRNA
NM 001167.2
GI: 32528298
Table 2-3
Genes-of-interest
*
The Bcl-xL sequence encoded only the first 212 amino acids with a truncation of the final 21 codons
encoding a transmembrane domain.
Transfer of the cDNA sequences from pGEM cloning vectors into the AAV expression cassette was
performed by excision of the cDNA sequences by restriction digestion (Section 2.2.1.6) followed by
ligation into the AAV backbone plasmid (Section 2.2.1.7). Endonuclease digestion of the pGEM
plasmids and the AAV backbone plasmid with the same pairs of restriction enzymes (Table 2-4)
generated ssDNA overhangs on the excised cDNA sequences that complemented the ssDNA
overhangs on the linearised AAV backbone plasmid.
pGEM vector insert
Restriction Enzymes
Buffer
Upstream
Downstream
BDNF / GDNF / Bcl-xL
XhoI
BglII
NEB #3
XIAP
XhoI
EcoRI
NEB EcoRI
Table 2-4
New England Biolabs (NEB) restriction enzymes and buffers
43
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Digested cDNA sequence fragments were isolated by agarose gel extraction and the AAV backbone
DNA CIP treated to prevent self-ligation. Complimentary pairing between the ssDNA overhangs
directed orientation dependant ligation of cDNA gene sequences into the AAV expression cassette inframe with the C-terminal HA-tag (Section 2.2.1.7). The ligated AAV expression cassette plasmids
were heatshock transformed into competent E. coli cells and plated onto LB agar / amp (Section
2.2.1.4). Individual colonies were screened for the presence of my cDNA gene sequences by colony
PCR (Section 2.2.1.5). An E. coli colony that generated the correct length PCR product was selected
to inoculate an LB culture for DNA plasmid mini-prep and storage as a glycerol stock (Section
2.2.1.8). To check that the cDNA sequences were correctly inserted into the AAV expression
cassette in-frame with the HA-tag sequence, I used a DNA primer complementary to the downstream
WPRE sequence (5’→3’ CAAATTTTGTAATCCAGAGGTTC) to reverse sequence across the HAtag and into the 3’ end of my inserted cDNA gene sequences (Section 2.2.1.9).
After confirming the insertion of each cDNA gene sequence into the AAV expression cassette I
performed DNA plasmid maxi-preps to generate large quantities of each plasmid for rAAV vector
packaging (Section 2.2.1.8). In addition to the AAV backbone plasmids, maxi-preps were performed
for each of the helper plasmids (pRV1, pH21 and pF∆6) required for rAAV packaging. The quantity
of DNA in each maxi-prep was determined by spectrophotometry (Ultrospec™ 2100, Biochrom) and
I performed restriction digests to check the purity of each plasmid by the length of digested DNA
fragments on a 1% agarose gel (Appendix A.2.3).
2.2.3
Mammalian cell culture and analysis protocols
2.2.3.1
HEK 293 and HT-1080 Cell Culture
Human embryonic kidney 293 cells (HEK 293) or human osteosarcoma cells (HT-1080) were used
for rAAV vector packaging and checking transgene protein expression following plasmid transfection
and AAV vector transduction. HT-1080 cells are more receptive to AAV transduction and were
utilised for checking transgene protein expression and functional anti-apoptotic activity of AAVmediated XIAP expression. BDNF, GDNF and Bcl-xL expression was verified using HEK293 cells.
A vial containing ~1 × 106 HEK293 or HT-1080 cells was removed from liquid nitrogen storage
dewar, quickly thawed and transferred to cold Dulbecco’s Modified Eagle Media (DMEM; GIBCO®)
containing 10% fetal bovine serum (FBS). To remove the storage media I pelleted the cells by
centrifugation at 1000rpm for 5min (Heraeus Multifuge 3S-R), discarded the supernatant and
resuspended the cells in 20mL DMEM / 10% FBS. The resuspended cells were transferred to a
single T75 cell culture flask (Nunc) and incubated at 37°C, 5% CO2 changing media with fresh
44
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
DMEM as required. When the cells reached ~70% confluence I passaged them by rinsing with sterile
PBS and incubating with 1mL 0.05% trypsin / 0.53mM EDTA for 3-5mins until the cells lifted from
the plate with gentle tapping. Once the cells had detached from the culture flask I added 10mL
DMEM / 10% FBS media to inhibit the trypsin and stop the dissociation reaction before centrifuging
at 1000rpm for 5mins. The cells were resuspended in fresh DMEM / 10% FBS and split into 5 new
T75 flasks or counted using a standard hemocytometer (Appendix B.2.2) and seeded onto cell culture
plates at the required density.
2.2.3.2
In Vitro Immunocytochemistry
Immunocytochemical staining was performed to visualise transgenic proteins and the expression of
phenotypic markers following in vitro rAAV transduction. In vitro cell cultures were fixed by
incubation with 4% paraformaldehyde for 10 mins and stored at 4°C in PBS. Endogenous peroxidase
activity was blocked by adding a solution of 1% hydrogen peroxide / 50% methanol to the cells for
10 mins and then gently washing four times with PBS-Triton. The primary antibodies were diluted in
PBS-Triton with 1% normal goat serum and incubated with the cells overnight at 4°C (Table 2-5).
Secondary biotinlyated antibodies raised against the primary antibody host species were diluted 1:500
in PBS-Triton with 1% normal goat serum and incubated with the cells for 2-3hrs at room
temperature with gentle rocking following four washes of the cells with PBS-Triton. Goat serum was
omitted when staining with goat anti-Luciferase primary antibody. Extravidin peroxidase was diluted
1:500 in PBS and incubated with the cells for 2-3hrs at room temperature before I gently washed the
cells four times with PBS and added DAB or DAB-nickel solution for 10mins to visualise cells
expressing the target protein.
Marker
Antibody
Dilution
Supplier
HA-epitope
HA.11
1:1000
Covance
Luciferase
Luciferase
1:10000
Chemicon
GABAergic Neurons
Calbindin
1:5000
Swant
Dopaminergic Neurons
Tyrosine Hydroxylase
1:500
Chemicon
Table 2-5
Primary antibodies for in vitro immunocytochemistry
2.2.3.3
Hoechst Nuclear Staining
To visually assess apoptotic cell death in vitro, the cells were fixed with 4% paraformaldehyde and
then incubated in 10 µg/mL Hoechst 33258 for 10 mins. Hoechst nuclear staining was visualised on
an inverted Nikon Eclipse TE2000-U microscope with a UV filter.
45
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.2.4
AAV expression cassette transfection testing
Transfection of HEK293 or HT-1080 cells with my AAV expression plasmids was undertaken to
confirm protein expression from cDNA gene sequences inserted into the AAV expression cassettes
prior to vector packaging.
HEK293 / HT-1080 cells cultured in high glucose DMEM (GIBCO®) with 10% FBS (GIBCO®) were
plated into 12-well poly-D-lysine (Sigma-Aldrich) coated cell culture plates (Nunc) at a seeding
density of 2 × 105 cells/well. After overnight incubation the cells were ~70% confluent and I
replaced the media with 1mL IMDM (GIBCO®), 5% FBS for 2hrs prior to calcium precipitate
transfection with my AAV backbone plasmids. To form a DNA CaPO4 precipitate I added 5µg of my
AAV plasmid prep to 30µL 2.5M CaCl2, made up to 250µL with dH2O, filtered with a 0.2µm syringe
filter (Pall) and transferred to 250µL 2× HeBS buffer (50mM HEPES, 280mM NaCl, 1.5mM
NaHPO4) while vortexing. After resting for 1min I added the finely precipitated DNA solution dropwise to the HT-1080 cells media, swirled to mix and incubated for 4-8hrs before changing the media
back to DMEM, 10% FBS. Following transfection the cells were incubated with DMEM media for
three days before washing with sterile PBS and fixation with 4% paraformaldehyde.
Immunocytochemistry was performed with an HA antibody to visualise the expression of the
HA-tagged transgenic protein (Section 2.2.3.2).
2.2.5
AAV vector production
2.2.5.1
Packaging and Purification of AAV Vector Particles
Production of chimeric rAAV vector particles was undertaken as previously described (During et al.
2003; Hauck et al. 2003) by co-transfection of HEK293 cells with the AAV expression cassette
plasmid and AAV packaging plasmids containing the AAV Rep and Cap genes and Adenoviral E2A,
E4 and VA genes required to assemble the AAV viral capsule and direct packaging (Matsushita et al.
1998).
HEK 293 cells grown in high glucose DMEM, 10% FBS were seeded into five 15cm cell culture
plates (Nunc) at 2.0-2.2 × 107 cells per plate one day prior to transfection. With the HEK 293 cells
~70% confluent I replaced the media with 25mL IMDM, 5% FBS 2hrs prior to CaPO4 transfection.
A CaCl2–DNA solution was prepared using 12.5µg AAV backbone plasmid, 25.0µg pF∆6, 6.25µg
pRV1, 6.25µg pH21, 330µL 2.5M CaCl2 (final concentration of 0.3M), made up to 13.75mL with
dH2O and filter sterilised through a 0.2µm syringe filter (Pall).
To precipitate the DNA for
transfection I added 2.5mL 2× HeBS buffer to an equal volume of the CaCl2-DNA solution while
46
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
vortexing. The transfection solution was then left for 50secs to form a fine CaPO4 precipitate before
adding drop-wise to one 15cm plate of HEK 293 cells and swirling gently to mix. This was repeated
for each of the 5 plates. After overnight incubation (8-15hrs) I replaced the media with 25mL
DMEM, 10% FBS. 48-60hrs after transfection I harvested the HEK 293 cells by gently washing with
PBS, adding another 25mL PBS to each plate and using a cell scraper to lift the cells. The harvested
cells were pooled together by centrifugation at 200g for 5min, resuspended in 50mL of a 150mM
NaCl 20mM Tris pH 8.0 solution, split into two 25mL lots and frozen overnight at -20°C.
Isolation of the rAAV vector particles from the harvested HEK 293 cells was performed by adding
sodium deoxycholate (final conc. 0.5%) plus Benzonase® endonuclease (50U/mL) and incubating at
37°C for 30mins. Initial cellular debris was separated by centrifugation at 3000g for 15mins, 4°C.
The supernatant was transferred to a new centrifuge tube and incubated at 56°C for 15mins. A freeze
thaw cycle using a dry ice/ethanol bath and a 56°C water bath followed by centrifugation (3000g;
15mins; 4°C) to pellet cell debris was run three times before freezing supernatant overnight at -20°C.
HiTrap Heparin HP columns (Amersham Biosciences) were used to purify the rAAV vector particles
by re-centrifuging the harvested rAAV after thawing and passing the supernatant through a HiTrap
Heparin HP column pre-equilibrated with 10mL of a 150mM NaCl, 20mM Tris pH 8.0 solution using
a Harvard infusion pump set at 1mL/min. The rAAV loaded column was washed with 20mL 100mM
NaCl / 20mM Tris pH 8.0 solution before eluting the purified rAAV vector from the column using
1mL solutions with increasing concentrations of NaCl - 200, 300, 400, 450, 450 and 500mM NaCl
buffered with 20mM Tris pH 8.0. All of the eluted factions were pooled and the rAAV particles
concentrated using 100K MWCO MicrosepTM Centrifugal Devices (Pall). The concentrators were
centrifuged at 3000g, 4°C until there was ~300µL remaining. The concentrated rAAV vector was
then loaded into a Slide-A-Lyzer dialysis cassette (Pierce) and suspended overnight at 4°C in a sterile
container of PBS containing 1mM MgCl2. Following overnight dialysis I filtered the rAAV vector
through a 0.2µm syringe filter (Pall) and divided into 10 or 15µL aliquots for storage at -80°C.
2.2.5.2
Genomic Particle Titre
Concentrations of my rAAV vector stocks were determined by real time quantitative-PCR to measure
the genomic particle titre for each vector preparation. The rAAV vector DNA was extracted in
triplicate reactions from the rAAV vector particles using DNAseI (Invitrogen) and Proteinase K
(Sigma-Aldrich). 2.0µL of the AAV vector was diluted in 10µL DNAseI reaction buffer (Invitrogen)
plus 86.5µL dH2O and incubated with 0.5µL DNAseI at 37°C for 30min before inactivating the
DNase at 70°C for 10mins. 0.5µL Proteinase K was then added and incubated at 50°C for 1hr before
inactivation at 95°C for 20mins. The extracted DNA was further diluted 1:50 in dH2O for a total
47
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
vector dilution of 1:2500 and stored at -20°C. Standards with known genome copy number were
prepared from a maxi-prep of the AAV-Luciferase backbone plasmid containing the WPRE sequence
(Appendix B.3). The standard AAV backbone plasmid was diluted to 1 × 107 plasmid copies per µL
and then ten-fold serial dilutions were done down to 1 × 104 copies/µL giving four plasmid DNA
standards of known copy number. Quantitative-PCR was performed using primers to amplify the
WPRE sequence from the expression cassette within each of my rAAV vectors DNA.
Each quantitative-PCR sample was run in triplicate on a 96 well plate using 12.5µL ABsoluteTM
QPCR SYBR Green mix (ABgene), 0.5µL forward WPRE primer (10µM; 5’→3’ GGCTCGGCTGT
TGGGCACTGAC), 0.5µL reverse WPRE primer (10µM; 5’→3’ GGGCCGAAGGGACGTAGCA
GAA), 6.5µL dH2O and 5.0µL of extracted vector DNA, standard WPRE plasmid dilution or dH2O
as a no template control. The plate was sealed with an ABI PrismTM Optical Adhesive Cover
(Applied Biosystems) and inserted into an ABI Prism® 7700 Sequence Detection System (v1.9;
Applied Biosystems) programmed to run the following thermal cycle:
Polymerase activation
95°C
10 min
Denaturing
95°C
15 sec
Annealing and Extension
60°C
60 sec
Final Extension
72°C
10 min
1 cycle
40 cycles
1 cycle
Mean cycle time (Ct) values from triplicate reactions were used to calculate the number of genomic
copies in each of the AAV vector stocks (Appendix B.3). A standard curve was generated from the
Ct values of the known concentration standards plotted against the Log value of the absolute number
of plasmid copies in the reaction mix. Using the standard curve Ct values for the rAAV samples were
converted to Log input quantities. To calculate actual genomic titres these values were inverse
Logged, multiplied by the extracted DNA dilution factor of 2500 and multiplied by 200 to convert
from the 5µL used in the reactions to copies per mL. To account for the single stranded AAV
genome in contrast to the double stranded plasmid DNA the concentrations calculated from the
plasmid standards were multiplied by 2 to give the actual genomic particle titre of my rAAV vectors.
2.2.6
In vitro transduction testing
Each of the newly constructed rAAV vector stocks were tested on HEK 293 or HT-1080 cells to
ensure they contained infectious particles. HEK 293 or HT-1080 cells were grown on poly-D-lysine
coated plates (24-well, Nunc) to ~70% confluence in 1mL DMEM media with 10% FBS. The media
48
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
was replaced with fresh DMEM and 2.0µL of the rAAV stock was added to each well. Cells were
incubated for one week refreshing the media four days after rAAV transduction. The final media
from AAV-BDNF, AAV-GDNF and AAV-Luciferase transduced cultures was collected and stored at
-80°C for ELISA quantification of secreted neurotrophic factors. Cells were then gently washed with
sterile PBS and fixed with 4% paraformaldehyde.
Immunocytochemistry was performed with either HA (Covance) or Luciferase (Chemicon)
antibodies to visualise transgene protein expression within successfully transduced cells (Section
2.2.3.2).
Control immunostaining was performed with the same antibodies on non-transduced
cultures.
Quantitative ELISAs were run on the collected media from the AAV-BDNF and AAV-GDNF
transduced HEK293 cells to measure secreted BDNF and GDNF protein using Promega Emax
ImmunoAssay kits (BDNF, G7610; GDNF, G7620). The conditioned culture media was diluted 1:2
and 1:4 in DMEM media and run in triplicate wells on the ELISA plate against the recommended
eight-point standard series for each kit. Conditioned media collected from non-transduced HEK293
cells was also assessed on the same ELISA plates to provide controls for any endogenous
neurotrophic factor expression. Optical absorbance was read at 450nm on a Spectra max plate reader
(Molecular Devices) and the quantity of neurotrophic factor expression calculated from the standard
curves.
2.3 Functional AAV-Mediated Protein Expression Testing In Vitro
Functional assays were performed with each rAAV vector construct to ensure that the encoded
protein-of-interest was expressed in a functionally active form following AAV transduction.
Differentiation assays with primary neuronal cultures were used to visualise neurotrophic factor
assisted phenotypic differentiation. Anti-apoptotic protein function was assessed with a cell death
assay kit to measure the level of apoptosis following the induction of apoptosis in rAAV transduced
in vitro cultures.
2.3.1
Isolating and culturing primary cells
Primary neuronal cells were cultured from embryonic day 14 (E14) or day 15 (E15) Wistar rat
embryos.
Dopaminergic precursor neurons were isolated from the E14 ventral mesencephalon,
GABAergic neuronal precursors from the E15 striatum and mixed cortical cultures from E15 cortex.
Tissue from each brain region was isolated under a dissecting microscope as described by Barker and
49
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Johnson (1995). Three independent parallel cultures were established for each region from separate
timed pregnant Wistar dams, harvesting tissue from 8-12 embryos per dam. The tissue from each
embryo was finely diced in chilled Leibovitz L15 media (GIBCO®) with added glucose and pen/strep,
and pooled together. Treating each dam separately, the dissected tissue was centrifuged at 300g for
2min and the L15 media replaced with 2mL fresh chilled L15 media. Three fire-polished Pasteur
pipettes of decreasing opening diameter were used sequentially to gently triturate the diced tissue into
single cells. After letting the debris settle the cloudy supernatant containing single cells was removed
and centrifuged at 1000g for 5min to pellet cells. The cells were then resuspended in Neurobasal
media (GIBCO®) with added glucose, L-glutamine, pen/strep and 2% B27, and plated as required
onto 24- or 96-well plates (Nunc) coated with 0.1mg/mL poly-D-lysine and pre-incubated with 10%
FBS in PBS.
2.3.2
AAV-BDNF
The expression of functional BDNF was assessed by the presence of calbindin expressing neurons
following AAV-BDNF transduction of primary striatal cultures. Primary striatal neurons isolated
from E15 Wistar rat embryos from three independent Wistar dams were seeded onto 24-well plates at
2 × 105 cells per well (Section 2.3.1). AAV-BDNF or AAV-Luciferase vectors were added to the
Neurobasal culture media 24hours after seeding at a concentration of 1,000 genomic particles per cell
(2 × 108 AAV genomic particles per well). Triplicate culture wells seeded from each independent
dam received either AAV-BDNF, AAV-Luciferase or were left untreated as negative controls (n = 9
per treatment). The cultures were maintained for 21 days at 37°C, 5% CO2 changing 50% of the
Neurobasal media every three days before gently washing with PBS and fixation with 4%
paraformaldehyde.
The differentiation of the primary striatal neurons was assessed by immunocytochemistry with anticalbindin (1:5000, Swant) to visualise calbindin protein expression (Section 2.2.3.2).
Cells
expressing calbindin were quantified under a 40× objective (Nikon Eclipse TS100) in five randomly
placed fields of view for each culture well.
2.3.3
AAV-GDNF
To verify functional GDNF protein expression I transduced embryonic ventral mesencephalic
cultures with AAV-GDNF to induce maturation towards dopaminergic neurons. Primary E14 ventral
mesencephalon cells from three independent isolations were seeded onto 24-well culture plates at 2 ×
105 cells per well in Neurobasal media and incubated overnight (Section 2.3.1). Twenty-four hours
50
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
after seeding the cells, AAV-GDNF or AAV-Luciferase vectors were added to the Neurobasal culture
media, at a concentration of 1,000 genomic copies per cell (2 × 108 genomic copies per well), in
triplicate wells for each culture.
An additional three wells from each dam received 10ng/mL
rhGDNF protein (R&D Systems) as a positive control and three wells were left untreated as a
negative control. All cultures (n = 9 per treatment) were maintained at 37°C, 5% CO2 changing 50%
of the media every three days with fresh Neurobasal and supplementing the positive control wells
with 10ng/mL rhGDNF protein. Three weeks after plating the cultures were gently washed with
sterile PBS and fixed with 4% paraformaldehyde.
Dopaminergic neurons were visualised by immunocytochemistry with anti-tyrosine hydroxylase
(anti-TH; 1:1000, Chemicon; Section 2.2.3.2) and quantified under a 40× objective (Nikon Eclipse
TS100) in five randomly placed fields of view for each culture well.
2.3.4
AAV-Bcl-xL
To test for functional Bcl-xL expression, primary cortical cultures were transduced with AAV-Bcl-xL
and used to perform an apoptosis assay. Primary cortical cells from three independent cultures were
plated onto 96-well plates at a density of 4 × 104 cells per well with 200µL Neurobasal media and
incubated overnight at 37°C, 5% CO2 (Section 2.3.1). Twenty-four hours after plating the cells were
transduced with either AAV-Bcl-xL (six wells per culture), or AAV-Luciferase (three wells per
culture). The rAAV vectors were added to the Neurobasal culture media at a concentration of 1,000
genomic copies per cell and maintained for three weeks replacing half of the Neurobasal media every
two-or-three days with fresh media. Apoptosis was induced three weeks after transduction in half of
the AAV-Bcl-xL transduced wells and all of the AAV-Luciferase transduced wells by incubating the
cultures with Neurobasal media containing 0.5µM staurosporine (Sigma-Aldrich) for 48hrs (n = 9 per
treatment). The remaining three AAV-Bcl-xL transduced wells from each culture received PBS as
non-apoptosis induced controls.
A Cell Death Detection ELISAPLUS kit (Roche) was used to quantify the level of apoptosis occurring
within each culture well by detecting apoptosis generated nucleosomes after 48hrs of staurosporine
exposure. Briefly the culture media was carefully discarded and the cells lysed using the supplied
lysis buffer and centrifuged to remove cellular debris and unfragmented DNA. Supernatant from
each culture well was incubated in a streptavidin coated ELISA plate with immunoreagent solution
containing both biotin labelled anti-histone and peroxidase conjugated anti-DNA antibodies. The
quantity of bound nucleosomes was photometrically determined using ABTS (2,2-azino-di-3ethylbenzthiazoline sulfonate) as a substrate for the bound peroxidase. Absorbance was read at
51
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
405nm on a Spectra max plate reader (Molecular Devices) with the non-apoptosis induced control
wells used to normalise data across the three independent cultures.
For visual analysis with immunocytochemical staining I cultured and treated a second set of primary
cortical cells in parallel to the cultures used for the apoptosis quantification. Immunocytochemistry
was undertaken with anti-HA (1:1000, Covance) and anti-Luciferase (1:10000, Chemicon) to
visualise the transduced cells (Section 2.2.3.2).
Hoechst 33258 nuclear staining allowed
identification of cells undergoing nuclear condensation and fragmentation (Section 2.2.3.3).
2.3.5
AAV-XIAP
To assess functional XIAP expression I performed an apoptosis assay on HT-1080 cell cultures
transduced with either AAV-XIAP or AAV-Luciferase. HT-1080 cells were plated onto 96-well
plates at a low seeding density of 1 × 104 cells per well in DMEM, 10% FBS and incubated overnight
at 37°C, 5% CO2.
AAV-XIAP or AAV-Luciferase were added to the culture media at a
concentration of 10,000 genomic copies per cell, transducing 18 wells with each vector. Cells were
grown for three days following AAV-XIAP transduction to ensure transgenic protein expression
before incubating half of the wells from each group with DMEM containing 0.2µM staurosporine for
12hrs (n = 9 per treatment). Non-staurosporine induced wells served as controls.
A Cell Death Detection ELISAPLUS kit was used to quantify the level of apoptotic cell death in each
well by measuring apoptosis generated nucleosomes (as described for AAV-Bcl-xL in Section 2.3.4).
Immunocytochemistry on parallel cultures was undertaken with either anti-HA or anti-Luciferase to
visualise AAV-XIAP and AAV-Luciferase transduced cells (Section 2.2.3.2). Hoechst 33258 nuclear
staining was performed to visually identify cells displaying apoptotic features of nuclear
condensation and fragmentation (Section 2.2.3.3).
2.4 Results
The production of recombinant AAV vectors was divided into two distinct elements: AAV plasmid
construction, and AAV vector packaging. This was then followed by functional testing of the newly
constructed AAV vector particles.
2.4.1
AAV plasmid construction
Construction of the AAV expression cassettes for the neuroprotective investigations was greatly
aided by the availability of an empty AAV expression cassette containing all of the desired regulatory
52
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
elements, requiring only the insertion of a gene-of-interest.
Following the insertion of cDNA
sequences encoding BDNF, GDNF, Bcl-xL or XIAP into separate AAV expression cassettes I
transfected HEK293 and/or HT-1080 cells with each newly constructed AAV plasmid. This was
performed to check protein expression driven from the AAV expression cassette prior to AAV vector
packaging. Immunostaining of the HEK293 or HT-1080 cells with an HA antibody confirmed the
expression of transgenic proteins following transfection for each of my four AAV plasmids (Figure
2-2A-D). The fusion of a small HA-epitope to the transgenic proteins allowed easy identification of
transgenic protein expression in transduced cells without potential staining of endogenously
A
B
C
D
E
Figure 2-2
Transfection of AAV backbone plasmids
Expression of HA-tagged proteins following AAV backbone plasmid transfection of
HT-1080 cells visualised by immunocytochemistry with an HA antibody – (A) BDNF, (B) GDNF,
(C) Bcl-xL, (D) XIAP and (E) non-transfected control culture. Scale bar = 25µ m.
53
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
expressed protein that is likely to occur with antibodies against the neurotrophic factors and antiapoptotic factors under investigation. All of the plasmids directed good expression of HA-tagged
proteins with expression of BDNF and GDNF concentrated at the perimeter of the cells (Figure
2-2A,B) compared with the more evenly distributed anti-apoptotic factors (Figure 2-2C,D). No HA
staining was detectable in any of the non-transfected culture wells (Figure 2-2E).
2.4.2
AAV vector production
After successful vector packaging, the concentration of each AAV vector stock was quantified by real
time PCR to determine its genomic titre. The AAV packaging and purification protocol produced
reasonably consistent AAV titres of ~1012 AAV genomes per mL (Table 2-6) although the AAV-BclxL was lower at 5.1 x 1011 genomes per mL and AAV-XIAP significantly higher than the other
vectors at 1.9 x 1013 genomes per mL. To allow reasonable comparisons between the different
vectors I diluted the AAV-XIAP 10-fold with sterile PBS prior to use.
AAV vector
Genome Copy Number
AAV-BDNF
2.0 × 1012
AAV-GDNF
2.2 × 1012
AAV-Bcl-xL
5.1 × 1011
AAV-XIAP*
1.9 × 1013
AAV-Luciferase
4.6 × 1012
Table 2-6
Genomic titres of AAV vector stocks
High-titre recombinant AAV vector stocks purified by heparin affinity chromatography ranged from
1011 – 1013 genomic particles per mL. * The AAV-XIAP vector was diluted 10-fold to provided
comparable vector titres of ~1012.
2.4.3
AAV vector transduction
In vitro transduction of HEK293 or HT-1080 cells with each of the recombinant AAV vectors was
confirmed by immunocytochemical staining with either HA or Luciferase antibodies (Figure 2-3).
Immunopositive cells were present in all culture wells that received one of the AAV vectors.
Specificity of the antibodies to the transgenic proteins was confirmed by the lack of staining in the
non-transduced cultures (Figure 2-3B,G). Transgenic protein expression following AAV-BDNF or
AAV-GDNF transduction once again appeared localised to the cell surface in contrast to the whole
cell accumulation of the anti-apoptotic factors and Luciferase. The HT-1080 cell line appeared more
receptive to rAAV transduction than the HEK293 cells, used initially to test the AAV vectors, as
evidenced by greater numbers of HA- and Luciferase-positive cells in the HT-1080 cultures.
54
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Secretion of the neurotrophic factors into the culture media was quantified by ELISA to be
approximately 350 pg/mL of BDNF and 600 pg/mL of GDNF.
A
B
C
D
E
F
G
Figure 2-3
AAV vector transduction in vitro
Successful AAV vector transduction of HEK293 or HT-1080 cells and the expression of transgenic
proteins visualised by immunocytochemistry with (A,B) Luciferase or (C-G) HA antibodies: (A)
AAV-Luciferase; (C) AAV-BDNF; (D) AAV-GDNF; (E) AAV-Bcl-xL; (F) AAV-XIAP; (B,G) nontransduced cultures. Scale bar = 25µm.
55
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.4.4
Functional protein expression
2.4.4.1
Brain Derived Neurotrophic Factor
AAV-BDNF mediated expression of functional BDNF was assessed following AAV-BDNF
transduction of primary embryonic day-15 striatal cultures. BDNF enhances GABAergic neuronal
differentiation and induces calbindin expression in the striatal neurons (Mizuno et al. 1994;
Ventimiglia et al. 1995). Calbindin-positive cells were observed in all of the striatal cultures (Figure
2-4). To standardise the quantification of calbindin-positive neurons across the three independent
cultures I calculated calbindin-positive cell counts as a ratio of the untreated control wells for each
culture (Figure 2-5). Addition of AAV-BDNF resulted in a 96 ± 2% increase in the number of
calbindin-positive cells over untreated wells (P < 0.001). AAV-Luciferase transduction did not
significantly alter the number of calbindin-expressing cells compared with untreated cultures.
Additionally, calbindin-positive neurons in the AAV-BDNF transduced cultures were observed to
have a greatly enhanced dendritic morphology compared with the restricted number of projections in
the control cultures (Figure 2-4).
2.4.4.2
Glial cell-line Derived Neurotrophic Factor
Transduction of undifferentiated ventral mesencephalon neuronal cultures isolated from embryonic
day-14 rat embryos with AAV-GDNF was undertaken to verify the expression of functional GDNF
(Figure 2-6).
GDNF induces differentiation of neurons towards a dopaminergic fate in the
developing mid-brain (Stromberg et al. 1993; Choi-Lundberg and Bohn 1995). Quantification of the
TH-positive neurons was standardised to untreated control cultures to account for variations between
the three independent source cultures (Figure 2-7). AAV-GDNF transduction induced a 62 ± 2%
increase in TH-positive neurons compared with the number of TH-positive neurons in untreated
cultures (P < 0.05). Supplementation of the culture media with rhGDNF as a positive control
increased the number of TH-positive neurons by 46 ± 2%, however this failed to reach statistical
significance (P > 0.05). The AAV-Luciferase vector control cultures were not significantly different
from untreated cultures. TH-positive neurons within AAV-GDNF and rhGDNF treated cultures
developed more extensive dendritic networks than the TH expressing cells in the AAV-Luciferase
and untreated negative control cultures (Figure 2-6).
56
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
A
B
C
D
Figure 2-4
Phenotypic differentiation of primary striatal cultures
Representative images of calbindin-expressing neurons within embryonic striatal cultures threeweeks post AAV-BDNF or AAV-Luciferase transduction. (A,B) AAV-BDNF transduced cultures
contained calbindin-positive neurons that developed an extensive dendritic morphology. (C,D) AAVLuciferase and non-transduced control cultures had fewer calbindin-positive neurons which displayed
restricted dendrite growth. Scale bar = 100µm for (A,C) and 50µ m for (B,D).
Figure 2-5
AAV-BDNF induced calbindin expression in embryonic striatal cultures
Graph showing the increased number of calbindin-expressing neurons following AAV-BDNF
transduction relative to the AAV-Luciferase transduced and un-treated cultures. Cell counts from
untreated control wells were used to normalise data between the three independent cultures. One-way
ANOVA P < 0.001 with Bonferroni’s post-hoc tests * P < 0.01, ** P < 0.001.
57
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
A
B
C
D
Figure 2-6
Phenotypic differentiation of primary ventral mesencephalon cultures
Representative images of TH-expressing neurons within embryonic ventral mesencephalon cultures
three-weeks post (A) AAV-GDNF transduction, (B) supplementation with rhGDNF, (C) AAVLuciferase transduction or (D) non-transduced cultures. AAV-GDNF and rhGDNF treated cultures
contained numerous TH-positive neurons that developed into groups of extensively networked
neurons. A smaller number of the ventral mesencephalon neurons in control cultures also
differentiated into TH-expressing neurons. Scale bar = 100µm.
Figure 2-7
AAV-GDNF induced TH expression in ventral mesencephalon cultures
Graph showing the increased number of TH-expressing neurons following AAV-GDNF transduction,
and the addition of rhGDNF protein, relative to AAV-Luciferase transduced and un-treated cultures.
Cell counts from untreated controls wells were used to normalise data between the three independent
cultures. One-way ANOVA P < 0.05 with Bonferroni’s post-hoc tests * P < 0.05.
58
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.4.4.3
Bcl-xL
Expression of functionally active Bcl-xL protein from the AAV-Bcl-xL vector was checked by
measuring staurosporine induced apoptotic cell death in primary cortical cultures transduced with
AAV-Bcl-xL (Figure 2-9). Apoptotic cell death across each of my three independent cortical cultures
was assessed relative to the quantity of apoptotic nucleosomes detected in the AAV-Luciferase vector
control wells following staurosporine exposure (Figure 2-8). The transgenic expression of Bcl-xL by
cortical cells in vitro, following AAV-Bcl-xL transduction, reduced apoptotic nucleosomes formation
by 19 ± 2% compared with my control AAV-Luciferase transduced cultures. Apoptosis in the control
AAV-Bcl-xL transduced cultures not exposed to staurosporine was measured at a level equivalent to
45 ± 2% of apoptosis cell death occurring in the AAV-Luciferase transduced controls exposed to
staurosporine.
Immunocytochemical staining with HA or Luciferase antibodies showed that only a small population
of the cortical cells within each culture were successfully transduced (Figure 2-9A,C,E). Cells
expressing transgenic Bcl-xL protein in the absence of staurosporine appeared healthy with extensive
dendritic morphology (Figure 2-9A). Following the induction of apoptosis, AAV-Bcl-xL transduced
Figure 2-8
AAV-Bcl-xL reduced staurosporine-induced apoptosis
Graph showing AAV-Bcl-xL mediated reduction in the level of apoptotic cell death occurring in
primary cortical cultures following staurosporine exposure relative to the AAV-Luciferase transduced
wells used to normalise data across the three independent cultures. A substantial level of noninduced apoptotic cell death was recorded in non-staurosporine exposed AAV-Bcl-xL treated cultures.
Mann-Whitney analysis * P < 0.01, ** P < 0.001.
59
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
A
B
C
D
E
F
Bcl-xL
No STS
Bcl-xL
+ STS
Luc
+ STS
Figure 2-9
AAV-Bcl-xL transduced cortical cells following staurosporine-induced apoptosis
Representative images of primary cortical cultures transduced with (A-D) AAV-Bcl-xL or (E,F)
AAV-Luciferase showing transgene expression and Hoechst nuclear staining. (A) Cortical cells
transduced by AAV-Bcl-xL express HA-tagged Bcl-xL protein as visualised by HA-positive neurons
not exposed to staurosporine. (C) After 48hrs of staurosporine exposure HA-positive cells were
observed to resist cell death. (E) Very few Luciferase-positive cells resisted staurosporine-induced
apoptosis. (B,D,F) Hoechst nuclear staining displays both large rounded healthy cells (arrowheads)
and cells under going apoptosis induced nuclear fragmentation (arrows). Scale bar = 50µm (DAB
and Hoechst images are not matched). Abbreviations: Luc, Luciferase; STS, Staurosporine.
60
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
cells were still present within the cortical cultures however they displayed condensed cell bodies with
restricted dendritic projections (Figure 2-9C). Very few cells expressing Luciferase were seen to
survive staurosporine induced cell death (Figure 2-9E). Hoechst staining showed widespread nuclear
condensing and fragmentation within all staurosporine induced cultures (Figure 2-9D,F), in contrast
to the predominantly large, rounded cells in the AAV-Bcl-xL transduced, non-staurosporine induced
wells (Figure 2-9B).
2.4.4.4
X-linked Inhibitor of Apoptosis Protein
AAV-XIAP mediated expression of functional XIAP was verified by transducing HT-1080 cells with
AAV-XIAP and assessing the level of apoptosis following staurosporine-induced apoptotic cell death
(Figure 2-11). HT-1080 cells are readily transduced by AAV vectors providing a clean substrate for
assessing the effect of non-cell dependent protein expression. Transduction with AAV-XIAP resulted
in a 52 ± 2% reduction in apoptosis compared with the apoptosis induced by staurosporine in AAVLuciferase cultures (Mann-Whitney P < 0.001; Figure 2-10). Non-staurosporine induced cultures
transduced with either AAV-XIAP or AAV-Luciferase only had marginally detectable levels of
apoptotic induced nucleosomes with no significant difference between the two groups.
Figure 2-10 AAV-XIAP reduced staurosporine-induced apoptosis
Graph showing AAV-XIAP mediated reduction in the level of apoptotic cell death occurring in
HT-1080 cultures following staurosporine exposure relative to the AAV-Luciferase transduced wells
used to normalise data across the three independent cultures. Negligible apoptotic cell death was
detected in non-staurosporine exposed cultures. Mann-Whitney analysis * P < 0.001.
61
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Visualisation of the transduced cells with immunocytochemical staining for HA or Luciferase showed
a population of the HT-1080 cells were transduced and expressed transgenic XIAP or Luciferase
(Figure 2-11). Staurosporine induced extensive cell death in all cultures however a number of HA
stained cells survived in the AAV-XIAP transduced wells and exhibited a neuronal-like morphology
(Figure 2-11C). A few AAV-Luciferase transduced cells were observed after staurosporine exposure
however they were located within patches of cellular debris non-representative of the HT-1080 cells
(Figure 2-11G). Co-staining of the transduced cells with Hoechst 33258 further showed the survival
of non-fragmented HT-1080 cells in the AAV-XIAP transduced cultures including both the surviving
HA-positive transduced cells (Hoechst staining is compromised by the DAB staining) and some
additional non-transduced cells (Figure 2-11D).
Cells displaying nuclear condensation and
fragmentation were observed with Hoechst staining in the AAV-Luciferase control transduced wells
and to a lesser extent within the AAV-XIAP transduced wells following staurosporine exposure, with
the total number of HT-1080 cells remaining clearly reduced in comparison to the non-staurosporine
treated cultures.
Figure on following page
Figure 2-11 Enhanced survival of AAV-XIAP transduced HT-1080 cells
Representative images of HT-1080 cells transduced with (A-D) AAV-XIAP or (E-H) AAVLuciferase showing transgene expression and Hoechst nuclear staining of the same cells (arrows;
DAB staining reduces intensity of Hoechst staining). (A,E) HT-1080 cells are readily transduced by
AAV vectors with individual XIAP expressing cells (C) surviving staurosporine exposure but with
shrunken cytoplasm. (G) A few AAV-Luciferase transduced cells survived staurosporine treatment
but were observed within clumps of cellular debris. Scale bar = 50µ m. Abbreviations: Luc,
Luciferase; STS, Staurosporine.
62
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
A
B
C
D
E
F
G
H
XIAP
No STS
XIAP
+ STS
Luc
No STS
Luc
+ STS
Figure 2-11
Enhanced survival of AAV-XIAP transduced HT-1080 cells
63
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.5 Discussion
2.5.1
AAV vector construction
AAV vectors were constructed to deliver DNA expression cassettes, encoding the potential
biotherapeutic proteins BDNF, GDNF, Bcl-xL or XIAP, to targeted neuronal populations in the CNS.
To direct transgenic protein expression I used an expression cassette containing the constitutive CBA
/ CMV promoter-enhancer hybrid shown to generate high level transgene expression (Klein et al.
2002) without down-regulation, ensuring continuous long-term protein production. A downstream
WPRE sequence and poly-A tail help to further enhance transgene expression by stabilising the
mRNA allowing greater protein translation (Loeb et al. 1999; Paterna et al. 2000; Xu et al. 2001).
Each protein-of-interest was cloned into the expression cassette, in-frame with a nine amino acid Cterminal HA-tag epitope to allow clear immunocytochemical visualisation of transgenic protein
expression following cellular transduction.
The expression cassettes were flanked by ITR sequences derived from serotype-2 AAV which have
been extensively utilised in both preclinical research and clinical trails (Grieger and Samulski 2005).
The ITR sequences are the only viral-derived DNA packaged into the rAAV vector particles which
can hold up to ~4.7 kb of ITR flanked DNA. The expression cassettes I constructed ranged in length
from ~2.9 for AAV-GDNF and AAV-Bcl-xL, ~3.0kb for AAV-BDNF, ~3.8kb for AAV-XIAP and
~4.1kb for AAV-Luciferase. Prior to rAAV packaging I confirmed protein expression from each
AAV expression cassette by transforming the AAV-plasmids into in vitro cell cultures. HA-positive
cells were present in all transformed cultures with the neurotrophic factors localising primarily to the
cell surface and the anti-apoptotic factors appearing to disperse throughout the cytoplasm of the cells
(Section 2.4.1).
The expression cassettes were packaged into chimeric rAAV particles consisting of serotype-1 and -2
capsid proteins in a 1:1 ratio.
The capsid proteins influence cellular transduction with this
combination of serotype-1/2 giving enhanced transduction efficiency of neuronal cells over either
capsid -1 or -2 alone (Hauck et al. 2003; Richichi et al. 2004). Utilising the heparin affinity of the
serotype-2 capsid proteins (Zolotukhin et al. 1999), AAV vectors were purified by heparin affinity
column and concentrated to ~1012 genomic particles per mL. While I tested that the vector stocks
contained infectious particles by transduction of cell-lines in vitro (Section 2.4.3), I did not undertake
infectious particle titres. I would assume that following heparin purification all remaining genomic
copies were packaged within AAV particles. However as AAV production requires capsid assembly
followed by the rate-limiting encapsulation of the ssDNA genome a large proportion of empty virions
64
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
are typically present within the final vector stocks and their theoretical impact cannot be discounted
(Timpe et al. 2005). Empty capsids may compromise the gene delivery by unnecessarily increasing
exposure of AAV particles which may influence transduction efficiency or enhance antibody
generation, a potential concern for repeated AAV administration.
2.5.2
Functional protein expression
The production of functionally active biotherapeutic molecules following gene transfer is clearly
essential for any gene therapy procedure. It was therefore important that I performed functional
assays with each recombinant AAV vector to determine that the proteins-of-interest were correctly
produced in a biologically active form following cellular transduction. Taking advantage of the well
characterised properties of neurotrophic factors in assisting neuronal differentiation and antiapoptotic factors in promoting cell survival, I designed and performed efficient phenotypic
differentiation and cell-survival assays to confirm expected functional impact of the transgenic
proteins following in vitro AAV vector transduction.
2.5.2.1
Differentiation Assays to Confirm Neurotrophic Factor Activity
Neurotrophic factors are important for directing both phenotypic differentiation within the developing
CNS, and maintaining cell plasticity and survival within the adult brain (Krieglstein 2004; Levy et al.
2005; Van Ooyen 2005). Neurotrophic factors are secreted proteins that signal via cell surface
receptors and have both autocrine and paracrine activity. Therefore the biological effect of transgenic
neurotrophic factor expression following gene delivery is expected to extend beyond the cells actually
transduced by the viral vector. I developed functional assays for BDNF and GDNF using primary
embryonic neuronal cultures isolated from gestation day 14 or 15 (E14 or E15) Wistar rat pups to
visualise the effect of these neurotrophic factors on phenotypic differentiation following AAVmediated gene transfer. Previous studies have shown that BDNF enhances the differentiation of
GABAergic neurons (Mizuno et al. 1994; Ventimiglia et al. 1995), while GDNF plays a key role in
the differentiation and maturation of dopaminergic neurons (Lin et al. 1993; Widmer et al. 2000).
Primary embryonic cultures were chosen to verify transgenic neurotrophic factor functionality as
immature embryonic neurons at E14/15 are naturally primed by their micro-environment and express
appropriate cell surface receptors for neurotrophic factors which assist in directing their phenotypic
differentiation and neurite outgrowth (Ernfors et al. 1992). Functional assessment of virally mediated
neurotrophic factor expression has previously been undertaken by collecting conditioned media
containing the transgenic protein from transduced cell lines, applying this media to non-transduced
cultures or explants and assessing morphological changes (Martinez-Serrano et al. 1995; Watabe et
65
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
al. 2000; Sakamoto et al. 2003; Hu et al. 2005). The use of conditioned media is important for
assessing any novel biological functions of secreted molecules as it avoids the potentially
confounding involvement of physical AAV vector transduction or altered protein expression.
However the functional assays I performed demonstrated that AAV-mediated expression of
functional BDNF and GDNF can effectively be assessed in a readily reproducible protocol by directly
transducing undifferentiated primary neuronal cultures.
Brain Derived Neurotrophic Factor
The biological activity of BDNF was assessed following AAV-BDNF transduction of primary
embryonic striatal cultures isolated from E15 Wistar rat pups (Section 2.4.4.1). Embryonic striatal
neurons were chosen as they predominantly differentiate into GABAergic medium spiny projection
neurons in vivo, and express TrkB the high-affinity cell-surface receptor for BDNF (Ernfors et al.
1992; Mizuno et al. 1994). BDNF is vital for both striatal development and maintenance throughout
adult life with mature striatal neurons both producing BDNF as well as receiving a significant supply
via anterograde transport of BDNF from the cortex via corticostriatal axonal projections (Altar et al.
1997; Kokaia et al. 1998).
Primary striatal cultures were transduced with AAV-BDNF and
maintained in vitro for three weeks to ensure a stable level of transgenic BDNF expression and
provide sufficient exposure of BDNF to the striatal cultures to enhance GABAergic differentiation
and maturation. Functional activity of BDNF was assessed by the induction of calbindin expression.
Calbindin is a calcium binding protein expressed by a population of striatal GABAergic neurons
(Gerfen et al. 1985; DiFiglia et al. 1989; Mizuno et al. 1994) shown to be induced in striatal neurons
by BDNF (Ventimiglia et al. 1995; Ivkovic and Ehrlich 1999). Three-weeks post AAV-BDNF
transduction there were up to twice the number of calbindin-positive neurons in the AAV-BDNF
transduced cultures compared with both AAV-Luciferase vector control and untreated cultures. This
significant increase in the number of calbindin-positive neurons observed in AAV-BDNF transduced
cultures indicates that the HA tagged BDNF transgenic protein produced was functionally active in
influencing the GABAergic differentiation of E15 embryonic striatal neurons. In addition to the
increased differentiation, it was observed that calbindin-positive neurons in the AAV-BDNF
transduced cultures had enhanced dendritic morphology compared to calbindin-positive neurons
within non-transduced cultures, suggesting that the transgenic protein expression has enhanced
maturation of these striatal neurons. This enhanced neurite outgrowth and maturation is consistent
with increased BDNF expression providing additional supporting evidence that the transgenic BDNF
is being correctly produced in a biologically active form.
66
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
Glial cell-line Derived Neurotrophic Factor
Functional GDNF expression was verified following in vitro AAV-GDNF transduction of E14
ventral mesencephalon cultures. GDNF is a potent dopaminergic neurotrophic factor that assists with
the differentiation and maturation of dopamine neurons.
Neurogenesis and migration of
dopaminergic precursor neurons into the ventral mesencephalon region occurs between gestation days
E10 to E16 in rats, peaking around E14 (Altman and Bayer 1981; Prakash and Wurst 2006). The
normal endogenous expression of GDNF, which peaks at birth in the CNS, assists in directing the
dopaminergic precursor neurons to develop a dopaminergic phenotype (Stromberg et al. 1993; ChoiLundberg and Bohn 1995). GDNF receptors expressed on the terminals of dopaminergic precursor
neurons allow retrograde transport back to the substantia nigra to direct the axon projections towards
high-level GDNF expression within the developing striatum (Lin et al. 1993; Tomac et al. 1995).
Three weeks after AAV transduction of E14 ventral mesencephalic cultures I performed
immunocytochemical staining for TH, the rate-limiting enzyme in the production of dopamine, a
phenotypic marker for dopaminergic neurons. With the E14 ventral mesencephalon cells already
primed for a dopaminergic neuronal fate I observed a large number of TH-positive cells within all
cultures. AAV-GDNF transduced wells however exhibited a significant (more than 50%) increase in
TH-positive cells over AAV-Luciferase and untreated cultures with more extensive dendritic
networking between the TH-positive neurons. Supplementation with rhGDNF failed to generate a
statistically significant increase in TH-positive neurons despite showing an enhancement of THdifferentiation. This contrast with AAV-GDNF treatment was possibly due to the concentration of
GDNF present in the cultures. AAV-GDNF transduced cells were likely to have been secreting a
constant supply of GDNF that may well have led to significantly greater GDNF bioavailability than
the 10 ng/mL rhGDNF added once daily to the E14 cells. AAV-Luciferase treatment did not alter the
number of TH-expressing cells compared with untreated wells.
The impact of AAV-GDNF in influencing differentiation into TH-positive neurons, exceeding the
influence of rhGDNF supplementation, is consistent with the known activity of endogenous GDNF in
driving undifferentiated ventral mesencephalon neurons towards a dopaminergic fate in vivo, and is
strongly indicative that the transgenic GDNF-HA is functional active. The additional observation of
enhanced dendritic networking by the TH-positive neurons, possibly due to axonal targeting of
GDNF expressing neurons and retrograde transportation of the GNDF, is further supportive of an
increased bioavailability of functional GDNF assisting the maturation of dopaminergic neurons.
67
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
2.5.2.2
Cell-Survival Assays to Confirm Anti-Apoptotic Protein Function
Anti-apoptotic proteins play a vital role in ensuring cell survival by counteracting or inhibiting the
function of pro-apoptotic caspases and mitochondrial proteins. Enhancing the expression level of
anti-apoptotic factors is likely to shift the apoptosis balance towards cell survival and therefore
increase the cells resistance to specific apoptotic induction cues (Simons et al. 1999; Xu et al. 1999;
Yamada et al. 1999; Shimazaki et al. 2000; Perrelet et al. 2002; Miagkov et al. 2004; Malik et al.
2005). Apoptosis can be quantified by detecting changes in apoptotic parameters including the
activation of apoptotic caspases, mitochondrial release of pro-apoptotic proteins or DNA
fragmentation (Loo and Rillema 1998; Goldstein et al. 2005). To verify functional anti-apoptotic
activity of the Bcl-xL and XIAP protein expression following AAV-mediated transduction I
quantified the generation of cytoplasmic histone-associated-DNA-fragments (nucleosomes) following
the induction of apoptosis.
Apoptosis was induced following AAV-Bcl-xL and AAV-XIAP
transduction by incubating the cultures with staurosporine, a potent kinase inhibitor that induces
apoptotic cell death through both caspase-dependent and caspase-independent mechanisms (Zhang et
al. 2004). Staurosporine provides a broad approach to apoptosis allowing the assessment of various
anti-apoptotic factors in different cell lines independent of a specific pathological process. Bcl-xL is a
pro-survival member of the Bcl-2 family of apoptosis regulating proteins involved in controlling both
caspase-9 activation via the mitochondrial release of cytochrome c and other caspase-independent
apoptogenic proteins (Kim 2005). XIAP is a potent anti-apoptotic factor that functions as an inhibitor
of both initiator caspase-9 and the executioner caspases -3 and -7 through its dual caspase inhibiting
sites (Deveraux and Reed 1999).
Bcl-xL
Functionally active Bcl-xL expression was confirmed by comparing staurosporine-induced apoptotic
cell death following AAV-Bcl-xL or AAV-Luciferase transduction of rat E15 cortical cultures.
Bcl-xL has been previously shown to prevent staurosporine-induced apoptotic cell death (Kaspar et al.
2002).
Apoptotic generated nucleosomes were detected in all cultures, including the non-
staurosporine exposed wells, possibly due to the high cell density or the age of the primary cultures
with many cells observed to be undergoing nuclear fragmentation. However the staurosporineinduced apoptotic cell death in AAV-Bcl-xL transduced cultures was significantly lower than the
AAV-Luciferase transduced control cultures. A population of HA-positive AAV-Bcl-xL transduced
cells were observed to survive staurosporine induced apoptosis in contrast to the loss of most AAVLuciferase transduced cells. This enhanced survival of Bcl-xL expressing cells reflects the 19%
reduction in detected nucleosomes following AAV-Bcl-xL transduction.
Assuming that non-
staurosporine induced apoptosis occurred consistently in all cultures independent of treatment, the
68
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
actual reduction in staurosporine induced apoptosis following AAV-Bcl-xL transduction was ~35%.
As Bcl-xL is not a secreted protein, only cells transduced by the AAV-Bcl-xL vector will be exposed
to higher Bcl-xL levels and therefore have enhanced resistance against staurosporine-induced
apoptosis. Given that I only transduced a proportion of the cultured cells the significant reduction in
staurosporine induced apoptotic cell death of ~19% confirmed the expression of functionally active
HA-tagged Bcl-xL protein.
X-linked Inhibitor of Apoptosis Protein
The functional activity of XIAP was assessed by inducing apoptotic death in HT-1080 cells cultures
following AAV-XIAP and AAV-Luciferase transduction. Due to the highly permissive nature of the
HT-1080 cell line towards AAV-mediated transduction, this cell line provides a reliable basis from
which to assess functional expression from AAV vectors, and can be used as an alternative cell
source when primary cells are not available or intrinsically necessary for assessing transgene
function. The addition of staurosporine induced rapid cell loss and morphological changes in the HT1080 cultures as visualised by light microscopy and Hoechst 33258 nuclear staining. However a
population of AAV-XIAP transduced cells survived the staurosporine insult and the level of
nucleosomes detected was halved by AAV-XIAP transduction. Only a minimal level of apoptosis
was detectable within the non-staurosporine induced cultures.
Given that I only transduced a
restricted proportion of the cultured cells, the large reduction in staurosporine-induced apoptosis
provided by AAV-XIAP transduction verified that the transgenic XIAP expressed is functionally
active.
2.5.3
Summary
AAV vectors encoding each of my potential biotherapeutic molecules BDNF, GDNF, Bcl-xL or
XIAP were successfully constructed and shown to direct the expression of functionally active
proteins following cellular transduction. The use of efficient functional assays for known protein
function provided reassurance that the therapeutic molecules were correctly translated and processed
prior to proceeding with investigative in vivo gene transfer studies.
The functional assays I conducted to verify neurotrophic factor functionality offer an efficient
reproducible method for direct assessment of phenotypic changes within AAV vector transduced
cultures in which there is continuous expression and secretion of the neurotrophic factors. The use of
conditioned media from transduced cell lines which is commonly used to assess the biological
activity of secreted factors restricts functional assessment to the secreted proteins acting on unmodified cultures and results in a variable level of protein exposure as the neurotrophic factors are
69
Adeno-Associated Viral Vectors: Plasmid Cloning, Vector Packaging and In Vitro Functional Testing
used and degraded. In contrast, direct transduction assays assess the impact of continuous stable
production and secretion of the transgenic proteins over an extended period of time in a cellular
population containing both transduced and non-transduced cells. This ability to assess continuous
stable expression would be of increased importance for vectors constructed to direct low level protein
expression for long-term therapeutic application. While I could not exclude the possibility that
physical transduction with AAV-BDNF or AAV-GDNF induced some phenotypic changes in the
transduced cultures, I believe that it is the BDNF or GDNF secreted following AAV-mediated gene
delivery that enhanced the differentiation of calbindin- and TH- expressing neurons by acting through
cell surface receptors on both transduced and non-transduced cells.
Cell-survival assays in vitro using staurosporine to induce apoptosis confirm the expression of
functional anti-apoptotic factors. The use of different culture systems – primary embryonic culture
versus an engineered cell-line – for the anti-apoptotic factors demonstrated the potential for utilising
different cells when the protein under consideration is not cell-type specific. For testing expression
from AAV vectors the cells clearly need to be receptive to AAV transduction of which both neuronal
cultures and the HT-1080 cells are, however the HT-1080 cells appeared to offer several advantages
over primary cultures. Most noticeable were the homogeneity and stability of an immortalised cellline with no confounding culture artefacts as observed along with the considerable level of apoptotic
death occurring in the primary cultures possibly due to the high cell density or the length of time in
culture.
While in vivo studies are required to conclusively determine the physiological activity and therapeutic
potential of any expressed molecule, these initial in vitro assessments are important for verifying
expected functional activity.
70
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
Chapter 3
Rodent Model of Huntington’s Disease:
Quinolinic Acid Lesion
3.1 Introduction
To investigate preventative in vivo gene therapy for Huntington’s disease I utilised the QA lesion
model of striatal cell death.
QA, an endogenous glutamate analogue, induces excitotoxic
mechanisms following over-activation of the NMDA receptors expressed postsynaptically by the
GABAergic medium spiny projection neurons in the striatum. Directly injected into the striatum,
QA produces the most accurate neurotoxin-induced representation of HD striatal pathology in both
rodents and non-human primates (Beal et al. 1986; Beal et al. 1989). While QA does not replicate
the genetic mutation or the slow progressive characteristics of HD neurodegeneration, excitotoxic
mechanisms – and possibly endogenous QA – are proposed to be a significant contributor to HD
following a mutant huntingtin-mediated increase in the susceptibility of vulnerable neurons to
excitatory inputs (Cowan and Raymond 2006).
Despite the extensive use of QA as a model of Huntington’s disease there has been no consensus
within the relative literature regarding a delivery protocol for QA to the rodent striatum. It was
therefore important that I briefly optimise a QA delivery protocol to generate a selective striatal
lesion large enough to generate behavioural deficits without causing excessive mechanical damage or
causing a physical hole at the site of injection.
3.2 Optimisation and Characterisation Procedures
3.2.1
Animals and surgeries
Optimisation of the QA lesion model was undertaken in adult male Wistar rats (230 – 280g) with
direct stereotaxic infusion of QA into the striatum on one side of the rodent brain. Stereotaxic
injection of QA was performed as listed in Table 3-1 using surgical procedures outlined in Section
4.4. Based on my previous experience with QA administration I performed initial trials with 50 or
100nmol QA delivered in 500nL NaOH, pH 7.4. A second group of animals received either 30 or
71
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
50nmol QA dissolved in 400nL NaOH, pH 7.4. Behavioural deficits were analysed on a further
cohort of animals that received 30nmol QA in 400nL before I undertook a more detailed behavioural
and immunocytochemical analysis of the selected 50nmol QA in 400nL lesion. Later development
of an additional behaviour task necessitated the use of a final cohort of rats to assess the level of
sensorimotor neglect.
QA
Coordinates from Bregma
A-P M-L D-V
No.
rats
Trial 1
100nmol, 500nL
50nmol, 500nL
+0.5
+2.8
-6.0
2
2
Trial 2
50nmol, 400nL
30nmol, 400nL
+0.5
+2.7
-5.0
3
3
Trial 3: Behaviour Testing Setup
30nmol, 400nL
+0.6
+2.6
-5.0
4
Final Characterisation
50nmol, 400nL
+0.5
±2.7
-5.0
10
Additional Behaviour
50nmol, 400nL
+0.5
+2.7
-5.0
4
Table 3-1
QA lesion optimisation trials
Table detailing the intrastriatal injection of QA to produce unilateral lesioning of the striatum in the
series of trials undertaken to optimise and characterise the neuropathological and behavioural
changes. The anterior-posterior (A-P) and medial-lateral (M-L) coordinates were measured from
Bregma and the dorsal-ventral (D-V) distance from the top of the dura with nose-tooth bar set at
zero.
3.2.2
Behavioural assessment
It was necessary that the unilateral QA lesion generated enough of a performance imbalance between
the two hemispheres of the basal ganglia that resultant functional motor deficits could be reliably
detected by an imbalance in the rats left / right side behavioural activity. I setup an array of
behavioural tests to assess QA induced deficits covering: non-induced motor control (spontaneous
exploratory forelimb use); sensorimotor neglect (“corridor” task); and drug induced activity
(apomorphine and amphetamine induced rotations).
Detailed procedures for each behavioural
assessment are provided in Section 4.5.
3.2.3
Neuropathological analysis
Rats were euthanised between seven and 20 days post-QA lesioning, fixed and processed for
immunocytochemical assessment as described in Section 4.7.1.
To analyse the extent of QA
lesioning within the striatum, I used immunocytochemical techniques (Section 4.7.2) to visualise the
72
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
expression of the general neuronal marker NeuN (1:1000, Chemicon), and more specifically for
GABAergic striatal neurons containing calbindin (1:5000, Swant) or DARPP-32 (1:750, Chemicon).
Further characterisation of the final 50nmol QA lesion within the striatum was undertaken by
immunocytochemistry against the interneuron marker proteins: calretinin (1:5000, Swant),
parvalbumin (1:5000, Swant), choline acetyl-transferase (ChAT; 1:500, Chemicon) and NOS
(1:10000, Piers Emson).
3.3 QA Lesion Optimisation Analysis
3.3.1
Initial QA trial
As a starting point to optimise the QA lesion for the neuroprotective studies, I investigated 100 and
50nmol QA dissolved in 500nL 0.4M and 0.2M NaOH respectively, pH 7.4. These quantities of QA
were selected based on both published literature (Qin et al. 1992; Arenas et al. 1993; Perez-Navarro
et al. 1994; Perez-Navarro et al. 1996) and my own prior experience with QA ((Kells et al. 2004);
unpublished data) in which I used these quantities but in significantly greater delivery volumes.
With larger injection volumes it is common to observe physical damage to the striatum that can
result in a hole at the site of injection.
Analysis of NeuN immunopositive cells seven days after QA injection showed both 100 and 50nmol
QA injections generated large extensive lesions within the striatum and in some cases extending out
into the adjacent cortical regions (Figure 3-1). The 100nmol QA injection resulted in extensive
tissue loss in the striatum along the needle tract in both rats which was not observed with the 50nmol
injection. Additionally, there appeared to be greater numbers of NeuN-immunopositive cells still
present within the “transition zone” surrounding the core of the 50nmol QA lesion indicating the
differential selectivity / vulnerability of different populations of striatal neurons to this protocol of
QA delivery. Deciding to investigate a slightly smaller lesion with a lower delivery volume and
quantity of QA, I did not further assess the specific populations of striatal neurons.
73
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
A
B
100nmol QA
D
C
50nmol QA
Figure 3-1
Initial 100 and 50 nmol QA lesion assessment
Representative images showing NeuN-positive neurons in the striatum following a unilateral
injection of (A,B) 100nmol or (C,D) 50nmol QA (500nL) into the striatum. NeuN immunostaining
displays extensive neuron loss within the injected striatum with physical damage surrounding the
needle tract in the 100nmol QA injected striatum and loss of some adjacent cortical neurons.
Surviving neurons were seen in the peripheral reaches of the lesion indicating a “transition zone” in
which small populations of striatal neurons display resistance to the QA-induced excitotoxicity.
Dotted lines show rough outline of the extent of QA lesioning in the striatum. Scale bar = 2mm for
whole sections (A,C) and 500µm for higher magnification images (B,D)
3.3.2
Trial 2: Lower QA quantity
While the 50nmol QA lesion in my initial trial generated an acceptable lesion representative of late
stage HD striatal pathology, I wanted to investigate a more restricted lesion that would potentially be
more representative of earlier stage HD and possibly more applicable to the neuroprotective gene
therapy research.
For this trial I reduced the delivery volume by 20% to 400nL to limit the
mechanical infusion, investigating injections of 50 and 30nmol QA.
Ten days post-QA the lower volume lesions appeared more contained than the 50nmol QA lesions in
the initial trial, with both the 30 and 50nmol QA affecting ~50% of the striatum. The 30nmol QA
looked to produce a slightly less severe lesion, with greater sparing of NeuN-positive striatal neurons
74
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
throughout the lesion, compared with a small “transition zone” following the 50nmol QA injection
(Figure 3-2A, C). Only a small population of calbindin-positive neurons were seen within the
lesioned area of the striatum for either concentration of QA (Figure 3-2B, D), suggesting that the
spared NeuN-positive cells are probably populations of interneurons and not the projection neurons
which generally express calbindin (DiFiglia et al. 1989). Therefore I felt the lesion produced by the
30nmol QA injection was potentially more representative of the selective degeneration of HD,
providing a less intensive model of excitotoxic cell death more suited to assessing protective effects
following delivery of neuroprotective biotherapeutic molecules.
NeuN
Calbindin
B
C
D
30nmol QA
50nmol QA
A
Figure 3-2
QA lesion testing: 50 and 30 nmol intrastriatal QA injections
Representative images showing surviving NeuN- and calbindin- immunopositive neurons following
injection of (A,B) 50nmol or (C,D) 30nmol QA (400nL) into the striatum. Survival of striatal
neurons within the lesioned striatum appeared greater in the lower concentration of QA (C), with
some calbindin-positive neurons also seen to be maintained post-QA (D). Dotted lines show rough
outline of the extent of QA lesioning in the striatum. Scale bar = 500µm
75
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
3.3.3
Trial 3: Behaviour testing – 30nmol QA
In order to later investigate functional protection against the development of motor impairments, I
needed to ensure that the QA lesion was sufficient to generate behavioural deficits that could be
readily observed and quantified by behaviour tests designed to assess imbalances in basal ganglia
function following unilateral lesioning. Therefore to further assess the suitability of the less severe
400nL, 30nmol QA injection from the second QA lesion trial, I took another small cohort of rats
(n = 4) and assessed their performance in behaviour tests seven days post-QA lesioning.
Following QA lesioning of the right striatum, all of the rats displayed preferential use of their right
(ipsilateral) forelimb for spontaneous exploration of the cylinder, with overall asymmetry scores
recording 54 – 71% ipsilateral forelimb use.
However the administration of apomorphine or
amphetamine only stimulated strong rotational behaviour in two of the four rats. The rats that did
respond displayed contrasting rotational effects arising from the two drugs. Apomorphine induced
the rats to rotate towards the lesioned striatum (94% ipsilateral), while amphetamine stimulated
rotations away from the lesioned striatum (96% contralateral).
While these results were not
expected, previous assessment of striatal lesioning has shown similar results when the anterior
portion of the striatum alone is lesioned (Norman et al. 1992; Fricker et al. 1996).
Overall these rats showed that the 30nmol QA lesion is severe enough to cause measurable
behavioural deficits, however the lack of significant drug-induced rotational behaviour in half of the
rats, and the differentially induced direction of rotation suggest that the ability to generate a lesion
that gives consistent behavioural impairments over a large cohort of rats may be difficult with this
quantity of QA. Larger lesions generally will provide greater consistency in overall behavioural
performance between subjects, therefore I elected to not proceed with this 30nmol QA lesion but to
use the higher concentration of 400nL, 50nmol QA for the neuroprotective investigations.
3.3.4
QA lesion model characterisation – 50nmol QA
After assessment of all the QA lesion trials I decided to proceed with 50nmol QA in 400nL NaOH,
as this protocol generated a large striatal lesion without obvious mechanical damage, while sparing a
population of non-calbindin containing neurons within the lesioned area suggestive of interneuron
sparing.
To more comprehensively characterise the neuropathological and behavioural changes
occurring following the 50nmol QA injection I assessed the development of quantifiable functional
behaviour deficits and performed immunocytochemical staining to positively identify sub-
76
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
populations of striatal neurons to determine more specifically which neurons are maintained in this
particular QA lesion model.
3.3.4.1
Functional Behaviour Assessment of Unilateral QA Lesioned Rats
To ensure reliable assessment of the QA lesion and associated functional impairments I took a larger
group of rats (n = 10) for investigation. Baseline measurements of exploratory forelimb use and
amphetamine- / apomorphine-induced rotations were undertaken one week prior to stereotaxic QA
injection. The rats were left for one week post QA injection to allow the acute lesion development to
occur before proceeding with behavioural assessment. I analysed spontaneous exploratory forelimb
use seven days post-QA lesioning followed directly by amphetamine-induced rotational assessment.
Apomorphine-induced rotational behaviour was assessed ten days post-lesion before the rats were
euthanised and processed for neuropathological analysis.
Functional impairments were measurable by behaviour tests one week following QA lesion. The
unilateral QA lesion rats developed a significant 63% ± 3 ipsilateral forelimb bias for exploratory
behaviour compared with the 53 ± 3% baseline assessment (paired t-test P < 0.05; Figure 3-3C).
Post-QA drug-induced rotational behaviour was preferentially towards the lesioned hemisphere with
apomorphine-inducing 91% ± 5 of rotations to be ipsilateral and amphetamine 82 ± 9% ipsilateral,
showing a significant shift from the proportion of baseline ipsilateral rotations of only 48% ± 9 and
34% ± 9 respectively (paired t-tests P < 0.05; Figure 3-3A, B). The extent of drug-induced rotational
behaviour following the QA lesion with apomorphine administration significantly increasing total
rotational behaviour from 2.2 ± 0.6 rotations per minute to 4.7 ± 0.7 (paired t-test P < 0.01), however
amphetamine only induced a rotation rate of 1.6 ± 0.3 rotations per minute that was non-significantly
increased to 2.7 ± 0.6 following the QA lesion (paired t-test P = 0.08). The amphetamine induction
of ipsilateral rotations was in contrast to that induced following the smaller 30nmol lesion which
caused the rats to rotate contralaterally, suggesting the extent of striatal lesioning determines the
direction of rotation (Norman et al. 1992).
77
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
A
Apomorphine
B
Amphetamine
C
Forelimb Use
D
Sensorimotor Neglect
Figure 3-3
QA lesioning induced behavioural deficits
Plots showing the development of measurable functional deficits following 50nmol QA lesion
assessed by behavioural tests before and after 50nmol QA lesioning. Paired t-test: * P < 0.05, ** P <
0.01
3.3.4.1.1
Additional sensorimotor behavioural testing
The inclusion of the recently developed “corridor” task (Section 4.5.2; (Dowd et al. 2005)) to assess
sensorimotor neglect in the neuroprotective investigations required a small group of rats (n = 4) to
facilitate the setting up of the corridor apparatus, determination of an assessment protocol, and to
ensure that the 50nmol QA lesion induced a measurable sensorimotor deficit.
Behavioural
performance was observed on days one and two prior to QA lesion and on days 12 and 13 after
injection.
Two of the rats displayed right side bias for sugar pellet retrieval in the baseline testing prior to the
QA lesion indicating a dominant left hemisphere. Unfortunately the QA was administered to the
right striatum of each rat, rather than their dominant side, resulting in an ipsilateral group bias prior
to QA. Following QA, three of the four rats showed an increased preference for ipsilateral (right
side) retrievals with an overall group shift from 59 ± 7% to 76 ± 7% ipsilateral retrievals (Figure
3-3D). This did not reach statistical significance (Wilcoxon signed rank test: P = 0.25), however this
78
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
was possibly due to the small group size and lesioning of the non-dominant hemisphere in half the
subjects. Reanalysis of the data using the duplicate trail results for each rat in an unpaired t-test did
indicate the significant development of sensorimotor neglect after QA lesion (P < 0.05).
3.3.4.2
Neuropathological Assessment of QA Lesion
Immunocytochemistry was performed on coronal sections through the striatum from each rat brain to
assess the extent of the QA-induced striatal lesioning by NeuN-, calbindin- and DARPP-32immunopositive staining.
More specifically the surviving striatal interneurons were visually
identified with antibodies directed against calretinin, parvalbumin, NOS and ChAT (Section 3.2.3).
Using the general neuronal marker NeuN, the loss of neurons following the 50nmol QA intrastriatal
injections was generally confined to the striatal region causing extensive neuronal loss without
obvious structural damage ten-days post injection (Figure 3-4A). In some cases where the lesion was
situated in the dorsal or lateral portion of the striatum, a loss of neurons was also observed in the
deep layers of the cortex overlying the lesioned striatum. A number of striatal neurons within the
lesioned area were however resistant to QA excitotoxicity (Figure 3-4C) as also observed in the
earlier testing (Figure 3-2). While a scattering of DARPP-32-positive neurons (Figure 3-4F) and
calbindin-positive neurons (not shown) were still observed within the QA lesioned area, the majority
of the QA resistant neurons were assumed to be striatal interneurons which normally make up ~5%
of the striatal neuron population. Partial sparing of striatal neurons was particularly enhanced in the
dorsolateral portion of the striatum with the medial extent of the lesion usually showing a distinct
border between the lesioned and non-lesioned striatum (Figure 3-4D, F). Immunocytochemistry for
markers of subpopulations of the striatal interneurons showed that only the small aspiny calretininpositive neurons (Figure 3-5C, D) and the large aspiny cholinergic ChAT-positive neurons (Figure
3-5G, H) were largely spared. The GABAergic parvalbumin (Figure 3-5A, B) and NOS (Figure
3-5E, F) immunopositive neurons were vulnerable to QA induced cell death.
I also observed that parvalbumin expressing neurons of the globus pallidus were affected by the QA
lesion (Figure 3-4G, H) suggesting a potential process of secondary cell death in the striatal output
nuclei which may have occured following the loss of afferent projections from the striatum. No
assessment was performed of the neurons in the substantia nigra following degeneration of the
striatonigral projections.
79
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
A
B
NeuN
Intact
DARPP-32
Lesioned
D
E
F
G
H
Parvalbumin
DARPP-32
NeuN
C
Figure 3-4
Pathological characterisation of the 50nmol QA lesion
Immunocytochemical staining for (A,C,D) NeuN or (B,E,F) DARPP-32 positive neurons show the
extent of the QA induced neuronal cell loss within the injected striatum compared to the intact
contralateral hemisphere. (G,H) Loss of parvalbumin positive cells in the globus pallidus indicates
possible QA induced cell death outside of the striatum. Dotted lines show a rough outline of the
extent of QA lesioning in the striatum (D,F) and outline of the globus pallidus (G,H). Scale bar =
3.5mm for whole sections (A,B), 500µm for (C-F) and 900µ m for (G,H).
80
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
Intact
Lesioned
B
C
D
E
F
G
H
ChAT
NOS
Calretinin
Parvalbumin
A
Figure 3-5
Striatal interneurons following QA lesioning
Representative images of the striatal interneurons within intact and QA lesioned striatum.
GABAergic interneurons expressing (A,B) parvalbumin, (C,D) calretinin or (E,F) NOS are present in
the striatum. The small population of calretinin neurons appeared to be fully maintained throughout
the lesioned striatum, with the large ChAT-positive cholinergic interneurons also appearing to be
relatively spared by QA. A few parvalbumin (B) and NOS (F) positive neurons were still present in
the “transition zone” more distal from the QA injection site (right side of images). Scale bar =
200µ m
81
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
3.4 Discussion
Optimisation and brief characterisation of the QA lesion model of HD was undertaken to ensure the
model generated the major pathological neurodegeneration of striatal projection neurons
representative of HD and produced quantifiable functional deficits in the rats’ behaviour. While the
QA model cannot be claimed to replicate the slow progressive neurodegenerative mechanisms
occurring in the HD brain, the selective vulnerability of striatal neurons is suggestive of excitotoxic
involvement. By restricting the quantity of QA and volume injected into the striatum I was able to
generate a partially selective lesion of the striatal neurons without inflicting gross structural changes
of the brain tissue. While the lower quantity of 30nmol QA resulted in a slightly less intensive lesion
and would have debatably provided a more realistic representation of excitotoxic insult for my
preventative gene delivery studies, concern over the reliable level of measurable behavioural deficits
meant that the 50nmol QA lesion protocol was ultimately selected.
3.4.1
QA-induced neuropathology
Previous investigations involving the intrastriatal injection of QA to model HD pathology in adult
rats have been conducted with a diverse range of quantities and delivery volumes including:
300nmol, 1µL QA (Popoli et al. 1994; Scattoni et al. 2004); 225nmol, 1µL (Emerich et al. 1996;
Borlongan et al. 2004; Emerich 2004b); 180nmol, 1µL (de Almeida et al. 2001; Escartin et al. 2004);
120nmol, 1µL (Dobrossy and Dunnett 2003); 120nmol, 0.5µL (Beal et al. 1986); 100nmol, 2µL
(Alexi et al. 1999); 85nmol, 42.5nL (Brickell et al. 1999); 60nmol, 0.5µL (Bordelon et al. 1999);
50nmol, 2µL (Kells et al. 2004); 50nmol, 1µL (Figueredo-Cardenas et al. 1998); 15-60nmol, 1µL
(Ryu et al. 2003). In my personal experience the larger quantities of QA have generally resulted in
physical damage to striatum, often causing a physical loss of striatal tissue at the site of injection as
observed in the initial 100nmol QA trial (Figure 3-1). Although neuroprotection has been achieved
against some of the larger doses of QA, the protracted but inevitable neurodegeneration induced by
the poly-Q tract expansion in huntingtin would indicate a more subtle contribution of excitotoxicity
to striatal neuronal death, better replicated by lower quantities of QA. It is possible that spreading
the QA across multiple injection sites in the striatum as performed by Dobrossy et al. (2003) may
further reduce the intensity of excitotoxicity directly surrounding the injection sites, and thereby
avoid inducing such severe damage.
However the lower quantities of QA are still capable of
inducing neuronal cell death over a considerable portion of the striatum following a single
intrastriatal delivery site, indicating that QA can readily diffuse through the striatal parenchyma.
Multiple injection sites would enable a greater proportion of the striatum to be lesioned and reduce
82
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
the extent of QA concentration gradients presumably responsible for the development of a “transition
zone” of partial neuron survival surrounding a core of total neuron loss (Brickell et al. 1999). A
region of complete neuronal death proximal to the site of injection was often not clearly
distinguishable following the selected 50nmol QA lesion although there was still a gradient of
increasing neuron survival away from the injection site.
The selective sparing of small calretinin-positive interneurons and the large cholinergic neurons from
QA-induced cell death is representative of their maintenance in the HD brain (Ferrante et al. 1987;
Cicchetti and Parent 1996a; Cicchetti et al. 1996b) and in agreement with earlier QA lesion
assessment (Figueredo-Cardenas et al. 1994).
However the apparent loss of medium aspiny
NADPHd / NOS or parvalbumin containing striatal interneurons contrasts with their relative
invulnerability to HD neurodegeneration (Ellison et al. 1987; Harrington and Kowall 1991), but has
previously been reported following QA lesioning (Davies and Roberts 1987; Waldvogel et al. 1991;
Figueredo-Cardenas et al. 1994); although others have detected sparing of these NADPHd /
somatostatin / neuropeptide Y interneurons (Beal 1992a; Beal 1992b) possibly due to differences in
QA injection protocols. The observed selectivity of striatal neuronal sparing of the 50nmol, 400nL
QA injection concurs with the quantitative analysis of striatal interneurons I previously conducted
following a larger volume 50nmol, 2µL QA lesion (Kells et al. 2004).
3.4.2
QA-induced behavioural impairments
A number of behavioural tests have been developed to assess functional deficits in rodent behaviour
exhibited following excitotoxic lesioning of the striatum. While disturbances in cognitive function
generally require bilateral lesioning, simple deficits in motor performance are readily induced by
unilateral lesioning and can be detected by observing imbalances in lateralised behaviour (Nakao and
Itakura 2000). Although it is difficult to correlate behavioural deficits in rodent models with HD
symptoms, it is possible that some of the motor impairments are resultant from the same neuronal
dysfunction responsible for the choreiform movements of HD patients. With symptomatic benefits
being the most critical measure of any treatment strategy, the use of behavioural testing in animalbased investigations is a vital measure of therapeutic efficacy.
Therefore to characterise the
acquirement of motor deficits following the selected QA lesion I set-up four behaviour tests: druginduced rotational behaviour, apomorphine and amphetamine; spontaneous forelimb use; and
sensorimotor neglect “corridor” task.
Unilateral loss of striatal projection neurons creates a hemispherical imbalance in the populations of
dopaminoceptive neurons. Administration of either a dopamine agonist (apomorphine) or dopamine83
Rodent Model of Huntington’s Disease: Quinolinic Acid Lesion
releasing drug (amphetamine) following QA injection induced the majority of rats to rotate towards
the lesion side (ipsilateral) as previously reported for excitotoxic striatal lesions with the extent of
lesioning determining the degree of rotational asymmetry (Schwarcz et al. 1979; Dunnett et al. 1988;
Nakao et al. 1996; Nakao and Brundin 1997). The loss of neurons expressing dopamine receptors
would conceivably be expected to result in similar motor behaviour following drug induced
dopamine release or dopamine agonist administration through greater dopamine receptor stimulation
in the intact striatum. However, the brief assessment of a smaller 30nmol QA lesion suggested
contrasting effects with amphetamine-inducing rotations away from the lesion side suggesting that
smaller lesions may result in other more subtle changes to dopamine signalling, or may have been
related to the positioning of the lesion with anterior lesions having been shown to induce
contralateral rotational behaviour (Norman et al. 1992; Fricker et al. 1996). More traditionally used
for assessing the integrity of the dopaminergic nigrostriatal connections (Choi-Lundberg et al. 1998),
drug-induced rotational assessment can also provide some indication of striatal projection neuron
maintenance; although inconsistencies in the direction of induced rotation, especially when dealing
with small lesions, complicates assessment of deficit in relation to the degree of striatal lesioning.
A general assessment of lateralised brain injury causing motor function impairment, the spontaneous
forelimb use analysis following the QA lesion showed enhanced overall use of the ipsilateral
forelimb. Greater use of the forelimb on the same side as the lesion is induced due to impaired CNS
control of the contralateral forelimb, which is proportional to the severity of lateralised damage
(Schallert et al. 1997; Schallert et al. 2000). Recent development by Dowd et al. (2005) of the
“corridor” task, a simple test of lateralised response selection, to assess the development of
sensorimotor neglect following unilateral 6-hydroxydopamine lesioning of dopaminergic neurons
also showed contralateral side neglect following the unilateral QA striatal lesion. Although still an
assessment of spontaneous motor control, the lateralised selection of food retrieval following
balanced left and right side external sensory cues possibly provides a more sensitive assessment of
basal ganglia control of sensorimotor coordination than the non-motivated exploratory forelimb use
analysis.
Overall, the non-drug induced assessments of sensorimotor function displayed significant
behavioural deficits following the 50nmol, 400nL QA injection without inducing purely unilateral
responses, which was often observed following drug-induced rotational behaviour. Sub-maximal
responses are more likely to allow for the detection of subtle changes potentially provided by
therapeutic agents against the neuropathological changes induced by QA lesioning.
84
Neuroprotective Study Methods
Chapter 4
Neuroprotective Study Methods
4.1 Overview
To investigate AAV-mediated delivery of biotherapeutics as a preventative treatment strategy against
striatal neurodegeneration and the onset of functional motor control impairments, I surgically
injected AAV vectors unilaterally into the rats’ striatum prior to an excitotoxic insult with QA
(Figure 4-1). To monitor the development of functional impairments I put each rat through a series
of behavioural tests both before and after AAV vector delivery to determine baseline behaviour and
then repeatedly for 6-7 weeks following QA lesion. On completion of behavioural testing the rats
were euthanised, paraformaldehyde fixed and the brains processed for immunocytochemical
analysis. To determine expression levels of the biotherapeutics within the striatum at the time of QA
lesion, I injected additional cohorts of Wistar rats with the same AAV vectors, euthanised after three
weeks and isolated the striatum for quantitative ELISA analysis.
QA injection
AAV delivery
-5
-4
Baseline
behaviour
-3
-2
Euthanised
-1
0
1
2
Post AAV
behaviour
3
4
5
6
…
…
Functional behaviour
assessment
Figure 4-1
Neuroprotective study timeline
Timeline of the in vivo investigative studies to assess the neuroprotective effects of AAV-mediated
gene transfer and prevention of functional behavioural deficits associated with a striatal lesion.
Numbers represent weeks prior and post QA injection with rats euthanised at various end-points
post-QA.
85
Neuroprotective Study Methods
4.2 Neuroprotective Investigations
4.2.1
In vivo expression testing
To test in vivo transduction and transgene expression for each of the AAV treatment vectors, prior to
commencing the neuroprotective investigation, I injected 4.0 µL of each AAV vector unilaterally
into the striatum at one or two stereotaxic sites (Table 4-1). The rats were housed for three weeks
following AAV injection to let transgene expression stabilise in the transduced cells before
euthanizing and processing for HA-immunostaining to visualise the spread and extent of transgenic
protein expression.
Coordinates from Bregma
A-P M-L D-V
AAV vector delivery
First Investigation – Single site
+0.6
2.6
-5.0
Second Investigation – Two-sites
+1.3
2.4
-5.0
-0.2
3.4
-5.0
Table 4-1
Stereotaxic injection coordinates for AAV vector delivery
Injection coordinates were determined from a rat brain atlas (Paxinos and Watson 1986), and in vivo
testing with AAV-Luciferase (Section 4.4.2).
4.2.2
Initial investigations: AAV-BDNF (high-titre), AAV-GDNF,
AAV-Bcl-xL
The first in vivo study I undertook investigated the protective effects of AAV-BDNF, AAV-GDNF
and AAV-Bcl-xL administration. Wistar rats were randomly assigned into five groups to receive
unilateral intrastriatal AAV vector or sham PBS injection (Table 4-4). Functional motor behaviour
was assessed in the spontaneous forelimb use test and by drug-induced rotations (Section 4.5).
Baseline behaviour was assessed to determine each rat’s naturally dominant hemisphere. Infusing
directly into the dominant hemisphere using stereotaxic surgical procedures (Table 4-1; Section
4.4.1), each rat received 4.0 µL AAV-BDNF, AAV-GDNF, AAV-Bcl-xL, AAV-Luciferase or PBS,
mixed with 1.0 µL 20% mannitol to increase the efficiency of transduction (Mastakov et al. 2001;
Mastakov et al. 2002). Three weeks later all rats received an intrastriatal injection of QA at the same
stereotaxic coordinates (Chapter 3). Functional motor behaviour was assessed weekly with the
AAV-BDNF treated rats euthanised five weeks post-QA and the remaining groups seven weeks after
QA (Table 4-2).
86
-4
!
Spontaneous Forelimb Use
!
Apomorphine Rotations
!
Amphetamine Rotations
-3
-2
-1
!
!
!
0
1
2
3
4
5
6
!
!
!
!
!
!
Table 4-2
First neuroprotective investigation timeline
4.2.3
Follow-up
!
!
!
!
investigations:
!
AAV-BDNF
!
7
Perfused
-5
AAV Delivery
Week
QA Injection
Neuroprotective Study Methods
(diluted),
AAV-Bcl-xL, AAV-XIAP
My second in vivo investigation followed-up on the initial results of the previous study to further
investigate AAV-BDNF and AAV-Bcl-xL administration, in addition to assessing the newly
constructed AAV-XIAP vector. Rats were randomly assigned to receive AAV-BDNF, AAV-Bcl-xL,
AAV-XIAP, AAV-Luciferase or PBS (Table 4-4). The dominant brain hemisphere was determined
for each rat following baseline behaviour testing in the “corridor” task, spontaneous forelimb use and
apomorphine-induced rotations (Section 4.5). Following baseline behaviour assessment, I injected
the AAV vectors or PBS into the dominant striatum. In contrast to the first study (Section 4.2.2) I
decided to split the vectors over two-injection sites within the striatum (Table 4-1), with each site
receiving 4.0 µL vector or PBS plus 1.0 µL 20% mannitol, except the AAV-BDNF rats which only
received 2.0 µL vector plus 1.0 µL 20% mannitol per site. The AAV-BDNF and AAV-XIAP vectors
were each diluted 1:10 with sterile PBS prior to injection. QA was administered three weeks after
vector delivery to all rats except five randomly chosen AAV-BDNF animals which provided nonlesioned AAV-BDNF treated controls. Rats were all euthanised eight weeks after QA lesion with
“Corridor” Task
Table 4-3
!
!
!
-3
-2
-1
!
!
!
0
1
2
3
4
5
6
7
!
!
!
!
!
!
!
!
!
Second neuroprotective investigation timeline
87
!
!
!
!
!
8
Perfused
Apomorphine Rotations
-4
QA Injection
Spontaneous Forelimb Use
-5
AAV Delivery
Week
Commenced
Dietary Restriction
behaviour assessed weekly or biweekly throughout (Table 4-3).
Neuroprotective Study Methods
4.3 Animals
Number of Rats
29 (Section 3.2.1: Table 3-1)
QA Lesion Development
AAV vector and Coordinate Testing
AAV-BDNF
10
AAV-GDNF
6
AAV-Bcl-xL
6
AAV-XIAP
6
AAV-Luciferase
12
Functional Protection
Transgene Expression
AAV-BDNF
7
5
AAV-GDNF
10
5
AAV-Bcl-xL
10
5
AAV-Luciferase
8
5
PBS
10
-
AAV-BDNF
- no QA
9
5
5
-
AAV-Bcl-xL
11
5
AAV-XIAP
9
5
AAV-Luciferase
5
-
PBS
5
-
First Investigation
Second Investigation
Table 4-4
Allocation of animals
Cohorts of male Wistar rats analysed for QA lesion development, AAV vector testing and
neuroprotective gene transfer studies.
All of the in vivo studies were conducted in adult male Wistar rats (200 – 300g) supplied by the
University of Auckland Animal Resources Unit with strict adherence to approvals granted by the
University of Auckland Animal Ethics Committee in accordance with the NZ Animal Welfare Act
(1999). Rats were housed in a temperature and humidity controlled environment on a 12hr light /
12hr dark regime. Depending on experimental design, housing was either in groups of 4-5 with food
and water available ab libitum, or individually when dietary restriction was required to maintain the
rats at 85% of their expected free feeding weight for incentive based behaviour testing – water was
available ab libitum.
88
Neuroprotective Study Methods
Following immunocytochemical analysis of the transgene expression and visualisation of the QA
lesion in the main neuroprotective investigations I removed from the analysis any rats that lacked
transgenic protein expression in the striatum, had no evidence of QA lesioning, or showed
misplacement of either AAV vector or QA injection.
4.4 Stereotaxic Surgeries: AAV Vector Delivery and QA Injection
4.4.1
Operating procedure
Direct intrastriatal injection of the AAV vectors and QA was performed by stereotaxic surgery
techniques using Kopf® small animal stereotaxic frames paired with a MicroSyringe Pump
Controller (Micro 4; World Precision Instruments) to control the injections via Hamilton® syringes.
Rats were systemically anaesthetised with an initial intraperitoneal (i.p.) injection of 60 mg/kg
sodium pentobarbital (National Veterinary Supplies Ltd, NZ) plus additional dosing as required to
maintain anaesthesia throughout the surgery. Marcain (AstraZeneca) was administered (0.5 mg/kg)
by subcutaneous (s.c.) injection, directly above the rat’s skull, prior to beginning surgery to provide
local analgesic at the site of incision. The rats were firmly secured into a Kopf® stereotaxic frame by
nose/tooth bar and ear bars with the nose/tooth bar zeroed to hold the skull level. The skin above the
skull was opened with a single longitudinal incision to expose the skull and positively identify
Bregma from which the A-P and M-L stereotaxic injection site coordinates were measured. A burr
hole was drilled with a 0.5mm tungsten carbide bit (Sunshine®-Dental) in the skull at the A-P, M-L
injection coordinates through which a 5 or 10µL Hamilton® syringe (32G needle) was carefully
lowered 1mm/min to the desired depth below the dura. Once the syringe was correctly positioned
the MicroSyringe Pump Controller was programmed to slowly infuse either an AAV vector / PBS
vehicle control at 150 nL/min or QA at 100 nL/min. After injection the syringe was left in place for
an additional 5mins before withdrawing to minimise backflow up the needle tract while the syringe
was slowly withdrawn. On completion of the stereotaxic injections the skin incision was sutured
closed (Silk 4/0, Resorba) and Xylocaine® 2% Jelly (AstraZeneca) was topically applied to the
wound. The rats were placed under a heat-lamp and monitored post-operatively until they recovered
from the systemic anaesthesia before returning to their home cages.
89
Neuroprotective Study Methods
4.4.2
Determination
of
initial
AAV
vector
injections
parameters
To test the striatal coordinates and the required volume for AAV vector delivery I performed a small
test using the AAV-Luciferase vector injecting either: 3.0 µL (n = 3) or 4.5 µL (n = 3) at a single site
(A-P +0.5, M-L 2.7, D-V -5.0 mm); or 5.0 µL evenly split between two injection sites (n = 3; Site 1:
A-P +1.0, M-L 2.7, D-V -5.0; Site 2: A-P -0.2, M-L 3.0, D-V -5.0). All vectors were injected along
with 1.0 µL 20% mannitol to increase the efficiency of transduction (Mastakov et al. 2001;
Mastakov et al. 2002). The Rat Brain in Stereotaxic Coordinates (Paxinos and Watson 1986) was
used as a guide to determine initial stereotaxic coordinates for all injection sites.
Intrastriatal injection of AAV-Luciferase led to transduction of the targeted striatal cells plus
pyramidal cortical neurons surrounding the needle tract, and pallidal neurons (Figure 4-2). The
lower volume injection tended to result in transduction of striatal neurons in a broad band
surrounding the needle tract in contrast to the more extensive spread of transduction throughout the
striatum following the single 4.5 µL or two-site 5.0 µL injection protocols.
Cortical neurons
surrounding the needle tract were extensively transduced indicating some backflow of the vectors up
the needle tract and also along the top of the corpus callosum. It is also possible that some of the
cortical transduction was facilitated by retrograde transport of the AAV vectors as previously
observed (Kaspar et al. 2002; Burger et al. 2004). Transduction of pallidal neurons within the
globus pallidus, a target nucleus of the striatal projection neurons, is indicative of anterograde vector
transport and was observed following all injection protocols. Transduction of the nigral neurons seen
in the main investigation was not assessed in these initial AAV-Luciferase transduced animals. The
anterograde transport and transduction of target nuclei may well be of therapeutic benefit for
delivering biotherapeutics to the terminal axonal projection fields of the medium spiny neurons and
supply target derived support of the neuronal projections against cellular insult.
Given the extensive spread of striatal transduction achieved following a single injection I decided to
proceed initially with a single site 4.0 µL delivery protocol for my neuroprotective studies to
minimise any surgical-related trauma associated with the vector delivery and generally restrict
transduction to the striatum. The 4.0µL vector plus 1.0µL mannitol injection allowed the use of
5.0µL Hamilton syringes. In later investigations I elected to use a two-site injection to enhance the
distribution of transduced neurons away from the direct site of QA injection.
90
Neuroprotective Study Methods
A
B
C
D
Figure 4-2
Intrastriatal AAV vector delivery
(A) Visualisation of in vivo Luciferase expression following trials of various intrastriatal AAVLuciferase injection protocols. Intrastriatal injection of AAV-Luciferase resulted in transduction of
(B) cortical neurons, (C) striatal neurons, and (D) neurons within the globus pallidus. Scale bar =
2mm for whole sections (A), 100µm for (B) and 50µ m for (C,D).
91
Neuroprotective Study Methods
4.5 Functional Behavioural Analysis
To assess the physical impact of AAV-mediated treatment on the rat’s behaviour I observed their
motor performance in a range of behavioural tests designed to show preferential biasness between
the left and right side of the rats following a unilateral lesion in the basal ganglia. All assessment of
behavioural testing was performed blinded to the specific AAV vector / PBS delivery and the treated
hemisphere.
4.5.1
Spontaneous exploratory forelimb use
Spontaneous exploratory forelimb use assessed the development of a preference for the QA lesioned
rat to use its forepaw ipsilateral to the lesioned hemisphere when exploring a novel environment
(Schallert et al. 2000). Rats were transferred from their home cage to a clear acrylic cylinder
(200mm internal diameter; 400mm high) where they were free to explore by rearing up on their
hindpaws and using their forepaws to support themselves against the cylinder walls.
Video
recording of 5mins exploration was analysed to quantify left and right forepaw usage while rearing
off the floor, initial placement on the cylinder wall and for landing back on the floor. A single
asymmetry score was calculated by averaging the percentage of time each rat used its ipsilateral
forepaw for rearing, initial cylinder wall placement and landing.
A
B
Figure 4-3
Spontaneous exploratory forelimb use
Each rat was placed into clear cylinder and video recorded for 5 mins for later analyse of left and
right forelimb usage while exploring the cylinder. The placement of two-mirrors behind the cylinder
allowed a full 360° view of the rats. Rat in (A) is shown initiating an exploratory rear off its right
forelimb, and in (B) contracting the cylinder wall with its left forelimb.
92
Neuroprotective Study Methods
4.5.2
“Corridor” task
The “Corridor” Task recently developed by Dunnett and colleagues to study 6-hydroxydopamine
induced lesions assesses left / right preference for food retrieval (Dowd et al. 2005). Rats are placed
into a long narrow corridor with caps containing sugar pellets located on each side of the corridor
floor in evenly spaced adjacent pairs. The rat is free to explore up and down the corridor but when
retrieving sugar pellets it is required to make a left or right selection or move onto the next pair of
sugar pellet containing caps. Although not previously reported to assess QA lesions I choose to
investigate using this test as it introduces an element of decision making and assesses the
development of any sensorimotor neglect. To undertake this task the rats were diet restricted to 85%
free feeding body weight in accordance with our ethical approval. In an effort to restrict exploratory
behaviour during assessment the rats were habituated to the testing apparatus one day prior to testing
by placing each animal into the corridor for 10mins with a few sugar pellets scattered along the floor
of the corridor. Then immediately prior to testing the rats were placed into an empty corridor for
5mins before transferring directly into a corridor setup to run the task. Retrievals were scored
whenever the rat placed its nose into a cap regardless of the number of sugar pellets actually
retrieved. The first 20 retrievals (max 5mins) were recorded as being either from the left- or rightside. Rats were tested on two consecutive days with the percentages of retrievals ipsilateral to the
lesion side averaged to ensure consistency.
93
Neuroprotective Study Methods
2400
70
350
ø 20
130
depth: 200
Figure 4-4
Sensorimotor “corridor” task
Dietary restricted rats were allowed to freely explore up-and-down the corridor retrieving sugar
pellets from evenly spaced containers along each wall of the corridor. A clear Perspex lid dissuaded
the rats from vertical exploration. Corridor dimensions in mm.
4.5.3
Drug-induced rotational analysis
Drug-induced rotational behaviour analysis was used to measure bilateral imbalances in the
dopamine system. Apomorphine – a dopamine agonist – and amphetamine – a dopamine releasing
agent – are commonly used to assess functional performance in Parkinson’s disease models but have
also been employed in QA lesion studies (Schwarcz et al. 1979; Dunnett et al. 1988). I investigated
the used of both apomorphine (1mg/kg injected s.c.) and
amphetamine (5mg/kg injected i.p.) dissolved in 0.9% saline.
Following drug administration the rats were placed into
rotational bowls and assessed for 1hr either by video analysis or
in real time using an automated Rotomax Rotometer (AccuScan
Instruments) system.
94
Neuroprotective Study Methods
Figure 4-5
Drug-induced rotational behaviour
Rats were fitted with a harness, placed into clear rotational cylinder and tethered to a Rotomax
Rotometer system used to quantify rotational behaviour for 1 hour following apomorphine or
amphetamine administration.
4.6 Quantitative Transgene ELISA
Quantification of the transgene expression within the striatum following AAV vector gene delivery
was undertaken to determine the level of biotherapeutic protein expression at the time of QA
injection. Three weeks after AAV vector delivery the rats were deeply anesthetised with an overdose
of sodium pentobarbital (~300mg/kg i.p.), decapitated and their brains immediately removed. The
brains were split into two hemispheres down the mid-line and the striatal region from each
hemisphere dissected out, snap-frozen in liquid nitrogen and stored at -80°C.
Homogenisation of the striatal tissue in preparation for ELISA quantification was performed in a
50mM Tris buffer pH 6.8 containing 0.5% Tween-20, 0.1% sodium azide, 1.5g/L EDTA, 5mg/L
Pepstatin A and 10mg/L PMSF. Frozen striatal tissue was transferred to a 15mL tube along with
600µL of homogenisation buffer and mechanically homogenised using a motorised cylindrical
Teflon pestle until tissue fragments were no longer visible.
Homogenates were centrifuged at
3,000rpm for 15mins at 4°C. The protein containing supernatant was divided into aliquots and
stored at -80°C to prevent protein degradation.
Quantitative ELISA assays were undertaken in accordance with the appropriate ELISA kit
instructions. Promega Emax® ImmunoAssay Systems were used for BDNF (G7610) and GDNF
(G7620), and R&D Systems Duoset® IC for XIAP (DYC822) and Bcl-xL (DYC894). To perform
quantification the sample supernatants were each run in triplicate at two dilutions (Table 4-5) along
with samples from AAV-Luciferase treated rats as AAV-vector transduction controls (1:10 and 1:50
dilutions) and each kits recommended eight-point standard series. Optical absorbance of the ELISA
plate was read on a Spectra max plate reader (Molecular Devices). Protein concentrations calculated
from the standard curve were subsequently standardised against total protein in each sample.
95
Neuroprotective Study Methods
Total protein was measured using bicinchinonic acid (BCA; Sigma-Aldrich) and bovine serum
albumin (BSA; Invitrogen) as a protein standard. A 4000 µg/mL BSA standard was prepared in 1N
sodium hydroxide and serially diluted 1:2 to produce an eight point standard curve from 2000 –
zero µg/mL. Sample supernatants were diluted 1:10, 1:20 and 1:40 and plated into a 96 well ELISA
plate in duplicate alongside the BSA standards also plated in duplicate (50 µL/well). 100µL BCA
reagent (1mL 4% copper sulphate solution per 50mL BCA) was added to each well and incubated at
room temperature for 2-3 hours before reading on a Spectra max plate reader at 562nm. Total
protein was calculated from the BSA standard curve.
Sample Dilutions
Initial Investigations
Ipsilateral
Contralateral
AAV-BDNF
1:1000, 1:5000_
1:10, 1:50
AAV-GDNF
1:500, 1:2500
1:10, 1:50
AAV-Bcl-xL
1:50, 1:250
1:10, 1:50
AAV-BDNF (1:10)
1:500, 1:1000
1:10, 1:50
AAV-Bcl-xL (Two-site)
1:500, 1:1000
1:10, 1:50
AAV-XIAP
1:500, 1:1000
1:10, 1:50
Follow-up Investigations
Table 4-5
Dilutions used for ELISA quantification of in vivo transgenic protein expression.
Transgenic protein containing supernatants from the striatal tissue homogenates were diluted in
supplied buffers to appropriate levels for ELISA quantification analysis. The ipsilateral hemisphere
required greater dilution to fit standard curves.
4.7 Immunohistochemical Analysis
Immunocytochemistry was performed to visualise transgene expression following AAV gene
delivery, analyse QA induced neurodegeneration and to correlate the attenuation of behavioural
impairments with structural maintenance of brain anatomy.
4.7.1
Brain tissue collection and processing
Paraformaldehyde fixation of the rat brains was used throughout the research. The rats were deeply
anesthetised with an overdose of sodium pentobarbital (~300mg/kg i.p.) and perfused transcardially
with 100mL chilled 0.9% saline followed by 500mL 4% paraformaldehyde in 0.1M phosphate
buffer, pH 7.4. Following ~30min perfusion the brains were removed, post-fixed overnight in 4%
96
Neuroprotective Study Methods
paraformaldehyde at 4°C and then cyroprotected for sectioning in 30% sucrose 0.1M phosphate
buffered solution. A sliding microtome with freezing stage was used to cut 40µm coronal sections
through the striatum from frozen brains. Eight sets of sections were collected from each brain
(distance of 320µ m between consecutive sections in each set) and stored in a cyroprotectant solution
(30% sucrose, 30% ethylene glycol, 0.5M phosphate buffer) at -20°C.
4.7.2
DAB-staining immunocytochemistry protocol
The visualisation of specific cellular populations and / or structure is possible with
immunocytochemistry using antibodies raised against specific proteins or peptides uniquely
expressed by the cells of interest. I utilised a DAB (3,3’-diaminobenzidine tetrahydrochloride)staining procedure to visualise various neuronal populations within the basal ganglia via the binding
of primary antibodies raised against specific marker proteins (Table 4-6).
Immunocytochemical staining was performed on individual sets of free floating coronal sections
spanning the region of interest. Sections were removed from the cyroprotectant solution and washed
overnight in PBS. To block any endogenous peroxidase activity I first incubated the sections in a
solution of 1% hydrogen peroxide, 50% methanol for 10mins and then washed four times in PBSTriton (PBS with 0.2% Triton X-100). The primary antibodies (Table 4-6) were diluted in PBSTriton, either with goat serum as a blocking agent or without any blocking serum. Goat serum
(GIBCO®) was used as a blocking agent for all antibodies except for when the primary antibody was
raised in goat.
Sections were incubated in the diluted primary antibody overnight at room
temperature with gentle agitation on a rocking table. Following overnight incubation the sections
were washed four times in PBS-Triton and incubated with an appropriate secondary antibody diluted
1:500 in PBS-Triton with or without goat serum.
All secondary antibodies were biotinlyated
antibodies raised against the host species of the primary antibody (Appendix B.4). The sections were
incubated with the secondary antibodies for 2-3 hours at room temperature on a rocking table,
washed four times with PBS-Triton and incubated for a further 2-3 hours with Extravidin peroxidise
(Sigma-Aldrich) diluted 1:500 in PBS-Triton. Sections were washed four times in PBS before
staining in DAB or DAB-nickel sulphate solution. After staining the sections were washed in PBS
and mounted onto polysine-coated glass microscope slides (Biolab Scientific, NZ). The slides were
dried overnight, serially dehydrated in 70%, 90% and 100% ethanol, delipidified in xylene and
coverslipped with histomount mounting medium (DPX; Sigma-Aldrich).
Marker
Antibody
Dilution
Supplier
HA-epitope
HA.11
1:1000
Covance
97
Neuroprotective Study Methods
Luciferase
Luciferase
1:10000
Chemicon
Neurons
NeuN
1:1000
Chemicon
Striatal Neurons
DARPP-32
1:750
Chemicon
Striatal Neurons
Egr-1 (krox-24)
1:1000
Santa Cruz
Dopaminergic Neurons
Tyrosine hydroxylase
1:500
Chemicon
Pallidal Neurons
Parvalbumin
1:5000
Swant
Cortical Neurons
SMI32
1:10000
Sternberger
Monoclonals
Table 4-6
Primary antibodies for DAB-staining immunocytochemistry
Primary antibodies and working dilutions for immunocytochemical analysis of different neuronal
populations and the localisation of transgene products in fixed free-floating brain sections.
Additional antibody details in Appendix B.5.
4.7.3
Fluorescent immunocytochemistry analysis
Double labelling of striatal sections was performed by fluorescent immunocytochemistry to visualise
the expression of cellular markers – NeuN, DARPP-32, krox-24 and GFAP – and the relative
localisation of transgenic protein expression. Striatal sections were removed from the cyroprotectant
solution and washed overnight in PBS.
The sections were then incubated overnight at room
temperature with pairs of primary antibodies diluted in PBS-Triton with 1% blocking serum (Table
4-7).
Following overnight incubation the sections were washed four times in PBS-Triton and
incubated in Alexa Fluor® secondary antibodies (Invitrogen) diluted 1:500 in PBS-Triton with 1%
goat or donkey serum (Table 4-7). After washing in PBS the sections were mounted onto uncoated
glass slides and coverslipped with Cytifluor (Agar Scientific) for analysis with confocal microscopy.
Primary antibodies
Dilution
NeuN
1:1000
DARPP-32 or krox-24
1:500 / 1:1000
Luciferase
1:20000
NeuN or GFAP
1:1000 / 1:500
Luciferase
1:20000
DARPP-32 or krox-24
1:500 / 1:1000
HA
1:1000
DARPP-32 or krox-24
1:500 / 1:1000
Serum
Goat
Donkey
Donkey
Goat
98
Alexa Fluor® 2° antibodies
594 anti-mouse
488 anti-rabbit
594 anti-goat
488 anti-mouse
594 anti-goat
488 anti-rabbit
594 anti-mouse
488 anti-rabbit
Neuroprotective Study Methods
Table 4-7
Antibodies for co-immunofluorescent labelling
Pairs of primary antibodies used for co-labelling of neurons, working antibody dilutions, blocking
serum (Goat, GIBCO®; Donkey, Sigma-Aldrich), secondary Alexa Fluor® conjugated antibodies
raised in goat (Molecular Probes™, Invitrogen). Further antibody details in Appendix B.5.
4.7.4
Microscopy and stereology
Light microscopy analysis and stereological quantification was performed using a Nikon Eclipse
E800 microscope coupled with StereoInvestigator® software (MicroBrightField) and MicroFire™
S99808 digital camera (Optronics). Staining intensity analysis was performed on captured images
using ImageJ (National Institutes of Health, USA). Presented images were compiled in Adobe®
Photoshop® (Adobe).
Confocal analysis of NeuN, DARPP-32 and HA staining confirmed full
penetration of the antibodies through the tissue slices (data not shown).
4.7.4.1
Striatal Neuron Stereology
DARPP-32 immunopositive neurons within the striatum were counted stereologically by unbiased
optical fractionator sampling procedures. For the first investigation I assessed the striatum over
twelve equispaced (320µm) coronal sections (sectioned at 40µm) extending from the head of the
striatum at bregma +2.4 mm to -1.8 mm. The striatum was delineated on each section under a 2×
objective using the lateral ventricle, corpus callosum, internal capsule and globus pallidus to help
define the striatal borders. Medium spiny projection neurons expressing DARPP-32 were estimated
by systematic sampling from a random starting point using a 60× objective lens. The optical
fractionator was set to sample at intervals of x = 600µm, y = 700µm with a counting frame x = 90µ m,
y = 70µm, dissector height z = 7µm; giving a section sampling fraction (ssf) of 1/8, area sampling
fraction (asf) of 1/67 and thickness sampling fraction (tsf) of 1/1.4. In the second investigation I
restricted the striatal neuronal estimates to six serial coronal sections (40µ m sections equispaced at
320µ m) covering the site of AAV vector and QA striatal injection (bregma +1.8mm to -0.5mm).
Optical fractionators were set with grid spacing x = 650µm, y = 650µm and counting frame x =
90µ m, y = 70µm, z = 8µm (ssf = 1/8, asf = 1/67, tsf = 1/1.25). Coefficient of Error values were
calculated using Gundersen equations, m = 1.
Subsequent stereological analysis of krox-24 expressing striatal neurons in the second investigation
was undertaken over eight coronal sections (40µm sections equispaced at 320µm) through the
striatum (bregma +2.1mm to -0.8mm). Optical fractionators were set with grid spacing x = 650µ m, y
= 650µm and counting frame x = 70µm, y = 70µm, z = 7µm (ssf = 1/8, asf = 1/86, tsf 1/1.4).
99
Neuroprotective Study Methods
4.7.4.2
Striatal Atrophy
The extent of striatal atrophy was determined from the coronal section contours outlined for
stereological counting of DARPP-32 neurons (Section 4.7.4.1). Total cross-sectional area of the
ipsilateral striatum was calculated as a proportion of the contralateral striatal area.
4.7.4.3
Striatal TH-Staining Intensity
Maintenance of TH in the striatum was quantified by density measurements of TH-immunostained
sections using ImageJ. Images of the ipsilateral and contralateral hemispheres from eight equispaced
(320µm spacing) coronal sections through the striatum (bregma +2.1mm to -0.8mm) were captured
under a 2× objective and the striatal regions outlined as above (Section 4.7.4.1). Integrated areadensity measurements of TH-staining in the treated striatum relative to the adjacent contralateral
striatum were averaged across the eight sections to give the relative maintenance of striatal TH
expression.
4.7.4.4
Maintenance of Striatonigral Projections
Innervations of the substantia nigra by DARPP-32 containing fibres were also quantified by density
measurements. Three equispaced (320µm spacing) coronal sections through the substantia nigra
(bregma -4.9mm to -5.9mm) were photographed under a 4× objective and both ipsilateral and
contralateral nigral regions outlined with ImageJ. Integrated area-density measurements of DARPP32 staining in the treated nigra relative to the adjacent contralateral nigra were averaged across the
three sections to determine relative maintenance of the DARPP-32 positive fibre innervations.
4.7.4.5
Pallidal Neuron Stereology
Parvalbumin expressing neurons in the globus pallidus were estimated by optical fractionator
following delineation of the GP region on four equispaced (320µm spacing) coronal sections
(sectioned at 40µm) between bregma -0.5mm to -1.8mm. Optical fractionator sampling parameters
were set to grid spacing of x = 200µm, y = 300µm and counting frame x = 100µm, y = 100µm, z =
7µ m (ssf = 1/8, asf = 1/6, tsf = 1/1.4).
4.7.4.6
Confocal Microscopy
To assess co-labelling of striatal cells following immunofluorescent staining I used a Leica TCS SP2
laser scanning confocal microscope (Biomedical Imaging Resource Unit, The University of
Auckland) to captured single optical slice images of fluorescently stained striatal cells under a 63×
objective lens.
100
Neuroprotective Study Methods
4.8 Statistical Analysis
All statistics were performed with GraphPad Prism® (version 4). Unless otherwise stated all data
presented represents group mean ± standard error of the mean (SEM).
Non-parametric Mann-Whitney tests were performed to assess the level of therapeutic transgenic
protein expression following AAV-vector delivery relative to endogenous protein expression in
AAV-Luciferase treated control striata and non-treated contralateral striata.
Data collected from behavioural testing was analysed by paired t-test to assess development of QA
induced functional deficits relative to baseline testing (Section 3.3.4.1), or two-way repeated
measures (RM) ANOVA to gauge the impact of therapeutic AAV vector delivery on QA-induced
deficits over the post-QA assessment period of the studies relative to controls. Un-paired t-tests were
used to assess any significant alterations imparted by AAV-vectors relative to controls prior to QAlesioning.
Statistical analysis of all neuropathological changes – stereological cell counts, striatal atrophy, and
immunostaining density – were all undertaken by un-paired t-tests between the treatment groups and
control rats, thereby treating each individual vector as an independent investigation.
Correlations between functional behaviour and neuropathological alterations were performed by
calculating each rats mean forelimb asymmetry score and “corridor” task retrieval score across all
post-QA trials to give each rat an overall behavioural score for each test that could be correlated with
the rats’ end-point pathological assessments. For apomorphine-induced rotational behaviour all
individual post-QA trials were included in the correlation analysis. Pearson correlation coefficients
were performed to determine any overall trends independent of treatment. Linear regression or
Deming (Model II) linear regressions were calculated for the individual treatment groups to assess
individual correlations and any significant alterations due to vector delivery.
In all assessments the AAV-Luciferase vector control and PBS vehicle control data was grouped for
analysis provided they were not significantly different at the 5% level (P > 0.05).
One-way ANOVA with Bonferroni’s post-hoc tests or non-parametric Mann-Whitney analysis were
used to analyse the earlier functional protein assays verifying transgenic protein expression following
AAV-vector transduction.
101
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Chapter 5
Neurotrophic Factor Delivery:
AAV-BDNF and AAV-GDNF
5.1 Overview
BDNF and GDNF were investigated as potential neuroprotective agents against excitotoxic insult by
infusing an AAV vector encoding either BDNF or GDNF directly into the rodent striatum to enhance
localised neurotrophic factor expression prior to a unilateral intrastriatal injection of the excitotoxic
glutamate analogue QA.
Building on previous literature that has reported protective benefits
associated with BDNF (Martinez-Serrano and Bjorklund 1996; Bemelmans et al. 1999; PerezNavarro et al. 2000a; Kells et al. 2004) and GDNF (Perez-Navarro et al. 1996; Araujo and Hilt 1997;
McBride et al. 2003; Kells et al. 2004), but which has indicated limitations with achieving efficient
in vivo delivery procedures, I constructed AAV vectors with the intention of directing high level
striatum targeted transgenic protein expression to support the striatal projection neurons and prevent
associated functional deficits.
Unfortunately following AAV-BDNF delivery some of the rats
displayed detrimental behaviour, presumably due to excessive BDNF expression, resulting in early
termination of this trial. Despite the adverse reaction I felt AAV-BDNF delivery still had sufficient
merit as a therapeutic agent if these side effects could be avoided so conducted a second trial with a
lower-titre of the AAV-BDNF vector. Continuous expression of the neurotrophic factors following
AAV-mediated delivery showed some attenuation of the behavioural deficits resultant of QA
lesioning however these functional benefits only had limited correlation with BDNF-derived
maintenance of the basal ganglia. Overall these investigations demonstrated controlled delivery of
neurotrophic factors could provide symptomatic relief without necessarily supplying significant
neuroprotection to reduce the extent of neuronal cell death.
5.2 Procedures
Chimeric AAV1/2 vectors were constructed containing cDNA encoding BDNF or GDNF and were
assessed with in vitro assays to verify they correctly directed the expression of biologically
functional neurotrophic factors (Section 2.3; (Kells et al. 2006)) prior to checking in vivo
102
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
transduction and transgene expression in the rodent striatum. Following the AAV vector testing I
undertook two in vivo studies, conducted as described (Chapter 4) to assess the influence of BDNF
and GDNF expression on QA-induced striatal excitotoxicity and associated functional behavioural
deficits. In the initial study I assessed the delivered of AAV-BDNF (n = 7*) or AAV-GDNF (n = 10)
to a single stereotaxic site within the rodent striatum prior to QA injection at the same stereotaxic
coordinates. Following adverse reactions resulting from the AAV-BDNF delivery I conducted a
second follow-up investigation with a ten-fold lower titre of AAV-BDNF (n = 9) delivered to two
separate striatal sites flanking the QA injection site. An additional group of rats (n = 5) that received
reduced-titre AAV-BDNF in this second study were assessed without QA lesioning to directly
monitor the functional impact of AAV-mediated BDNF expression on sensorimotor performance.
Control rats for each study received either AAV-Luciferase (Initial: n = 8; Follow-up: n = 5) or
sterile PBS (Initial: n = 10; Follow-up: n = 5) prior to QA lesioning.
5.3 Animal Welfare
Throughout all in vivo investigations the only rats that were observed to display any abnormal health
issues were rats that received AAV-BDNF in the initial neuroprotective study. Starting five weeks
after AAV-BDNF infusion – two-weeks post-QA – a number of these rats began to display excessive
hyperactivity and aggression in their home cages, weight loss and seizure activity. In accordance
with predetermined animal welfare guidelines the rats were euthanised if they had greater than 20%
weight loss or ongoing seizures. The AAV-BDNF study was prematurely terminated seven weeks
post AAV delivery. No indication of any negative effects were noted during earlier in vivo vector
testing trials suggesting the health concerns were resultant of consistent long-term BDNF overexpression and therefore were not evident during the first three weeks post-AAV vector delivery in
which I had conducted all prior assessment. It was not determined whether these welfare issues were
due to the level of BDNF expression, the distribution within the brain, or a combined effect, but they
nevertheless highlight the challenges associated with the administration of neurotrophic factors as
therapeutic agents for neurological disorders. To avoid further welfare concerns but proceed with
investigation of BDNF as a neuroprotective agent using the existing AAV-BDNF vector, I reduced
the intensity of BDNF expression by lowering the vector titre 10-fold and splitting gene delivery
over two separate stereotaxic sites within the striatum.
*
n values here represent the final number of rats included in the analysis of the investigations (Section 4.3).
103
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.4 In Vivo AAV Vector Testing
To assess the spread of in vivo AAV vector transduction and neurotrophic factor transgene
expression prior to investigating the therapeutic efficacy of BDNF or GDNF expression, I injected
naïve rats using the same stereotaxic surgical delivery procedures to be performed on the main
cohorts of rats in the neuroprotective investigations. In the first instance, the surgical vector delivery
protocol was determined from the earlier AAV-Luciferase delivery testing (Section 4.4.2), which I
then modified for the second lower titre AAV-BDNF two-site injection study designed to reduce the
expression level but maintain a wide distribution of transduced cells within the striatum. Three
weeks
post-AAV
vector
delivery
transgenic
protein
expression
was
visualised
by
immunocytochemical staining against an HA-epitope attached to the C-terminal of the expressed
neurotrophic factors.
A
B
C
D
Figure 5-1
Spread of undiluted AAV-BDNF transduction and BDNF expression
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged BDNF
expression three weeks after a single site 4.0 µL striatal injection of the undiluted AAV-BDNF
vector. Cells expressing HA-tagged BDNF were largely contained within the injected striatum
where a large population of the striatal neurons appeared to be transduced. Higher-power images of
AAV-BDNF transduced neurons in (B) the striatum, (C) globus pallidus, and (D) substantia nigra.
Scale bar = 2mm for whole sections (A); 100µm for higher magnification images (B-D).
104
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Following the high-titre AAV vector injections, transduced cells were observed in an extensive but
often irregularly dispersed distribution throughout the rostral-caudal extent of the striatum (Figure
5-1, Figure 5-2). A population of cells within the globus pallidus and substantia nigra pars compacta
ipsilateral to the injected striatum were HA-positive indicating transportation of the AAV-vectors
and transduction of cells in the striatal target nuclei. The ipsilateral substantia nigra pars reticulata
also displayed HA-immunostaining, although this was mainly restricted to the striatonigral axonal
fibres with very few identifiable HA-positive cell bodies.
Ten-fold dilution of the AAV-BDNF vector clearly restricted the extent and distribution of cellular
transduction with the majority of HA-positive cells located close to the site of injection (Figure 5-3).
The transduction of cells within the substantia nigra and globus pallidus was also diminished with
only a few weakly HA-immunopositive cell bodies observed (Figure 5-3 C, D). A greater 100-fold
A
B
C
D
Figure 5-2
Spread of AAV-GDNF transduction and GDNF expression
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged GDNF
expression three weeks after a single site 4.0 µL striatal injection of the AAV-GDNF vector. Cells
expressing HA-tagged GDNF were largely contained within the injected striatum where a large
population of the striatal neurons appeared to be transduced. Higher-power images of AAV-GDNF
transduced neurons in (B) the striatum, (C) globus pallidus, and (D) substantia nigra. Scale bar =
2mm for whole sections (A); 100µ m for higher magnification images (B-D).
105
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A
B
C
D
Figure 5-3
Spread of the reduced-titre AAV-BDNF transduction and BDNF expression
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged BDNF
expression three weeks after striatal injection of the AAV-BDNF vector diluted ten-fold. Extensive
transduction of the striatal cells was seen in the proximity of the intrastriatal injection site and
directly adjacent to the corpus callosum. Higher-power images of AAV-BDNF transduced neurons
in (B) the striatum, (C) globus pallidus, and (D) substantia nigra. Scale bar = 2mm for whole
sections (A); 100µm for higher magnification images (B-D).
dilution of the AAV-BDNF vector almost completely eliminated striatal transduction detectable by
HA-immunocytochemistry, with only a few isolated HA-positive cells visually detectable close to
the site of injection.
5.5 BDNF and GDNF Expression Level
To quantify the level of BDNF and GDNF expression generated following AAV-mediated gene
transfer, cohorts of rats were euthanised three weeks after AAV vector delivery and their ipsilateral
and contralateral striatal tissue separately isolated for ELISA-based quantification of the total BDNF
and GDNF protein. Expression was assessed three weeks post-AAV delivery to provide a measure
of neurotrophic factor expression equivalent to that expected to be present in the neuroprotective
106
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
study group of rats at the time of QA injection.
BDNF expression in the striatum following
undiluted AAV-BDNF injection was enhanced ~1000 fold to 46 ± 7 ng/mg total protein compared
with the 0.049 ± 0.006 ng/mg total protein detected in control AAV-Luciferase injected striatum (P <
0.01; Figure 5-4A). The contralateral striatum displayed a slight increase in BDNF expression to
0.12 ± 0.02 ng/mg total protein (P < 0.05 compared to AAV-Luciferase contralateral striatum 0.064
± 0.007 ng/mg total protein) suggesting a small amount of transgene expression may have crossed to
the non-injected hemisphere. The lower titre AAV-BDNF injections resulted in a ~150-fold increase
to 4.2 ± 0.7 ng/mg total protein compared to 0.026 ± 0.002 ng/mg total protein in the contralateral
striatum. AAV-GDNF administration induced a similar increase in GDNF expression with GDNF
levels increased to 26 ± 6 ng/mg total protein in the injected striatum and 0.063 ± 0.005 ng/mg total
protein in the contralateral striatum (Figure 5-4B). Striatal expression of GDNF protein within the
control AAV-Luciferase treated rats was below the reliable detection limit of the ELISA assay.
A
B
Figure 5-4
ELISA quantification of BDNF and GDNF expression in the striatum
The level of BDNF (A) or GDNF (B) protein expression in striatal tissue isolated three weeks after
infusion of AAV-BDNF, AAV-GDNF or AAV-Luciferase was quantified by ELISA. Total protein
in the samples was measured by BCA assay to normalise the individual samples. The GDNF
expression in the AAV-Luciferase treated rats was considered to be below reliable detection levels.
Mann-Whitney tests: comparison with AAV-Luciferase * P < 0.05, ** P < 0.01; comparison with
high-titre AAV-BDNF ‡ P < 0.01. No statistics were performed on the GDNF expression levels.
5.6 Functional Behaviour Assessment
Throughout the neuroprotective studies I assessed the development of functional deficits by
analysing the performance of each rat in behavioural tests designed to show hemispherical
imbalances in brain function arising as a result of unilateral lesioning in the basal ganglia. The
functional behaviour tests undertaken as described earlier (Section 4.5) involved spontaneous
107
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
forelimb use analysis, drug-induced rotational behaviour following either apomorphine or
amphetamine dosing and preferential left / right side food selection. All the rats were assessed with
baseline measurements taken both before and after AAV delivery and for 5-7 weeks post-QA
injection (Table 4-2 and Table 4-3).
5.6.1
Spontaneous forelimb use
Deficits in functional motor performance were assessed by observing spontaneous forelimb usage
during exploratory rearing behaviour. Delivery of the AAV vectors or PBS did not induce any
significant alterations in baseline forelimb usage assessed prior to the QA injection, although both
neurotrophic factor treated groups – AAV-BDNF and AAV-GDNF – were tending towards an
increased preference to use their contralateral forelimb (Figure 5-5A,B). This slight contralateral
preference resulted in a small divergence in forelimb use between the control and neurotrophic factor
treated rats reaching statistical significance with lower-titre AAV-BDNF treated rats in the follow-up
study (Unpaired t-test P < 0.05).
Following unilateral QA administration the AAV-Luciferase and PBS treated control rats showed an
immediate shift towards preferentially using their ipsilateral forelimb for spontaneous exploration as
expected from the earlier testing (Section 3.3.4). This ipsilateral bias was however only observed
during the first two-weeks following QA injection in the initial study (Figure 5-5A), but maintained
throughout the seven-week post-QA assessment period in the second study (Figure 5-5B).
In
contrast, the preferential forelimb use by AAV-BDNF or AAV-GDNF treated rats was not
significantly affected by the QA injection in either investigation (Figure 5-5A,B). AAV-GDNF
treated rats maintained baseline preferences of non-biased spontaneous forelimb use, significantly
ameliorating the QA-induced ipsilateral bias (Two-way RM ANOVA P < 0.05; Figure 5-5A).
Following QA injection the AAV-BDNF treated rats in the initial high expression study continued to
develop a persistent contralateral forelimb preference in contrast to the immediate preferential
ipsilateral forelimb shift in the control rats (Two-way RM ANOVA P < 0.001; Figure 5-5A).
Subsequent BDNF investigation following ten-fold dilution of the AAV-BDNF vector eliminated the
ongoing development of a contralateral forelimb bias beyond the initial divergence from the control
group induced by AAV-BDNF transduction prior to QA injection (Figure 5-5B). Following QA
injection into the striatum of reduced-titre AAV-BDNF treated rats, the acquirement of a slight
contralateral forelimb use preference was reversed with a small shift towards greater ipsilateral
forelimb usage, such that overall the group remained largely unbiased in contrast to the significant
ipsilateral preference of control rats (Two-way RM ANOVA P < 0.05; Figure 5-5B). The extra
108
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
cohort of non-lesioned AAV-BDNF treated rats displayed a small shift towards contralateral
forelimb use, but with no on-going changes the continuous induced expression of BDNF at this
lower level did not appear to directly influence forelimb motor control (Figure 5-5B).
A
B
Figure 5-5
Spontaneous ipsilateral forelimb use asymmetry score
Plots displaying changes in group ipsilateral asymmetry scores quantified from forelimb use during
exploratory rearing behaviour in (A) the initial AAV-BDNF / AAV-GDNF and (B) AAV-BDNF
follow-up investigations. Ipsilateral asymmetry scores represent the combined usage of the
ipsilateral forelimb, as a percentage of the total left and right forelimb use, for rearing, initial contact
of the cylinder wall during an exploratory rear and landing. Un-paired t-test between treatment
groups: * P < 0.05. Two-way RM ANOVA relative to the control group: † BDNF P < 0.001, GDNF
P < 0.05; ‡ BDNF P < 0.05, BDNF – no QA P < 0.001.
109
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
In addition to the forelimb asymmetry scores, the level of exploratory activity in the cylinder was
assessed showing general reduction in the number of exploratory rears made during the five minute
observational period with sequential trials. Both AAV-BDNF and AAV-GDNF treated rats were
observed to maintain a significantly higher level of exploratory activity following QA administration
with the initial high-titre AAV-BDNF treated rats displaying full maintenance of exploratory
behaviour (Figure 5-6A). A higher level of activity was recorded in the second study for both
control and neurotrophic factor treated rats, which was likely to have been consequential of the
dietary restriction regime in the second investigation or adjustment to the home cage environment
which enhanced their level of exploratory behaviour (Figure 5-6B).
A
B
Figure 5-6
Spontaneous exploratory rearing activity
Plots displaying the number of exploratory rears in the assessment cylinder during the five minute
analysis of spontaneous forelimb use in (A) the initial AAV-BDNF / AAV-GDNF and (B) AAVBDNF follow-up investigations. No statistics were performed on the pre-QA baseline data.
Two-way RM ANOVA relative to the control group: † GDNF P < 0.05, BDNF P < 0.01; ‡ BDNF
P < 0.05, BDNF – no QA P < 0.01.
Overall the single administration of either AAV-BDNF or AAV-GDNF resulted in a significant
amelioration of the ipsilateral forelimb use bias induced by a unilateral striatal lesion with high
BDNF expression actually leading to predominant use of the contralateral forelimb. The apparent
recovery of the control group towards un-biased forelimb use in the initial study was in contrast to
the increasing bias in the second follow-up investigation.
An explanation for this conflicting
observation was not evident although the rats in the second study also exhibited a higher level of
exploratory rearing behaviour, potentially due to the dietary restriction of the rats in the second
study.
110
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.6.2
Drug-induced rotational behaviour
The extent of rotational behaviour induced by apomorphine or amphetamine was undertaken to
assess imbalances in the dopamine system following unilateral intrastriatal QA injection and the
subsequent loss of striatal neurons expressing dopamine receptors. Results of both the apomorphine
and amphetamine induced rotational behaviour were difficult to interpret due to the inconsistency of
rotational direction between individual rats within the treatment groups which was possibly resultant
from slight variations in the positioning of the striatal lesion.
5.6.2.1
Apomorphine
Apomorphine administered subcutaneously acts as a non-specific dopamine receptor agonist
stimulating dopaminoceptive neurons and thereby inducing rotational motor behaviour generally
towards the lesioned striatum (Section 3.3.4). The prevalence of apomorphine induced rotational
behaviour varied greatly between individual rats with rotation rates ranging from no rotational
behaviour through to 20 rotations per minute. Within each group some rats displayed a contralateral
rotational dominance in contrast to the majority of control treated rats that rotated towards the
lesioned hemisphere (Figure 5-7).
Although there were no significant differences between the
treatment groups in terms of total rotations, I did observe an overall trend towards increased
rotational behaviour after QA injection (Figure 5-8). The additional non-lesioned AAV-BDNF rats
in the follow-up study also tended to display increased rotational behaviour in spite of not being
lesioned and in contrast to the AAV-BDNF treated rats that were QA lesioned.
For reliable
assessment of rotational behaviour I restricted the analysis of ipsilateral rotation percentage to rats
that had greater than 0.5 rotations per minute for apomorphine.
Having selectively treated the rats on their naturally dominant striatal hemisphere – determined
following the baseline testing – the initial baseline rotational behaviour was generally in an
ipsilateral direction less than 50% of the time (Figure 5-7). Apomorphine administration after AAV
vector delivery but prior to QA injection resulted in a large distribution in the percentage of
ipsilateral rotations for both neurotrophic factor – AAV-BDNF and AAV-GDNF – and the AAVLuciferase or PBS control treated groups. The majority of AAV-BDNF treated rats were however
observed to switch rotational direction following AAV-BDNF injection with the increase in striatal
BDNF protein expression causing the rats to predominantly rotate towards their treated hemisphere.
This change in rotational direction was particularly pronounced in the initial AAV-BDNF trial which
had the highest BDNF expression levels (Figure 5-7A). The induction of ipsilateral rotational
behaviour following BDNF expression was also observed in the smaller cohort of reduced-titre
111
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
AAV-BDNF treated rats in the follow-up study which were not selected for QA lesioning. However,
five weeks following AAV-BDNF delivery the non-lesioned rats had reverted to a contralateral
rotational dominance suggesting modifications in the dopamine system following continuous
expression of BDNF in the striatum (Figure 5-7B). Following the QA lesion apomorphine-induced
rotational behaviour became more uni-directional in all animals although it was not always in an
ipsilateral direction. While the majority of the control treated rats exhibited persistent ipsilateral
rotational behaviour, the AAV-BDNF and AAV-GDNF treated groups were more evenly divided
between predominantly displaying contralateral or ipsilateral rotational behaviour. With the lack of a
consistent rotational direction between similarly treated rats I did not perform any statistical analysis
on the rotational data.
A
B
Figure 5-7
Apomorphine-induced rotational behaviour
Plots displaying each rats rotational behaviour towards the treated side of their brain as a percentage
of total rotations following s.c. administration of 1mg/kg apomorphine in (A) the initial AAV-BDNF
/ AAV-GDNF and (B) AAV-BDNF follow-up investigations. Rats that had less than 0.5 rotations
per minute were excluded from this analysis. Lines represent the median result for each group.
112
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A
B
Figure 5-8
Total apomorphine-induced rotations
Plots displaying the mean rate of apomorphine-induced rotational behaviour for each group in (A)
the initial AAV-BDNF / AAV-GDNF and (B) AAV-BDNF follow-up investigations following s.c.
administration of 1mg/kg apomorphine. No significance was found between treatment groups and
controls post-QA.
5.6.2.2
Amphetamine
Amphetamine was only used to induce rotational behaviour in the initial high-titre AAV-BDNF and
AAV-GDNF study. Wide variation in the rotational response of individual rats was observed during
baseline testing with the selection of the dominant hemisphere for treatment skewing this into an
overall contralateral rotational preference (Figure 5-9A). The average rate of rotation also varied
greatly with many rats not showing any induction of rotational behaviour, therefore I restricted the
analysis of rotational direction to rats that displayed greater than an average 0.1 total rotations per
minute over the 60 minute testing period. Following AAV-vector delivery, but prior to QA injection,
the enhanced expression of BDNF and GDNF significantly increased the amphetamine induced
rotation rate compared with the control treated rats (BDNF P < 0.05; GDNF P < 0.01; Figure 5-9B)
A majority of the AAV-BDNF and AAV-GDNF treated rats preferentially rotated towards their
treated side following amphetamine administration, while control treated rats showed very little
rotational behaviour. Post-QA injection the majority of rats from all treatment groups immediately
displayed largely unidirectional rotational behaviour – predominantly in an ipsilateral direction
although a few rats preferentially rotated away from their lesioned hemisphere. Over the sequential
trials amphetamine-induced rotational behaviour of the control and AAV-GDNF treated rats became
more polarised becoming purely unidirectional at week six. In contrast, AAV-BDNF treated rats
displayed much greater variation in rotation direction than the control group with only a few rats
acquiring complete unidirectional behaviour and displaying a return towards bidirectional rotational
behaviour at four weeks post-QA. The BDNF rats were removed from this initial study five weeks
after QA administration and amphetamine-induced rotations were not assessed in the lower AAVBDNF follow-up study so I was unable to determine whether this observed return towards equal
113
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
directional rotational behaviour was enhanced or maintained at later time points. Statistical analysis
was not performed on the directional rotation data due to the inconsistency in the direction of
induced rotation following QA lesioning.
A
B
Figure 5-9
Amphetamine-induced rotational behaviour
Plots displaying the rotational behaviour induced following an i.p. injection of 5mg/kg of
amphetamine in the initial AAV-BDNF / AAV-GDNF investigation. (A) Individual rats’ rotational
behaviour towards the treated (ipsilateral) side of their brain as a percentage of total rotations.
(B) Mean rate of rotational behaviour for each group. Rats that had less than 0.1 rotations per minute
were excluded from the directional analysis. Lines in (A) represent the median result for each group
at each time point. Post-AAV – Un-paired t-test: * P < 0.05, ** P < 0.001. Post-QA – Two-way RM
ANOVA: † BDNF P < 0.05; GDNF P = 0.055.
5.6.3
Sensorimotor “corridor” task
The impact of AAV-BDNF delivery on the development of sensorimotor neglect was investigated in
the second in vivo study by analysing the rats’ performance in the “corridor” task. During baseline
assessment the rats displayed a fairly even distribution of sugar pellet retrievals from the left and
right sides of the corridor with the selection of the dominant hemisphere for treatment skewing the
group data slightly towards a preferential retrieval of pellets from the contralateral side of the
114
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
corridor (Figure 5-10). Delivery of the AAV vectors did not alter the percentage of ipsilateral
retrievals for the control rats or the main group of reduced-titre AAV-BDNF treated rats. However,
in contrast to the main treatment groups, the additional group of rats included to assess AAV-BDNF
treatment in the absence of a QA lesion did display a small but significant increase in the retrieval of
sugar pellets located on the ipsilateral side of the corridor post-AAV delivery (Paired t-test P < 0.05),
although this shift did not result in a significant ipsilateral retrieval bias (Not significantly above
50%; Wilcoxon signed-rank test P > 0.05) and remained fairly consistent throughout the full testing
period. Following QA administration the control rats rapidly acquired a strong ipsilateral retrieval
bias that persisted throughout the seven week investigative period. In stark contrast the AAV-BDNF
treated group did not show significant development of an ipsilateral retrieval preference post-QA
remaining unchanged from baseline preferences and significantly separated from the control group
(Two-way ANOVA post-QA P < 0.01).
Figure 5-10 Preferential food selection in the sensorimotor “corridor” task
Plot displaying group changes in the number of sugar pellet retrievals from the same side as the
treated striatum as a percentage of the 20 retrievals per trial. Two-way RM ANOVA relative to the
control group: † BDNF P < 0.01; BDNF – no QA P < 0.05.
5.7 Immunocytochemical Analysis
On completion of the functional behavioural assessment I analysed the post-mortem brain tissue to
visualise and quantitatively determine the extent of any neuroprotection imparted by the AAVBDNF or AAV-GDNF vector delivery prior to QA-induced excitotoxic insult. Immunocytochemical
staining was performed on individual series of coronally sliced sections equispaced at 320µ m
intervals through the caudate-putamen portion of the striatum, the globus pallidus and substantia
nigra to identify specific populations of basal ganglia neurons affected by the QA striatal lesion.
115
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.7.1
AAV-mediated transgene expression and QA lesioning of
the striatum
To assess the level of neuroprotective support imparted by AAV-mediated neurotrophic factor
expression against QA-induced excitotoxic insult, I initially visualised the distribution of transgene
expression by HA or Luciferase immunocytochemical staining and quantified the extent of QA
striatal lesioning using DARPP-32 as a marker for the GABAergic striatal projection neurons.
A
*
B
C
E
F
H
I
*
*
*
HA
D
*
*
*
*
DARPP-32
G
*
*
*
*
NeuN
Figure 5-11 High-titre AAV-BDNF transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated BDNF expression and
neuronal cell loss five weeks post-QA. (A-C) HA-immunostaining displayed an irregular
distribution of BDNF expression within the striatum resultant of undiluted AAV-BDNF transduction.
Maintenance of striatal neurons as detected by (D-F) DARPP-32 and (G-I) NeuN-immunostaining
was shown to inversely reflect the BDNF expression as identified by the arrows pointing to areas of
high BDNF expression and asterisks in areas with no transgenic BDNF expression. Regions outlined
by boxes are shown at higher magnification in figures immediately to the right. Scale bar = 1mm for
(A,D,G), 200µm for (B,E,H), 50µm for (C,F,I).
116
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.7.1.1
Initial Study – AAV-BDNF and AAV-GDNF Delivery
Using adjacent sections to compare the distribution of neurotrophic factor expression and the
maintenance of striatal projection neurons identified by their intense expression of DARPP-32, I
observed an inverse relationship between areas of extensive HA-tagged neurotrophic factor
expression and DARPP-32 positive neurons. This inverse correlation was particularly strong in the
AAV-BDNF treated rats as shown in Figure 5-11 where a well-defined portion of striatum is devoid
of HA-immunoreactivity but displays complete maintenance of DARPP-32 positive neurons, despite
its close proximity to the site of QA injection. Although less apparent, the opposite was also seen
A
B
C
E
F
H
I
*
HA
D
*
DARPP-32
G
*
NeuN
Figure 5-12 AAV-GDNF transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated GDNF expression and
neuronal cell loss seven weeks post-QA. (A-C) HA-immunostaining displayed the distribution of
GDNF expression within the striatum resultant of AAV-GDNF transduction. Maintenance of striatal
neurons was detected by (D-F) DARPP-32 and (G-I) NeuN-immunostaining. A large number of
HA-positive GDNF expressing cells were observed within regions of the striatum that exhibited a
complete loss of DARPP-32 staining (asterisks). Regions outlined by boxes are shown at higher
magnification in figures immediately to the right. Scale bar = 1mm for (A,D,G), 200µm for (B,E,H),
50µ m for (C,F,I).
117
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
with a reduction of DARPP-32 immunopositive cells in the dispersed areas of intensive BDNF
expression, but more maintained in adjacent portions of the striatum raising the question of DARPP32 down-regulation in AAV-BDNF transduced neurons. Overall this effect resulted in the AAVBDNF treated rats not having a clearly defined “lesion” area based on the absence of DARPP-32
immunopositive cells as I observed with the PBS and AAV-Luciferase control rats (Figure 5-13).
Immunostaining for NeuN in an adjacent section appeared to indicate that while there was a definite
reduction in the number of neurons it was not to the extent indicated by DARPP-32.
A
B
C
E
F
H
I
HA
D
DARPP-32
G
NeuN
Figure 5-13 AAV-Luciferase transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated Luciferase expression
and neuronal cell loss seven weeks post-QA. (A-C) Immunostaining for Luciferase shows the
striatal expression resultant of AAV-Luciferase transduction. Maintenance of striatal neurons was
detected by (D-F) DARPP-32 and (G-I) NeuN-immunostaining showing a fairly well defined region
of QA-induced lesioning. The vast majority of Luciferase expressing cells were located outside of
the lesion borders within intact segments of the striatum. Regions outlined by boxes are shown at
higher magnification in figures immediately to the right. Scale bar = 1mm for (A,D,G), 200µm for
(B,E,H), 50µm for (C,F,I).
118
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Similar to BDNF the AAV-GDNF treated rats displayed extensive HA-immunostaining of cells
within areas of the striatum devoid of DARPP-32 cells, however the area of “lesion” was more
clearly delineated and, in contrast to the BDNF rats, extended into regions of striatal tissue not
showing any HA staining (Figure 5-12). Surprisingly, staining for the neuronal marker NeuN also
displayed a lack of immunopositive neurons in the region of transgenic GDNF expression displaying
a similar pattern of cell loss to DARPP-32. In general the maintenance of NeuN-positive cells
appeared greater than DARPP-32-positive cells although I did not confirm this observation with
stereological quantification. In AAV-Luciferase control treated rats the Luciferase expression was
generally restricted to the areas of DARPP-32 staining although there was a scattering of Luciferasepositive cells remaining within the lesioned area that roughly correlated with the remaining NeuNpositive neurons (Figure 5-13). As with the PBS treated rats, AAV-Luciferase control rats displayed
more uniformity in DARPP-32 striatal cell loss than the neurotrophic factor expressing rats.
5.7.1.2
Study 2 – Reduced Titre AAV-BDNF Delivery
The inverse correlation between HA-detected BDNF expression and DARPP-32 expression seen in
the initial high-titre study was still observed following the 10-fold dilution of the AAV-BDNF vector
A
HA
B
C
E
DARPP-32
NeuN
D
F
Figure 5-14 Diluted AAV-BDNF administration and striatal cell maintenance
Adjacent sections through the striatum showing AAV-mediated BDNF expression and the loss of
striatal neurons eight weeks post-QA. (A,B) HA-immunostaining displayed the distribution of
BDNF expression within the striatum resultant of reduced-titre AAV-BDNF transduction.
Maintenance of striatal neurons was detected by (C,D) DARPP-32 and (E,F) NeuN-immunostaining.
Regions outlined by boxes are shown at higher magnification in figures immediately below. Scale
bar = 2mm for whole sections (A,C,E) and 200µm for higher magnifications (B,D,F).
119
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
and the two-site delivery procedure, although the correlation was less distinct with substantial areas
of the striatum containing both HA-immunoreactive cells and DARPP-32 expressing neurons (Figure
5-14A-D). Additional staining for NeuN confirmed the presence of some neurons within areas of
DARPP-32 loss further suggesting that the transduction with AAV-BDNF is leading to long-term
down-regulation of DARPP-32 expression (Figure 5-14E, F). The control AAV-Luciferase and PBS
treated rats continued to display a more regularly defined region of striatal lesioning, within which
only a small population of DARPP-32 and NeuN-expressing cells remained (Figure 5-15).
A
HA
B
C
E
DARPP-32
NeuN
D
F
Figure 5-15 Two-site AAV-Luciferase injection and striatal cell maintenance
Adjacent sections through the striatum showing AAV-mediated Luciferase expression and the loss of
striatal neurons eight weeks post-QA. (A,B) Immunostaining for Luciferase shows the striatal
distribution of Luciferase expression resultant of the AAV-Luciferase transduction following twosite delivery. Maintenance of striatal neurons was detected by (C,D) DARPP-32 and (E,F) NeuNimmunostaining, displaying a reasonably well defined region of QA lesioning. The majority of
Luciferase expressing cells were located outside of the lesion borders within the intact segments of
the striatum. Regions outlined by boxes are shown at higher magnification in figures immediately
below. Scale bar = 2mm for whole sections (A,C,E) and 200µm for higher magnifications (B,D,F).
5.7.1.3
Stereological Analysis – DARPP-32
To quantify the striatal damage induced by QA lesioning following delivery of AAV vectors
encoding BDNF, GDNF, Luciferase or PBS I employed stereological cell counting procedures to
estimate the number of DARPP-32 immunopositive neurons remaining within both the treated
striatum and the intact contralateral striatal hemisphere. In the initial high-titre AAV-BDNF and
120
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
AAV-GDNF investigations, optical fractionator probes estimated the number of DARPP-32 positive
neurons in the sampled region of the caudate-putamen at 1,400,000 ± 120,000 in high-titre AAVBDNF treated rats, 1,210,000 ± 90,000 in AAV-GDNF rats and 1,150,000 ± 120,000 in the AAVLuciferase / PBS control rats compared with an overall average of 2,180,000 ± 50,000 DARPP-32
positive cells in the contralateral intact striatum (Figure 5-16A; Coefficient of Error:
Initial High-titre Neurotrophic Factor Investigation
A
B
Follow-up Reduced-titre AAV-BDNF Investigation
C
D
Figure 5-16 Maintenance of DARPP-32 positive striatal projection neurons
Graphs displaying the actual and relative numbers of DARPP-32 positive neurons in the striatum as
estimated by optical fractionator stereological analysis of the treated (ipsilateral) and intact
(contralateral) striatal hemispheres in (A,B) the initial AAV-BDNF and AAV-GDNF investigation
and (C,D) reduced-titre AAV-BDNF follow-up study. Population estimates were determined from
12 sections spanning 3.56mm of the striatum for the initial study and 7 sections spanning 1.96mm of
the anterior striatum for the follow-up study. Relative cell counts represent the number of DARPP32 cells within the lesioned striatum as a proportion of cells present in the contralateral intact
striatum. Statistical analysis revealed no significance differences between treatment groups at the
5% level (Unpaired t-test P > 0.05).
121
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
ipsilateral ≤ 0.04, contralateral ≤ 0.02). A smaller portion of the caudate-putamen centred around the
QA lesion was analysed in the second investigation containing an estimated 1,530,000 ± 40,000
DARPP-32 positive neurons in the intact contralateral striatum that was reduced to 930,000 ±
100,000 in the reduced-titre AAV-BDNF treated striatum and 760,000 ± 60,000 in the AAVLuciferase / PBS controls (P = 0.18; Figure 5-16C; Coefficient of Error: ipsilateral ≤ 0.06,
contralateral ≤ 0.03).
Overall the proportion of cells expressing DARPP-32 in the QA lesioned striatum relative to the
intact contralateral striatal hemisphere was reduced in control AAV-Luciferase / PBS treated rats to
52 ± 4 % in the initial study and 47 ± 4 % in the second follow-up investigation. Prior delivery of
the AAV vectors to enhance neurotrophic factor expression at the time of QA lesioning was
unsuccessful in significantly increasing the maintenance of DARPP-32 positive neurons.
The
proportion of DARPP-32 positive neurons remaining in the initial high-titre AAV-BDNF injected
rats was estimated at 60 ± 4 % (t-test P = 0.28) and 58 ± 5 % in the AAV-GDNF treated group (t-test
P = 0.35; Figure 5-16B). Dilution of the AAV-BDNF vector still failed to generate sufficient
assistance to significantly protect the striatal neurons from QA-induced insult, despite increasing the
relative maintenance of DARPP-32 neurons to 65 ± 8 % of the contralateral striatum (t-test P =
0.054; Figure 5-16D).
5.7.1.4
Striatal Atrophy
In addition to the loss of striatal neurons I observed an apparent atrophy of the striatum and
enlargement of the adjacent lateral ventricle (e.g. Figure 5-15). By analysis of the striatal area using
the same contours drawn to perform stereological cell estimates, I quantified the relative volume of
the striatum in the control rats to be 73 ± 2% of the contralateral striatum in the initial study (Figure
5-17A) and 75 ± 3% in the second follow-up investigation (Figure 5-17C). AAV-BDNF treatment
significantly prevented striatal atrophy with complete maintenance of the striatal area in the initial
high-titre study (103 ± 3%, t-test P < 0.0001) and only a 9% reduction in the follow-up reduced-titre
AAV-BDNF investigation (91 ± 6%, t-test P < 0.05). In contrast, AAV-GDNF delivery did not
significantly influence QA-induced atrophy compared with the control rats (79 ± 2%, t-test P = 0.12).
Comparison between the striatal atrophy and the loss of DARPP-32 expressing striatal projection
neurons showed a direct correlation with the striatum contracting in proportion to the loss of striatal
neurons (Figure 5-17B,D). The correlation was significantly shifted by AAV-BDNF delivery in the
initial high-titre investigation, with the striatum maintaining its full volume despite DARPP-32 cell
loss equivalent to some of the control and AAV-GDNF treated rats (P < 0.001).
122
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Initial Neuroprotective Study
Follow-up Reduced-titre AAV-BDNF Study
A
C
B
D
Figure 5-17 Atrophy of the lesioned striatum
Graphs displaying the size of the lesioned striatum as a proportion of the intact contralateral striatal
area, and plots correlating striatal atrophy with DARPP-32 positive cell loss in the striatum.
(A,B) Initial high-titre AAV-BDNF and AAV-GDNF investigation and (C,D) the follow-up reducedtitre AAV-BDNF study. Cross-sectional striatal area was measured on 12 coronal sections for the
initial study and 7 sections for the second study. Unpaired t-tests: * P < 0.05, ** P < 0.0001. Linear
regression analysis: R values represent the overall Pearson correlation coefficient; Solid lines
represent significant non-zero linear correlations for individual treatment groups (P < 0.05).
Comparison with controls: (A) BDNF: slope P = 0.81, elevation P < 0.001 (†); GDNF: slope P =
0.43, elevation P = 0.12; (B) BDNF: slope P = 0.88, elevation P = 0.34.
5.7.2
Krox-24 expression
As an alternative to the DARPP-32 protein dependent analysis of neuronal survival, I also visualised
striatal neurons in the reduced-titre AAV-BDNF follow-up investigation by their expression of krox24 / early growth response protein 1 (Egr1) (Herdegen et al. 1995; MacGibbon et al. 1995). An early
response transcription factor, krox-24 is induced in neurons following neurotransmitter or trophic
factor activation of the mitogen-activated protein kinase (MAPK) signalling pathway, subsequently
regulating the expression of a diverse range of neuronal proteins and thereby contributing to neuronal
123
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
plasticity (Knapska and Kaczmarek 2004). Basal expression of krox-24 in rodent striatal neurons
may provide a more reliable visualisation of surviving neurons than late-response gene products.
Visual assessment of the normal rat striatum showed the vast majority of striatal neurons expressing
NeuN also co-express both krox-24 and DARPP-32 (Figure 5-18).
A late addition to the
pathological analysis to complement DARPP-32 based quantification of striatal neurons, I did not
retrospectively quantify krox-24 maintenance in the initial high-titre AAV-BDNF and AAV-GDNF
investigations.
A
NeuN
DARPP-32
B
NeuN
krox-24
Figure 5-18 Double-immunofluorescent labelling of striatal neurons
Co-labelling of striatal neurons in the normal striatum with NeuN (red) and either (A) DARPP-32 or
(B) krox-24 (green), demonstrated the vast majority of neurons expressing the general neuronal
marker NeuN also express DARPP-32 and krox-24. All expression of DARPP-32 and krox-24 was
localised to the NeuN-positive neurons. Scale bar = 30µm.
The distribution of krox-24 expression within the AAV-BDNF treated striatum appeared similar to
DARPP-32 immunostaining, although as a nuclear protein krox-24 staining was more distinct and
had less variability in DAB staining intensity (Figure 5-19).
Quantification of krox-24
immunopositive cells was performed using the optical fractionator stereology probe on eight
124
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
equispaced sections through the striatum (Figure 5-20A). An estimated 1,060,000 ± 110,000 krox-24
positive cells remained within the analysed region of the striatum in the control AAV-Luciferase /
PBS treated rats, and 1,420,000 ± 180,000 in the reduced-titre AAV-BDNF treated rats (Coefficient
of Error ≤ 0.05). The intact contralateral striatal regions contained an estimated 2,090,000 ± 60,000
krox-24 positive cells (Coefficient of Error ≤ 0.03). Overall I found similar maintenance of the krox24 positive striatal cells to that quantified by DARPP-32 analysis (Section 5.7.1.3), however the
survival of krox-24 expressing neurons following AAV-BDNF at 68 ± 8% did demonstrate a
significant level of protection when compared with the 50 ± 6% krox-24 cell maintenance in AAVLuciferase / PBS control rats (t-test P < 0.05; Figure 5-20B).
Correlation of the krox-24 expression with DARPP-32 cell maintenance demonstrated a parallel link
between the maintenance of krox-24 expression and DARPP-32 expression following QA lesioning
that was independent of the prior AAV-BDNF or control treatment (Figure 5-20C).
krox-24
A
D
AAV-BDNF
AAV-Luciferase
DARPP-32
B
C
E
F
Figure 5-19 Krox-24 expression in the striatum
Representative images displaying the expression of krox-24 in striatal neurons following QA
lesioning in (A,B) AAV-BDNF treated rats and (D,E) AAV-Luciferase treated rats. (C,F) Adjacent
sections immunostained for DARPP-32 (copied from Figure 5-14D and Figure 5-15D) show the
positive distribution correlation between krox-24 and DARPP-32 positive cells in the striatum.
Regions outlined by boxes are shown at higher magnification in figures immediately to the right.
Scale bar = 2mm for whole sections (A,D) and 200µm for higher magnifications (B,C,E,F).
125
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A
B
C
Figure 5-20 Maintenance of krox-24 expressing striatal neurons
Graphs displaying (A) actual and (B) relative numbers of striatal neurons expressing krox-24 as
estimated by optical fractionator stereological cell counting in the treated (ipsilateral) and intact
(contralateral) striatal hemispheres in the follow-up, reduced-titre AAV-BDNF investigation.
Relative cell counts represent the number of krox-24 expressing cells within the lesioned striatum as
a proportion of krox-24 positive cells present in the contralateral striatum. Unpaired t-test: * P <
0.05. (C) Plot showing the correlation between the maintenance of krox-24 expressing neurons and
DARPP-32 positive neurons in the striatum. Deming linear correlation: slope = 1.02 ± 0.10; r2 =
0.87, P < 0.0001. R value represents the overall Pearson correlation coefficient.
126
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.7.3
Analysis of transduced striatal cells
To assess the phenotype of surviving AAV vector transduced cells within the striatum at the
conclusion of the neuroprotective studies I performed double-immunofluorescent staining for
transgene protein expression – Luciferase or HA – and either NeuN, DARPP-32, krox-24 or GFAP.
Co-labelling of Luciferase and NeuN demonstrated that the vast majority of transduced cells were
striatal neurons ( Figure 5-21A) although a small amount of co-localisation was also observed with
GFAP ( Figure 5-21D), suggesting that while the AAV vectors preferentially transduced neurons
they were capable of also transducing glial cells.
Despite the vast majority of AAV-Luciferase transduced striatal cells expressing the general
neuronal marker NeuN, expression of specific markers of striatal neurons – DARPP-32 or krox-24 –
by the AAV vector transduced cells varied with the different transgene being expressed.
No
DARPP-32 or krox-24 expression was observed within Luciferase expressing cells ( Figure
5-21B,C). While the majority of AAV-BDNF transduced cells positively labelled for krox-24, the
intensity of DARPP-32 expression appeared to be inversely related to the level of BDNF expression
( Figure 5-22). A similar pattern was also observed for the GDNF expressing cells with very few
maintaining expression of DARPP-32, and the majority of AAV-GDNF transduced cells also
displaying a large reduction in detectable krox-24 expression (Figure 5-23).
Figures on the following pages
Figure 5-21 Immunofluorescent analysis of AAV-Luciferase transduced cells
Representative single-slice confocal images from an AAV-Luciferase treated rat from the second
investigation showing AAV-Luciferase transduced cells (red) within the lesioned striatum and
immunofluorescent staining for (A) NeuN-positive cells, (B) DARPP-32 expression, (C) krox-24
expression and (D) GFAP expression (all displayed in green). Few Luciferase-positive cells actually
survived QA lesioning. (A) Co-labelling with NeuN was evident for most Luciferase expressing
cells. AAV-Luciferase transduced cells very rarely co-expressed (B) DARPP-32 or (C) krox-24.
(D) A few Luciferase-expressing cells appeared to co-localise with GFAP expression (arrows).
Scale bar: 30µm
Figure 5-22 Immunofluorescent analysis of AAV-BDNF transduced cells in the striatum
Representative single-slice confocal images from AAV-BDNF treated rats showing HA-positive
BDNF expressing cells within the striatum (red) together with immunofluorescent staining for (A-C)
DARPP-32 or (D) krox-24 expression (both displayed in green). (A) Co-labelling with HA and
DARPP-32 was only evident for some BDNF expressing cells in the undiluted AAV-BDNF study
with many morphologically identical cells not appearing to express DARPP-32 (arrows). A greater
proportion of HA-positive cells co-labelled in (B) the reduced-titre AAV-BDNF investigation,
although DARPP-32 staining was still weaker for the HA-positive transduced cells than nontransduced cells, especially in (C) the non-QA lesioned AAV-BDNF treated rats. (D) Co-labelling
for HA and krox-24 was evident for transduced cells in the reduced-titre AAV-BDNF study although
not all HA-positive cells displayed krox-24 expression (arrowheads). Scale bar: 30µm
127
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A AAV-Luciferase
Luciferase
NeuN
B AAV-Luciferase
Luciferase
DARPP-32
C AAV-Luciferase
Luciferase
krox-24
D AAV-Luciferase
Luciferase
GFAP
Figure 5-21 Immunofluorescent analysis of AAV-Luciferase transduced cells
128
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A High-titre AAV-BDNF
HA
DARPP-32
B Reduced-titre AAV-BDNF
HA
DARPP-32
C Reduced-titre AAV-BDNF
No-QA
HA
DARPP-32
D Reduced-titre AAV-BDNF
HA
krox-24
Figure 5-22 Immunofluorescent analysis of AAV-BDNF transduced cells in the striatum
129
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A AAV-GDNF
HA
DARPP-32
B AAV-GDNF
HA
DARPP-32
C AAV-GDNF
HA
krox-24
Figure 5-23 Immunofluorescent analysis of AAV-GDNF transduced cells in the striatum
Representative single-slice confocal images from AAV-GDNF treated rats showing HA-positive
GDNF expressing cells within the striatum (red) together with immunofluorescent staining for (A,B)
DARPP-32 or (C) krox-24 expression (both displayed in green). (A) Co-labelling with HA and
DARPP-32 was not evident in the QA-lesioned striatum despite overlapping distribution in some
areas showing general maintenance of DARPP-32 positive neurons. (B) AAV-GDNF transduced
cells were also found to survive within striatal areas largely devoid of DARPP-32 expressing cells.
(C) Labelling of krox-24 revealed co-localisation with some HA-positive cells (arrows) although
many of the AAV-GDNF transduced cells lacked krox-24 expression. Scale bar: 30µm
130
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.7.4
Dopaminergic innervations of the striatum
Using tyrosine hydroxylase (TH) as a marker to visualise the maintenance of dopaminergic input into
the striatum I assessed TH-positive immunostained fibres within the treated striatum relative to the
contralateral hemisphere. A clear loss of TH-positive fibres was visible in the striatum of control
treated rats proximal to the site of QA injection, with significant disruption to the structural
arrangement of TH fibres in a larger portion of the lesioned striatum surrounding the central lesion
core (Figure 5-24A). QA-induced disruption of TH-fibres was less evident in the reduced-titre
AAV-Luciferase
A
Low-titre AAV-BDNF
B
i
AAV-GDNF
C
v
iii
ii
vi
iv
i
iii
v
ii
iv
vi
Figure 5-24 Tyrosine hydroxylase expression in the striatum
Representative images displaying TH-immunoreactivity in the striatum following QA injection in
(A) AAV-Luciferase, (B) reduced-titre AAV-BDNF, and (C) AAV-GDNF treated rats. The
distribution of TH-positive fibres was greatly affected in the control treated striatum (A) with a loss
of TH expression at the lesion centre (ii) and a condensing of the TH-positive matrix component of
the striatum in the surrounding QA-lesioned striatum (i). AAV-BDNF treated rats displayed less
disruption to the distribution of TH expression in the striatum (iii, iv), but AAV-GDNF delivery did
not induce any obvious changes compared to controls (v, vi). Dashed lines indicate the extent of
striatal disruption (middle images) and the TH-depleted core (bottom images). Scale bar = 1mm for
top images and 200µm for higher magnification images.
131
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
AAV-BDNF treated rats with the injected striatum generally displaying greater maintenance of the
normally dispersed arrangement of the TH-positive fibres within the striatal matrix, and less evident
depletion of TH proximal to the site of injection (Figure 5-24B). TH-expression in AAV-GDNF
treated rats from the initial investigation was also visually assessed given the potent trophic action of
GDNF on dopaminergic neurons (Choi-Lundberg and Bohn 1995), however the localisation of
striatal TH appeared to be disrupted by QA in a similar pattern and extent to that observed in the
control treated rats (Figure 5-24C).
To quantify the maintenance of dopaminergic striatal innervations imparted by AAV-BDNF
delivery, integrated density measurements of TH-positive staining in the treated striatum relative to
the contralateral striatum were performed. Control rats displayed an 80 ± 3% maintenance of TH
immunostaining density which was not significantly altered by the reduced-titre AAV-BDNF
treatment at 82 ± 3% TH maintenance (Figure 5-25A). The loss of striatal TH innervations showed a
significant correlation with the loss of DARPP-32 positive striatal neurons (Pearson r = 0.66, P <
0.01; Figure 5-25B). With no alteration in the overall level of TH-staining in the AAV-BDNF
treated rats despite extensive maintenance of TH distribution, and no apparent maintenance of
DARPP-32 neurons by AAV-GDNF, I did not undertake density quantification of TH-staining in the
AAV-GDNF treated striatum.
A
B
Figure 5-25 Maintenance of tyrosine hydroxylase striatal innervations
(A) Graph showing the relative density of TH-positive fibre staining in the treated striatum compared
with TH-staining intensity within the contralateral striatum. Maintenance of striatal TH was
determined by measuring the integrated density of DAB immunoreactivity in the striatum averaged
over eight equispaced coronal sections. (B) Plot displaying the correlation between the maintenance
of TH expression in the striatum and relative maintenance of DARPP-32 expressing striatal neurons.
Linear regression analysis: slope = 0.32 ± 0.09, P < 0.01. R value represents overall Pearson
correlation coefficient.
132
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.7.5
Cortical projection fibres in the striatum
A
AAV-Luciferase
Contralateral
AAV-BDNF
H
Ipsilateral
Ipsilateral
B
B
E
E
II
C
C
FF
JJ
D
D
G
G
K
K
Figure 5-26 SMI32 expression in the cortex and striatum
Representative images of SMI32 expression in the contralateral (left hemisphere) and ipsilateral
(right hemisphere) cortex and striatum following QA injection in (A,E-G) AAV-Luciferase and (HK) reduced-titre AAV-BDNF treated rats. (B,E,I) Pyramidal neurons predominantly in cortical
layers III and V overlaying the striatum appeared unaffected by QA striatal lesioning. SMI32
expression in (C,D) the intact contralateral striatum and (F,G,J,K) the AAV vector and QA treated
striatum. Regions outlined in boxes are shown at higher magnification in the figures immediately
below. Scale bar = 1mm for whole sections (A,H), 100µm for (B,E,I), 200µm for (C,F,J), 50µm for
(D,G,K).
133
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Maintenance of cortical neuronal fibres within the striatum was visualised by immunostaining for
SMI32 – a non-phosphorylated neurofilament protein – expressed by a subpopulation of pyramidal
neurons (Campbell and Morrison 1989; Gerfen 1992), which are vulnerable to HD degeneration
(Cudkowicz and Kowall 1990; Hedreen et al. 1991; Macdonald and Halliday 2002). The majority of
SMI32 positive neurons are located in layers III and V with no apparent loss of neurons observed in
the primary motor or sensory areas overlying the striatum following unilateral QA lesioning (Figure
5-26).
Distribution of SMI32 expression in the striatum was however altered following QA
lesioning. Within the intact striatum SMI32 appeared largely contained within fibres innervating the
striosome-like patches which are irregularly dispersed throughout the striatum (Figure 5-26C,D).
Following QA-lesioning of the control treated striatum, the striatal density of SMI32 staining
increased with a greater proportion of the striatal area containing SMI32 consistent with a loss of
striatal matrix and possible enlargement of the striosome compartments or fibre bundles (Figure
5-26F,G). This QA-induced alteration in striatal organisation is similar to the changes observed with
TH staining (Section 5.7.4). The expression of SMI32 was also enhanced in AAV-BDNF treated
rats in the striatum proximal to the site of QA injection with the fibres appearing larger than in the
control rats, but was less extensively increased in the more distal surrounding striatum (Figure
5-26J,K). AAV-GDNF treated rats from the initial investigation were not assessed for SMI32 due to
the lack of any apparent striatal neuroprotection.
5.7.6
Striatal projection nuclei
To investigate whether enhanced BDNF expression prior to QA lesioning of the striatum had any
bearing on neuronal maintenance in the striatal projection nuclei I performed immunocytochemistry
to identify neurons within the substantia nigra and globus pallidus. Analysis was only performed on
the control and reduced-titre AAV-BDNF treated rats from the follow-up investigation with no
evidence of any striatal neuroprotection being imparted by AAV-GDNF delivery.
5.7.6.1
Substantia Nigra
Dopaminergic neurons in the substantia nigra pars compacta region were visualised by TH
immunocytochemical staining and showed no observable differences between brain hemispheres in
either control (Figure 5-27) or AAV-BDNF treated rats (Figure 5-28). Similarly the parvalbuminpositive GABAergic neurons in the substantia nigra pars reticulata appeared to be equally unaffected
by the striatal QA lesion with visually comparable expression in each hemisphere. With the nigral
neurons not appearing to be influenced by the QA lesion I analysed the maintenance of striatonigral
axonal innervations. The projection of DARPP-32 positive fibres, originating from the vulnerable
134
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
DARPP-32 expressing striatal projection neurons, into the substantia nigra appeared to be partially
depleted in the ipsilateral nigra (Figure 5-27C and Figure 5-28C).
To quantify the loss of
striatonigral innervations I measured the density of DARPP-32 immunoreactivity in the ipsilateral
substantia nigra relative to the contralateral side of the brain (Figure 5-29A). Control rats displayed a
29 ± 3% loss of DARPP-32 immunostaining that was significantly reduced to 10 ± 5 % in AAVBDNF rats. Comparison with the relative maintenance of DARPP-32 positive neuronal cell bodies
in the striatum showed a direct correlation (Pearson r = 0.75, P < 0.001) between striatal cell bodies
and DARPP-32 immunoreactivity in the substantia nigra (Figure 5-29B).
A
Contralateral
Ipsilateral
Tyrosine Hydroxylase
B
Parvalbumin
C
DARPP-32
Figure 5-27 Visual assessment of the substantia nigra in control AAV-Luciferase treated rats
Representative images of the substantia nigra in an AAV-Luciferase treated brain displaying the
comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) TH-positive neurons in the pars compacta, (B) parvalbuminpositive neurons in the pars reticulata, and (C) DARPP-32 positive neurons and efferent fibres.
Regions outlined by boxes are shown at higher magnification in figures to the right. Scale bar =
2mm for whole sections and 200µ m for higher magnification images.
135
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Contralateral
Ipsilateral
A
Tyrosine Hydroxylase
B
Parvalbumin
C
DARPP-32
Figure 5-28 Visual assessment of the substantia nigra in reduced-titre AAV-BDNF treated
rats
Representative images of the substantia nigra in a reduced-titre AAV-BDNF treated brain displaying
the comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) TH-positive neurons in the pars compacta, (B) parvalbuminpositive neurons in the pars reticulata, and (C) DARPP-32 positive neurons and efferent fibres.
Regions outlined by boxes are shown at higher magnification in figures to the right. Scale bar =
2mm for whole sections and 200µ m for higher magnification images.
136
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A
B
Figure 5-29 DARPP-32 innervations of the substantia nigra
(A) Graph showing the density of DARPP-32 immunoreactivity within the substantia nigra,
ipsilateral to the treated striatum, as a proportion of DARPP-32 immunostaining in the contralateral
substantia nigra. DARPP-32 density was measured on three coronal sections through the substantia
nigra. (B) Plot displaying the correlation between DARPP-32 positive fibre innervations of the
substantia nigra and maintenance of the DARPP-32 positive striatal neurons. * Un-paired t-test
P < 0.01. Deming linear correlation: slope = 0.70 ± 0.15, P < 0.001. R value represents overall
Pearson correlation coefficient.
5.7.6.2
Globus Pallidus
Pallidal neurons were visualised by immunostaining for parvalbumin and NeuN with a clear loss of
neurons seen within the ipsilateral globus pallidus of AAV-Luciferase treated control rats (Figure
5-30A,B). AAV-BDNF treated rats did not generally have any obvious loss of pallidal neurons
(Figure 5-31A,B). Additional staining for DARPP-32 showed the mostly intact caudal region of the
striatum adjacent to the globus pallidus remained mostly intact, but displayed reduced DARPP-32
immunoreactivity in the globus pallidus compared with the contralateral hemisphere for both control
(Figure 5-30C) and AAV-BDNF treated rats (Figure 5-31C).
With parvalbumin positive neurons in the globus pallidus clearly affected by the QA lesion in some
rats, I performed stereological estimates over four equispaced coronal sections through the pallidus
(Stereology coefficient of error ≤ 0.09). In contrast to all other analysis parvalbumin-positive
neurons in the globus pallidus showed a significant difference between the AAV-Luciferase and PBS
control groups (t-test P < 0.01; Figure 5-32A). AAV-Luciferase animals were massively depleted of
parvalbumin neurons in the globus pallidus with only 15 ± 8 % maintained relative to the
contralateral hemisphere while the PBS group had 87 ± 18 % maintenance. The parvalbuminpositive pallidal neurons were mostly maintained in the AAV-BDNF treated group (96 ± 10 %).
There was no significant correlation between the survival of DARPP-32 positive striatal neurons and
the parvalbumin expressing pallidal neurons (Pearson r = 0.42, P = 0.07; Figure 5-32B).
137
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Contralateral
Ipsilateral
Parvalbumin
A
NeuN
B
DARPP-32
C
Figure 5-30 Visual assessment of the globus pallidus following AAV-Luciferase treatment
Representative images of the globus pallidus in a control AAV-Luciferase treated brain displaying
the comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) parvalbumin-positive pallidal neurons, (B) NeuN-positive
neurons, and (C) DARPP-32 immunoreactivity. Dashed lines indicate the boundary between the
striatum and globus pallidus. Scale bar = 250µm.
138
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Contralateral
Ipsilateral
Parvalbumin
A
NeuN
B
DARPP-32
C
Figure 5-31 Visual assessment of the globus pallidus following reduced-titre AAV-BDNF
treatment
Representative images of the globus pallidus in a reduced-titre AAV-BDNF treated brain displaying
the comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) parvalbumin-positive pallidal neurons, (B) NeuN-positive
neurons, and (C) DARPP-32 immunoreactivity. Dashed lines indicate the boundary between the
striatum and globus pallidus. Scale bar = 250µm.
139
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
A
B
Figure 5-32 Survival of parvalbumin-positive neurons in the globus pallidus
(A) Graph displaying the relative proportions of parvalbumin-immunopositive neurons surviving in
the globus pallidus as estimated by optical fractionator stereology on four coronal sections through
the globus pallidus. (B) Plot comparing the survival of parvalbumin-positive neurons relative to the
maintenance of DARPP-32 positive striatal neurons. * Un-paired t-test P < 0.01. R value represents
overall Pearson correlation coefficient, P = 0.07.
5.7.7
Pathological correlations with functional behaviour
impairments
To assess whether there were significant correlations between the functional behavioural
impairments and the loss of striatal neurons or pallidal neurons I analysed overall Pearson
correlations and individual treatment group linear relationships for each of the behavioural tests
undertaken in the follow-up, reduced-titre AAV-BDNF investigation.
Due to the significant
maintenance of parvalbumin-expressing pallidal neurons in PBS controls compared with the loss in
AAV-Luciferase treated rats I have separately identified whether rats received PBS or AAVLuciferase in the correlations against pallidal neurons but not for striatal DARPP-32 correlations
where there was no significant difference between the groups. The PBS and AAV-Luciferase treated
rats were still combined as a single control group to assess for linear relationships as they did not
perform differently as two distinct groups in any of the functional behavioural assessments.
5.7.7.1
Spontaneous Ipsilateral Forelimb Use Bias
The proportion of exploratory behaviour undertaken by the rats with their ipsilateral forelimb
following QA injection was found to be significantly correlated with the loss of DARPP-32 positive
neurons in the striatum (Pearson r = -0.49, P < 0.05; Figure 5-33A). However, with the prior
delivery of AAV-BDNF attenuating development of an ipsilateral forelimb use bias, independent
140
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
analysis for a linear trend between DARPP-32 maintenance and ipsilateral asymmetry score
indicated that the extent of ipsilateral bias in AAV-BDNF treated rats was not greatly influenced by
the loss of DARPP-32 positive striatal neurons. This was in contrast to the strong linear relationship
between the loss of DARPP-32 striatal neurons and ipsilateral forelimb use in the control group (P <
0.001). Exploratory ipsilateral forelimb use in the AAV-BDNF treated rats did however appear to be
strongly linked to the ipsilateral:contralateral ratio of parvalbumin-positive neurons in the globus
pallidus (Linear regression P < 0.01) with a 1:1 ratio correlating with a non-biased 52 ± 2 %
ipsilateral asymmetry score (Figure 5-33B).
Overall though the maintenance of parvalbumin-
positive pallidal neurons did not significantly correlate with the ipsilateral asymmetry score (Pearson
r = -0.39, P = 0.10) with the control rats displaying preferential ipsilateral forelimb use independent
from the relative number of parvalbumin positive neurons in the globus pallidus (P = 0.518).
A
B
Figure 5-33 Preferential forelimb use correlation with striatum and globus pallidus cell loss
Plots correlating the extent of ipsilateral forelimb use bias with the relative proportion of (A)
DARPP-32 and (B) parvalbumin-positive neurons remaining within the striatum and globus pallidus
respectively. Data points represent individual rats’ average score over the seven post-QA trials.
R values represent overall Pearson correlation coefficients independent of treatment. Solid lines
represent significant non-zero linear correlations (P < 0.05) and the dotted lines non-significant linear
trends for individual treatment groups. Comparison with controls: (A) slope P = 0.14; elevation P <
0.001; (B) slope P = 0.001.
5.7.7.2
Contralateral Sensorimotor Neglect
Preferential retrieval of sugar pellets from the side of the corridor adjacent to the rats treated brain
hemisphere was significantly correlated with the anatomical state of the globus pallidus (Pearson r =
-0.68, P < 0.01) but not the extent of DARPP-32 striatal cell loss (Pearson r = -0.41, P = 0.08; Figure
5-34A).
Maintenance of parvalbumin-positive pallidal neurons appeared to contribute towards
141
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
attenuating development of a contralateral sensorimotor neglect following QA injection. Individual
AAV-BDNF and control group assessment for linear relationships indicated that this sensorimotor
neglect correlation with pallidal neurons was stronger for AAV-BDNF treated rats (Linear trend
slope = -63 ± 14, P < 0.0001) than the control rats (slope = -19 ± 5, P < 0.001; Figure 5-34B). While
there was not overall a significant correlation with the DARPP-32 striatal neurons, the percentage of
ipsilateral retrievals made by control rats did display a significant linear relationship with the loss of
DARPP-32-positive striatal neurons (slope = -77 ± 19, P < 0.01; Figure 5-34A). AAV-BDNF treated
rats did not show any relationship between attenuation of preferential ipsilateral retrievals and the
gross maintenance of DARPP-32-positive striatal neurons.
A
B
Figure 5-34 Sensorimotor neglect correlation with striatal and pallidal neuronal cell loss
Plots correlating the percentage of ipsilateral sugar pellet retrievals made in the “corridor” task with
the relative proportion of (A) DARPP-32 and (B) parvalbumin-positive neurons maintained within
the striatum and globus pallidus respectively. Data points represent individual rats’ average retrieval
preference over the four post-QA trials. R values represent overall Pearson correlation coefficients
independent of treatment. Solid lines represent significant non-zero linear correlations (P < 0.05)
and the dotted lines non-significant linear trends for individual treatment groups. Comparison with
controls: (A) slope P < 0.05; (B) slope P < 0.01.
5.7.7.3
Apomorphine-Induced Rotations
Apomorphine-induced rotational behaviour did not display any overall correlation with DARPP-32positive striatal cell loss (Pearson r = -0.32, P = 0.19; Figure 5-35A). Separate linear trend analysis
with the individual groups also failed to show any significant correlations for either the AAV-BDNF
rats (P = 0.069) or control rats (P = 0.86). In contrast, comparison of apomorphine-induced rotations
with parvalbumin-positive neurons in the globus pallidus did reveal a significant correlation with the
maintenance of pallidal neurons (Pearson r = -0.66, P < 0.01; Figure 5-35B). This correlation was
142
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
very significant for the control treated rats (Linear trend P < 0.001), but not for the AAV-BDNF
treated rats (P = 0.07) although both treatment groups showed similar trends. The direction of
apomorphine-induced rotation also appeared to be strongly dependent on the integrity of the globus
pallidus with a loss of pallidal neurons resulting in rotational behaviour towards the lesioned side,
while apomorphine induced the rats to rotate contralaterally away from the lesioned brain
hemisphere when the globus pallidus was fully maintained (Figure 5-35B).
A
B
Figure 5-35 Correlation of apomorphine-induced rotational behaviour with striatal and
pallidal neuronal cell loss
Plots displaying the percentage of apomorphine-induced rotations in an ipsilateral direction in
relation to the maintenance of (A) DARPP-32 and (B) parvalbumin-positive neurons within the
striatum and globus pallidus respectively. Each data point represents the result of a single post-QA
trial with three trials conducted per rat. Shaded boxes show the predominant contralateral rotational
behaviour when the relative number of parvalbumin pallidal neurons is greater in the treated
hemisphere and preferential ipsilateral rotations when the globus pallidus is compromised. R values
represent overall Pearson correlation coefficients independent of treatment. Solid lines represent
significant non-zero linear correlations (P < 0.05) and the dotted lines non-significant linear trends
for individual treatment groups. AAV-BDNF treatment did not significantly alter the linear
correlations observed in the control rats.
143
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.8 Discussion
Through these preventative in vivo studies I investigated the pathological and functional impact of
increasing the availability of neurotrophic factors using AAV vectors to establish continuous
expression of either BDNF or GDNF within the striatum prior to challenging the striatal neurons
with QA-administered excitotoxicity. While the protective effects of neurotrophic factors have been
previously studied in models of Huntington’s disease with varying degrees of success (Section 1.6),
the ongoing development and advances in gene transfer technologies make additional investigation
necessary to enhance our understanding of both delivery vectors and potential gene-based
therapeutics in an in vivo research setting. Stereotype-2 AAV vectors used in many early AAV gene
transfer studies have significantly lower efficiency of neuronal transduction than the chimeric 1/2
serotype vectors used in these investigations. Using behaviour tests to measure functional motor
deficits consequential of an interhemispherical imbalance in the integrity of motor and sensorimotor
neuronal processing in unilaterally treated rats, I endeavoured to correlate the prevention of physical
symptomatic impairments with the maintenance of basal ganglia anatomical organisation provided
by the prior intrastriatal delivery of the AAV-BDNF or AAV-GDNF vectors.
5.8.1
AAV-mediated BDNF or GDNF expression prior to QA
The AAV1/2 vectors I constructed – containing cDNA sequences for BDNF or GDNF under the
control of a constitutive CBA promoter and WPRE sequence – provided an efficient mechanism for
establishing high-level neurotrophic factor expression in the CNS.
Spread of the AAV vector
transduction throughout the rodent striatum following a single injection appeared reasonably
extensive in the majority of cases although somewhat irregular in its penetration resulting in patches
of intensive expression and other areas with few or no transduced cells. With the neurotrophic
factors being secreted from transduced cells, the uneven spread of transduction was not immediately
concerning as the non-transduced striatal neurons were still likely to be exposed to an increased level
of BDNF or GDNF as the neurotrophic factors were released, diffusing away from the transduced
cells.
5.8.1.1
Undiluted AAV-BDNF
Following the development of seizures, hyperactivity and continuous weight loss in some of the
AAV-BDNF treated rats, evident five weeks after AAV-BDNF vector delivery and forcing early
termination of the BDNF portion of the study, I had to reassess the delivery procedure for this vector.
144
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
No welfare concerns were raised with any of the other AAV vectors, and with the delayed onset the
deleterious effects were most likely due specifically to the BDNF expression. BDNF has previously
been implicated in seizure severity, thought to be modulated via BDNF activity in the entorhinal
cortex and hippocampus (Scharfman 1997; Croll et al. 1999). Additionally BDNF can act as an
appetite suppressor causing weight loss following ventricular infusion (Pelleymounter et al. 1995),
and positively regulates locomotor activity (Kernie et al. 2000) which is consistent with the effects I
observed. With the massive escalation in striatal BDNF levels following undiluted AAV-BDNF
delivery, and with observed anterograde transport of the AAV-BDNF vector to striatal projection
nuclei, it is probable that the availability of BDNF was also enhanced in other regions of the rodent
brain including the entorhinal cortex which projects efferent fibres to the striatum. Retrograde
transport of AAV-vectors to the entorhinal cortex has also been previously shown to occur (Kaspar et
al. 2002).
Analysis of the transgenic BDNF expression in the striatum showed an inverse correlation with
DARPP-32 expression suggesting the intensive BDNF expression was detrimentally impairing the
functionality of transduced striatal neurons, but in direct contrast was supplying neuroprotective
support to the neighbouring DARPP-32 positive neurons. While I did not conclusively determine
whether this loss of DARPP-32 expression was due to a BDNF-induced down regulation of
expression or an enhanced susceptibility of transduced neurons to QA-induced excitotoxicity, the
persistence of HA-expressing cell bodies in the striatum and their co-labelling with krox-24 indicates
survival – and presumed functional activity – of a population of BDNF expressing striatal neurons
four weeks post-QA. Given the neuronal preference of the AAV1/2 vectors, and the normally high
expression of DARPP-32 by striatal projection neurons (Ouimet et al. 1984; Ouimet et al. 1998), it is
reasonable to assume that the vast majority of AAV-BDNF transduced striatal cells would have been
expressing DARPP-32 at the time of transduction, prior to being challenged with QA. Striatal
neurons transduced by AAV-GDNF or AAV-Luciferase also lacked DARPP-32 expression at the
conclusion of the study. While some of the transduced neurons may well have been non-DARPP-32
expressing interneurons that were spared by QA-lesioning, the majority are likely to have been
striatal projection neurons indicating a disruption of DARPP-32 expression, not specific to transgene
expression, following AAV vector transduction. Given this apparent down-regulation of DARPP-32
expression in transduced striatal neurons, the use of DARPP-32 as a marker of striatal projection
neurons to quantify BDNF and GDNF-derived support against QA-induced cell death will have lead
to an underestimation of the actual number of surviving neurons. This may have contributed to the
lack of a significant increase in the stereologically estimated striatal neurons maintained in AAVBDNF treated rats relative to the control rats despite visually distinguishable areas of protected
145
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
neurons and the complete preservation of striatal volume (Section 5.7.1). However, functional
implications of DARPP-32 down-regulation will need serious consideration given the central role of
DARPP-32 in mediating intracellular signalling of both dopamine and glutamate in the
dopaminoceptive striatal projection neurons (Greengard et al. 1999). A reduction in DARPP-32 has
been reported in presymptomatic HD mice and may be a contributing factor to HD pathogenesis
(Bibb et al. 2000).
Despite the non-significant maintenance of DARPP-32 positive neurons in the striatum, extensive
BDNF expression in the initial investigation ameliorated the development of QA-induced ipsilateral
forelimb use bias with the rats actually tending to favour their contralateral forelimb.
The
preservation / enhancement of forelimb motor control suggests a possible augmentation of brain
function due to increased BDNF expression that was independent of actual neuronal cell
maintenance in the striatum. Together these observations suggested that despite serious detrimental
effects on the rats’ welfare and the potentially detrimental alterations to the function of transduced
neurons, BDNF could still offer both neuroprotective support to striatal neurons against excitotoxic
insult and prevent associated behavioural deficits. Provided BDNF delivery can be sufficiently
regulated to limit the spread and control the level of expression it could well be of therapeutic
benefit, and therefore I felt that AAV-mediated BDNF expression warranted further investigation.
5.8.1.2
AAV-GDNF
The delivery of AAV-GDNF and subsequent rise in striatal GDNF availability from normally very
low expression levels in the adult striatum (Schaar et al. 1993; Springer et al. 1994; Choi-Lundberg
and Bohn 1995) imparted significant attenuation of the ipsilateral forelimb use bias that developed in
control rats following QA lesioning. The contrasting development of a contralateral forelimb use
bias as seen in the AAV-BDNF treated rats was not however recorded in analysis of AAV-GDNF
treated rats, suggesting that the maintenance of forelimb motor control provided by AAV-GDNF was
probably mediated via a different signalling pathway than the AAV-BDNF effects. Apomorphineand amphetamine-induced rotational behaviour did not appear greatly altered from the performance
of control rats, with the AAV-GDNF treated rats preferentially displaying unidirectional rotations,
usually towards the QA injected striatal hemisphere.
Despite the maintenance of forelimb motor control, AAV-GDNF delivery prior to QA did not
enhance the resistance of DARPP-32 positive striatal projection neurons, supporting the observation
of the drug-induced rotational testing. This lack of neuroprotection was in contrast to my earlier
findings of partial protection of striatal neurons following transduction with a lower expression level
AAV2-GDNF vector (Kells et al. 2004) and other reports of AAV-mediated GDNF delivery in the 3146
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
NP mitochondrial toxin (McBride et al. 2003) and N171-82Q genetic models of HD (McBride et al.
2006), but in agreement with Popovic and colleagues (2005) who reported no attenuation of
behavioural or neuropathological changes in R6/2 Huntington mice following LV vector-mediated
GDNF expression. Given these previous results the lack of AAV-GDNF derived neuroprotection
against QA-induced excitotoxicity was unexpected. I had hypothesised that the enhanced neuronal
transduction efficiency of the new chimeric AAV1/2 vector, and higher CBA promoter driven GDNF
expression, would increase GDNF-derived support of the striatal neurons. A common factor in the
studies which have demonstrated GDNF expression-derived protection is the assessment of NeuN
immunoreactivity (McBride et al. 2003; Kells et al. 2004; McBride et al. 2006), in contrast to the
DARPP-32 expression used in both the LV-GDNF study (Popovic et al. 2005) and current analysis
to quantify neuroprotection, raising the possibility that the neurons may survive but with altered
phenotype / functionality. Alternatively the conflicting findings with GDNF may reflect the different
processes of striatal cell loss between neurotoxins – excitotoxic QA versus mitochondrial inhibitor 3NP – or genetic models – R6/2 (Hdh exon-1 with 150 CAG repeats) versus N171-82Q (Hdh Nterminal with 82 CAG repeats) – of HD. The 3-NP and N171-82Q models display a more protracted
development of behavioural impairments and pathological changes suggesting a less intensive insult
that may be better counteracted by GDNF.
A further explanation of these differential GDNF
findings could be the extent of transduction and / or the production of GDNF with the more efficient
AAV1/2 and LV vectors potentially generating GDNF that exceeds therapeutically beneficial levels.
Direct comparisons of the quantity of GDNF expression between studies was unfortunately not
possible due to differences in the quantification protocols and in the reporting of transgene
expression, however in my earlier investigations with AAV2-GDNF (Kells et al. 2004) the transgenic
expression of GDNF was considerably lower [Unpublished data]. A recent study by Eslamboli et al.
(2005) reported extensive protection of dopaminergic nigral neurons and attenuation of behavioural
deficits following low-level GDNF expression in the primate striatum (three- to four-fold increase)
prior to 6-hydroxydopamine modelling of Parkinson’s disease. High levels of striatal GDNF were
shown to bilaterally increase TH and dopamine turnover causing a reduction in striatal dopamine
(Eslamboli et al. 2005), and have also been reported to increase the loss of striatal neurons following
ischemic stress (Arvidsson et al. 2003).
In reassessing the expression pattern of GDNF within the striatum it became apparent that large
numbers of GDNF expressing cells were still present within the striatum following QA injection
suggesting they had in fact received protection against QA-induced cell death. On correlating the
location of these surviving AAV-GDNF transduced striatal cells to the area of QA-lesioning, defined
by DARPP-32 immunoreactivity, it was evident that the majority of HA-positive cells resided in
147
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
areas largely devoid of DARPP-32 expression. Additional correlation with the general neuronal
marker NeuN displayed a similar lack of immunopositive cells in the region of HA staining, although
NeuN cells appeared more prevalent than DARPP-32 positive cells (Section 5.7.1.1). Furthermore,
double-immunofluorescent labelling of the AAV-GDNF treated striatum revealed only minimal colabelling of HA and DARPP-32 positive cells displaying a down-regulation of DARPP-32 in the
HA-positive GDNF expressing cells (Section 5.7.3). The loss of DARPP-32 is highly likely to affect
neurotransmitter signalling (Section 5.8.1.1 and 7.1). It therefore appeared that while many AAVGDNF transduced neurons did actually survive QA-induced excitotoxicity, the expression of their
usually dominant signalling proteins used as identification markers were severely compromised.
How this alteration in protein expression influences the functionality of the striatal neurons was not
specifically investigated but highlights the need for caution and assessment of host cells
physiological functions following in vivo gene transfer to direct production of a bioactive therapeutic
molecule. Stereological analysis of NeuN-immunopositive striatal neurons may possibly have better
estimated the proportion of striatal neurons maintained, although from the lack of correlation in
immunostaining it appeared that NeuN may also have been down-regulated in the AAV-GDNF
transduced cells by the end-point of the investigation – 11-weeks post AAV-GDNF delivery.
Although not quantified, TH staining in the striatum – indicative of dopamine innervations –
following QA-lesioning did not appear to be altered by the enhanced GDNF expression. However
the dopamine neurons in general are not affected by QA lesioning and therefore any TH-positive
fibre sprouting induced by GDNF – as reported following striatal GDNF expression in animal
models of Parkinson’s disease (Rosenblad et al. 2000; Kirik et al. 2000a; Georgievska et al. 2002) –
may simply not be visibly discernable.
Therefore, although indirect evidence suggested that AAV-GDNF delivery imparted neuroprotective
support to transduced striatal neurons, continuous high-level GDNF expression appeared to cause
alterations in neuronal processes. Despite the fact that I was not aware of any adverse alterations in
the rats behaviour during the extended period of functional behavioural testing – actually observing
maintenance of forelimb motor control – the changes in protein expression patterns are likely to
ultimately result in disruption to neuronal function, potentially negating any benefits of initial AAVGDNF derived neuroprotective support. While better regulation of the GDNF expression may well
circumvent some of these undesired effects, I opted against proceeding further with investigation of
this AAV-GDNF vector in the QA lesion model of HD. However it is possible that a significantly
lower level of GDNF expression maybe beneficial (Eslamboli et al. 2005), and that the extensive
expression I induced exceeded tolerable quantities for a region that has a very low level of
endogenous GDNF expression in adulthood (Springer et al. 1994; Choi-Lundberg and Bohn 1995).
148
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.8.2
Reduced-titre AAV-BDNF behavioural and pathological
protection
Continuing investigation with delivery of the AAV-BDNF vector, I elected to shift the striatal
injections site away from the same stereotaxic coordinates as the QA injection and split the vector
delivery over two stereotaxic sites flanking the QA injection site in an attempt to even out the striatal
distribution of transduced cells. To minimise any toxicity associated with AAV-BDNF transduction
I also diluted the vector ten-fold to reduce the multiplicity of transduction and thereby decrease the
intensity of BDNF expression per transduced cell. This reduced the enhanced expression level of
BDNF in the striatum from ~1000-times endogenous expression to a ~150-fold increase at the time
of QA administration, and prevented the previously observed weight-loss and seizure development.
Visual assessment of AAV-BDNF transduced cells showed extensive transduction of neurons around
the site of injection, but significantly less spread than the undiluted vector injections. To more fully
assess the AAV-BDNF delivery on functional behaviour – without the confounding impact of a QA
lesion – I additionally assessed a smaller cohort of reduced-titre AAV-BDNF treated rats for 11weeks post-AAV vector delivery in parallel with the main neuroprotective investigation.
5.8.2.1
Behavioural Protection
Prior to QA-lesioning rats that received reduced-titre AAV-BDNF showed an enhanced tendency to
use their contralateral forelimb for initiating exploratory movement and the induction of ipsilateral
rotational behaviour following apomorphine administration, compared with unbiased lateralised
behaviour of the control rats. While this behaviour was similar to that observed in the initial hightitre AAV-BDNF study, the slight preferential use of the contralateral forelimb did not develop into a
strong contralateral bias in either the QA-lesioned or non-lesioned rats with both groups remaining
insignificantly altered from baseline analysis in contrast to the ipsilateral bias in control rats and
contralateral bias in the initial BDNF study (Section 5.6.1). While not significantly different, the two
AAV-BDNF treated groups were separated after the main group received a QA injection inducing a
small shift towards greater use of their ipsilateral forelimb, while the non-QA injected rats
maintained slightly greater contralateral forelimb use, although neither AAV-BDNF treated group
could be considered to have a significant forelimb use bias. These results suggested that while the
expression of BDNF may provide some enhancement of basal ganglia coordinated motor control, the
lack of a significant contralateral usage in the absence of striatal cell death implies AAV-BDNF
derived amelioration of QA induced ipsilateral forelimb bias is unlikely to be solely attributed to
149
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
BDNF activity compensating for the loss of striatal cell loss, but involve the maintenance of
functional striatal projection neuron circuitry by BDNF.
The transient display of apomorphine-induced ipsilateral rotational behaviour initially following
AAV-BDNF delivery, before predominantly switching to induce contralateral rotations in both QA
lesioned and non-QA lesioned rats (Section 5.6.2.1), suggests that BDNF expression causes opposing
short and long-term actions. QA striatal lesioning of control rats caused a loss of dopaminoceptive
projection neurons, generally resulting in ipsilateral rotations following either apomorphine or
amphetamine administration. Therefore enhanced BDNF expression appeared to be acting long-term
to enhance dopamine activity, but initially resulted in impairment to the striatal neurons ability to
process dopamine signalling. With apomorphine directly stimulating both D1 and D2 dopamine
receptors (Arnt and Hyttel 1985), rotational behaviour was most probably mediated through
alterations in the expression of dopamine receptors by surviving striatal neurons, thereby making the
results of drug-induced rotational testing difficult to conclusively assess in regards to any direct
neuroprotective support provided by AAV-BDNF. However this does further highlight challenges
facing the use of neurotrophic factors as therapeutic agents with widespread neurotrophic factor
receptor expression and multiple signalling pathways creating a high potential for inducing nontargeted effects that clearly need consideration prior to any clinical investigation.
BDNF has previously been shown to enhance dopamine activity by increasing both the striatal
release and turnover of dopamine (Altar et al. 1992b; Altar et al. 1994), and induces behavioural
changes indicative of increased dopamine activity (Martin-Iverson et al. 1994; Martin-Iverson and
Altar 1996). More recently though, BDNF has been shown to positively-regulate the expression of
post-synaptic D3 dopamine receptors in the striatum (Guillin et al. 2001), suggesting that the
unilateral delivery of BDNF may have resulted in sensitisation of the surviving striatal neurons to
dopamine agonists, thereby counteracting any QA-induced deficiency in motor effector output.
Therefore the initial dysfunction following AAV-BDNF delivery may have been consequential of a
rapid increase in striatal BDNF levels causing functional disruption or desentisation of the dopamine
receptors. Dopamine has been proposed to actually contribute to the degeneration of striatal neurons
such that a sudden increase in BDNF-induced dopamine release, without a corresponding increase in
dopamine uptake, may initially cause neuronal dysfunction (Filloux and Townsend 1993; Hastings et
al. 1996; Hattori et al. 1998). Dopamine toxicity may also have been a contributing factor to the
deleterious effects in the initial high-expression AAV-BDNF investigation. Another contributing
factor may be the involvement of TrkB receptors which are likely to have been down-regulated at
some stage following continuous enhancement of BDNF expression (Frank et al. 1996).
150
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Additional evidence of AAV-BDNF delivery supplying neuroprotective support resulting in
attenuation of functional impairments was observed in the “corridor” task assessment of
sensorimotor neglect. The reduced-titre AAV-BDNF delivery completely prevented acquirement of
the contralateral sensorimotor neglect observed following QA injection in control rats (Section
5.6.3). Although the non-lesioned and QA lesioned groups of AAV-BDNF treated rats did not
significantly differ in their “corridor” task performance, the AAV-BDNF delivery alone did
significantly change the non-lesioned rats’ preferential food retrieval from a slight baseline
contralateral preference towards development of a slight contralateral neglect.
This tended to
suggest that AAV-BDNF delivery attenuated the acquirement of contralateral sensorimotor neglect
through protection against QA-induced alterations and not via BDNF-induced enhancement of other
compensatory mechanisms as suggested by the apomorphine-induced rotations.
5.8.2.2
Neuropathological Protection
Despite significant attenuation of behavioural deficits, analysis of neuronal survival following AAVBDNF delivery revealed only limited enhancement of striatal maintenance, compared with the
control treated rats. Maintenance of krox-24 expressing striatal neurons was significantly enhanced
with a 36% increase in neuron survival following AAV-BDNF delivery; however the parallel
analysis of DARPP-32 positive neurons did not quite reach significance despite a similar 38%
average increase in the relative number of DARPP-32-positive cells. The lack of significance due to
greater variation in the quantification of DARPP-32 neurons is likely to have arisen from the downregulation of DARPP-32 or the less distinct immunostaining of cytoplasmic DARPP-32, compared
with the krox-24 nuclear staining, making the striatal neurons more difficult to visually discern
against the positive staining of dendritic processes. Co-labelling of the BDNF expressing transduced
neurons with DARPP-32 and krox-24 still displayed inverse staining intensities, although krox-24
was detectable in most HA-positive cells and the majority also appeared to display some DARPP-32
expression.
While a small enhancement of cellular survival could potentially lead to an observable prevention of
behavioural deficits in this QA-lesion model of HD, I felt that the quantified partial protection of
striatal neurons supplied by AAV-BDNF was unlikely to have been solely responsible for the
amelioration of functional impairments. Coupled with the maintenance of striatal projection neurons
I observed that atrophy of the striatum was significantly reduced in the AAV-BDNF treated rats
(Section 5.7.1.4), suggesting that the structural organisation of the striatum was protected against
QA-induced excitotoxicity by BDNF, possibly to a greater extent than individual striatal neurons.
Therefore I propose that the functionality of the striatum in regard to the assessed motor coordination
151
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
tasks is more reliant on structural organisation than the total number of striatal projection neurons,
and that AAV-BDNF by enhancing the maintenance of this structural architecture, in addition to
providing individual neurons with greater resistance against QA, was able to ameliorate the
behavioural deficits. The striatum is topographically organised with the sensory and motor areas of
the neocortex projecting to the striatum in a highly organised but overlapping longitudinal
arrangement (McGeorge and Faull 1989).
Therefore overall preservation of this structural
arrangement, with a reduction in neuronal density but without areas of total projection neuron loss,
may well attenuate the severity of behavioural deficits.
Further analysis revealed that preservation of substantia nigra innervations by striatonigral DARPP32 positive fibres was significantly enhanced by AAV-BDNF, with the nigral neurons themselves
not appearing to be greatly affected by the striatal lesion (Section 5.7.6.1).
Maintenance of
striatonigral projections was correlated with the maintenance of DARPP-32 positive neurons in the
striatum. Despite no apparent loss of dopaminergic neurons in the substantia nigra pars compacta I
assessed dopaminergic innervations of the striatum by measuring the density of TH-immunostaining
to try and determine if maintenance of dopamine input may have been responsible for the reduced
severity of behavioural impairments. While the integrated density measurements indicated equal loss
of TH-positive fibres in the striatum averaging ~19% reduction relative to the contralateral striatum
across all rats following QA lesioning, the control rats visually displayed intensification of the THpositive fibres from the dispersed matrix into defined tracts interwoven around TH-negative patches
(Section 5.7.4). Prior AAV-BDNF delivery attenuated this apparent atrophy of the striatal matrix,
with TH-staining remaining diffusely distributed throughout the striatum, indicating a general
maintenance of the striatal architecture by BDNF.
Further evidence for preservation of the
striosome-matrix arrangement following AAV-BDNF delivery was provided by visual assessment of
the neurofilament protein SMI32 expression in the striatum – presumed to be contained within
afferent projections of the SMI32-positive pyramidal neurons in the motor and sensory cortex
(Section 5.7.5).
Localised to striosome-like patches, SMI32 appeared to be greatly enhanced
following QA lesioning possibly due to fibre sprouting or structural rearrangement occurring within
these afferent corticostriatal fibres following the death of their target striatal neurons. While SMI32
expression was greatly enhanced across a substantial proportion of the striatum in control rats, with
an accompanying increase in the density of striosomes, AAV-BDNF treated rats generally only
displayed an increased intensity of SMI32 directly proximal to the QA injection site. A smaller
enhancement of SMI32 following BDNF expression is possibly indicative of less fibre sprouting due
to a greater maintenance or re-establishment of synaptic connections in the striatum following QA
lesioning.
152
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
Pallidal neurons, in contrast to those in the substantia nigra, were subjected to QA induced
neurotoxicity although this was highly variable with the two control groups displaying significantly
contrasting levels of parvalbumin-positive neuronal maintenance (Section 5.7.6.2). A reason for
these opposing results was undetermined with no correlation to the extent of DARPP-32 loss in the
striatum. While it is possible that chance variation in the positioning of the QA lesion could have
contributed to the opposing observations given the small group sizes, the influence of AAVLuciferase transduction or Luciferase expression making these pallidal neurons more vulnerable to
neurotoxic insult cannot be discounted. Negative impacts of marker proteins have previously been
reported (Detrait et al. 2002; Krestel et al. 2004), possibly due to intensive expression of a foreign
protein that may cause cellular stress through disruption of degradation mechanisms or accumulation
to toxic levels – especially over extended periods of expression. An empty DNA expression cassette
may provide a more valid control for AAV vector transduction. With only five rats in each control
group and reasonably high amounts of variability with the QA lesion – demonstrated here with only
one of the five PBS rats having extensive pallidal cell loss – I was unable to reliably draw any
conclusions regarding the vulnerability of the pallidal neurons although it was important to consider
their maintenance in respect to the striatal output via the globus pallidus and the impact that it has on
motor control in the behavioural testing.
5.8.2.3
Pathological and Behavioural Correlations
To investigate whether there was any association between the quantified maintenance of the basal
ganglia nuclei and the observed amelioration of functional deficits I performed correlation analysis
between the results of each behavioural test and the relative maintenance of DARPP-32 striatal
neurons and parvalbumin-positive pallidal neurons (Section 5.7.7). The loss of DARPP-32 striatal
neurons showed significant correlation with reductions in the striatal area, TH striatal density and
DARPP-32 fibre innervations of the substantia nigra, although none of these were reduced to the
same extent as striatal neuron loss. Therefore I choose to directly compare the functional behaviour
with the relative DARPP-32 positive cell maintenance, with the assumption that any correlations
would also be reflected in these related structures. Separate correlations with parvalbumin-positive
neurons in the globus pallidus were analysed due to the lack of any apparent correlation with the
maintenance of striatal neurons (Section 5.7.6.2). As the behavioural tests are designed to assess an
imbalance in functional control between the brains two hemispheres I performed all correlations
against the ratio of neurons remaining in the treated hemisphere compared to the contralateral untreated hemisphere despite the possibility that the contralateral hemisphere may not be entirely
unaffected by the AAV-vector delivery or QA lesion. I did not however observe any indications of
153
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
the contralateral hemisphere being influenced in any of the immunocytochemical analysis; although
transduction of cortical neurons may have caused a small enhancement in striatal BDNF due to the
bilateral projections of cortical neurons (McGeorge and Faull 1989).
Both the development of spontaneous ipsilateral forelimb use bias and contralateral sensorimotor
neglect showed a positive correlation with the severity of striatal lesioning in the control rats as
expected. However with only partial protection of the striatum, the reduced severity of behavioural
deficits exhibited by the AAV-BDNF treated rats did not directly reflect maintenance of the striatum
but instead correlated with the relative maintenance of parvalbumin expressing pallidal neurons. A
correlation with the maintenance of the globus pallidus was also observed in the control rats
development of sensorimotor neglect but not spontaneous ipsilateral forelimb use; possibly
indicating the greater executive function required in processing the sensory information and making
a left / right selection in the “corridor” task. AAV-BDNF treated rats that had a loss of parvalbuminexpressing pallidal neurons were observed to develop ipsilateral forelimb use equivalent to that seen
in control rats with similar striatal cell loss, suggesting that the overall AAV-BDNF amelioration of
the behavioural impairments was potentially the result of a dynamic interaction between maintenance
of the striatal anatomical structure / organisation and striatal output via the globus pallidus. The
inducement of rotational behaviour following apomorphine administration also reflected the integrity
of the globus pallidus with rats that had no loss of parvalbumin-positive neurons preferentially
rotating away from the lesioned striatum, while ipsilateral rotations were generally induced post-QA
lesioning when the ipsilateral globus pallidus exhibited neuron loss.
Although I was unable to determine whether AAV-BDNF delivery provided any direct
neuroprotective support to the pallidal neurons in this investigation, the significant correlations
between the maintenance of striatal neurons and attenuation of behavioural deficits was indicative of
BDNF-derived trophic support mitigating the extent of disruption to functional behaviour. Given the
evidential requirement for pallidal neurons to facilitate normal sensorimotor behaviour, it is probable
that efferent striatal projections to the globus pallidus, predominantly arising from the striatal matrix
(Gerfen 1985), are better maintained in the AAV-BDNF treated rats independent of pallidal neuron
survival. Assessment of DARPP-32 staining in the substantia nigra demonstrated BDNF-enhanced
maintenance of the striatonigral projections, arising from both matrix and striosome compartments
(Gerfen 1985), however DARPP-32 staining of the globus pallidus was less defined and definitive
assessment of the striatopallidal projection survival should be undertaken with tracer studies.
154
Neurotrophic Factor Delivery: AAV-BDNF and AAV-GDNF
5.8.3
Conclusion
Despite the vital role that neurotrophic factors, and specifically BDNF, play in maintaining the
plasticity and functionality of the striatum, and the disruption of BDNF production / transportation in
the HD brain, there has only been limited success to date in alleviating cell loss in the striatum
through the administration of BDNF. While a low level of neuroprotection has been previously
found (Bemelmans et al. 1999; Kells et al. 2004), these studies together with the current
investigations show the significant impact that BDNF can impart on the coordination of functional
behaviour and the ultimate need to be able to finely control the extent and localisation of enhanced
BDNF expression. To my knowledge, all of the reported BDNF studies to date have used acute
administration of neurotoxic chemicals to induce selective cell death in the vulnerable striatal
projection neurons in which the cells are probably exposed to more intense insult than the actual
neurons are in HD patients in which there is a slow progressive loss. Given the ability to provide
protection in these studies, it is therefore conceivable that the continuous expression of neurotrophic
factors would actually provide a greater level of support potentially with lower levels of exogenous
expression being required; which will additionally limit any adverse effects of the transgene
expression. Therefore the delivery of neurotrophic factors to transgenic models in which there is a
progression of symptom onset and neuropathological changes, as has been reported for GDNF, may
provide a truer reflection of the actual potential of neurotrophic factor based therapy for HD.
Ultimately the results of these neurotrophic factor investigations highlight the need to apply caution
in the enhancement of endogenously expressed trophic factors, with excessive uncontrolled
production potentially deleterious, while tightly controlled expression could be of significant
therapeutic benefit. This is of particular importance given that protective treatments are likely to be
of greatest efficacy when applied early in the degenerative disease process – potentially even prior to
the onset of physical symptoms in HD. Consideration will also need to be given to areas of HD
neuropathology beyond the caudate-putamen and whether neurotrophic factor delivery to the
striatum is sufficient to attenuate HD symptoms, or if other areas of primary or secondary
neurodegeneration are also suited to targeting with neurotrophic factor gene delivery.
155
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
Chapter 6
Anti-Apoptotic Factor Delivery:
AAV-Bcl-xL and AAV-XIAP
6.1 Overview
The proposal that apoptotic cell death processes are implicated in Huntington’s disease
neurodegeneration (Section 1.7) raises the question of whether enhancing the expression of antiapoptotic factors in the vulnerable striatal projection neurons can reduced their susceptibility to
neurotoxic processes occurring in the Huntington’s disease brain. In this investigation I constructed
AAV vectors encoding either Bcl-xL or XIAP, using them to transduce striatal neurons prior to an
intrastriatal injection of the glutamate analogue QA. Treated rats were observed in behavioural tests
undertaken to assess whether the anti-apoptotic factor expression could provide any amelioration of
motor impairments following unilateral QA-induced striatal lesioning.
While there was some
lessening of behavioural deficits in the AAV-Bcl-xL and AAV-XIAP treated rats, I found no
quantified reduction of QA-induced pathology in assessed neuronal populations of the basal ganglia.
Overall these investigations showed the ability to deliver anti-apoptotic factors to the central nervous
system without causing any immediately apparent welfare concerns, however suggest that the
enhancement of an isolated pro-survival protein is not sufficient to counteract acute excitotoxic insult
of the striatal neurons.
6.2 Procedures
Chimeric AAV1/2 vectors were constructed containing cDNA encoding Bcl-xL or XIAP and were
assessed with in vitro assays to ensure they directed the expression of biologically functional antiapoptotic factors (Chapter 2; Kells et al. 2006), prior to verifying in vivo transduction and expression
in the rodent striatum. Following the AAV vector testing I undertook two in vivo studies, conducted
as described (Chapter 4) to assess the influence of Bcl-xL and XIAP expression on QA induced
striatal excitotoxicity and associated functional behavioural deficits. In the initial neuroprotective
investigation I delivered 4.0µL AAV-Bcl-xL (n = 10*) to a single stereotaxic site within the rodent
*
n values here represent the final number of rats included in the analysis of the investigations (Section 4.3).
156
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
striatum prior to QA injection at the same stereotaxic coordinates. To further enhance the number of
striatal neurons transduced, and their distribution within the striatum, I conducted a second
investigation delivering 8.0µL of AAV-Bcl-xL (n = 11) or AAV-XIAP (n = 9) split between two
stereotaxic sites in the striatum flanking the QA injection coordinates. These two neuroprotective
investigations were undertaken in parallel with the previously described neurotrophic factors studies
(Chapter 5) utilising the same groups of control rats which received either AAV-Luciferase (First
study: n = 8; Second study: n = 5) or sterile PBS (First study: n = 10; Second study: n = 5) prior to
QA lesioning as described (Table 4-2, Table 4-3).
6.3 In Vivo AAV Vector Testing
A
B
C
D
Figure 6-1
Single delivery site for AAV-Bcl-xL transduction and subsequent Bcl-xL
expression
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged Bcl-xL
expression three weeks after a single 4.0µL striatal injection of the AAV-Bcl-xL vector. Cells
expressing HA-tagged Bcl-xL were largely contained within the injected striatum where a large
population of the striatal neurons appeared to be transduced. Higher power images of AAV-Bcl-xL
transduced neurons in (B) the striatum, (C) globus pallidus, and (D) substantia nigra. Scale bar =
2mm for whole sections (A); 200µm for (B); 100µm for (C,D).
157
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
To assess the spread of in vivo AAV-Bcl-xL and AAV-XIAP transduction and transgene expression
prior to investigating the preventative therapeutic efficacy of over-expressing anti-apoptotic factors
in the striatum, I injected naïve rats using the same stereotaxic surgical protocols to be undertaken on
the main cohorts of rats in the neuroprotective investigations. The initial single site delivery protocol
was determined from the earlier AAV-Luciferase delivery testing (Section 4.4.2) which I then
modified for the second two-site delivery study designed to increase the number of transduced cells
and better distribute vector transduction around the QA-injection site. Three weeks post-AAV
delivery the enhanced Bcl-xL (Single site: Figure 6-1; Two-site: Figure 6-2) and XIAP (Two-site:
Figure 6-3) expression was visualised by immunocytochemical staining against the HA-epitope
attached to the C-terminal of the anti-apoptotic factors.
Both AAV-Bcl-xL and AAV-XIAP
transduced cells were observed in an extensive but often irregularly dispersed distribution
A
B
C
D
Figure 6-2
AAV-Bcl-xL transduction and Bcl-xL expression following two-site striatal
delivery
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged Bcl-xL
expression three weeks after two 4.0µL striatal injections of the AAV-Bcl-xL vector. Cells
expressing HA-tagged Bcl-xL were largely contained within the injected striatum where a large
population of the striatal neurons appeared to be transduced. Higher power images of AAV-Bcl-xL
transduced neurons in (B) the striatum, (C) globus pallidus, and (D) substantia nigra. Scale bar =
2mm for whole sections (A); 100µ m for higher magnification images (B-D).
158
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
throughout the rostral-caudal extent of the striatum. Transgenic Bcl-xL protein appeared to be
distributed throughout the cytosol of transduced neurons (Figure 6-2B) making identification of
individual transduced neurons less evident compared to the nuclear localisation of XIAP expression
(Figure 6-3B). A population of cells within the globus pallidus and substantia nigra pars compacta
ipsilateral to the injected striatum were also HA-positive indicating transportation of the AAVvectors and transduction of cells within the striatal target nuclei. The ipsilateral substantia nigra pars
reticulata also displayed HA-immunoreactivity although this was mainly restricted to the striatonigral
axonal fibres with very few identifiable HA-positive cell bodies. I also detected the presence of HAtagged proteins throughout fibres in the cerebral cortex ipsilateral to the two-site intrastriatal
injection of AAV-Bcl-xL, suggesting either low level transduction of these cortical neurons – a
potential effect of the larger volume of vector delivered – or retrograde transport of Bcl-xL produced
in the striatum.
A
B
C
D
Figure 6-3
Spread of AAV-XIAP transduction and subsequent XIAP expression
(A) Representative coronal sections of a rat brain showing the main regions of HA-tagged XIAP
expression three weeks after two 4.0µL striatal injections of the AAV-XIAP vector (A). Cells
expressing HA-tagged XIAP were largely contained within the injected striatum where a large
population of the striatal neurons appeared to be transduced. Higher power images of AAV-XIAP
transduced neurons in (B) the striatum, (C) globus pallidus, and (D) substantia nigra. Scale bar =
2mm for whole sections (A); 100µ m for higher magnification images (B-D).
159
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.4 Bcl-xL and XIAP Expression Level
To determine the quantity of Bcl-xL and XIAP expression within the striatum following AAVmediated gene delivery I injected additional cohorts of rats with the AAV-Bcl-xL or AAV-XIAP
vectors using the same surgical protocol employed for the neuroprotective investigation. The rats
were euthanised three weeks post-surgery and their striatal tissue separately isolated for ELISAbased quantification of the Bcl-xL or XIAP content (Section 4.6). Expression was assessed three
weeks post-AAV delivery to provide a measure of the increased anti-apoptotic factor expression
equivalent to the expression levels in the main neuroprotective study groups at the time of QA
injection.
Bcl-xL expression in the striatum following the initial single site AAV-Bcl-xL injection was enhanced
~20-fold to 1200 ± 300 ng / mg total protein compared with the 49 ± 2 ng / mg total protein in the
control AAV-Luciferase injected striatum (Mann-Whitney P < 0.01; Figure 6-4A). The contralateral
striatum displayed a small increase in Bcl-xL expression at 66 ± 4 ng / mg total protein indicating a
small amount of expression crossing over into the non-injected striatal hemisphere. The control
AAV-Luciferase vector injections did not induce a significant alteration in Bcl-xL expression with
the injected striatum having 49 ± 2 ng Bcl-xL / mg total protein and the non-injected striatum 39 ± 7
ng / mg total protein. Significantly higher Bcl-xL expression was generated following the 8.0µL twosite AAV-Bcl-xL injections with a ~2.5-fold increase over the single site injected striatum to 3100 ±
700 ng / mg total protein (~60-fold increase over controls; Mann-Whitney P < 0.05). A significant
amount of transgenic Bcl-xL (120 ± 10 ng / mg total protein) was again detected in the non-injected
contralateral striatum (Mann-Whitney P < 0.01).
AAV-XIAP delivery resulted in a much lower quantity of transgenic protein expression than the
AAV-Bcl-xL delivery with the injected striatum containing 150 ± 20 ng XIAP / mg total protein,
although this represented a comparable ~70-fold enhancement over the endogenous XIAP expression
detected in the AAV-Luciferase injected control striatum (Mann-Whitney P < 0.01; Figure 6-4B). A
small amount of hemispherical crossover of transgenic protein expression was again detected in the
contralateral non-treated striatum with 4.3 ± 0.3 ng XIAP / mg total protein detected compared with
the 1.7 ± 0.7 ng / mg total protein in the control rats (Mann-Whitney P < 0.05).
160
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
A
B
Figure 6-4
ELISA quantification of Bcl-xL and XIAP expression in the striatum
The level of (A) Bcl-xL or (B) XIAP protein expression in striatal tissue isolated three weeks after
infusion of AAV-Bcl-xL, AAV-XIAP or AAV-Luciferase was quantified by ELISA. Total protein in
the samples was measured by BCA assay to normalise the individual samples. Mann-Whitney tests:
comparison with AAV-Luciferase * P < 0.05, ** P < 0.01; comparison with two-site AAV-Bcl-xL
‡ P < 0.01.
6.5 Functional Behaviour Assessment
Throughout the neuroprotective studies I assessed the development of functional deficits by
analysing the performance of each rat in behavioural tests designed to show hemispherical
imbalances in brain function arising as a result of a unilateral lesion in the basal ganglia. The
functional behavioural tests undertaken as previously described (Section 4.5) involved spontaneous
forelimb use analysis, drug-induced rotational behaviour following either apomorphine or
amphetamine dosing, and preferential left / right side food selection. All the rats were assessed with
baseline measurements taken both before and after AAV delivery and for 5-7 weeks post-QA
injection (Table 4-2, Table 4-3).
6.5.1
Spontaneous forelimb use
Assessment of forelimb usage during spontaneous exploratory activity was undertaken by observing
the rats rearing behaviour when placed into a clear cylinder (Section 4.5.1). Baseline assessment of
the naïve rats prior to any treatment generally showed non-biased usage of both left and right
forelimbs. AAV-Bcl-xL delivery in the initial single site delivery investigation did not induce any
alterations in forelimb use following vector delivery (Figure 6-5A). Although initially appearing to
attenuate development of the ipsilateral forelimb use bias seen in control rats, the AAV-Bcl-xL
treated rats progressively acquired a strong preferential use of their ipsilateral forelimb while the
161
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
A
B
Figure 6-5
Spontaneous ipsilateral forelimb use asymmetry scores
Plots displaying changes in group ipsilateral asymmetry scores as quantified during spontaneous
exploration of the forelimb use assessment cylinder in (A) the first AAV-Bcl-xL and (B) second
AAV-Bcl-xL / AAV-XIAP investigations. Ipsilateral asymmetry scores represent the combined use
of the ipsilateral forelimb, as a percentage of the total left and right forelimb usage, for rearing, initial
contact of the cylinder wall during an exploratory rear and landing. * Un-paired t-test between
treatment groups: P < 0.05. Two-way RM ANOVA relative to the control group: † Bcl-xL
P = 0.053, XIAP P < 0.001.
162
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
control rats appeared to undergo spontaneous recovery three-weeks post QA such that AAV-Bcl-xL
provided no overall attenuation of the contralateral forelimb motor control deficit. In the second
two-site vector delivery investigation the control rats developed and maintained a strong ipsilateral
forelimb bias that tended to be restricted by the prior delivery of AAV-Bcl-xL but was not quite
statistically significant (Two-way RM ANOVA P = 0.053; Figure 6-5B).
Delivery of AAV-XIAP in the second investigation induced a small but significant shift towards
greater usage of the treated rats’ contralateral forelimb (44 ± 4% ipsilateral asymmetry) prior to QA
lesioning, compared with the unbiased 53 ± 3% ipsilateral forelimb use in control rats (Unpaired ttest P < 0.05; Figure 6-5B).
Following QA injection the AAV-XIAP treated rats showed an
immediate shift back to non-biased forelimb usage with the over-expression of XIAP resulting in the
complete attenuation of the ipsilateral forelimb use bias exhibited by the control treated rats (Twoway RM ANOVA P < 0.001; Figure 6-5B)
Comparison of total activity level between the treatment groups showed that while all rats have a
reduction in the number of exploratory rears from initial baseline testing, the rats with enhanced antiapoptotic factor expression overall showed higher levels of exploratory activity. With AAV-Bcl-xL
treated rats in the first study and AAV-XIAP treated rats in the second study displaying significantly
greater rearing behaviour than the control rats (Two-way RM ANOVA P < 0.05; Figure 6-6).
A
B
Figure 6-6
Spontaneous exploratory rearing activity
Plots displaying the number of exploratory rears in the cylinder during the five minute assessment of
spontaneous forelimb use in (A) the first AAV-Bcl-xL and (B) second AAV-Bcl-xL / AAV-XIAP
investigations. No statistics were performed on the pre-QA baseline data. Two-way RM ANOVA
relative to the control group: † P < 0.05; ‡ Bcl-xL P = 0.11, XIAP P < 0.05.
163
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.5.2
Drug-induced rotational behaviour
Apomorphine- and amphetamine-induced rotational motor activity was analysed to assess alterations
in striatal dopamine signalling following unilateral QA injection and the subsequent loss of
dopamine receptive striatal neurons (Section 4.5.3).
Analysis of the rotation data showed
inconsistencies in rotational activity and direction between individual rats within the treatment
A
B
Figure 6-7
Apomorphine-induced rotational behaviour
Plots displaying each rat’s rotational behaviour towards the treated side of their brain as a percentage
of total rotations following subcutaneous administration of 1mg/kg of apomorphine in (A) the first
AAV-Bcl-xL and (B) second AAV-Bcl-xL / AAV-XIAP investigations. Rats that had less than 0.5
rotations per minute were excluded from this analysis. Lines represent the median result for each
group at each time point.
164
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
groups – possibly resultant of minor variations in the actual positioning of the AAV-vector or QA
injections – complicating the assessment of dopamine related functional motor impairment.
Therefore statistical analysis was restricted to the assessment of total rotation rates post QA,
independent from the direction of induced rotation.
6.5.2.1
Apomorphine
As expected from the earlier QA lesion testing (Section 3.3.4.1), the administration of apomorphine
to rats with a unilateral striatal lesion tended to induce rotational motor behaviour towards the
lesioned hemisphere (Figure 6-7), in contrast to a lower level of unbiased motor activity induced
prior to QA lesioning (Figure 6-8). The extent of apomorphine-induced rotations varied significantly
between individual rats in the two anti-apoptotic factor investigations with the rats showing up to 20
rotations per minute irrespective of their treatment, and with no significant overall differences in
rotation rates between the groups in either investigation (Figure 6-8A,B). For reliable assessment of
rotational behaviour I excluded trial data for rats that displayed less than 0.5 rotations per minute
following apomorphine administration.
Baseline and post-AAV trials showed a wide spread in the extent and direction of rotational
behaviour which was skewed towards a contralateral dominance by the selective treatment of the
individual rats more dominant hemisphere (Figure 6-7A,B). The AAV vector delivery and transgene
expression did not appear to be having any direct influence on the rotational behaviour prior to QA.
Following QA injection the control rats predominantly had a strongly ipsilateral rotational bias while
A
B
Figure 6-8
Total apomorphine-induced rotations
Plots displaying the mean number of apomorphine-induced rotations for each group in (A) the first
AAV-Bcl-xL and (B) second AAV-Bcl-xL / AAV-XIAP investigations following subcutaneous
administration of 1mg/kg apomorphine. No significance was found between treatment groups and
controls post-QA.
165
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
a number of anti-apoptotic factor expressing rats showed less unidirectional behaviour with a slight
majority of AAV-Bcl-xL and AAV-XIAP treated rats in the second study actually displaying a
greater preference towards contralateral rotations (Figure 6-7B). Although not statistically analysed,
the observed changes to rotational behaviour in the second investigation were indicative of Bcl-xL
and XIAP derived alterations to the QA-induced neuropathological disruptions.
6.5.2.2
Amphetamine
Rotational behaviour induced by amphetamine administration was only assessed in the initial AAVBcl-xL study where greater rotational behaviour was induced in AAV-Bcl-xL treated rats following
A
B
Figure 6-9
Amphetamine-induced rotational behaviour
Plots displaying the rotational behaviour induced following an i.p. injection of 5mg/kg of
amphetamine in the first AAV-Bcl-xL investigation. (A) Individual rats’ rotational behaviour
towards the treated (ipsilateral) side of their brain as a percentage of total rotations and (B) the total
rotation rate for each group. Rats that had less than 0.1 rotations per minute were excluded from this
analysis. Lines in (A) represent the median result for each group at each time point. No significance
was found in rotation rates between AAV-Bcl-xL treatment rats and controls post-QA.
166
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
QA-injection than in the AAV-Luciferase / PBS treated control rats (Figure 6-9B). However the
extent of this behaviour varied extensively between individual rats, with many not displaying any
persistent rotational behaviour following amphetamine dosing and therefore being excluded from the
assessment of rotation direction. Analysis of the number of ipsilateral rotations as a percentage of
total rotational behaviour found that post-QA the majority of rats in both the AAV-Bcl-xL and
control treated groups predominantly or solely performed unidirectional rotations, with the majority
rotating towards the lesioned hemisphere (Figure 6-9A). The slight contralateral rotation preference
observed in the pre-QA baseline trials was due to the selection of the dominant brain hemisphere for
treatment. No statistical analysis was performed on the directional rotation data due to the lack of
consistency between similarly treated rats in their extent or direction of rotation.
6.5.3
Sensorimotor “corridor” task
Inclusion of the “corridor” task in the second study provided an assessment of the impact that overexpressing anti-apoptotic factors had on the development of sensorimotor neglect following QAlesioning.
During baseline and post-AAV testing all treatment groups displayed a fairly even
distribution of sugar pellet retrievals from both the left and right sides of the corridor with only the
AAV-XIAP treated rats displaying an increase in the proportion of retrievals from the ipsilateral side
Figure 6-10 Preferential food selection in the sensorimotor “corridor” task
Plot displaying group changes in the number of sugar pellet retrievals from the same side as the
treated striatum as a percentage of the 20 retrievals per trial. No significance was found between
treatment groups and controls post-QA.
167
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
prior to QA injection (paired t-test P < 0.05; Figure 6-10). The slight preference for contralateral
retrievals in all groups during baseline testing is resultant of the intentional selection of each rat’s
dominant brain hemisphere for treatment. Post-QA the development of contralateral sensorimotor
neglect, resulting in preferential ipsilateral sugar pellet retrieval, was strongest in the control rats (77
± 2%) but also observed in both the AAV-XIAP (73 ± 1%) and AAV-Bcl-xL (65 ± 1%) treated
groups with no significant alterations between the different treatments (Two-way RM ANOVA postQA P > 0.05).
6.6 Immunocytochemical Analysis
Immunocytochemical staining was undertaken to determine if AAV-vector mediated expression of
the anti-apoptotic factors Bcl-xL or XIAP supplied any neuroprotective support against QA-induced
excitotoxic stress in the striatum of adult rats. Following the completion of behavioural testing I
processed the rat brains for immunocytochemical analysis, sectioning coronally through striatum,
globus pallidus and substantia nigra for immunostaining against various neuronal makers.
6.6.1
AAV-mediated transgene expression and QA lesioning of
the striatum
Initial assessment of the surviving AAV-mediated transgene expression was undertaken by
visualising the HA-tagged anti-apoptotic factors or control Luciferase expression within the striatum.
The extent of the QA-induced striatal lesioning was visually assessed by both DARPP-32 and NeuN
immunostaining with stereological quantification to determine the maintenance of the vulnerable
DARPP-32 positive striatal projection neurons.
6.6.1.1
Study 1 – AAV-Bcl-xL Delivery
In the first study AAV-Bcl-xL was delivered to the striatum at a single stereotaxic injection site prior
to QA injection at the same coordinates. Using adjacent striatal sections individually immunostained
for HA, DARPP-32 and NeuN to show the distribution of enhanced Bcl-xL expression and neuronal
maintenance (Figure 6-11) I observed a generally positive correlation between immunoreactivity,
although HA staining was less extensive than the neuronal markers. Intense HA staining of cellular
processes in the striatum, suggesting intracellular accumulation of transgenic Bcl-xL, made
identification of transduced neurons less distinct (Figure 6-11C). Despite a scattering of DARPP-32
and NeuN-positive cells within the area of striatal lesioning – particularly in the more distal
“transition zone” – the extent of neuronal sparing varied considerably between individual AAV-Bcl168
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
xL treated rats (Figure 6-11D-I) and was also observed in AAV-Luciferase / PBS treated control rats
(Figure 5-13D-I). Overall there was no visually apparent evidence that prior AAV-Bcl-xL delivery
reduced striatal cell loss.
A
HA
D
G
DARPP-32
NeuN
B
E
H
C
F
I
Figure 6-11 Single injection site AAV-Bcl-xL transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated Bcl-xL expression and
neuronal cell loss seven weeks post-QA. (A-C) HA-immunostaining displayed the distribution of
Bcl-xL expression within the striatum resultant of AAV-Bcl-xL transduction prior to QA injection.
Maintenance of striatal neurons was detected by (D-F) DARPP-32 and (G-I) NeuN immunostaining.
Scale bar = 2mm for (A,D,G); 200µ m for (B,E,H); 50µm for (C,F,I).
169
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.6.1.2
Study 2 – AAV-Bcl-xL and AAV-XIAP Delivery
The second investigation of anti-apoptotic factors in which AAV vectors encoding either Bcl-xL or
XIAP were injected into two striatal sites flanking the QA injection coordinates showed some
maintenance of transgene expression within the striatum. As with the previous AAV-Bcl-xL study,
the striatal transgene expression was still only present in areas that also contained DARPP-32 and
NeuN expression for both AAV-Bcl-xL (Figure 6-12) and AAV-XIAP (Figure 6-13) treated rats.
With reasonably defined areas of striatal lesioning visualised with DARPP-32 or NeuN staining, the
brains expressing enhanced levels of anti-apoptotic factors were not visually discernable from AAVLuciferase / PBS treated control brains (Figure 5-15).
A
HA
D
G
DARPP-32
NeuN
B
E
H
C
F
I
Figure 6-12 Dual injection site AAV-Bcl-xL transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated Bcl-xL expression and
neuronal cell loss eight weeks post-QA. (A-C) HA-immunostaining displayed the distribution of
Bcl-xL expression within the striatum resultant of AAV-Bcl-xL transduction prior to QA injection.
Maintenance of striatal neurons was detected by (D-F) DARPP-32 and (G-I) NeuN immunostaining.
Scale bar = 2mm for (A,D,G); 200µ m for (B,E,H); 50µm for (C,F,I).
170
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
A
D
HA
G
DARPP-32
NeuN
B
E
H
C
F
I
Figure 6-13 Dual injection site AAV-XIAP transduction and striatal cell maintenance
Representative images from adjacent striatal sections showing AAV-mediated XIAP expression and
neuronal cell loss eight weeks post-QA. (A-C) HA-immunostaining displayed the distribution of
Bcl-xL expression within the striatum resultant of AAV-XIAP transduction prior to QA injection.
Maintenance of striatal neurons was detected by (D-F) DARPP-32 and (G-I) NeuN immunostaining.
Scale bar = 2mm for (A,D,G); 200µ m for (B,E,H); 50µm for (C,F,I).
6.6.1.3
Stereological Analysis – DARPP-32
Quantification of the DARPP-32 immunopositive neurons using optical fractionator stereology
probes in the first AAV-Bcl-xL study estimated the number of DARPP-32 positive neurons
remaining within the sampled region of the treated caudate-putamen at 1,300,000 ± 100,000 in the
AAV-Bcl-xL treated rats compared with 1,150,000 ± 120,000 in the control AAV-Luciferase / PBS
treated rats (Figure 6-14A; Coefficient of Error ≤ 0.04). The adjacent intact contralateral striatum
contained an overall average across all rats of 2,200,000 ± 60,000 (Coefficient of Error ≤ 0.02). In
the second investigation I limited the stereological analysis of DARPP-32 positive neurons to a
smaller portion of the striatum centred around the QA lesion containing an estimated 820,000 ±
90,000 DARPP-32 positive neurons in AAV-Bcl-xL treated rats, 890,000 ± 100,000 in AAV-XIAP
171
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
treated rats and 760,000 ± 60,000 in control AAV-Luciferase / PBS treated rats (Figure 6-14C;
Coefficient of Error ≤ 0.06). The corresponding contralateral striatal region was estimated to contain
an overall average across all treated rats of 1,530,000 ± 30,000 DARPP-32 positive neurons
(Coefficient of Error ≤ 0.03).
First AAV-Bcl-xL Investigation
A
B
Second AAV-Bcl-xL / AAV-XIAP Investigation
C
D
Figure 6-14 Maintenance of DARPP-32 striatal projection neurons
Graphs displaying the actual and relative numbers of DARPP-32 positive neurons in the striatum as
estimated by optical fractionator stereological analysis of the treated (ipsilateral) and intact
(contralateral) striatal hemispheres in (A,B) the first AAV-Bcl-xL and (C,D) second AAV-Bcl-xL /
AAV-XIAP neuroprotective studies. Population estimates were determined from 12 sections
spanning 3.56mm of the striatum for the first study and 7 sections spanning 1.96mm of the anterior
striatum for the second study. Relative cell counts represent the number of DARPP-32 positive
neurons within the lesioned striatum as a proportion of DARPP-32 expressing neurons in the
contralateral intact striatum estimated independently for each rat. Statistical analysis revealed no
significance differences between treatment groups at the 5% level (P > 0.05).
172
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
Analysis of the stereological estimates to assess the relative maintenance of DARPP-32 positive
striatal neurons showed the control AAV-Luciferase / PBS treated rats to have 52 ± 4% maintenance
in the initial study and 47 ± 4% in the second investigation. Over-expression of an anti-apoptotic
factor – Bcl-xL or XIAP – in the striatum prior to QA injection did not significantly enhance the
maintenance of DARPP-32 neurons.
AAV-Bcl-xL treated rats had 57 ± 5% maintenance of
DARPP-32 neurons in the first study (Figure 6-14B) and 52 ± 4% in the second (Figure 6-14D).
Delivery of AAV-XIAP was estimated to have enhanced the maintenance of DARPP-32 positive
neurons by ~23% to 58 ± 7% relative survival, although this failed to be statistically significance
(P = 0.20; Figure 6-14D).
6.6.1.4
Striatal Atrophy
First Single Injection AAV-Bcl-xL Study
Second Dual Injection AAV-Bcl-xL / AAV-XIAP Study
A
C
B
D
Figure 6-15 Atrophy of the lesioned striatum
Graphs displaying the size of the lesioned striatum as a proportion of the intact contralateral striatal
area, and plots correlating striatal atrophy with DARPP-32 positive cell loss in the striatum.
(A,B) First AAV-Bcl-xL study and (C,D) second AAV-Bcl-xL / AAV-XIAP neuroprotective
investigation. Cross-sectional striatal area was measured on 12 coronal sections for the initial study
and 7 sections for the second study. Combined correlation analysis between the striatal atrophy and
the loss of DARPP-32 positive neurons displayed Deming linear regression correlations for both the
first (B; slope = 0.51 ± 0.06, P < 0.001) and second (D; slope = 0.53 ± 0.08, P < 0.001) anti-apoptotic
factor investigations. R values represent Pearson correlation coefficient independent of treatment.
173
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
As an alternative measure of the overall striatal maintenance I analysed the volume of the striatum
which was observed to have significantly atrophied in most cases, with an associated enlargement of
the adjacent lateral ventricle. By using contours drawn to perform stereological cell estimates, I
calculated the striatal volume relative to the contralateral hemisphere for each rat. The AAVmediated delivery of anti-apoptotic factors did not alter the extent of striatal atrophy following QA
lesioning in either study. In the initial investigation the AAV-Bcl-xL injected striatum contracted to
79 ± 2% of the contralateral volume compared with 73 ± 2% in control AAV-Luciferase / PBS
treated rats (Figure 6-15A). Similarly, in the second study the striatum was reduced to 77 ± 2% of
the contralateral striatal volume in AAV-Bcl-xL treated rats, 76 ± 4% in AAV-XIAP treated rats and
75 ± 3% in the control group of rats (Figure 6-15C).
Analysis of the correlation between the relative striatal area and the maintenance of DARPP-32
positive striatal neurons showed a direct relationship with the loss of striatal neurons following QA
injection ultimately resulting in a reduction in the overall striatal volume (Figure 6-15B, D). Neither
AAV-Bcl-xL nor AAV-XIAP delivery prior to the QA injection significantly altered this correlation.
6.6.2
Krox-24 expression
Stereological analysis of krox-24 expressing neurons was performed in the second investigation to
further confirm the loss of striatal neurons using an alternative marker for the striatal neurons. The
distribution of krox-24 positive neurons matched with the DARPP-32 immunostaining although
being a transcription factor the krox-24 immunostaining was restricted to the nucleus resulting in
more distinct staining (Figure 6-16). Quantification of the krox-24 positive neurons was performed
using optical fractionator probes across eight equispaced striatal sections with the number of neurons
estimated at 1,060,000 ± 100,000 in AAV-Bcl-xL treated rats and 1,280,000 ± 150,000 following
AAV-XIAP treatment compared with the 1,060,000 ± 110,000 krox-24 positive cells in AAVLuciferase / PBS control rats (Figure 6-17A; Coefficient of Error ≤ 0.05). The corresponding
contralateral striatal region contained an estimated average of 2,160,000 ± 40,000 krox-24 positive
cells (Coefficient of Error ≤ 0.03). Overall the quantified maintenance of krox-24 positive neurons
reflected the DARPP-32 analysis with 50 ± 5% relative maintenance of krox-24 neurons in the
control rats that was not significantly enhanced by the prior delivery of either AAV-Bcl-xL (50 ± 5%)
or AAV-XIAP (58 ± 7%; Figure 6-17B).
Correlation of the krox-24 expression with DARPP-32 cell maintenance demonstrated a parallel link
between the maintenance of krox-24 expression and DARPP-32 expression following QA lesioning
174
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
that was independent of the prior AAV-mediated anti-apoptotic factor expression or control
treatment (Figure 6-17C).
krox-24
A
D
G
AAV-Bcl-xL
AAV-XIAP
AAV-Luciferase
DARPP-32
B
C
E
F
H
I
Figure 6-16 Krox-24 expression in the striatum
Representative images displaying the expression of krox-24 in striatal neurons following QA
lesioning in (A,B) AAV-Bcl-xL, (D,E) AAV-XIAP, and (G,H) AAV-Luciferase treated rats.
(C,F,I) Adjacent sections (copied from Figure 6-12E, Figure 6-13E and Figure 5-15D)
immunostained for DARPP-32 show the distribution correlation between krox-24 and DARPP-32
positive cells in the striatum. Scale bar = 2mm for whole sections and 200µm for higher
magnification images.
175
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
A
B
C
Figure 6-17 Maintenance of krox-24 expressing striatal neurons
Graphs displaying the (A) actual and (B) relative number of striatal neurons expressing krox-24 as
estimated by optical fractionator stereological cell counting in the treated (ipsilateral) and intact
(contralateral) striatal hemisphere in the second anti-apoptotic factor investigation. Relative cell
counts represent the number of krox-24 expressing cells within the lesioned striatum as a proportion
of krox-24 positive cells present in the contralateral striatum. (C) Plot showing the correlation
between the relative maintenance of krox-24 positive neurons and DARPP-32 expressing neurons in
the striatum. Trend line shows the overall Deming linear regression correlation across all treatment
groups: slope = 1.05 ± 0.07, P < 0.001. R value represents overall Pearson correlation coefficient
independent of treatment.
6.6.3
Analysis of transduced striatal cells
To further assess the state of AAV-vector transduced cells in the striatum at the conclusion of the
investigations, I performed double-label immunofluorescent staining of the transgene expression
with HA and either DARPP-32 or krox-24. Previous assessment of AAV-Luciferase transduced
cells in the striatum showed co-expression of Luciferase with NeuN, but not with DARPP-32 or
krox-24 ( Figure 5-21). In contrast, for both AAV-Bcl-xL and AAV-XIAP treated rats I observed
HA-positive cells co-labelling with DARPP-32 and krox-24 in the striatum (AAV-Bcl-xL: Figure
176
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6-18; AAV-XIAP: Figure 6-19). While the majority of HA-positive neurons in both AAV-Bcl-xL
and AAV-XIAP treated rats co-expressed DARPP-32, krox-24 expression appeared highly variable
with not all of the transduced HA-positive cells co-labelling. However this irregularity in krox-24
labelling intensity was also seen in non-transduced striatal neurons, so may not be related to the
enhanced expression of the anti-apoptotic factors.
A AAV-Bcl-xL
HA
DARPP-32
B AAV-Bcl-xL
HA
krox-24
Figure 6-18 Immunofluorescent double-labelling of AAV-Bcl-xL transduced striatal neurons
Representative single-slice confocal images from an AAV-Bcl-xL treated rat from the second
investigation showing AAV-Bcl-xL transduced cells (red) within the QA-injected striatum and
immunofluorescent staining for (A) DARPP-32 expression and (B) krox-24 expression (both
displayed in green). Co-labelling of the HA-positive cells with DARPP-32 or krox-24 was found in
the striatum, although many of the AAV-Bcl-xL transduced cells only displayed weak krox-24
labelling (arrowheads). Scale bar: 30µm
177
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
A AAV-XIAP
DARPP-32
HA
B AAV-XIAP
HA
krox-24
Figure 6-19 Immunofluorescent double-labelling of AAV-XIAP transduced striatal neurons
Representative single-slice confocal images from an AAV-XIAP treated rat from the second
investigation showing AAV-XIAP transduced cells (red) within the QA-injected striatum and
immunofluorescent staining for (A) DARPP-32 expression and (B) krox-24 expression (both
displayed in green). Co-labelling with DARPP-32 or krox-24 was evident for most HA-positive
cells. However, a few HA-positive cells completely lacked DARPP-32 labelling (arrows) and krox24 expression appeared reduced in a large proportion of AAV-XIAP transduced cells (arrowheads).
Scale bar: 30µm
6.6.4
Dopaminergic innervations of the striatum
To visually assess the maintenance of dopaminergic input into the striatum I performed
immunostaining for TH expression. The extent of TH-immunoreactivity appeared to be altered in
the striatum of all treatment groups with a clear loss of TH proximal to the site of QA injection
(Figure 6-20).
Additionally, the structural organisation of TH-positive fibres appeared to be
disrupted in a larger portion of the striatum surrounding the lesion centre with the normally diffuse
TH labelling of the striatal matrix becoming condensed into tighter bundles surrounding what would
appear to be an enlargement of striosome patches. Neither AAV-Bcl-xL nor AAV-XIAP delivery to
the striatum prior to QA lesioning provided any attenuation of the disruption to the structural
organisation of dopaminergic innervations.
178
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
AAV-Luciferase
A
AAV-Bcl-xL
B
AAV-XIAP
C
iii
i
v
iv
vi
ii
i
iii
v
ii
iv
vi
Figure 6-20 Tyrosine hydroxylase expression in the striatum
Representative images displaying TH-immunoreactivity in the striatum following QA injection in
(A) AAV-Luciferase, (B) AAV-Bcl-xL, and (C) AAV-XIAP treated rats. The distribution of THimmunopositive fibres was affected in the striatum of all treatment groups with a reduction in THexpression at the lesion core (bottom images), and a condensing of the TH-positive matrix
component of the striatum in the surrounding QA-lesioned striatum (middle images). Dashed lines
provide an approximate outline of the lesion core largely devoid of TH (bottom images), and the
limits of the striatal alterations induced by QA (middle images). Scale bar = 1mm for top images
and 200µ m for higher magnification images.
6.6.5
Cortical projection fibres in the striatum
Corticostriatal projections were assessed by SMI32 expression in the striatum.
Following QA
lesioning there was an apparent increase in the staining of SMI32-positive fibres in the striatum
relative to the intact contralateral striatum (Figure 6-21). SMI32 immunostaining was most intensely
enhanced in the striatum proximal to the site of QA injection. Additionally the normally dispersed
patches of SMI32 staining became a dominant feature filling the striatum and often appearing to be
arranged into disjointed bands in the less severely damaged area surrounding the centre of the QA
179
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
lesion (Figure 6-21D). This alteration in cortical projections following QA lesioning did not appear
to be affected by the prior enhancement of Bcl-xL (Figure 6-21F-H) or XIAP (Figure 6-21I-K)
expression in the striatal neurons.
B
C
D
E
G
H
J
K
A
AAV-Luciferase
F
AAV-Bcl-xL
I
AAV-XIAP
Figure 6-21 SMI32 expression in the striatum
Representative images displaying SMI32-immunoreactivity in the contralateral intact striatum (left
hemispheres and (B,C)) and following QA injection in (A,D,E) AAV-Luciferase, (F-H) AAV-Bcl-xL
and (I-K) AAV-XIAP treated rats. The arrangement of SMI32-immunopositive fibres was affected
in the striatum of all treatment groups with an increase in the density of SMI32 positive patches,
particularly around the QA-lesion core. Scale bar = 1mm for whole sections; 200µ m for middle
column of images; 50µ m for high magnification images on the right.
180
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.6.6
Striatal projection nuclei
With the AAV-vector transduction extending to cells in the target nuclei of the striatal axonal
projections (Figure 6-2, Figure 6-3), I used immunocytochemical staining to assess whether the
limited enhancement of Bcl-xL or XIAP expression in the nigral or pallidal neurons had any bearing
on their survival following QA lesioning of the striatum.
6.6.6.1
Substantia Nigra
Assessment of the substantia nigra was performed by immunocytochemical staining of the
dopaminergic neurons in the pars compacta with TH, a population of GABA-receptive neurons in the
pars reticulata using parvalbumin, and the maintenance of GABAergic innervations by striatonigral
projection neurons by measuring the density of DARPP-32 immunostaining. I did not observe any
apparent changes to the number of TH-positive neurons in either the controls (Figure 5-27), or antiapoptotic factor treated rats (AAV-Bcl-xL: Figure 6-23A; AAV-XIAP: Figure 6-24A) with similar
TH expression in each hemisphere. Similarly with the GABAergic neurons in the pars reticulata
there was no apparent reduction in parvalbumin expressing neurons following QA striatal lesioning
(Figure 6-23B, Figure 6-24B). While the nigral neurons appeared largely unaffected, the loss of
GABAergic striatal projection neurons did reduce the intensity of DARPP-32 fibres innervating the
substantia nigra (Figure 6-23C, Figure 6-24C).
The reduced GABAergic innervations were
quantitatively assessed by measuring the density of immunostaining in the ipsilateral substantia nigra
A
B
Figure 6-22 DARPP-32 innervations of the substantia nigra
(A) Graph showing the density of DARPP-32 immunoreactivity within the substantia nigra,
ipsilateral to the treated striatum, as a proportion of DARPP-32 immunostaining in the contralateral
substantia nigra. DARRP-32 density was measured on three coronal sections through the substantia
nigra. (B) Plot displaying the correlation between DARPP-32 positive fibre innervations of the
substantia nigra and maintenance of the DARPP-32 positive neurons. Deming linear regression
correlation across all treatment groups: slope = 0.67 ± 0.15, P < 0.001. R value represents overall
Pearson correlation coefficient independent of treatment.
181
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
relative to the contralateral hemisphere in the same coronal plane. The control rats displayed a
29 ± 3% reduction in the density of DARPP-32 fibre innervations that was not significantly altered
by either AAV-Bcl-xL delivery (20 ± 3% reduction, P = 0.08) or AAV-XIAP treatment (20 ± 5%
reduction, P = 0.15; Figure 6-22A). When compared with the maintenance of DARPP-32-positive
striatal neurons, the reduction in DARPP-32 fibre immunostaining within the substantia nigra
showed a strong, direct correlation with the loss of the striatal neurons (Pearson r = 0.65;
Figure 6-22B).
Contralateral
Ipsilateral
A
Tyrosine Hydroxylase
B
Parvalbumin
C
DARPP-32
Figure 6-23 Visual assessment of the substantia nigra in AAV-Bcl-xL treated rats
Representative images of the substantia nigra from an AAV-Bcl-xL treated brain displaying the
comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) TH-positive neurons in the pars compacta, (B) parvalbuminpositive neurons in the pars reticulata, and (C) DARPP-32 positive neurons and efferent fibres. Scale
bar = 2mm for whole sections and 200µ m for higher magnification images.
182
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
Contralateral
Ipsilateral
A
Tyrosine Hydroxylase
B
Parvalbumin
C
DARPP-32
Figure 6-24 Visual assessment of the substantia nigra in AAV-XIAP treated rats
Representative images of the substantia nigra from an AAV-XIAP treated brain displaying the
comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) TH-positive neurons in the pars compacta, (B) parvalbuminpositive neurons in the pars reticulata, and (C) DARPP-32 positive neurons and efferent fibres. Scale
bar = 2mm for whole sections and 200µ m for higher magnification images.
183
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.6.6.2
Globus Pallidus
Assessment of the globus pallidus was undertaken by immunostaining for parvalbumin and NeuN
which displayed a loss of pallidal neurons in the ipsilateral hemisphere for AAV-Luciferase (refer
previous chapter Figure 5-30A,B), AAV-Bcl-xL (Figure 6-26A,B) and AAV-XIAP (Figure
6-27A,B).
Immunostaining for DARPP-32 generally showed a reduced density of DARPP-32
positive fibres within the globus pallidus consistent with the loss of striatopallidal projections postQA for all treatment groups despite the maintenance of DARPP-32-positive cells in the striatum
directly adjacent to the globus pallidus (AAV-Luciferase, Figure 5-30C; AAV-Bcl-xL, Figure 6-26C;
AAV-XIAP, Figure 6-27C).
Neuronal maintenance in the globus pallidus was determined by quantifying the parvalbuminpositive neurons using stereological estimates of the ipsilateral and contralateral pallidal nuclei
assessed over four equispaced coronal sections. As previously mentioned (Section 5.7.6.2), I found a
significant split between the PBS vehicle and AAV-Luciferase control groups with no apparent
alteration to the number of parvalbumin-positive pallidal neurons in the majority of PBS treated rats,
in contrast to the extensive loss of parvalbumin expressing pallidal neurons in AAV-Luciferase
treated rats. Maintenance of pallidal neurons containing parvalbumin in the AAV-Bcl-xL and AAVXIAP treated rats varied extensively with the AAV-Bcl-xL group having 72 ± 10 % maintenance and
A
B
Figure 6-25 Survival of parvalbumin-positive neurons in the globus pallidus
(A) Graph displaying the proportions of parvalbumin-immunopositive neurons surviving in the
globus pallidus as estimated by optical fractionator stereology on four coronal sections through the
globus pallidus relative to the contralateral hemisphere. (B) Plot comparing the survival of
parvalbumin-positive neurons relative to the maintenance of DARPP-32 positive striatal neurons. R
value represents overall Pearson correlation coefficient independent of treatment (P < 0.05). Solid
line represents significant non-zero linear correlation (P < 0.05) and the dotted lines non-significant
linear trends for individual treatment groups. No statistically significant differences were found
between treatment groups.
184
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
AAV-XIAP rats showing only 55 ± 11% maintenance (Figure 6-25A).
Overall there was a
correlation between the loss of parvalbumin-positive pallidal neurons and the striatal projection
neurons (Pearson r = 0.43, P < 0.05) although this correlation was only clearly seen with the AAVXIAP treated group of rats (Figure 6-25B).
Contralateral
Ipsilateral
Parvalbumin
A
NeuN
B
DARPP-32
C
Figure 6-26 Visual assessment of the globus pallidus following AAV-Bcl-xL treatment
Representative images of the globus pallidus of an AAV-Bcl-xL treated brain displaying the
comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) parvalbumin-positive pallidal neurons, (B) NeuN-positive
neurons, and (C) DARPP-32 immunostaining. Scale bar = 250µm.
185
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
Contralateral
Ipsilateral
Parvalbumin
A
NeuN
B
DARPP-32
C
Figure 6-27 Visual assessment of the globus pallidus following AAV-XIAP treatment
Representative images of the globus pallidus of an AAV-XIAP treated brain displaying the
comparison between the treated (ipsilateral) and un-treated (contralateral) hemispheres.
Immunocytochemical staining of (A) parvalbumin-positive pallidal neurons, (B) NeuN-positive
neurons, and (C) DARPP-32 immunostaining. Scale bar = 250µm.
186
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.6.7
Pathological correlations with functional behaviour
impairments
Without any clear indications from the pathological analysis of significant AAV-Bcl-xL or AAVXIAP supplied neuroprotection I analysed data collected from individual rats to directly assess
correlations between the quantified basal ganglia pathology and the extent of functional motor
impairment for each of the behaviour tests in the second investigation. Due to the significant
maintenance of parvalbumin-expressing pallidal neurons in PBS controls compared with the large
loss in AAV-Luciferase treated rats I have separately identified whether rats received PBS or AAVLuciferase in the correlations against pallidal neurons but not for striatal correlations where there was
no significant difference between the groups. The PBS and AAV-Luciferase treated rats were
however combined as a single control group to assess for any linear relationships as they did not
perform differently as two distinct groups in any of the functional behavioural assessments.
6.6.7.1
Spontaneous Forelimb Use
The proportion of exploratory behaviour undertaken by the rats with their ipsilateral forelimb showed
a direct correlation with the loss of DARPP-32 positive striatal neurons, with greater cell loss
following the unilateral lesioning causing increased use of the rats ipsilateral forelimb (Pearson
A
B
Figure 6-28 Preferential forelimb usage correlation with neuron loss in the striatum and
globus pallidus
Plots correlating the extent of ipsilateral forelimb use bias with the relative proportion of (A)
DARPP-32 and (B) parvalbumin-positive neurons remaining within the striatum and globus pallidus
respectively. Data points represent individual rats’ average score over the seven post-QA trials.
R values represent overall Pearson correlation coefficient for combined data from all rats. Solid lines
represent significant non-zero linear correlations (P < 0.05) and the dotted lines non-significant linear
trends for individual treatment groups. Comparison with controls: (A) Bcl-xL slope P = 0.26,
elevation P < 0.01; XIAP slope P = 0.08, elevation P < 0.001; (B) Bcl-xL slope P < 0.05; XIAP slope
P = 0.72, elevation P < 0.001.
187
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
r = -0.43, P < 0.05). However the analysis of individual linear trends for the AAV-Bcl-xL, AAVXIAP and control treated groups found that only the AAV-Luciferase / PBS treated control rats
actually displayed significant correlation between ipsilateral forelimb use and quantified striatal cell
loss (P < 0.05, Figure 6-28A). Preferential usage of the rats ipsilateral forelimb did not show any
overall correlation with the loss of pallidal neurons (Pearson r = -0.05, P = 0.79), with only AAVBcl-xL treatment showing a weak correlation (Figure 6-28B).
6.6.7.2
Sensorimotor Neglect
Development of sensorimotor neglect on the contralateral side following QA-lesioning resulted in a
greater proportion of ipsilateral sugar pellet retrievals in the “corridor” task, and was significantly
correlated with both DARPP-32-positive striatal cell loss (Pearson r = -0.39, P < 0.05) and the loss of
parvalbumin-positive pallidal neurons (Pearson r = -0.68, P < 0.001; Figure 6-29). Individual
assessment of linear trends for each treatment group showed a strong correlation for the AAV-XIAP
and AAV-Luciferase / PBS control treated rats between the loss of DARPP-32 neurons and the
extent of sensorimotor neglect, but not for the AAV-Bcl-xL treated rats which displayed a wide
spread of preferential sugar pellet retrievals that were seemingly unrelated to the level of striatal
lesioning. Separate linear comparisons with the pathological state of the globus pallidus revealed
A
B
Figure 6-29 Sensorimotor neglect correlation with striatal and pallidal neuronal cell loss
Plots correlating the percentage of ipsilateral sugar pellet retrievals made in the “corridor” task with
the relative proportion of (A) DARPP-32 and (B) parvalbumin-positive neurons remaining within the
striatum and globus pallidus respectively. Data points represent individual rats’ average retrieval
preference over the four post-QA trials. R values represent overall Pearson correlation coefficient
for combined data from all rats. Solid lines represent significant non-zero linear correlations (P <
0.05) and the dotted lines non-significant linear trends for individual treatment groups. Comparison
with controls: (A) Bcl-xL slope P = 0.10, elevation P < 0.01; XIAP not-significant; (B) Bcl-xL slope
P < 0.05; XIAP slope P = 0.001.
188
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
significant non-zero linear trends for each treatment group, although the correlations were weakened
for the control and AAV-Bcl-xL groups by a few outliers that displayed strong ipsilateral bias despite
no disruption of pallidal neurons. Significantly though, all rats that had extensive loss of pallidal
neurons also displayed strong contralateral sensorimotor neglect.
6.6.7.3
Apomorphine-Induced Rotations
Comparisons between the proportion of apomorphine-induced ipsilateral rotations and the extent of
DARPP-32 neuronal cell loss showed no overall correlation (Pearson r = -0.22, P = 0.24; Figure
6-30A). Individual treatment group analysis however demonstrated that the AAV-XIAP treated
group did show a trend towards a greater proportion of contralateral rotations when the striatal lesion
is smaller, but ipsilateral rotations when there is high loss of DARPP-32 expressing striatal cells. In
contrast the proportion of rats preferentially rotating in a contralateral direction showed strong
correlation with the maintenance of the globus pallidus independent of treatment (Pearson r = -0.75,
P < 0.001; Figure 6-30B).
A
B
Figure 6-30 Correlation of apomorphine-induced rotational behaviour with striatal and
pallidal neuronal cell loss
Plots displaying the percentage of rotations in an ipsilateral direction in relation to the maintenance
of (A) DARPP-32 and (B) parvalbumin-positive neurons within the striatum and globus pallidus
respectively. Each data point represents the result of a single post-QA trial with three trials
conducted per rat. Shaded boxes show the predominant contralateral rotational behaviour when the
relative number of parvalbumin pallidal neurons is greater in the treated hemisphere and preferential
ipsilateral rotations when the globus pallidus is compromised. R values represent overall Pearson
correlation coefficient for combined data from all rats. Solid lines represent significant non-zero
linear correlations (P < 0.05) and the dotted lines non-significant linear trends for individual
treatment groups. Neither AAV-Bcl-xL nor AAV-XIAP treatment significantly altered the linear
correlations observed in the control rats.
189
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
6.7 Discussion
Through the delivery of AAV vectors encoding anti-apoptotic factors to the rodent striatum I
investigated the potential for increasing the expression of Bcl-xL or XIAP within the striatal neurons
with a view to enhancing their resistance against excitotoxic cell death processes that contribute to
HD neurodegenerative disease processes.
While apoptotic processes are likely to be major
contributing factors in HD neurodegeneration, and other neurodegenerative disorders, until recently
there has been little published literature surrounding the use of anti-apoptotic factors as therapeutic
agents (Section 1.7). A major limiting factor for direct therapeutic administration of endogenous
anti-apoptotic factors is their intracellular localisation and site-of-action requiring efficient and
extensive targeting of the vulnerable neurons. The AAV1/2 vectors I investigated provide an avenue
to direct the continuous expression of a therapeutic protein within transduced neurons. By injecting
either AAV-Bcl-xL or AAV-XIAP into the rodent striatum – inducing over-expression of Bcl-xL and
XIAP respectively – and using behavioural tests to measure motor activity before and after an
intrastriatal injection of QA I assessed whether these anti-apoptotic factors could provide any
symptomatic or neuropathological relief from the striatal excitotoxic insult.
6.7.1
AAV-mediated Bcl-xL or XIAP expression prior to QA
The chimeric AAV1/2 vectors constructed to enhance Bcl-xL or XIAP expression prior to QA
administration appeared to readily transduce the striatal neurons with significant enhancement of
anti-apoptotic factor expression following a single AAV-Bcl-xL injection in the first study, and the
dual injections of either AAV-Bcl-xL or AAV-XIAP in the second investigation (Section 6.3). While
the AAV vectors appeared capable of travelling through the striatal parenchyma transducing neurons
a reasonable distance from the injection coordinates, the actual distribution of transduced striatal
cells was not consistent. This irregular distribution of cells with enhanced anti-apoptotic factor
expression – some parts of the striatum appearing to have the majority of neurons transduced but
adjacent areas showing no visible HA-positive cells – did not appear to follow any structural pattern
in the striatum, although many rats showed numerous transduced cells adjacent to white matter tracts
suggesting the vectors can more readily diffuse or are transported along these tracts. Assuming the
transgenic protein expression remained intracellular, any enhanced resistance against the primary
excitotoxic insult would have been restricted to the transduced cells, making extensive transduction
of the targeted striatal neurons of vital importance. However the presence of HA-tagged transgenic
protein throughout the cerebral cortex following AAV-Bcl-xL delivery suggested that the Bcl-xL
190
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
construct lacking the C-terminal transmembrane domain may possibly have been transported away
from the transduced neurons. While transportation to the cortex may possibly be advantageous to
cortical neurons subjected to apoptotic cell death, the Bcl-xL protein did not appear to be transported
to other striatal neurons. Bcl-xL accumulated to a much greater extent within the striatum than XIAP
despite the same regulatory elements driving expression; however both Bcl-xL and XIAP were
enhanced 60-70 times above detected endogenous expression levels suggesting the different
concentrations maybe related to normal processing of these anti-apoptotic factors. Transduction of
nigral and pallidal neurons indicated the ability for these AAV vectors to be anterogradely and
retrogradely transported to transduce neurons in the target nuclei in agreement with previous reports
(Kaspar et al. 2002).
6.7.1.1
Neuropathological Changes
In the first anti-apoptotic factor investigation I injected the AAV-Bcl-xL vector into the striatum at a
single stereotaxic site prior to delivering QA to the same site three-weeks later. While the most
extensive transduction of the striatal neurons were therefore likely to be found in close proximity to
the QA injection site, the level of excitotoxic stress that these neurons were exposed to would also
have been significantly greater than that in the more distal reaches of the QA-lesion. As a model of
excitotoxic cell death that potentially replicates pathological mechanisms which contribute to HD
neurodegeneration, I felt that the less intensive excitotoxic insult as the QA diffuses away from the
injection site is possibly more representative of the challenges facing striatal neurons in HD patients
than the lesion core, despite still being a very acute model. With striatal cells proximal to the site of
QA injection facing very severe excitotoxicity, multiple forms of cell death pathways are likely to
have been initiated including necrotic mechanisms (Portera-Cailliau et al. 1995; Bordelon et al.
1999), such that a single factor is unlikely to have any discernable impact. Therefore with this
hypothesis of QA-induced cell loss and the lack of any neuroprotection in the initial AAV-Bcl-xL
investigation I continued investigation of anti-apoptotic factors but increased AAV-vector delivery to
two-sites within the striatum slightly removed from the site of QA injection. This enhanced the
proportion of neurons transduced in the “transition zone” of the striatum surrounding the central core
of the QA lesion where there is also greater survival of the less vulnerable striatal interneurons
(Section 3.3.4.2).
The independent enhancement of Bcl-xL or XIAP expression in the striatum by AAV-mediated gene
transfer was not found to confer any statistically significant increase in the resistance of transduced
striatal neurons against QA-induced excitotoxic cell death, although AAV-XIAP treatment did result
in a slightly higher average survival of striatal neurons (Section 6.6.1.3). The lesioned area within
191
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
the treated striatum could be clearly delineated, despite the delivery of AAV-Bcl-xL or AAV-XIAP
prior to QA administration, with no quantified maintenance of striatal neurons, and no apparent
evidence of transduced neurons surviving within the confines of QA lesioning. Co-labelling of
transduced neurons within the unlesioned portion of the striatum with HA and DARPP-32 or krox-24
indicated that expression of transgenic Bcl-xL or XIAP was not disrupting normal cellular processes
to the extent seen with the continuous Luciferase expression in which the transduced neurons lost all
expression of these marker proteins (Section 6.6.3). Although there was no evidence of Bcl-xL or
XIAP supplied maintenance of the striatal neurons, I assessed other neuropathological changes in the
basal ganglia to allow correlations with the changes in functional behaviour. While no significant
differences were observed in the substantia nigra, parvalbumin-positive neurons in the globus
pallidus showed remarkably different levels of maintenance between individual rats irrespective of
treatment group (Section 6.6.6). Only AAV-XIAP rats exhibited a positive correlation with the
extent of striatal lesioning, suggesting pallidal cell death is not solely consequential of the loss of
afferent striatal projections, but may have involved direct QA exposure or be modulated by the AAV
vector transduction. Contrasting results between AAV-Luciferase and PBS injected control rats
prevented assessment regarding any potential neuroprotective action of the anti-apoptotic factors on
maintenance of the globus pallidus, with Luciferase potentially enhancing degeneration of pallidal
neurons as discussed previously (Section 5.8.2.2). Afferent innervations of the striatum by THpositive dopaminergic neurons (Section 6.6.4) and SMI32-positive corticostriatal projections
(Section 6.6.5) demonstrated the disruption of the striosome-matrical architecture of the striatum
following QA lesioning, but neither AAV-Bcl-xL nor AAV-XIAP delivery provided any visibly
discernable protection against the disruption of striatal structural arrangement evident eight-weeks
following acute excitotoxic insult.
6.7.1.2
Behavioural Protection
Despite the lack of a significant reduction in any of the investigated pathological changes induced in
the striatum by QA lesioning, I did observe some attenuation of functional behaviour impairments
when compared with the AAV-Luciferase / PBS treated control rats. AAV-XIAP treated rats, while
tending towards having enhanced striatal maintenance, displayed complete amelioration of an
ipsilateral forelimb use bias in the spontaneous exploratory forelimb use assessment. AAV-Bcl-xL
treated rats in the two-site delivery investigation also had a trend towards a reduction in the
preferential ipsilateral forelimb use that was not quite significant and a similar trend towards reduced
contralateral sensorimotor neglect. Across all treatment groups the extent of ipsilateral forelimb use
bias was correlated with the loss of striatal neurons, while the severity of sensorimotor neglect
192
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
appeared to be more dependent on the maintenance of pallidal neurons. Therefore assuming the
observed trends in functional behaviour for each treatment group reflected real effects of treatment,
AAV-XIAP and AAV-Bcl-xL mediated prevention of a strong ipsilateral forelimb use bias would
tend to indicate enhanced maintenance of striatal neuronal function, while reduced contralateral
sensorimotor neglect in AAV-Bcl-xL treated rats is suggestive of greater globus pallidus
functionality. Although this is circumstantial evidence, it is possible that the anti-apoptotic factors
could have helped maintain the function of surviving neurons without significantly increasing overall
survival of striatal neurons.
Greater variation in the apomorphine-induced rotation direction for both the AAV-Bcl-xL and AAVXIAP treated rats, compared to the predominantly ipsilateral rotations in control rats, tended to also
suggest a reduced severity of striatal lesioning or compensatory changes in the dopamine system
specifically modulated by the enhanced anti-apoptotic factor expression; although I am not aware of
any cellular pathway through which this could have occurred.
In contrast, no attenuation of
apomorphine- or amphetamine-induced rotational behaviour was seen in the initial single-site AAVBcl-xL delivery investigation suggesting a significant difference in the integrity of dopamine
signalling or striatal efferent connections between AAV-Bcl-xL treated rats in the two studies.
Although I only conducted limited overlapping neuropathological analysis of the two AAV-Bcl-xL
studies I did not see any structural changes that would provide an explanation of these differential
performances in apomorphine-induced behaviour.
This therefore raises the question of other
differences in the design of the two investigations. Besides vector delivery the only major design
change was the dietary restriction of the rats in the second investigation required for the food
retrieval based “corridor” task.
Dietary restriction has been shown to induce an increase in
endogenous BDNF expression (Mattson 2000; Duan et al. 2003) which could potentially have had an
influence on the severity of QA lesioning and also more specifically on dopamine receptor
expression. Without an evident reduction in the gross QA-induced striatal pathology in the dietary
restricted study, and similar inducement of ipsilateral rotations in both groups of control rats, the
prevention of ipsilateral rotational behaviour appeared to be a direct effect of the enhanced Bcl-xL
expression – possibly in conjunction with a small increase in endogenous neurotrophic factor
support. Alternatively, with the apomorphine-induced rotation direction correlating strongly with the
maintenance of the globus pallidus, it could be that the pallidal neurons were better maintained in the
second investigation – either by the greater Bcl-xL expression or chance positioning of the QA lesion
causing differential loss of pallidal neurons between treatment groups.
Overall though the
sensorimotor neglect “corridor” task – which appeared to give the most sensitive measure of
193
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
functional behaviour in this QA lesion model – was not significantly attenuated by the prior delivery
of AAV-Bcl-xL or AAV-XIAP.
6.7.2
Comparison with previous studies
The lack of any significant protection of striatal projection neurons by the viral vector delivery of
Bcl-xL or XIAP prior to QA-induced excitotoxicity was in contrast to a number of previously
reported situations in which pro-survival proteins have protected specific populations of neurons
from various apoptosis promoting insults (Section 1.7.1). XIAP has also recently been reported to
protect against the excitotoxic kanic acid insult of CA3 neurons following in vivo delivery of a
XIAP-PTD (protein-transducing-domain) fusion protein (Li et al. 2006) and also glutamate-induced
death of embryonic motor neurons and dorsal root ganglion cultures in vitro (Garrity-Moses et al.
2006).
While these anti-apoptotic factors appear capable of attenuating cell death following
apoptotic-inducing excitotoxic signals, a recent study of transgenic mice over-expressing Bcl-2 failed
to display any reduction in QA-induced striatal cell loss (Maciel et al. 2003). These findings suggest
that QA-induced cell death is not likely to be solely dependant on a single apoptotic mechanism, but
may involve multiple mechanisms of cell death; including non-Bcl protein regulated mitochondrial
permeability transition – commonly induced by high intracellular Ca2+ accumulation following overexcitation (Bordelon et al. 1998) – and neuronal necrosis. With conflicting data surrounding the
actual process of QA-induced cell death, it is possible that QA can activate multiple pathways
leading to cell death depending on experimental conditions. Therefore, while Bcl-2 / Bcl-xL may
protect striatal neurons against mitochondrial dependent apoptotic mechanisms, these pathways may
simply be bypassed through activation of alternative cell death mechanisms including non-caspase
dependent processes. The failure of XIAP to provide any significant protection is strongly indicative
of caspase-independent apoptosis or necrotic cell death pathways. While I verified that both AAVvectors produced functionally active anti-apoptotic proteins capable of preventing the induction of
apoptosis by staurosporine (Chapter 2, (Kells et al. 2006)), I did not specifically test for the
attenuation of QA toxicity in vitro given uncertainties over the induction of apoptotic mechanisms.
6.7.3
Conclusion
The selective degeneration of specific neuronal populations in HD, despite ubiquitous expression of
mutant huntingtin in the CNS, indicates the induction of cell death through mechanisms specifically
related to physiological properties of vulnerable neurons. Excitotoxicity is proposed as a leading
initiator of HD neurodegeneration given intensive glutamate input to the striatum, selective
194
Anti-Apoptotic Factor Delivery: AAV-Bcl-xL and AAV-XIAP
vulnerability of striatal projection neurons to chemical excitotoxins, and direct potentiation of
glutamate receptor signalling by mutant huntingtin.
With the developing and juvenile CNS
appearing remarkably resilient to the presence of mutant huntingtin, it is conceivable that sensitive
apoptotic mechanisms maybe initiated in older neurons that have reduced capacity to handle
potentially destructive cellular stress. Therefore while apoptotic mechanisms initiated via excessive
NMDA receptor signalling may be a significant contributor to the slow progressive degeneration in
the HD brain, the failure of either enhanced Bcl-xL or XIAP expression to significantly attenuate
QA-induced neuronal death in the current investigations may well have been due to the acute,
intensive insult simultaneously initiating multiple cell death pathways such that single factor
intervention is insufficient to ultimately block neurodegeneration. Whether the same process occurs
in the HD brain with cell death occurring via multiple apoptotic and necrotic mechanisms is at this
stage unknown, although apoptotic hallmarks are present in post-mortem HD brains (Section 1.7).
The in vivo gene delivery and overexpression of Bcl-xL or XIAP did not appear to disrupt neuronal
function, but conversely showed a potential preservation of neuronal signalling given the tendency
towards a reduction in the degree of behavioural impairments exhibited by the AAV-Bcl-xL and
AAV-XIAP rats despite no overall enhancement of neuronal maintenance. Therefore these results
suggest that while anti-apoptotic factor production may not be effective as a stand alone therapy, in
conjunction with other more efficacious neuroprotective molecules anti-apoptotic factors may
provide critical preservation of neuronal function in a complimentary fashion. Further investigation
in a more subtle / progressive model of striatal degeneration may also reveal whether the
enhancement of endogenously expressed pro-survival proteins can directly attenuate or slow the
degeneration of striatal neurons.
195
General Discussion
Chapter 7
General Discussion
The prospect that neuroprotective agents which halt the relentless progression of neurodegenerative
processes occurring in the CNS of HD patients, and other neurological disorders will one day be
clinical reality was the ultimate goal driving this thesis research and other similar bodies of current
neuroscience investigation.
7.1 AAV-mediated Gene Delivery
Utilising AAV vectors to mediate the transfer of genetic constructs to the rodent brain, I directed the
enhanced expression of a neurotrophic factor – BDNF or GDNF – or anti-apoptotic factor – Bcl-xL
or XIAP – within vulnerable striatal projection neurons. While AAV vectors themselves have been
shown to be non-toxic, and are currently used extensively in both pre-clinical research and clinical
trials, the spread of vector particles and expression of the encoded therapeutic molecules needs to be
closely analysed on a use-by-use basis. Following intrastriatal injection of the AAV1/2 vectors I
observed extensive transduction of striatal neurons as well as numerous neurons in the globus
pallidus, substantia nigra pars compacta and pars reticulata, and cerebral cortex (Section 4.4.2). This
spread of transduction to cells residing in nuclei connected to the striatum via afferent and efferent
projections indicated the ability for the AAV1/2 vector to be retrogradely, anterogradely and possibly
postsynaptically transported in agreement with previous assessment of AAV vector transportation
(Burger et al. 2004). While this may be potentially advantageous for many applications including
neuroprotection, through the production of a therapeutic agent at both the targeted cell body and its
terminal projection fields, it may also result in undesired deleterious actions.
The extensive
overexpression of BDNF following high-titre AAV vector delivery to the striatum in the initial
investigation resulted in seizure development, aggression, weight-loss and death (Section 5.3).
These deleterious effects were likely to have been induced by enhanced BDNF activity outside the
striatum due to transportation of the AAV-BDNF vector particles, or alternatively the direct
transportation / diffusion of the overexpressed BDNF protein, presumably to the entorhinal cortex or
hippocampus (Pelleymounter et al. 1995; Naert et al. 2006).
Although beyond the scope of this thesis research, future consideration should be given to assessing
the impact of enhanced expression of endogenous proteins – particularly secreted neurotrophic
196
General Discussion
factors – on processes of neurogenesis that occur in the subependymal layer bordering the caudateputamen and appear to be modified in both the HD brain (Curtis et al. 2003; Curtis et al. 2005), and
following QA lesioning (Tattersfield et al. 2004; Gordon et al. 2007). The generation of new
neurons has been shown to occur in the striatum, however the normal physiological importance of
this phenomenon is not clear. Significant changes in the striatal expression of neurotrophic factors
vital for directing brain development are likely to effect the migration, maturation, and / or survival
of subependyma-derived neuroblasts. Although the enhancement of neurotrophic factors prior to
excitotoxic insult was undertaken to primarily investigate protection against neurodegenerative
processes and subsequent functional deficits, without direct assessment of proliferative cell markers
the possible restoration of the striatum via neurotrophic factor mediated neurogenesis / migration
cannot be discounted.
With the mammalian brain potentially containing a regenerative capacity,
gene delivery may provide an avenue through which to promote both neuronal restoration and
enhance long-term survival of new neurons in the HD brain despite the persistence of pathogenic
genetic pressures.
The level of expression required to provide therapeutic intervention following gene transfer is also an
area that needs to be assessed in vivo. The expression cassette I used for all of the AAV vectors was
designed to generate high-level expression that was sustained throughout the entire investigation.
The hybrid CBA promoter is not down-regulated with expression maintained indefinitely following
AAV vector transduction (Klein et al. 2002). While the need for continuous long-term expression is
presumed to be a necessity to counteract slow neurodegenerative processes, the required level of
expression will be specific to the biotherapeutic molecule. Following the welfare issues with AAVBDNF treatment I reduced the expression level by diluting the vector stock prior to delivery;
however this did result in a discernable reduction in the number of neurons that were transduced.
While this was not of great concern for secreted neurotrophic factors, this approach is clearly not
suitable for non-secreted therapeutics in which extensive transduction is paramount. A potentially
better approach would be the incorporation of lower expression or regulatable promoters allowing
extensive transduction of targeted cells but control of the transgene expression levels (Eslamboli et
al. 2005). Surprisingly, the AAV-GDNF transduced neurons in the striatum, while being observed to
have survived QA-induced cell death, displayed complete loss of striatal projection neuron markers
likely to indicate severely compromised function due to the high expression of GDNF protein
(Section 5.7.3). This further highlights the concern with continuous expression of a transgene
product in which the host cells function maybe compromised either by the physical production of the
transgenic protein or via continuous exposure.
While a similar loss of neuronal proteins was
observed in the AAV-Luciferase transduced neurons, the high-expression of anti-apoptotic factors
197
General Discussion
did not induce the same disruption to normal protein expression, suggesting the alterations are
specific to gene expression (Section 6.6.3). Significant changes to dopaminergic mechanisms in the
striatum following enhanced GDNF expression have been previously quantified including increased
dopamine synthesis and turnover (Hudson et al. 1995; Kirik et al. 2000b), with the indication that
enhanced dopamine exacerbates neuronal cell death in the striatum (Cyr et al. 2003).
While
neurochemical alterations were not assessed in the current investigations, the reduction in DARPP-32
neuron expression following high expression of BDNF or GDNF indicate that biochemical signalling
pathways would have been compromised. DARPP-32 has been referred to as a “molecular switch”
modulating the integration of dopaminergic and glutamatergic signalling cascades through its potent
inhibition of protein phosphatase-1 (Gould and Manji 2005); with the phosphorylation state of all
physiological effectors in striatal dopaminoceptive neurons regulated by the DARPP-32 / protein
phosphatase-1 cascade (Greengard et al. 1999).
DARPP-32 knockout mice display significant
reductions in their molecular, physiological and functional behaviour changes normally induced by
dopamine and dopamine-mediated drugs of abuse (Greengard et al. 1999; Valjent et al. 2005). The
use of regulatable promoters allowing the on / off switching of transgene expression would also
provide the ability for pulsatile application of the therapeutic molecule (Jiang et al. 2004;
Goverdhana et al. 2005), which could be more therapeutically beneficial than straight continuous
expression that may lead to down-regulation of receptors and effector proteins.
7.2 Preventative Therapy for Huntington’s Disease
To investigate whether the continuous delivery of these neurotrophic factors or anti-apoptotic
proteins could enhance the resistance of striatal projection neurons, which are selectively vulnerable
to cell death processes in HD, I locally injected QA into the striatum as a model of HD pathological
changes (Chapter 3). QA has been extensively used to model the selective loss of striatal neurons
seen in HD through over excitation of NMDA receptors expressed by striatal projection neurons.
While the actual mechanism of neurodegeneration that occurs in HD has not been fully elucidated,
there is reasonable evidence to suggest that cell death pathways stimulated by excitotoxic insults are
involved with expanded huntingtin causing potentiation of the NR2B subunit expressed by striatal
neurons (Chen et al. 1999; Zeron et al. 2001). It is also conceivable that QA itself may contribute
towards the neurodegeneration (Chiarugi et al. 2001), with an increase in QA being reported in the
HD brain (Guidetti et al. 2004). Therefore while QA tends to replicate the striatal pathology of HD,
the direct intrastriatal injection causes an acute, intense neurotoxic insult localised to the tissue
surrounding the site of injection not representative of the slow progressive HD neurodegeneration.
198
General Discussion
With complete non-selective cell loss directly at the site of QA injection, neuroprotection is more
likely to occur in the surrounding penumbra region where the lower QA concentrations have spared
the less vulnerable interneurons. Given that the QA stimulation of excitotoxic mechanisms greatly
exceeds any similar activation in the actual HD brain, I therefore conversely expect that any
protection seen against QA-induced pathology would be considerably greater in the HD brain.
Of the four proteins assessed as potential therapeutic agents, only enhanced BDNF expression
resulted in a significant quantified protection of striatal neurons against QA-induced excitotoxicity,
displaying gross maintenance of the striatal cytoarchitecture in addition to the survival of individual
striatal projection neurons (Section 5.7.1). While AAV-GDNF transduced cells survived within the
penumbra of the lesioned striatum, they lacked DARPP-32 and krox-24 expression suggesting a loss
of neuron functionality. Neither Bcl-xL nor XIAP overexpression provided any significant protection
to the transduced striatal cells – visually apparent by the absence of HA-positive cells within the
lesioned striatum. However given the spread of the QA lesion – covering approximately half of the
striatum – and substantial variation in the extent of neuronal cell death, it is possible that small levels
of neuroprotective support may have occurred in the peripheral reaches of the lesion but were below
the resolving power of these in vivo studies.
Downregulation of marker proteins raises additional questions over the actual extent of neuronal cell
death following QA, as against the loss of phenotypic markers. A phenomena that has previously
been reported in other neurological models, such as the loss of TH expression following 6hydroxydopamine lesioning despite the persistence of dopaminergic cell bodies and nigrostriatal
projections (Reis et al. 1978; Shirao et al. 1992; Sauer and Oertel 1994). The use of chemical tracers
or histological markers, not biochemically linked to the GABAergic phenotype of the striatal
projection neurons, may have provided more definitive assessment of the striatal neurons fate and
any maintenance of axonal projections following QA. However the loss of Luciferase-expressing
cells within the lesioned striatum of AAV-Luciferase treated control rats suggest that in the absence
of enhanced trophic support the striatal neurons do ultimately die in this 50nmol QA lesion model,
although no time-course of neurodegeneration was determined.
The functional state of the
transduced neurons expressing high-levels of BDNF or GDNF but with significantly down-regulated
DARPP-32 and krox-24 expression remains to be determined, with the possibility that attenuation of
behavioural impairments is resultant of neurotrophic factor activity on other non-transduced striatal
neurons or actions outside of the striatum
The very limited protection of striatal neurons solely by BDNF, despite reports of enhanced neuronal
survival with GDNF and anti-apoptotic factors, brings into question the suitability / relevance of the
199
General Discussion
QA lesion model for conducting neuroprotective investigations of the striatum. GDNF has been
previously shown to protect striatal neurons against cell death induced by the mitochondrial toxin 3NP (McBride et al. 2003) and also in a transgenic mice model of HD (McBride et al. 2006). The
failure of both Bcl-xL and XIAP to provide protection against QA neurotoxicity suggests the
inducement of neurotic cell death or possibly the activation of multiple apoptotic mechanisms such
that a single factor is unable to ultimately prevent degeneration. Despite the apparent severity of
QA-induced striatal degeneration, promising reductions in the extent of QA lesioning have been
reported by transplantation of encapsulated choroid plexus cells secreting multiple neurotrophic
factors (Borlongan et al. 2004; Emerich et al. 2006), and following the combined delivery of
pharmacological agents pyruvate and minocycline (Ryu et al. 2006), suggesting that delivery of
multiple factors can overcome the QA-induced excitotoxic insult. With BDNF gene transfer alone
providing what appeared to be significant maintenance of the gross striatal architecture but minimal
enhancement of neuron survival, it would possibly have been more advantageous to have
investigated co-delivery of the anti-apoptotic factor vectors looking for any additional
complementary physical and functional enhancement of the BDNF-mediated protection.
It is
conceivable that the overexpression of BDNF may have enhanced the striatal neurons capacity to
handle an increase in NMDA receptor activity, but not to the extent of blocking the activation of
apoptotic mechanisms. While QA has provided a readily available model to study excitotoxicity in
the striatum, and more specifically the degeneration of the vulnerable projection neurons; the
severity and acuteness with which QA induces neuronal cell death maybe preventing the true
realisation of therapeutic potential when used to investigate possible neuroprotective agents for HD.
With the development of new transgenic HD models showing progressive degeneration of striatal
projection neurons reminiscent of HD, the reliance on neurotoxic chemical based modelling of HD
neurodegeneration has effectively been eliminated. Additionally, the realisations that pathological
changes in the HD brain are not restricted to the caudate-putamen, but are evident in numerous
regions of the brain such as the neocortex, globus pallidus, substantia nigra and thalamus (Vonsattel
and DiFiglia 1998) make it important that future research into preventative therapies for HD do not
neglect to consider the impact of these regions.
The confirmation of BDNF as a potential biotherapeutic molecule to prevent or restrict the
degeneration of striatal projection neurons following AAV vector mediated gene delivery to the
striatum, and the significant amelioration of functional behavioural defects displayed in these
investigations further highlights the importance of BDNF in the functional maintenance of the
striatum. With the necessity of BDNF for the functional maintenance of the striatal GABAergic
neurons (Nakao et al. 1995; Ventimiglia et al. 1995), the well documented reduction of BDNF levels
200
General Discussion
in HD patients (Ferrer et al. 2000; Zuccato et al. 2001) and transgenic mice (Zuccato et al. 2005),
and the impaired transport of BDNF by mutant huntingtin (Zuccato et al. 2001; Zuccato et al. 2003),
an enhancement of striatal BDNF appears promising as a therapeutic approach. The disruption of
intracellular transport by expanded huntingtin may limit the transportation of BDNF to the striatal
target nuclei following the transduction of striatal neurons that I observed in these investigations;
however this may also limit the spread to undesired CNS regions reducing the potential for
deleterious side effects.
Finally the attenuation of behavioural deficits was found to correlate with the survival of both striatal
and pallidal neurons, although the loss of parvalbumin-positive GABAergic neurons in the globus
pallidus showed considerable variation within each treatment group that was largely independent
from the extent of striatal degeneration. A specific cause for the degeneration of pallidal neurons
following intrastriatal QA injection was undetermined, but potentially involved direct QA exposure,
secondary neurodegeneration, or an adverse consequence of AAV vector transduction.
With
considerable variation in the extent of pallidal degeneration any maintenance following
overexpression of BDNF, Bcl-xL or XIAP was indeterminable. It was however interesting to observe
gross alterations in functional behaviour correlations with the integrity of both the striatum and
globus pallidus following striatal gene delivery. While the gross level of locomotor activity did not
appear to display large changes following striatal lesioning, the unilateral QA lesion did induce
lateralised imbalances in motor control with an apparent reduction in sensorimotor activity
contralateral to the lesioned striatum. Attenuation of contralateral forelimb use deficits by AAVmediated therapeutic expression, without maintenance of DARPP-32 striatal neurons, resulted in a
weaker correlation between preferential forelimb use and striatal integrity, with the AAV-BDNF
treated rats specifically acquiring a strong correlation to the extent of pallidal cell survival, which
was not exhibited by the control rats (Section 5.7.7.1). A similar pattern was observed for the
amelioration of sensorimotor neglect following AAV-BDNF delivery, with a reduced correlation to
the relative survival of striatal neurons, but enhanced correlation with pallidal neuronal maintenance.
The degree of contralateral neglect in the “corridor” task was found to correlate with the integrity of
the globus pallidus for all rats irrespective of treatment – presumably reflecting the enhanced sensory
complexity of this lateralised selection task over the spontaneous forelimb use analysis. In addition
to the reduced contralateral motor activity observed in these two non-drug induced behavioural
analyses, the administration of apomorphine following the unilateral striatal lesioning induced
rotational behaviour that was generally towards the lesioned striatum. However correlation analysis
with the relative survival of pallidal neurons showed a strong relationship between the integrity of
the globus pallidus and the direction of induced rotation following striatal lesioning – ipsilateral
201
General Discussion
rotations induced when the pallidus was disrupted but contralateral rotations if the pallidus was fully
maintained.
AAV-BDNF delivery weakened the directional correlation with end-point pallidal
pathology, possibly due to direct BDNF-induced modification of dopamine processing / signalling
(Section 5.8.2.1) and / or enhanced maintenance of striatal projection neurons that resulted in
apomorphine-induced ipsilateral rotations in initial tests following QA injections but contralateral
rotations in later trials. Variation in the extent of striatal lesioning alone appeared to have no
discernable influence on the direction of the apomorphine-induced rotations in these neuroprotective
investigations despite previous reports of the lesion size and position influencing drug-induced
rotations (Dunnett et al. 1988; Norman et al. 1992; Fricker et al. 1996; Nakao et al. 1996; Nakao and
Brundin 1997).
These behavioural deficit correlations with neuropathology changes highlight the importance of the
globus pallidus as a major striatal output nucleus for facilitating motor control, with BDNF
overexpression specifically appearing to have a much greater functional impact when the pallidal
neurons are maintained. Assessment of the globus pallidus has not previously been reported in
neuroprotective investigations following striatal lesioning, however lesioning of the GPe (equivalent
to the rodent globus pallidus) has been proposed as a potential treatment to correct HD symptoms
(Joel et al. 1998; Ayalon et al. 2004; Reiner 2004; Temel et al. 2006). The basic direct pathway /
indirect pathway model of basal ganglia circuitry describes two major striatal output circuits;
stimulation of the direct pathway leading to disinhibition of the thalamus via the GPi and SNr, and
the indirect striatopallidal projections increasing thalamic inhibition via the GPe, subthalamic
nucleus and GPi (Penney and Young 1986; Crossman 1987; Albin et al. 1995; Joel 2001). Although
the direct GPi / SNr pathway is generally considered to promote intended movements by enhancing
thalamocortical activity, and the indirect GPe pathway suppressing movements, they are presumed to
have complimentary roles in controlling desired locomotion (Penney and Young 1986; DeLong
1990). Ayalon et al. (2004) reported that bilateral QA lesioning of the rat globus pallidus resulted in
attenuation of behavioural impairments acquired following QA lesioning of the striatum and that
pallidal lesions alone did not generally induce severe impairments in motor and cognitive tasks;
however a slight reduction in activity was observed in some of their functional assessments as
predicted by the basal ganglia circuitry model following a lesion of the GPe. The current findings
that contralateral hypokinesia and sensorimotor neglect are exhibited following striatal lesioning, and
are potentially compounded by a loss of pallidal neurons, appear contradictory to the earlier studies
but may be resultant of different behavioural assessments or the use of unilateral lesioning compared
with the earlier bilateral lesions. Lesioning of the globus pallidus is suggested as a treatment strategy
for attenuating the hyperkinetic chorea symptoms of HD generally exhibited in the earlier stages of
202
General Discussion
disease progression; however the implications raised in these investigations – that a loss of pallidal
neurons following striatal degeneration will enhance hypokinesia – as predicted by basal ganglia
circuitry – highlights the concern that pallidal lesioning may exuberate the late-stage HD akinesia /
bradykinesia symptoms (Reiner 2004). With the correlations between non-drug induced behavioural
impairments and the integrity of the globus pallidus being significantly enhanced in the AAV-BDNF
treated rats, it is possible that the observed BDNF-mediated amelioration of motor deficits were
resultant of BDNF attenuating or compensating for the loss of striatal neurons but having no direct
effect on any pathological changes in the globus pallidus. Although not investigated in the current
studies,
the
differential
loss
/
maintenance
of
striatopallidal
(direct
pathway)
and
striatoentopenducular (indirect pathway) neurons, and the integrity of the entopenducular nucleus
should also be considered to further elucidate the pathological basis of the behavioural deficits I
observed. Lesioning of the GPi (equivalent to the rodent entopenducular nucleus; pallidotomy) is
known to alleviate hypokinetic motor dysfunction in Parkinson’s disease patients through
eliminating the over-inhibition of the thalamus and thereby allowing easier initiation of movement
(Bergman and Deuschl 2002). Byler et al. (2006) recently demonstrated that unilateral electrolytic
lesioning of the entopenducular nucleus in rats induced hyperlocomotion with a tendency for
ipsilateral circling behaviour, but they also reported the development of sensorimotor asymmetries
and contralateral forelimb motor deficits which they proposed were due to non-specific damage to
fibres of passage within the internal capsule (Byler et al. 2006). This would suggest that hyperactive
motor impairments normally induced by specific entopenducular nucleus lesioning can be modified
by pathological disruption to other basal ganglia circuitry, and that pathological disruption of pallidal
neurons in the direct pathway may not be evident from behavioural testing. With the primary
pathology in the current investigations localised to the striatum, there exists the possibility that
behavioural impairments could partially be attributed to an unequal loss / protection of striatopallidal
neurons differentially projecting to the internal and external segments of the globus pallidus.
However with the exception of AAV-BDNF treated rats that did not develop contralateral deficits,
the lesioned striatum displayed fairly extensive loss of DARPP-32 neurons and provided no
indication of differential vulnerabilities between the GABAergic projections as have been previously
reported to occur following QA lesioning (Figueredo-Cardenas et al. 1994) and in early stage HD
(Reiner et al. 1988; Sapp et al. 1995). A more tenable explanation for the behavioural deficit
correlations with neuropathology changes maybe that the striatal lesioning disrupts processing of
sensory inputs from the cortex, thereby resulting in reduced ability to initiate contralateral motor
activity response to sensory input, with disruption to the globus pallidus acting to exaggerate any
impairment of striatal output signalling in comparison to the intact contralateral basal ganglia.
203
General Discussion
7.3 Conclusion
Overall this thesis highlights the vital importance to assess putative biotherapeutic agents using in
vivo model systems and the need to consider adverse complications that can arise from nonregulatable control of transgene expression following gene delivery. Utilisation of AAV1/2 vectors to
mediate gene transfer to the striatum led to efficient transduction of striatal neurons, directing highlevel expression of biologically functional proteins within the striatum prior to QA-induced
lesioning. Additional transduction of neurons in CNS regions directly connected to the striatum also
occurred to a lesser extent, which could potentially be of therapeutic benefit for striatal protection
though enhanced trophic support within the terminal-fields, but may also induce unintended
consequences such as the observed induction of seizures by BDNF.
Maintenance of the striatum by BDNF, accompanied by an attenuation of the behavioural
impairments exhibited following acute excitotoxic lesioning of the striatum, provided further
evidence of the promising therapeutic potential that BDNF holds for preventing the progression of
HD. Further investigation is required however to determine an optimal level of BDNF expression
and fully elucidate the impact of continuous long-term overexpression. Enhancement of striatal
GDNF did not replicate the previously reported neuroprotective support of striatal neurons, with
substantial disruption to the striatal architecture and an apparent downregulation of both the
intracellular dopamine and glutamate signal modulating protein DARPP-32, and the early response
neuronal transcription factor krox-24. Similar to the enhanced BDNF expression, the disruption to
normal physiological protein expression suggested large increases in the striatal expression of GDNF
is detrimental to the functionality of dopaminoceptive striatal neurons, negating any trophic
assistance GDNF may potentially provide against excitotoxic stress when available to striatal
neurons at lower concentrations. Together these BDNF and GDNF investigations demonstrated the
prospect neurotrophic factor based therapy holds for reducing the susceptibility of striatal neurons in
neurodegenerative disease, although the imperative need for greater control over the location and
quantity of endogenously expressed proteins is clearly manifested. To my knowledge this is the first
study to demonstrate downregulation of DARPP-32 and krox-24 in striatal projection neurons
following the overexpression of neurotrophic factors and QA lesioning.
Enhanced expression of a single anti-apoptotic protein by striatal projection neurons did not convey
any reduction in their susceptibility to acute excitotoxic-induced neurodegeneration. However the
overexpression of either Bcl-xL or XIAP in the striatum provided attenuation against the severity of
behavioural impairments, suggesting enhanced functionality of the maintained neurons with no
204
General Discussion
apparent transgene induced disruption of normal host cell signalling pathways. As intracellular
therapeutic agents, the high efficiency of transduction provided by the AAV1/2 vectors, without any
adverse effects in these studies, is vital to ensure extensive expression of the vulnerable striatal
neurons. Therefore while these investigations suggest anti-apoptotic factors in isolation may not
prevent excitotoxic-induced neurodegeneration, they may well be of significant therapeutic benefit in
a combined treatment strategy to prevent unintended inducement of apoptotic death and enhance the
maintenance of neuronal function.
This thesis investigation also demonstrates the critical involvement of basal ganglia neurons beyond
the striatum in modulating sensorimotor behaviour following acute lesioning of the striatum, and the
importance for preventative HD treatment strategies to also consider the impact of other primary or
secondary areas of neurodegeneration on HD symptoms. Maintenance of the globus pallidus proved
vital in attenuating the degree of sensorimotor deficits and reversing drug-induced effects on
locomotor activity following QA lesioning. As more accurate transgenic models of HD become
available and inducible promoters of transgene expression are incorporated into the gene expression
cassettes, future investigation targeting in vivo delivery of neurotrophic factors and other
endogenously
expressed
pro-survival
factors
to
areas
of
mutant
huntingtin
induced
neurodegeneration may well display considerable enhancement of the pathological and behavioural
protection I observed in these investigative therapeutic studies.
Ultimately the safe and efficient demonstration of chimeric AAV-vectors to deliver biotherapeutics
to the striatal neurons and specifically the maintenance of striatal structure and amelioration of
functional impairments following the enhancement of BDNF, known to be depleted in the HD brain,
confirms the promising potential for in vivo gene therapy strategies to prevent the onset or slow
progression of neurodegeneration.
205
Appendix A: Gene Sequences and DNA Plasmids
Appendix A:
Gene Sequences and DNA Plasmids
A.1 cDNA Gene Sequences
Combined sequences from pGEM-T Easy cloning vectors and reverse sequencing of AAV-backbone
vectors across the C-terminal HA-tag.
Initial ATG (methionine) start codon and the TGA TAG TAA stop codons are highlighted.
Restriction sites flanking the cDNA sequences are underlined.
HA-tag sequence: TAT CCG TAT GAT GTT CCT GAT TAT GCT
A.1.1
Brain Derived Neurotrophic Factor
BDNF cDNA sequence PCR cloned out of pAM/CRE-BDNF-WPRE-bGHpA (M. During and
D. Young, Department of Molecular Medicine and Pathology, The University of Auckland)
BLAST alignment with:
Homo sapiens brain-derived neurotrophic factor (BDNF), transcript variant 1, mRNA.
Accession Number: NM_170735.4
Complete match with bases 563..1303
Signal peptide
563..616
Pro-protein
617..1303
Mature peptide
947..1303
Protein Identity with Rattus norvegicus: 96% (positives 97%)
CTC GAG CAC CAG GTG AGA AGA GTG ATG ACC ATC CTT TTC CTT ACT ATG GTT
ATT TCA TAC TTT GGT TGC ATG AAG GCT GCC CCC ATG AAA GAA GCA AAC ATC
CGA GGA CAA GGT GGC TTG GCC TAC CCA GGT GTG CGG ACC CAT GGG ACT CTG
GAG AGC GTG AAT GGG CCC AAG GCA GGT TCA AGA GGC TTG ACA TCA TTG GCT
GAC ACT TTC GAA CAC GTG ATA GAA GAG CTG TTG GAT GAG GAC CAG AAA GTT
CGG CCC AAT GAA GAA AAC AAT AAG GAC GCA GAC TTG TAC ACG TCC AGG GTG
ATG CTC AGT AGT CAA GTG CCT TTG GAG CCT CCT CTT CTC TTT CTG CTG GAG
GAA TAC AAA AAT TAC CTA GAT GCT GCA AAC ATG TCC ATG AGG GTC CGG CGC
CAC TCT GAC CCT GCC CGC CGA GGG GAG CTG AGC GTG TGT GAC AGT ATT AGT
GAG TGG GTA ACG GCG GCA GAC AAA AAG ACT GCA GTG GAC ATG TCG GGC GGG
ACG GTC ACA GTC CTT GAA AAG GTC CCT GTA TCA AAA GGC CAA CTG AAG CAA
TAC TTC TAC GAG ACC AAG TGC AAT CCC ATG GGT TAC ACA AAA GAA GGC TGC
206
Appendix A: Gene Sequences and DNA Plasmids
AGG GGC ATA GAC AAA AGG CAT TGG AAC TCC CAG TGC CGA ACT ACC CAG TCG
TAC GTG CGG GCC CTT ACC ATG GAT AGC AAA AAG AGA ATT GGC TGG CGA TTC
ATA AGG ATA GAC ACT TCT TGT GTA TGT ACA TTG ACC ATT AAA AGG GGA AGA
AGA TCT TAT CCG TAT GAT GTT CCT GAT TAT GCT TGA TAG TAA
A.1.2
Glial cell-line Derived Neurotrophic Factor
GDNF cDNA sequence PCR cloned out of AAV/NSE-GDNF-WPRE-bGHpA (M. During and
D. Young, Department of Molecular Medicine and Pathology, The University of Auckland)
BLAST alignment with:
Rattus norvegicus glial cell-line derived neurotrophic factor (GDNF), mRNA.
Accession Number: NM_019139.1
Complete match with bases 50..682
Signal peptide
50..106
Mature peptide
344..682
Protein Identity with Homo sapiens: 92% (positives 95%)
C TCG AGC GGA CGG GAC TCT AAG ATG AAG TTA TGG GAT GTC GTG GCT GTC
TGC CTG GTG TTG CTC CAC ACC GCG TCT GCC TTC CCG CTG CCC GCC GGT AAG
AGG CTT CTC GAA GCG CCC GCC GAA GAC CAC TCC CTC GGC CAC CGC CGC GTG
CCC TTC GCG CTG ACC AGT GAC TCC AAT ATG CCC GAA GAT TAT CCT GAC CAG
TTT GAT GAC GTC ATG GAT TTT ATT CAA GCC ACC ATC AAA AGA CTG AAA AGG
TCA CCA GAT AAA CAA GCG GCG GCA CTT CCT CGA AGA GAG AGG AAC CGG CAA
GCT GCA GCT GCC AGC CCA GAG AAT TCC AGA GGG AAA GGT CGC AGA GGC CAG
AGG GGC AAA AAT CGG GGG TGC GTC TTA ACT GCA ATA CAC TTA AAT GTC ACT
GAC TTG GGT TTG GGC TAC GAA ACC AAG GAG GAA CTG ATC TTT CGA TAT TGT
AGC GGT TCC TGT GAA GCG GCC GAG ACA ATG TAC GAC AAA ATA CTA AAA AAT
CTG TCT CGA AGT AGA AGG CTA ACA AGT GAC AAG GTA GGC CAG GCA TGT TGC
AGG CCG GTC GCC TTC GAC GAC GAC CTG TCG TTT TTA GAC GAC AGC CTG GTT
TAC CAT ATC CTA AGA AAG CAT TCC GCT AAA CGG TGT GGA TGT ATC AGA TCT
TAT CCG TAT GAT GTT CCT GAT TAT GCT TGA TAG TAA
207
Appendix A: Gene Sequences and DNA Plasmids
A.1.3
Bcl-xL
Bcl-xL cDNA PCR cloned out of pcDNA3-HA-Bcl-xL (Science Reagents)
BLAST alignment with:
Homo sapiens BCL2-like 1 (BCL2L1), nuclear gene encoding mitochondrial protein,
transcript variant 1, mRNA.
Accession Number: NM_138578.1
Complete match with bases 367..1002
Gene
367-1068
Protein Identity with Rattus norvegicus: 97% (positives 98%)
CT CGA GTT ATA AAA ATG TCT CAG AGC AAC CGG GAG CTG GTG GTT GAC TTT
CTC TCC TAC AAG CTT TCC CAG AAA GGA TAC AGC TGG AGT CAG TTT AGT GAT
GTG GAA GAG AAC AGG ACT GAG GCC CCA GAA GGG ACT GAA TCG GAG ATG GAG
ACC CCC AGT GCC ATC AAT GGC AAC CCA TCC TGG CAC CTG GCA GAC AGC CCC
GCG GTG AAT GGA GCC ACT GGC CAC AGC AGC AGT TTG GAT GCC CGG GAG GTG
ATC CCC ATG GCA GCA GTA AAG CAA GCG CTG AGG GAG GCA GGC GAC GAG TTT
GAA CTG CGG TAC CGG CGG GCA TTC AGT GAC CTG ACA TCC CAG CTC CAC ATC
ACC CCA GGG ACA GCA TAT CAG AGC TTT GAA CAG GTA GTG AAT GAA CTC TTC
CGG GAT GGG GTA AAC TGG GGT CGC ATT GTG GCC TTT TTC TCC TTC GGC GGG
GCA CTG TGC GTG GAA AGC GTA GAC AAG GAG ATG CAG GTA TTG GTG AGT CGG
ATC GCA GCT TGG ATG GCC ACT TAC CTG AAT GAC CAC CTA GAG CCT TGG ATC
CAG GAG AAC GGC GGC TGG GAT ACT TTT GTG GAA CTC TAT GGG AAC AAT GCA
GCA GCC GAG AGC CGA AAG GGC CAG GAA CGC TTC AAC CGC AGA TCT TAT CCG
TAT GAT GTT CCT GAT TAT GCT TGA TAG TAA
A.1.4
X-linked Inhibitor of Apoptosis
XIAP cDNA PCR cloned out of pCI-neo-Flag-XIAP (Science Reagents)
Homo sapiens Baculoviral IAP repeat-containing 4 (BIRC4), mRNA.
Accession Number: NM_001167
Complete match with bases 129..1619
Gene
129..1619
Protein Identity with Rattus norvegicus: 89% (positives 95%)
C TCG AGA ATG ACT TTT AAC AGT TTT GAA GGA TCT AAA ACT TGT GTA CCT
GCA GAC ATC AAT AAG GAA GAA GAA TTT GTA GAA GAG TTT AAT AGA TTA AAA
208
Appendix A: Gene Sequences and DNA Plasmids
ACT TTT GCT AAT TTT CCA AGT GGT AGT CCT GTT TCA GCA TCA ACA CTG GCA
CGA GCA GGG TTT CTT TAT ACT GGT GAA GGA GAT ACC GTG CGG TGC TTT AGT
TGT CAT GCA GCT GTA GAT AGG TGG CAA TAT GGA GAC TCA GCA GTT GGA AGA
CAC AGG AAA GTA TCC CCA AAT TGC AGA TTT ATC AAC GGC TTT TAT CTT GAA
AAT AGT GCC ACG CAG TCT ACA AAT TCT GGT ATC CAG AAT GGT CAG TAC AAA
GTT GAA AAC TAT CTG GGA AGC AGA GAT CAT TTT GCC TTA GAC AGG CCA TCT
GAG ACA CAT GCA GAC TAT CTT TTG AGA ACT GGG CAG GTT GTA GAT ATA TCA
GAC ACC ATA TAC CCG AGG AAC CCT GCC ATG TAT AGT GAA GAA GCT AGA TTA
AAG TCC TTT CAG AAC TGG CCA GAC TAT GCT CAC CTA ACC CCA AGA GAG TTA
GCA AGT GCT GGA CTC TAC TAC ACA GGT ATT GGT GAC CAA GTG CAG TGC TTT
TGT TGT GGT GGA AAA CTG AAA AAT TGG GAA CCT TGT GAT CGT GCC TGG TCA
GAA CAC AGG CGA CAC TTT CCT AAT TGC TTC TTT GTT TTG GGC CGG AAT CTT
AAT ATT CGA AGT GAA TCT GAT GCT GTG AGT TCT GAT AGG AAT TTC CCA AAT
TCA ACA AAT CTT CCA AGA AAT CCA TCC ATG GCA GAT TAT GAA GCA CGG ATC
TTT ACT TTT GGG ACA TGG ATA TAC TCA GTT AAC AAG GAG CAG CTT GCA AGA
GCT GGA TTT TAT GCT TTA GGT GAA GGT GAT AAA GTA AAG TGC TTT CAC TGT
GGA GGA GGG CTA ACT GAT TGG AAG CCC AGT GAA GAC CCT TGG GAA CAA CAT
GCT AAA TGG TAT CCA GGG TGC AAA TAT CTG TTA GAA CAG AAG GGA CAA GAA
TAT ATA AAC AAT ATT CAT TTA ACT CAT TCA CTT GAG GAG TGT CTG GTA AGA
ACT ACT GAG AAA ACA CCA TCA CTA ACT AGA AGA ATT GAT GAT ACC ATC TTC
CAA AAT CCT ATG GTA CAA GAA GCT ATA CGA ATG GGG TTC AGT TTC AAG GAC
ATT AAG AAA ATA ATG GAG GAA AAA ATT CAG ATA TCT GGG AGC AAC TAT AAA
TCA CTT GAG GTT CTG GTT GCA GAT CTA GTG AAT GCT CAG AAA GAC AGT ATG
CAA GAT GAG TCA AGT CAG ACT TCA TTA CAG AAA GAG ATT AGT ACT GAA GAG
CAG CTA AGG CGC CTG CAA GAG GAG AAG CTT TGC AAA ATC TGT ATG GAT AGA
AAT ATT GCT ATC GTT TTT GTT CCT TGT GGA CAT CTA GTC ACT TGT AAA CAA
TGT GCT GAA GCA GTT GAC AAG TGT CCC ATG TGC TAC ACA GTC ATT ACT TTC
AAG CAA AAA ATT TTT ATG TCT CGC GAA TTC GGA AGA TCT TAT CCG TAT GAT
GTT CCT GAT TAT GCT TGA TAG TAA
209
Appendix A: Gene Sequences and DNA Plasmids
A.2 DNA Plasmid Maps
A.2.1
AAV Backbone Plasmid
ITR
Nco I (434)
CAG promoter
XbaI (1026)
BamHI (1127)
Xho I (1134)
Amp
pAM/CAG-C-termHA-WPRE-bGHpA
5411 bp
Eco RI (1163)
BglII (1172)
HA
HindIII (1212)
ClaI (1219)
WPRE
ClaI (1814)
pUC19 ori
bGH pA
ITR
Nco I (2393)
SV40 ori
Replacement of the insert DNA stop-codon with either a EcoRI or BglII restriction site allows inframe C-terminal fusion with the nine amino acid HA epitope tag.
HA-tag sequence with 5’ EcoRI (GAATTC) and BglII (AGATCT) restriction sites and triplicate stop
codons (TGA TAG TAA):
GAA TTC GGA AGA TCT TAT CCG TAT GAT GTT CCT GAT TAT GCT TGA TAG TAA
210
Appendix A: Gene Sequences and DNA Plasmids
A.2.2
AAV-Luciferase
ITR
NcoI (600)
CBA promoter
XbaI (1186)
Amp
BamHI (1293)
XhoI (1298)
EcoRI (1303)
pAM/CBA-Luc-WPRE-bGHpA
HindIII (1324)
7336 bp
NcoI (1356)
pUC19 ori
Luciferase
XbaI (3023)
SV40 ori
NcoI (4253)
NotI (3042)
HindIII (3049)
ITR
bGH pA
WPRE
AAV-expression cassette containing a Firefly Luciferase cDNA sequence supplied by M. During and
D. Young
211
Appendix A: Gene Sequences and DNA Plasmids
A.2.3
A.2.3.1
AAV Helper Plasmids
AAV rep and cap genes
XbaI (1)
AAV-2 rep
Restriction digest with XbaI
2 bands:
- 7505bp
- 3867bp
pRV1
11372 bp
AAV-2 cap
XbaI (7505)
pRV1: Diagrammatic representation only – restriction sites are only representative of fragment
lengths when digested with XbaI, actual location within plasmid was unknown.
Sac I (38)
Sac I (578)
Restriction digest with SacI
3 bands:
- 3953bp
- 2837bp
- 540bp
pH21
7320 bp
Sac I (4531)
AAV-1 cap
212
AAV-2 rep
Appendix A: Gene Sequences and DNA Plasmids
A.2.3.2
Adenoviral packaging genes
HindIII (519)
HindIII (14420)
EcoRI (550)
E4
EcoRI (2888)
HindIII (2900)
pF_ 6
pF∆6
HindIII (11483)
VA
15423 bp
Fiber
pVIII
E2A DNA binding protein
EcoRI (9475)
33K
HindIII (8472)
100kD hexon assembly protein
Restriction digest with HindIII
5 bands:
- 5572bp
- 3011bp
- 2937bp
- 2381bp
- 1522bp
Or with EcoRI
3 bands:
- 6587bp
- 6490bp
- 2338bp
213
Appendix B: General Materials
Appendix B:
General Materials & Protocols
B.1 Molecular Biology
Luria-Bertani broth (LB)
20 g/L LB broth, ready-made powder (USB) containing casein peptone, yeast extract and
NaCl.
LB amp Agar plates
20 g/L LB broth, ready-made powder (USB)
25 g/L Agar (USB)
Autoclave sterilised
Added 50 mg/L ampicillin
poured 25 mL/plate
Ampicillin (amp)
50 mg/mL Ampicillin, sodium salt (Sigma-Aldrich) in sterile dH2O
added to LB or LB agar at 1:1000 (50 µg/mL)
X-gal
20 mg/mL X-gal (Sigma-Aldrich) in dimethysulfoxide (DMSO; Sigma-Aldrich)
spread 40µL onto pre-poured LB amp agar plates and dried.
1% Agarose Gel Electrophoresis
250 mg SeaKem®LE Agarose (BioWhittaker Molecular Applications) was added to 25 mL
1× TAE buffer and microwaved to melt agarose. 1µL ethidium bromide (Invitrogen) added
to agarose and poured into a gel casting tray to set.
DNA samples with 1× gel loading dye were transferred to wells in the gel alongside 5-10 µL
1kb+ DNA ladder (0.1µg/µL; Invitrogen) and gel electrophoresis run at 100 volts. DNA
bands were visualised under short wave UV light using a Gel Documentation System.
TAE buffer (50× stock)
Tris base
EDTA
Glacial Acetic acid
pH adjusted to 8.5
2M
100 mM
1M
Tris EDTA (TE) Buffer
Tris-HCl
Na2EDTA
autoclaved sterilised
(pH 7.5)
(pH 8.0)
Gel Loading Dye (10×)
Bromophenol Blue
Xylene Cyanol
Sucrose
10 mM
1 mM
0.25% w/v
0.25% w/v
40.0% w/v
214
Appendix B: General Materials
B.2 Cell Culture
B.2.1
Tissue culture media
Culture Media / Reagent
Supplier
Cat. No.
Dulbecco’s Modified Eagle Media (DMEM)
GIBCO®
12100
Iscove’s Modified Dulbecco’s Media (IMDM)
GIBCO®
12200
Leibovitz’s L-15
GIBCO®
11415
Neurobasal™ Medium
GIBCO®
21103
100× L-glutamine
GIBCO®
25030
100× Sodium pyruvate
GIBCO®
11360
100× Penicillin-Streptomycin
GIBCO®
15140
100× Non-essential amino acids
GIBCO®
11140
B27
GIBCO®
17504
Fetal Bovine Serum (FBS)
GIBCO®
10091
Dulbecco’s Modified Eagle Media (DMEM)
3.7g Sodium hydrogen carbonate
pH 7.1 with 10N NaOH
Added: Non-essential amino acids, Sodium pyruvate, Penicillin-Streptomycin
Iscove’s Modified Dulbecco’s Media (IMDM)
3.0g Sodium hydrogen carbonate
Leibovitz’s L15
Added: Penicillin-Streptomycin, D-glucose (3 g/L)
Neurobasal™ Medium
Added: L-glutamine, Penicillin-Streptomycin, D-glucose (3 g/L)
B.2.2
Cell counting
Hemocytometer Cell Counting
85µL serum-free media
10µL Trypan blue
5µL Cell suspension
The trypan blue / cell mixture was transferred to a hemocytometer and viable cells in the four
corner squares counted under a Nikon TE200 inverted scope.
cell count
4
× 104 × 20 = Cells / mL
215
Appendix B: General Materials
B.3 AAV Vector Genomic Titering
Plasmid Standard Calculation
50µg/mL DNA of 1kb has 4.74 x 1013 molecules per mL
4.74 × 1013
×
plasmid size (kb)
plasmid conc. ( µg /mL)
5 × 10 4
Log template copies = Ct value −
= DNA copies / µL
y intercept
slope
Genome copies / mL = 10 Log template copies × dilution factor ×
B.4 Immunocytochemistry Buffers
10× Phosphate Buffered Saline (PBS)
KH2PO4
18 mM
82 mM
Na2HPO4
NaCl
1.4 M
KCl
27 mM
PBS-Triton
1× PBS plus 0.2% Triton X-100
0.4M PB
NaH2PO4
Na2HPO4
pH adjusted to 7.2
76 mM
324 mM
0.1M Phosphate Buffer
NaH2PO4
Na2HPO4
pH adjusted to 7.2
28 mM
72 mM
Cyroprotectant Solution
Phosphate buffer
Sucrose
Ethylene glycol
0.5 M
30 % w/v
30 % v/v
4% Paraformaldehyde
Phosphate buffer
0.1 M
Paraformaldehyde
4 % w/v
heated to 60°C to dissolve
pH adjusted to 7.4
216
1000
× 2
template volume used ( µL)
Appendix B: General Materials
DAB
3,3’-diaminobenzidine tetrahydrochloride (DAB) 0.5 mg/mL
Phosphate buffer
0.1 M
Hydrogen peroxide
0.01 % v/v
Nickel sulphide
0.04 % w/v (optional)
B.5 Antibodies
Primary Antibody
Host species
Dilution
Company
Cat #
NeuN
mouse
1:1000
Chemicon
MAB 377
Calbindin
mouse
1:5000
Swant
300
DARPP-32
rabbit
1:750
Chemicon
AB1656
Parvalbumin
mouse
1:5000
Swant
235
NOS
sheep
1:10000
Piers Emson
-
ChAT
goat
1:500
Chemicon
AB144P
Calretinin
rabbit
1:5000
Swant
7699/4
HA.11
mouse
1:1000
Covance
MMS-101R
Luciferase
goat
1:10000
Chemicon
AB3256
Tyrosine Hydroxylase
rabbit
1:500
Chemicon
AB152
Krox-24 (Egr-1 (C-19))
rabbit
1:1000
Santa Cruz
Sc-189
GFAP
rabbit
1:500
Dako
Z0334
SMI32
mouse
1:10000
Sternberger
Monoclonals
SMI-32R
Biotinlyated
Secondary Antibody
Host species
Blocking
Serum
Company
Cat #
Anti-mouse
Goat
Goat
Sigma-Aldrich
B7264
Anti-rabbit
Goat
Goat
Sigma-Aldrich
B7389
Anti-sheep
Donkey
Goat
Sigma-Aldrich
B7390
Anti-goat
Rabbit
-
Sigma-Aldrich
B7014
Alexa Fluor®
Secondary Antibody
Host species
Blocking
Serum
Company
Cat #
488 anti-goat
Donkey
Donkey
Invitrogen
A11055
488 anti-rabbit
Goat
Donkey
Invitrogen
A11034
594 anti-mouse
Goat
Donkey
Invitrogen
A11032
594 anti-goat
Donkey
Donkey
Invitrogen
A11058
217
Literature References
Literature References
Abrous, D.N., Torres, E.M. and Dunnett, S.B. (1993). Dopaminergic grafts implanted into the
neonatal or adult striatum: comparative effects on rotation and paw reaching deficits induced
by subsequent unilateral nigrostriatal lesions in adulthood. Neuroscience 54(3): 657-68.
Adams, J.M. (2003). Ways of dying: multiple pathways to apoptosis. Genes & Development 17(20):
2481-95.
Alberch, J., Perez-Navarro, E. and Canals, J.M. (2004). Neurotrophic factors in Huntington's
disease. Progress in Brain Research 146: 195-229.
Albin, R.L., Young, A.B. and Penney, J.B. (1995). The functional anatomy of disorders of the basal
ganglia. Trends in Neurosciences 18(2): 63-4.
Alexander, G.E., DeLong, M.R. and Strick, P.L. (1986). Parallel organization of functionally
segregated circuits linking basal ganglia and cortex. Annual Review of Neuroscience 9: 35781.
Alexi, T., Venero, J.L. and Hefti, F. (1997). Protective effects of neurotrophin-4/5 and transforming
growth factor-alpha on striatal neuronal phenotypic degeneration after excitotoxic lesioning
with quinolinic acid. Neuroscience 78(1): 73-86.
Alexi, T., Hughes, P.E., Faull, R.L. and Williams, C.E. (1998). 3-Nitropropionic acid's lethal triplet:
cooperative pathways of neurodegeneration. Neuroreport 9(11): R57-64.
Alexi, T., Hughes, P.E., van Roon-Mom, W.M., Faull, R.L., Williams, C.E., Clark, R.G. and
Gluckman, P.D. (1999). The IGF-I amino-terminal tripeptide glycine-proline-glutamate (GPE)
is neuroprotective to striatum in the quinolinic acid lesion animal model of Huntington's
disease. Experimental Neurology 159(1): 84-97.
Alexi, T., Borlongan, C.V., Faull, R.L., Williams, C.E., Clark, R.G., Gluckman, P.D. and Hughes,
P.E. (2000). Neuroprotective strategies for basal ganglia degeneration: Parkinson's and
Huntington's diseases. Progress in Neurobiology 60(5): 409-70.
Allendoerfer, K.L., Cabelli, R.J., Escandon, E., Kaplan, D.R., Nikolics, K. and Shatz, C.J. (1994).
Regulation of neurotrophin receptors during the maturation of the mammalian visual system.
Journal of Neuroscience 14(3 Pt 2): 1795-811.
Almeida, R.D., Manadas, B.J., Melo, C.V., Gomes, J.R., Mendes, C.S., Graos, M.M., Carvalho, R.F.,
Carvalho, A.P. and Duarte, C.B. (2005). Neuroprotection by BDNF against glutamate-induced
apoptotic cell death is mediated by ERK and PI3-kinase pathways. Cell Death and
Differentiation 12(10): 1329-43.
Altar, C.A., Armanini, M., Dugich-Djordjevic, M., Bennett, G.L., Williams, R., Feinglass, S.,
Anicetti, V., Sinicropi, D. and Bakhit, C. (1992a). Recovery of cholinergic phenotype in the
injured rat neostriatum: roles for endogenous and exogenous nerve growth factor. Journal of
Neurochemistry 59(6): 2167-77.
Altar, C.A., Boylan, C.B., Jackson, C., Hershenson, S., Miller, J., Wiegand, S.J., Lindsay, R.M. and
Hyman, C. (1992b). Brain-derived neurotrophic factor augments rotational behavior and
nigrostriatal dopamine turnover in vivo. Proceedings of the National Academy of Sciences of
the United States of America 89(23): 11347-51.
Altar, C.A., Boylan, C.B., Fritsche, M., Jackson, C., Hyman, C. and Lindsay, R.M. (1994). The
neurotrophins NT-4/5 and BDNF augment serotonin, dopamine, and GABAergic systems
218
Literature References
during behaviorally effective infusions to the substantia nigra. Experimental Neurology
130(1): 31-40.
Altar, C.A., Cai, N., Bliven, T., Juhasz, M., Conner, J.M., Acheson, A.L., Lindsay, R.M. and
Wiegand, S.J. (1997). Anterograde transport of brain-derived neurotrophic factor and its role
in the brain. Nature 389(6653): 856-60.
Altar, C.A. (1999). Neurotrophins and depression. Trends in Pharmacological Sciences 20(2): 5961.
Altman, J. and Bayer, S.A. (1981). Development of the brain stem in the rat. V. Thymidineradiographic study of the time of origin of neurons in the midbrain tegmentum. Journal of
Comparative Neurology 198(4): 677-716.
Anderson, K.D., Panayotatos, N., Corcoran, T.L., Lindsay, R.M. and Wiegand, S.J. (1996). Ciliary
neurotrophic factor protects striatal output neurons in an animal model of Huntington's
disease. Proceedings of the National Academy of Sciences of the United States of America
93: 7346-7351.
Aoki, C., Wu, K., Elste, A., Len, G., Lin, S., McAuliffe, G. and Black, I.B. (2000). Localization of
brain-derived neurotrophic factor and TrkB receptors to postsynaptic densities of adult rat
cerebral cortex. Journal of Neuroscience Research 59(3): 454-63.
Araujo, D.M. and Hilt, D.C. (1997). Glial cell line-derived neurotrophic factor attenuates the
excitotoxin-induced behavioral and neurochemical deficits in a rodent model of Huntington's
disease. Neuroscience 81(4): 1099-110.
Araujo, D.M. and Hilt, D.C. (1998). Glial cell line-derived neurotrophic factor attenuates the
locomotor hypofunction and striatonigral neurochemical deficits induced by chronic systemic
administration of the mitochondrial toxin 3-nitropropionic acid. Neuroscience 82(1): 117-27.
Arenas, E., Perez-Navarro, E., Alberch, J. and Marsal, J. (1993). Selective resistance of tachykininresponsive cholinergic neurons in the quinolinic acid lesioned neostriatum. Brain Research
603(2): 317-20.
Armanini, M.P., McMahon, S.B., Sutherland, J., Shelton, D.L. and Phillips, H.S. (1995). Truncated
and catalytic isoforms of trkB are co-expressed in neurons of rat and mouse CNS. European
Journal of Neuroscience 7(6): 1403-9.
Arnt, J. and Hyttel, J. (1985). Differential involvement of dopamine D-1 and D-2 receptors in the
circling behaviour induced by apomorphine, SK & F 38393, pergolide and LY 171555 in 6hydroxydopamine-lesioned rats. Psychopharmacology 85(3): 346-52.
Arvidsson, A., Kirik, D., Lundberg, C., Mandel, R.J., Andsberg, G., Kokaia, Z. and Lindvall, O.
(2003). Elevated GDNF levels following viral vector-mediated gene transfer can increase
neuronal death after stroke in rats. Neurobiology of Disease 14(3): 542-56.
Ashkenazi, A. and Dixit, V.M. (1998). Death receptors: signaling and modulation. Science
281(5381): 1305-8.
Ayalon, L., Doron, R., Weiner, I. and Joel, D. (2004). Amelioration of behavioral deficits in a rat
model of Huntington's disease by an excitotoxic lesion to the globus pallidus. Experimental
Neurology 186(1): 46-58.
Azzouz, M., Hottinger, A., Paterna, J.C., Zurn, A.D., Aebischer, P. and Bueler, H. (2000). Increased
motoneuron survival and improved neuromuscular function in transgenic ALS mice after
intraspinal injection of an adeno-associated virus encoding Bcl-2. Human Molecular Genetics
9(5): 803-11.
219
Literature References
Bamji, S.X., Majdan, M., Pozniak, C.D., Belliveau, D.J., Aloyz, R., Kohn, J., Causing, C.G. and
Miller, F.D. (1998). The p75 neurotrophin receptor mediates neuronal apoptosis and is
essential for naturally occurring sympathetic neuron death. Journal of Cell Biology 140(4):
911-23.
Baquet, Z.C., Gorski, J.A. and Jones, K.R. (2004). Early striatal dendrite deficits followed by neuron
loss with advanced age in the absence of anterograde cortical brain-derived neurotrophic
factor. Journal of Neuroscience 24(17): 4250-8.
Barbacid, M. (1994). The Trk family of neurotrophin receptors. Journal of Neurobiology 25(11):
1386-403.
Barde, Y.A. (1989). Trophic factors and neuronal survival. Neuron 2(6): 1525-34.
Barinaga, M. (1994). Neurotrophic factors enter the clinic. Science 264(5160): 772-4.
Barker, R.A. and Johnson, A. (1995). Nigral and Striatal Neurons. Neural Cell Culture, A
Practical Approach. J. Cohen and G. P. Wilkin: 25-39.
Bates, G.P. and Hockly, E. (2003). Experimental therapeutics in Huntington's disease: are models
useful for therapeutic trials? Current Opinion in Neurology 16(4): 465-70.
Bazzett, T.J., Becker, J.B., Kaatz, K.W. and Albin, R.L. (1993). Chronic intrastriatal dialytic
administration of quinolinic acid produces selective neural degeneration. Experimental
Neurology 120(2): 177-85.
Bazzett, T.J., Becker, J.B., Falik, R.C. and Albin, R.L. (1994). Chronic intrastriatal quinolinic acid
produces reversible changes in perikaryal calbindin and parvalbumin immunoreactivity.
Neuroscience 60(4): 837-41.
Beal, M.F., Kowall, N.W., Ellison, D.W., Mazurek, M.F., Swartz, K.J. and Martin, J.B. (1986).
Replication of the neurochemical characteristics of Huntington's disease by quinolinic acid.
Nature 321(6066): 168-71.
Beal, M.F., Kowall, N.W., Swartz, K.J., Ferrante, R.J. and Martin, J.B. (1989). Differential sparing
of somatostatin-neuroprptide Y and cholinergic neurons following striatal excitotoxin lesions.
Synapse 3: 38-47.
Beal, M.F., Ferrante, R.J., Swartz, K.J. and Kowall, N.W. (1991). Chronic quinolinic acid lesions in
rats closely resemble Huntington's disease. Journal of Neuroscience 11(6): 1649-59.
Beal, M.F. (1992a). Does impairment of energy metabolism result in excitotoxic neuronal death in
neurodegenerative illnesses? Annals of Neurology 31(2): 119-30.
Beal, M.F. (1992b). Role of excitotoxicity in human neurological disease. Current Opinion in
Neurobiology 2(5): 657-62.
Bemelmans, A.P., Horellou, P., Pradier, L., Brunet, I., Colin, P. and Mallet, J. (1999). Brain-derived
neurotrophic factor-mediated protection of striatal neurons in an excitotoxic rat model of
Huntington's disease, as demonstrated by adenoviral gene transfer. Human Gene Therapy
10(18): 2987-97.
Benraiss, A., Chmielnicki, E., Lerner, K., Roh, D. and Goldman, S.A. (2001). Adenoviral brainderived neurotrophic factor induces both neostriatal and olfactory neuronal recruitment from
endogenous progenitor cells in the adult forebrain. Journal of Neuroscience 21(17): 6718-31.
Bergman, H. and Deuschl, G. (2002). Pathophysiology of Parkinson's disease: from clinical
neurology to basic neuroscience and back. Movement Disorders 17 Suppl 3: S28-40.
220
Literature References
Bibb, J.A., Yan, Z., Svenningsson, P., Snyder, G.L., Pieribone, V.A., Horiuchi, A., Nairn, A.C.,
Messer, A. and Greengard, P. (2000). Severe deficiencies in dopamine signaling in
presymptomatic Huntington's disease mice. Proceedings of the National Academy of Sciences
of the United States of America 97(12): 6809-14.
Biffo, S., Offenhauser, N., Carter, B.D. and Barde, Y.A. (1995). Selective binding and
internalisation by truncated receptors restrict the availability of BDNF during development.
Development - Supplement 121(8): 2461-70.
Bjorklund, A., Kirik, D., Rosenblad, C., Georgievska, B., Lundberg, C. and Mandel, R.J. (2000).
Towards a neuroprotective gene therapy for Parkinson's disease: use of adenovirus, AAV and
lentivirus vectors for gene transfer of GDNF to the nigrostriatal system in the rat Parkinson
model. Brain Research 886(1-2): 82-98.
Blomer, U., Kafri, T., Randolph-Moore, L., Verma, I.M. and Gage, F.H. (1998). Bcl-xL protects
adult septal cholinergic neurons from axotomized cell death. Proceedings of the National
Academy of Sciences of the United States of America 95(5): 2603-8.
Bohn, M.C. (1999). A commentary on glial cell line-derived neurotrophic factor (GDNF). From a
glial secreted molecule to gene therapy. Biochemical Pharmacology 57(2): 135-42.
Bohn, M.C., Kozlowski, D.A. and Connor, B. (2000a). Glial cell line-derived neurotrophic factor
(GDNF) as a defensive molecule for neurodegenerative disease: a tribute to the studies of
antonia vernadakis on neuronal-glial interactions. International Journal of Developmental
Neuroscience 18(7): 679-84.
Bohn, M.C., Connor, B., Kozlowski, D.A. and Mohajeri, M.H. (2000b). Gene transfer for
neuroprotection in animal models of Parkinson's disease and amyotrophic lateral sclerosis.
Novartis Foundation Symposium 231: 70-89; discussion 89-93.
Bolton, M.M., Lo, D.C. and Sherwood, N.T. (2000). Long-term regulation of excitatory and
inhibitory synaptic transmission in hippocampal cultures by brain-derived neurotrophic factor.
Progress in Brain Research 128: 203-18.
Bonelli, R.M., Wenning, G.K. and Kapfhammer, H.P. (2004). Huntington's disease: present
treatments and future therapeutic modalities. International Clinical Psychopharmacology
19(2): 51-62.
Bordelon, Y.M., Chesselet, M.F., Erecinska, M. and Silver, I.A. (1998). Effects of intrastriatal
injection of quinolinic acid on electrical activity and extracellular ion concentrations in rat
striatum in vivo. Neuroscience 83(2): 459-69.
Bordelon, Y.M., Mackenzie, L. and Chesselet, M.F. (1999). Morphology and compartmental
location of cells exhibiting DNA damage after quinolinic acid injections into rat striatum.
Journal of Comparative Neurology 412(1): 38-50.
Borlongan, C.V., Koutouzis, T.K., Freeman, T.B., Hauser, R.A., Cahill, D.W. and Sanberg, P.R.
(1997). Hyperactivity and hypoactivity in a rat model of Huntington's disease: the systemic 3nitropropionic acid model. Brain Research. Brain Research Protocols 1(3): 253-7.
Borlongan, C.V., Skinner, S.J., Geaney, M., Vasconcellos, A.V., Elliott, R.B. and Emerich, D.F.
(2004). Neuroprotection by encapsulated choroid plexus in a rodent model of Huntington's
disease. Neuroreport 15(16): 2521-5.
Borrell-Pages, M., Zala, D., Humbert, S. and Saudou, F. (2006). Huntington's disease: from
huntingtin function and dysfunction to therapeutic strategies. Cellular & Molecular Life
Sciences 63(22): 2642-60.
221
Literature References
Boyd, J.G. and Gordon, T. (2002). A dose-dependent facilitation and inhibition of peripheral nerve
regeneration by brain-derived neurotrophic factor. European Journal of Neuroscience 15(4):
613-26.
Bramham, C.R. and Messaoudi, E. (2005). BDNF function in adult synaptic plasticity: the synaptic
consolidation hypothesis. Progress in Neurobiology 76(2): 99-125.
Brickell, K.L., Nicholson, L.F., Waldvogel, H.J. and Faull, R.L. (1999). Chemical and anatomical
changes in the striatum and substantia nigra following quinolinic acid lesions in the striatum of
the rat: a detailed time course of the cellular and GABA(A) receptor changes. Journal of
Chemical Neuroanatomy 17(2): 75-97.
Brown, L.L., Schneider, J.S. and Lidsky, T.I. (1997). Sensory and cognitive functions of the basal
ganglia. Current Opinion in Neurobiology 7(2): 157-63.
Bruyn, R.P. and Stoof, J.C. (1990). The quinolinic acid hypothesis in Huntington's chorea. Journal
of Neurological Sciences 95(1): 29-38.
Burger, C., Gorbatyuk, O.S., Velardo, M.J., Peden, C.S., Williams, P., Zolotukhin, S., Reier, P.J.,
Mandel, R.J. and Muzyczka, N. (2004). Recombinant AAV viral vectors pseudotyped with viral
capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery
to different regions of the central nervous system. Molecular Therapy 10(2): 302-17.
Burger, C., Nguyen, F.N., Deng, J. and Mandel, R.J. (2005). Systemic mannitol-induced
hyperosmolality amplifies rAAV2-mediated striatal transduction to a greater extent than local
co-infusion. Molecular Therapy 11(2): 327-31.
Burke, R.E. (2006). GDNF as a candidate striatal target-derived neurotrophic factor for the
development of substantia nigra dopamine neurons. Journal of Neural Transmission.
Supplementum(70): 41-5.
Butterworth, N.J., Williams, L., Bullock, J.Y., Love, D.R., Faull, R.L. and Dragunow, M. (1998).
Trinucleotide (CAG) repeat length is positively correlated with the degree of DNA
fragmentation in Huntington's disease striatum. Neuroscience 87(1): 49-53.
Byler, S.L., Shaffer, M.C. and Barth, T.M. (2006). Unilateral pallidotomy produces motor deficits
and excesses in rats. Restorative Neurology & Neuroscience 24(3): 133-45.
Campbell, M.J. and Morrison, J.H. (1989). Monoclonal antibody to neurofilament protein (SMI-32)
labels a subpopulation of pyramidal neurons in the human and monkey neocortex. Journal of
Comparative Neurology 282(2): 191-205.
Canals, J.M., Marco, S., Checa, N., Michels, A., Perez-Navarro, E., Arenas, E. and Alberch, J.
(1998). Differential regulation of the expression of nerve growth factor, brain-derived
neurotrophic factor, and neurotrophin-3 after excitotoxicity in a rat model of Huntington's
disease. Neurobiology of Disease 5(5): 357-64.
Canals, J.M., Checa, N., Marco, S., Akerud, P., Michels, A., Perez-Navarro, E., Tolosa, E., Arenas,
E. and Alberch, J. (2001). Expression of brain-derived neurotrophic factor in cortical neurons
is regulated by striatal target area. Journal of Neuroscience 21(1): 117-24.
Carter, B.J. (2005). Adeno-associated virus vectors in clinical trials. Human Gene Therapy 16(5):
541-50.
Cattaneo, E. and McKay, R. (1990). Proliferation and differentiation of neuronal stem cells
regulated by nerve growth factor. Nature 347(6295): 762-5.
Cattaneo, E., Zuccato, C. and Tartari, M. (2005). Normal huntingtin function: an alternative
approach to Huntington's disease. Nature Reviews Neuroscience 6(12): 919-30.
222
Literature References
Cepeda, C., Ariano, M.A., Calvert, C.R., Flores-Hernandez, J., Chandler, S.H., Leavitt, B.R.,
Hayden, M.R. and Levine, M.S. (2001). NMDA receptor function in mouse models of
Huntington disease. Journal of Neuroscience Research 66(4): 525-39.
Chao, M.V. (1994). The p75 neurotrophin receptor. Journal of Neurobiology 25(11): 1373-85.
Chao, M.V. and Hempstead, B.L. (1995). p75 and Trk: a two-receptor system. Trends in
Neurosciences 18(7): 321-6.
Charriaut-Marlangue, C. and Ben-Ari, Y. (1995). A cautionary note on the use of the TUNEL stain to
determine apoptosis. Neuroreport 7(1): 61-4.
Checa, N., Canals, J.M., Gratacos, E. and Alberch, J. (2001). TrkB and TrkC are differentially
regulated by excitotoxicity during development of the basal ganglia. Experimental Neurology
172(2): 282-92.
Chen, K., Henry, R.A., Hughes, S.M. and Connor, B. (2007). Creating a neurogenic environment:
The role of BDNF and FGF2. Molecular and Cellular Neurosciences.
Chen, N., Luo, T., Wellington, C., Metzler, M., McCutcheon, K., Hayden, M.R. and Raymond, L.A.
(1999). Subtype-specific enhancement of NMDA receptor currents by mutant huntingtin.
Journal of Neurochemistry 72(5): 1890-8.
Chen, Z.Y., Patel, P.D., Sant, G., Meng, C.X., Teng, K.K., Hempstead, B.L. and Lee, F.S. (2004).
Variant brain-derived neurotrophic factor (BDNF) (Met66) alters the intracellular trafficking
and activity-dependent secretion of wild-type BDNF in neurosecretory cells and cortical
neurons. Journal of Neuroscience 24(18): 4401-11.
Chiarugi, A., Meli, E. and Moroni, F. (2001). Similarities and differences in the neuronal death
processes activated by 3OH-kynurenine and quinolinic acid. Journal of Neurochemistry
77(5): 1310-8.
Chittka, A., Arevalo, J.C., Rodriguez-Guzman, M., Perez, P., Chao, M.V. and Sendtner, M. (2004).
The p75NTR-interacting protein SC1 inhibits cell cycle progression by transcriptional
repression of cyclin E. Journal of Cell Biology 164(7): 985-96.
Chmielnicki, E., Benraiss, A., Economides, A.N. and Goldman, S.A. (2004). Adenovirally expressed
noggin and brain-derived neurotrophic factor cooperate to induce new medium spiny neurons
from resident progenitor cells in the adult striatal ventricular zone. Journal of Neuroscience
24(9): 2133-42.
Choi, D.W. (1988). Glutamate neurotoxicity and diseases of the nervous system. Neuron 1(8): 62334.
Choi-Lundberg, D.L. and Bohn, M.C. (1995). Ontogeny and distribution of glial cell line-derived
neurotrophic factor (GDNF) mRNA in rat. Brain Research. Developmental Brain Research
85(1): 80-8.
Choi-Lundberg, D.L., Lin, Q., Schallert, T., Crippens, D., Davidson, B.L., Chang, Y.N., Chiang,
Y.L., Qian, J., Bardwaj, L. and Bohn, M.C. (1998). Behavioral and cellular protection of rat
dopaminergic neurons by an adenoviral vector encoding glial cell line-derived neurotrophic
factor. Experimental Neurology 154(2): 261-75.
Choo, Y.S., Johnson, G.V., MacDonald, M., Detloff, P.J. and Lesort, M. (2004). Mutant huntingtin
directly increases susceptibility of mitochondria to the calcium-induced permeability transition
and cytochrome c release. Human Molecular Genetics 13(14): 1407-20.
223
Literature References
Cicchetti, F. and Parent, A. (1996a). Striatal interneurons in Huntington's disease: selective increase
in the density of calretinin-immunoreactive medium-sized neurons. Movement Disorders
11(6): 619-26.
Cicchetti, F., Gould, P.V. and Parent, A. (1996b). Sparing of striatal neurons coexpressing calretinin
and substance P (NK1) receptor in Huntington's disease. Brain Research 730(1-2): 232-7.
Clark, K.R., Sferra, T.J. and Johnson, P.R. (1997). Recombinant adeno-associated viral vectors
mediate long-term transgene expression in muscle. Human Gene Therapy 8(6): 659-69.
Cohen, G.M., Sun, X.M., Fearnhead, H., MacFarlane, M., Brown, D.G., Snowden, R.T. and
Dinsdale, D. (1994). Formation of large molecular weight fragments of DNA is a key committed
step of apoptosis in thymocytes. Journal of Immunology 153(2): 507-16.
Connor, B. and Dragunow, M. (1998). The role of neuronal growth factors in neurodegenerative
disorders of the human brain. Brain Research - Brain Research Reviews 27(1): 1-39.
Conover, J.C., Ip, N.Y., Poueymirou, W.T., Bates, B., Goldfarb, M.P., DeChiara, T.M. and
Yancopoulos, G.D. (1993). Ciliary neurotrophic factor maintains the pluripotentiality of
embryonic stem cells. Development - Supplement 119(3): 559-65.
Cory, S. and Adams, J.M. (2002). The Bcl2 family: regulators of the cellular life-or-death switch.
Nature Reviews. Cancer 2(9): 647-56.
Costantini, L.C., Feinstein, S.C., Radeke, M.J. and Snyder-Keller, A. (1999). Compartmental
expression of trkB receptor protein in the developing striatum. Neuroscience 89(2): 505-13.
Cowan, C.M. and Raymond, L.A. (2006). Selective neuronal degeneration in Huntington's disease.
Current Topics in Developmental Biology 75: 25-71.
Crocker, S.J., Wigle, N., Liston, P., Thompson, C.S., Lee, C.J., Xu, D., Roy, S., Nicholson, D.W.,
Park, D.S., MacKenzie, A., Korneluk, R.G. and Robertson, G.S. (2001). NAIP protects the
nigrostriatal dopamine pathway in an intrastriatal 6-OHDA rat model of Parkinson's disease.
European Journal of Neuroscience 14(2): 391-400.
Croll, S.D., Suri, C., Compton, D.L., Simmons, M.V., Yancopoulos, G.D., Lindsay, R.M., Wiegand,
S.J., Rudge, J.S. and Scharfman, H.E. (1999). Brain-derived neurotrophic factor transgenic
mice exhibit passive avoidance deficits, increased seizure severity and in vitro hyperexcitability
in the hippocampus and entorhinal cortex. Neuroscience 93(4): 1491-506.
Crossman, A.R. (1987). Primate models of dyskinesia: the experimental approach to the study of
basal ganglia-related involuntary movement disorders. Neuroscience 21(1): 1-40.
Cudkowicz, M. and Kowall, N.W. (1990). Degeneration of pyramidal projection neurons in
Huntington's disease cortex. Annals of Neurology 27(2): 200-4.
Curtis, M.A., Penney, E.B., Pearson, A.G., van Roon-Mom, W.M., Butterworth, N.J., Dragunow,
M., Connor, B. and Faull, R.L. (2003). Increased cell proliferation and neurogenesis in the
adult human Huntington's disease brain. Proceedings of the National Academy of Sciences of
the United States of America 100(15): 9023-7.
Curtis, M.A., Penney, E.B., Pearson, J., Dragunow, M., Connor, B. and Faull, R.L. (2005). The
distribution of progenitor cells in the subependymal layer of the lateral ventricle in the normal
and Huntington's disease human brain. Neuroscience 132(3): 777-88.
Cyr, M., Beaulieu, J.M., Laakso, A., Sotnikova, T.D., Yao, W.D., Bohn, L.M., Gainetdinov, R.R.
and Caron, M.G. (2003). Sustained elevation of extracellular dopamine causes motor
dysfunction and selective degeneration of striatal GABAergic neurons. Proceedings of the
National Academy of Sciences of the United States of America 100(19): 11035-40.
224
Literature References
Das, K.P., Chao, S.L., White, L.D., Haines, W.T., Harry, G.J., Tilson, H.A. and Barone, S., Jr.
(2001). Differential patterns of nerve growth factor, brain-derived neurotrophic factor and
neurotrophin-3 mRNA and protein levels in developing regions of rat brain. Neuroscience
103(3): 739-61.
Davidson, B.L., Stein, C.S., Heth, J.A., Martins, I., Kotin, R.M., Derksen, T.A., Zabner, J., Ghodsi,
A. and Chiorini, J.A. (2000). Recombinant adeno-associated virus type 2, 4, and 5 vectors:
transduction of variant cell types and regions in the mammalian central nervous system.
Proceedings of the National Academy of Sciences of the United States of America 97(7):
3428-32.
Davies, S.W. and Roberts, P.J. (1987). No evidence for preservation of somatostatin-containing
neurons after intrastriatal injections of quinolinic acid. Nature 327(6120): 326-9.
Davies, S.W. and Beardsall, K. (1992). Nerve growth factor selectively prevents excitotoxin induced
degeneration of striatal cholinergic neurones. Neuroscience Letters 140(2): 161-4.
de Almeida, L.P., Zala, D., Aebischer, P. and Deglon, N. (2001). Neuroprotective effect of a CNTFexpressing lentiviral vector in the quinolinic acid rat model of Huntington's disease.
Neurobiology of Disease 8(3): 433-46.
DeChiara, T.M., Vejsada, R., Poueymirou, W.T., Acheson, A., Suri, C., Conover, J.C., Friedman, B.,
McClain, J., Pan, L. and Stahl, N. (1995). Mice lacking the CNTF receptor, unlike mice lacking
CNTF, exhibit profound motor neuron deficits at birth. Cell 83(2): 313-22.
DeLong, M.R. (1990). Primate models of movement disorders of basal ganglia origin. Trends in
Neurosciences 13(7): 281-5.
Detrait, E.R., Bowers, W.J., Halterman, M.W., Giuliano, R.E., Bennice, L., Federoff, H.J. and
Richfield, E.K. (2002). Reporter gene transfer induces apoptosis in primary cortical neurons.
Molecular Therapy 5(6): 723-30.
Deveraux, Q.L., Leo, E., Stennicke, H.R., Welsh, K., Salvesen, G.S. and Reed, J.C. (1999). Cleavage
of human inhibitor of apoptosis protein XIAP results in fragments with distinct specificities for
caspases. EMBO Journal 18(19): 5242-51.
Deveraux, Q.L. and Reed, J.C. (1999). IAP family proteins--suppressors of apoptosis. Genes &
Development 13(3): 239-52.
DiFiglia, M., Christakos, S. and Aronin, N. (1989). Ultrastructural localization of immunoreactive
calbindin-D28k in the rat and monkey basal ganglia, including subcellular distribution with
colloidal gold labeling. Journal of Comparative Neurology 279(4): 653-65.
DiFiglia, M. (1990). Excitotoxic injury of the neostriatum: a model for Huntington's disease. Trends
in Neurosciences 13(7): 286-9.
Dobrossy, M.D. and Dunnett, S.B. (2003). Motor training effects on recovery of function after
striatal lesions and striatal grafts. Experimental Neurology 184(1): 274-84.
Dobrowsky, R.T., Werner, M.H., Castellino, A.M., Chao, M.V. and Hannun, Y.A. (1994). Activation
of the sphingomyelin cycle through the low-affinity neurotrophin receptor. Science 265(5178):
1596-9.
Dowd, E., Monville, C., Torres, E.M. and Dunnett, S.B. (2005). The Corridor Task: a simple test of
lateralised response selection sensitive to unilateral dopamine deafferentation and graftderived dopamine replacement in the striatum. Brain Research Bulletin 68(1-2): 24-30.
225
Literature References
Dragunow, M., Beilharz, E., Mason, B., Lawlor, P., Abraham, W. and Gluckman, P. (1993). Brainderived neurotrophic factor expression after long-term potentiation. Neuroscience Letters
160(2): 232-6.
Dragunow, M., Faull, R.L., Lawlor, P., Beilharz, E.J., Singleton, K., Walker, E.B. and Mee, E.
(1995). In situ evidence for DNA fragmentation in Huntington's disease striatum and
Alzheimer's disease temporal lobes. Neuroreport 6(7): 1053-7.
Drake, C.T., Milner, T.A. and Patterson, S.L. (1999). Ultrastructural localization of full-length trkB
immunoreactivity in rat hippocampus suggests multiple roles in modulating activity-dependent
synaptic plasticity. Journal of Neuroscience 19(18): 8009-26.
Duan, D., Sharma, P., Yang, J., Yue, Y., Dudus, L., Zhang, Y., Fisher, K.J. and Engelhardt, J.F.
(1998). Circular intermediates of recombinant adeno-associated virus have defined structural
characteristics responsible for long-term episomal persistence in muscle tissue. Journal of
Virology 72(11): 8568-77.
Duan, D., Yan, Z., Yue, Y. and Engelhardt, J.F. (1999). Structural analysis of adeno-associated virus
transduction circular intermediates. Virology 261(1): 8-14.
Duan, W., Guo, Z., Jiang, H., Ware, M., Li, X.J. and Mattson, M.P. (2003). Dietary restriction
normalizes glucose metabolism and BDNF levels, slows disease progression, and increases
survival in huntingtin mutant mice. Proceedings of the National Academy of Sciences of the
United States of America 100(5): 2911-6.
Dunnett, S.B., Isacson, O., Sirinathsinghji, D.J., Clarke, D.J. and Bjorklund, A. (1988). Striatal
grafts in rats with unilateral neostriatal lesions--III. Recovery from dopamine-dependent motor
asymmetry and deficits in skilled paw reaching. Neuroscience 24(3): 813-20.
Dure, L.S.t., Wiess, S., Standaert, D.G., Rudolf, G., Testa, C.M. and Young, A.B. (1995). DNA
fragmentation and immediate early gene expression in rat striatum following quinolinic acid
administration. Experimental Neurology 133(2): 207-14.
During, M.J., Young, D., Baer, K., Lawlor, P. and Klugmann, M. (2003). Development and
optimization of adeno-associated virus vector transfer into the central nervous system.
Methods in Molecular Medicine 76: 221-36.
Eberhardt, O., Coelln, R.V., Kugler, S., Lindenau, J., Rathke-Hartlieb, S., Gerhardt, E., Haid, S.,
Isenmann, S., Gravel, C., Srinivasan, A., Bahr, M., Weller, M., Dichgans, J. and Schulz, J.B.
(2000). Protection by synergistic effects of adenovirus-mediated X-chromosome-linked inhibitor
of apoptosis and glial cell line-derived neurotrophic factor gene transfer in the 1-methyl-4phenyl-1,2,3,6-tetrahydropyridine model of Parkinson's disease. Journal of Neuroscience
20(24): 9126-34.
Ellison, D.W., Beal, M.F., Mazurek, M.F., Malloy, J.R., Bird, E.D. and Martin, J.B. (1987). Amino
acid neurotransmitter abnormalities in Huntington's disease and the quinolinic acid animal
model of Huntington's disease. Brain 110(Pt 6): 1657-73.
Emerich, D.F., Lindner, M.D., Winn, S.R., Chen, E.Y., Frydel, B.R. and Kordower, J.H. (1996).
Implants of encapsulated human CNTF-producing fibroblasts prevent behavioral deficits and
striatal degeneration in a rodent model of Huntington's disease. Journal of Neuroscience
16(16): 5168-81.
Emerich, D.F., Cain, C.K., Greco, C., Saydoff, J.A., Hu, Z.Y., Liu, H. and Lindner, M.D. (1997a).
Cellular delivery of human CNTF prevents motor and cognitive dysfunction in a rodent model
of Huntington's disease. Cell Transplantation 6(3): 249-66.
226
Literature References
Emerich, D.F., Winn, S.R., Hantraye, P.M., Peschanski, M., Chen, E.Y., Chu, Y., McDermott, P.,
Baetge, E.E. and Kordower, J.H. (1997b). Protective effect of encapsulated cells producing
neurotrophic factor CNTF in a monkey model of Huntington's disease. Nature 386(6623): 3959.
Emerich, D.F. (1999). Encapsulated CNTF-producing cells for Huntington's disease. Cell
Transplantation 8(6): 581-2.
Emerich, D.F. and Winn, S.R. (2004a). Neuroprotective effects of encapsulated CNTF-producing
cells in a rodent model of Huntington's disease are dependent on the proximity of the implant to
the lesioned striatum. Cell Transplantation 13(3): 253-9.
Emerich, D.F. (2004b). Dose-dependent neurochemical and functional protection afforded by
encapsulated CNTF-producing cells. Cell Transplantation 13(7-8): 839-44.
Emerich, D.F., Thanos, C.G., Goddard, M., Skinner, S.J., Geany, M.S., Bell, W.J., Bintz, B.,
Schneider, P., Chu, Y., Babu, R.S., Borlongan, C.V., Boekelheide, K., Hall, S., Bryant, B. and
Kordower, J.H. (2006). Extensive neuroprotection by choroid plexus transplants in excitotoxin
lesioned monkeys. Neurobiology of Disease 23(2): 471-80.
Engelender, S., Sharp, A.H., Colomer, V., Tokito, M.K., Lanahan, A., Worley, P., Holzbaur, E.L.
and Ross, C.A. (1997). Huntingtin-associated protein 1 (HAP1) interacts with the p150Glued
subunit of dynactin. Human Molecular Genetics 6(13): 2205-12.
Ernfors, P., Merlio, J.P. and Persson, H. (1992). Cells Expressing mRNA for Neurotrophins and their
Receptors During Embryonic Rat Development. European Journal of Neuroscience 4(11):
1140-1158.
Escartin, C., Boyer, F., Bemelmans, A.P., Hantraye, P. and Brouillet, E. (2004). Insulin growth
factor-1 protects against excitotoxicity in the rat striatum. Neuroreport 15(14): 2251-4.
Eslamboli, A., Georgievska, B., Ridley, R.M., Baker, H.F., Muzyczka, N., Burger, C., Mandel, R.J.,
Annett, L. and Kirik, D. (2005). Continuous low-level glial cell line-derived neurotrophic factor
delivery using recombinant adeno-associated viral vectors provides neuroprotection and
induces behavioral recovery in a primate model of Parkinson's disease. Journal of
Neuroscience 25(4): 769-77.
Fallon, J., Reid, S., Kinyamu, R., Opole, I., Opole, R., Baratta, J., Korc, M., Endo, T.L., Duong, A.,
Nguyen, G., Karkehabadhi, M., Twardzik, D., Patel, S. and Loughlin, S. (2000). In vivo
induction of massive proliferation, directed migration, and differentiation of neural cells in the
adult mammalian brain. Proceedings of the National Academy of Sciences of the United
States of America 97(26): 14686-91.
Fang, W., Rivard, J.J., Mueller, D.L. and Behrens, T.W. (1994). Cloning and molecular
characterization of mouse bcl-x in B and T lymphocytes. Journal of Immunology 153(10):
4388-98.
Ferrante, R.J., Kowall, N.W., Beal, M.F., Martin, J.B., Bird, E.D. and Richardson, E.P., Jr. (1987).
Morphologic and histochemical characteristics of a spared subset of striatal neurons in
Huntington's disease. Journal of Neuropathology & Experimental Neurology 46(1): 12-27.
Ferrer, I., Goutan, E., Marin, C., Rey, M.J. and Ribalta, T. (2000). Brain-derived neurotrophic factor
in Huntington disease. Brain Research 866(1-2): 257-61.
Figueredo-Cardenas, G., Anderson, K.D., Chen, Q., Veenman, C.L. and Reiner, A. (1994). Relative
survival of striatal projection neurons and interneurons after intrastriatal injection of
quinolinic acid in rats. Experimental Neurology 129(1): 37-56.
227
Literature References
Figueredo-Cardenas, G., Harris, C.L., Anderson, K.D. and Reiner, A. (1998). Relative resistance of
striatal neurons containing calbindin or parvalbumin to quinolinic acid-mediated excitotoxicity
compared to other striatal neuron types. Experimental Neurology 149(2): 356-72.
Filloux, F. and Townsend, J.J. (1993). Pre- and postsynaptic neurotoxic effects of dopamine
demonstrated by intrastriatal injection. Experimental Neurology 119(1): 79-88.
Frank, L., Ventimiglia, R., Anderson, K., Lindsay, R.M. and Rudge, J.S. (1996). BDNF downregulates neurotrophin responsiveness, TrkB protein and TrkB mRNA levels in cultured rat
hippocampal neurons. European Journal of Neuroscience 8(6): 1220-30.
Fricker, R.A., Annett, L.E., Torres, E.M. and Dunnett, S.B. (1996). The placement of a striatal
ibotenic acid lesion affects skilled forelimb use and the direction of drug-induced rotation.
Brain Research Bulletin 41(6): 409-16.
Friedman, B., Scherer, S.S., Rudge, J.S., Helgren, M., Morrisey, D., McClain, J., Wang, D.Y.,
Wiegand, S.J., Furth, M.E. and Lindsay, R.M. (1992). Regulation of ciliary neurotrophic factor
expression in myelin-related Schwann cells in vivo. Neuron 9(2): 295-305.
Friedman, W.J., Olson, L. and Persson, H. (1991). Temporal and spatial expression of NGF receptor
mRNA during postnatal rat brain development analyzed by in situ hybridization. Brain
Research. Developmental Brain Research 63(1-2): 43-51.
Friedman, W.J. and Greene, L.A. (1999). Neurotrophin signaling via Trks and p75. Experimental
Cell Research 253(1): 131-42.
Frim, D.M., Short, M.P., Rosenberg, W.S., Simpson, J., Breakefield, X.O. and Isacson, O. (1993a).
Local protective effects of nerve growth factor-secreting fibroblasts against excitotoxic lesions
in the rat striatum. [see comments.]. Journal of Neurosurgery 78(2): 267-73.
Frim, D.M., Uhler, T.A., Short, M.P., Ezzedine, Z.D., Klagsbrun, M., Breakefield, X.O. and Isacson,
O. (1993b). Effects of biologically delivered NGF, BDNF and bFGF on striatal excitotoxic
lesions. Neuroreport 4(4): 367-70.
Frim, D.M., Simpson, J., Uhler, T.A., Short, M.P., Bossi, S.R., Breakefield, X.O. and Isacson, O.
(1993c). Striatal degeneration induced by mitochondrial blockade is prevented by biologically
delivered NGF. Journal of Neuroscience Research 35(4): 452-8.
Gafni, J., Hermel, E., Young, J.E., Wellington, C.L., Hayden, M.R. and Ellerby, L.M. (2004).
Inhibition of calpain cleavage of huntingtin reduces toxicity: accumulation of calpain/caspase
fragments in the nucleus. Journal of Biological Chemistry 279(19): 20211-20.
Galpern, W.R., Matthews, R.T., Beal, M.F. and Isacson, O. (1996). NGF attenuates 3-nitrotyrosine
formation in a 3-NP model of Huntington's disease. Neuroreport 7(15-17): 2639-42.
Gao, G., Vandenberghe, L.H., Alvira, M.R., Lu, Y., Calcedo, R., Zhou, X. and Wilson, J.M. (2004).
Clades of Adeno-associated viruses are widely disseminated in human tissues. Journal of
Virology 78(12): 6381-8.
Garin, M.I., Garrett, E., Tiberghien, P., Apperley, J.F., Chalmers, D., Melo, J.V. and Ferrand, C.
(2001). Molecular mechanism for ganciclovir resistance in human T lymphocytes transduced
with retroviral vectors carrying the herpes simplex virus thymidine kinase gene. Blood 97(1):
122-9.
Garrity-Moses, M.E., Teng, Q., Liu, J., Tanase, D. and Boulis, N.M. (2005). Neuroprotective adenoassociated virus Bcl-xL gene transfer in models of motor neuron disease. Muscle and Nerve
32(6): 734-44.
228
Literature References
Garrity-Moses, M.E., Teng, Q., Krudy, C., Yang, J., Federici, T. and Boulis, N.M. (2006). X-Linked
inhibitor of apoptosis protein gene-based neuroprotection for the peripheral nervous system.
Neurosurgery 59(1): 172-82; discussion 172-82.
Gascon, E., Vutskits, L., Jenny, B., Durbec, P. and Kiss, J.Z. (2007). PSA-NCAM in postnatally
generated immature neurons of the olfactory bulb: a crucial role in regulating p75 expression
and cell survival. Development 134(6): 1181-90.
Gauthier, L.R., Charrin, B.C., Borrell-Pages, M., Dompierre, J.P., Rangone, H., Cordelieres, F.P., De
Mey, J., MacDonald, M.E., Lessmann, V., Humbert, S. and Saudou, F. (2004). Huntingtin
controls neurotrophic support and survival of neurons by enhancing BDNF vesicular transport
along microtubules. Cell 118(1): 127-38.
Gavalda, N., Perez-Navarro, E., Gratacos, E., Comella, J.X. and Alberch, J. (2004). Differential
involvement of phosphatidylinositol 3-kinase and p42/p44 mitogen activated protein kinase
pathways in brain-derived neurotrophic factor-induced trophic effects on cultured striatal
neurons. Molecular and Cellular Neurosciences 25(3): 460-8.
Gavrieli, Y., Sherman, Y. and Ben-Sasson, S.A. (1992). Identification of programmed cell death in
situ via specific labeling of nuclear DNA fragmentation. Journal of Cell Biology 119(3): 493501.
Georgievska, B., Kirik, D. and Bjorklund, A. (2002). Aberrant sprouting and downregulation of
tyrosine hydroxylase in lesioned nigrostriatal dopamine neurons induced by long-lasting
overexpression of glial cell line derived neurotrophic factor in the striatum by lentiviral gene
transfer. Experimental Neurology 177(2): 461-74.
Gerfen, C.R. (1985). The neostriatal mosaic. I. Compartmental organization of projections from the
striatum to the substantia nigra in the rat. Journal of Comparative Neurology 236(4): 454-76.
Gerfen, C.R., Baimbridge, K.G. and Miller, J.J. (1985). The neostriatal mosaic: compartmental
distribution of calcium-binding protein and parvalbumin in the basal ganglia of the rat and
monkey. Proceedings of the National Academy of Sciences of the United States of America
82(24): 8780-4.
Gerfen, C.R. (1992). The neostriatal mosaic: multiple levels of compartmental organization. Trends
in Neurosciences 15(4): 133-9.
Glass, M., Dragunow, M. and Faull, R.L. (2000). The pattern of neurodegeneration in Huntington's
disease: a comparative study of cannabinoid, dopamine, adenosine and GABA(A) receptor
alterations in the human basal ganglia in Huntington's disease. Neuroscience 97(3): 505-19.
Goffredo, D., Rigamonti, D., Zuccato, C., Tartari, M., Valenza, M. and Cattaneo, E. (2005).
Prevention of cytosolic IAPs degradation: a potential pharmacological target in Huntington's
Disease. Pharmacological Research 52(2): 140-50.
Goldstein, J.C., Rodier, F., Garbe, J.C., Stampfer, M.R. and Campisi, J. (2005). Caspaseindependent cytochrome c release is a sensitive measure of low-level apoptosis in cell culture
models. Aging Cell 4(4): 217-22.
Gonzalez-Garcia, M., Perez-Ballestero, R., Ding, L., Duan, L., Boise, L.H., Thompson, C.B. and
Nunez, G. (1994). Bcl-XL is the major bcl-x mRNA form expressed during murine development
and its product localizes to mitochondria. Development 120(10): 3033-42.
Gonzalez-Garcia, M., Garcia, I., Ding, L., O'Shea, S., Boise, L.H., Thompson, C.B. and Nunez, G.
(1995). Bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent
neuronal cell death. Proceedings of the National Academy of Sciences of the United States
of America 92(10): 4304-8.
229
Literature References
Goodman, L.J., Valverde, J., Lim, F., Geschwind, M.D., Federoff, H.J., Geller, A.I. and Hefti, F.
(1996). Regulated release and polarized localization of brain-derived neurotrophic factor in
hippocampal neurons. Molecular & Cellular Neurosciences 7(3): 222-38.
Gordon, R.J., Tattersfield, A.S., Vazey, E.M., Kells, A.P., McGregor, A.L., Hughes, S.M. and
Connor, B. (2007). Temporal Profile of Subventricular Zone Progenitor Cell Migration
Following Quinolinic Acid Induced Striatal Cell Loss. Neuroscience In Press.
Gould, T.D. and Manji, H.K. (2005). DARPP-32: A molecular switch at the nexus of reward
pathway plasticity. Proceedings of the National Academy of Sciences of the United States of
America 102(2): 253-4.
Goverdhana, S., Puntel, M., Xiong, W., Zirger, J.M., Barcia, C., Curtin, J.F., Soffer, E.B., Mondkar,
S., King, G.D., Hu, J., Sciascia, S.A., Candolfi, M., Greengold, D.S., Lowenstein, P.R. and
Castro, M.G. (2005). Regulatable gene expression systems for gene therapy applications:
progress and future challenges. Molecular Therapy 12(2): 189-211.
Greengard, P., Allen, P.B. and Nairn, A.C. (1999). Beyond the dopamine receptor: the DARPP32/protein phosphatase-1 cascade. Neuron 23(3): 435-47.
Grieger, J.C. and Samulski, R.J. (2005). Adeno-associated virus as a gene therapy vector: vector
development, production and clinical applications. Advances in Biochemical Engineering
and Biotechnology 99: 119-45.
Gross, A., McDonnell, J.M. and Korsmeyer, S.J. (1999). BCL-2 family members and the
mitochondria in apoptosis. Genes & Development 13(15): 1899-911.
Gross, A. (2001). BCL-2 proteins: regulators of the mitochondrial apoptotic program. IUBMB Life
52(3-5): 231-6.
Guidetti, P., Luthi-Carter, R.E., Augood, S.J. and Schwarcz, R. (2004). Neostriatal and cortical
quinolinate levels are increased in early grade Huntington's disease. Neurobiology of Disease
17(3): 455-61.
Guillin, O., Diaz, J., Carroll, P., Griffon, N., Schwartz, J.C. and Sokoloff, P. (2001). BDNF controls
dopamine D3 receptor expression and triggers behavioural sensitization. Nature 411(6833):
86-9.
Gunawardena, S., Her, L.S., Brusch, R.G., Laymon, R.A., Niesman, I.R., Gordesky-Gold, B.,
Sintasath, L., Bonini, N.M. and Goldstein, L.S. (2003). Disruption of axonal transport by loss
of huntingtin or expression of pathogenic polyQ proteins in Drosophila. Neuron 40(1): 25-40.
Gutekunst, C.A., Li, S.H., Yi, H., Mulroy, J.S., Kuemmerle, S., Jones, R., Rye, D., Ferrante, R.J.,
Hersch, S.M. and Li, X.J. (1999). Nuclear and neuropil aggregates in Huntington's disease:
relationship to neuropathology. Journal of Neuroscience 19(7): 2522-34.
Haik, K.L., Shear, D.A., Schroeder, U., Sabel, B.A. and Dunbar, G.L. (2000). Quinolinic acid
released from polymeric brain implants causes behavioral and neuroanatomical alterations in
a rodent model of Huntington's disease. Experimental Neurology 163(2): 430-9.
Hajnoczky, G., Davies, E. and Madesh, M. (2003). Calcium signaling and apoptosis. Biochemical
and Biophysical Research Communications 304(3): 445-54.
Halbert, C.L., Miller, A.D., McNamara, S., Emerson, J., Gibson, R.L., Ramsey, B. and Aitken, M.L.
(2006). Prevalence of neutralizing antibodies against adeno-associated virus (AAV) types 2, 5,
and 6 in cystic fibrosis and normal populations: Implications for gene therapy using AAV
vectors. Human Gene Therapy 17(4): 440-7.
230
Literature References
Handley, O.J., Naji, J.J., Dunnett, S.B. and Rosser, A.E. (2006). Pharmaceutical, cellular and
genetic therapies for Huntington's disease. Clinical Science 110(1): 73-88.
Harrington, K.M. and Kowall, N.W. (1991). Parvalbumin immunoreactive neurons resist
degeneration in Huntington's disease striatum. Journal of Neuropathology & Experimental
Neurology 50: 309.
Hastings, T.G., Lewis, D.A. and Zigmond, M.J. (1996). Role of oxidation in the neurotoxic effects of
intrastriatal dopamine injections. Proceedings of the National Academy of Sciences of the
United States of America 93(5): 1956-61.
Hattori, A., Luo, Y., Umegaki, H., Munoz, J. and Roth, G.S. (1998). Intrastriatal injection of
dopamine results in DNA damage and apoptosis in rats. Neuroreport 9(11): 2569-72.
Hauck, B., Chen, L. and Xiao, W. (2003). Generation and characterization of chimeric recombinant
AAV vectors. Molecular Therapy 7(3): 419-25.
Hedreen, J.C., Peyser, C.E., Folstein, S.E. and Ross, C.A. (1991). Neuronal loss in layers V and VI of
cerebral cortex in Huntington's disease. Neuroscience Letters 133(2): 257-61.
Helgren, M.E., Squinto, S.P., Davis, H.L., Parry, D.J., Boulton, T.G., Heck, C.S., Zhu, Y.,
Yancopoulos, G.D., Lindsay, R.M. and DiStefano, P.S. (1994). Trophic effect of ciliary
neurotrophic factor on denervated skeletal muscle. Cell 76(3): 493-504.
Henry, R.A., Hughes, S.M. and Connor, B. (2007). AAV-mediated delivery of BDNF augments
neurogenesis in the normal and quinolinic acid-lesioned adult rat brain. European Journal of
Neuroscience 25(12): 3513-25.
Herdegen, T., Kovary, K., Buhl, A., Bravo, R., Zimmermann, M. and Gass, P. (1995). Basal
expression of the inducible transcription factors c-Jun, JunB, JunD, c-Fos, FosB, and Krox-24
in the adult rat brain. Journal of Comparative Neurology 354(1): 39-56.
Hersch, S.M. and Ferrante, R.J. (2004). Translating therapies for Huntington's disease from genetic
animal models to clinical trials. Neurorx 1(3): 298-306.
Hetman, M., Kanning, K., Cavanaugh, J.E. and Xia, Z. (1999). Neuroprotection by brain-derived
neurotrophic factor is mediated by extracellular signal-regulated kinase and
phosphatidylinositol 3-kinase. Journal of Biological Chemistry 274(32): 22569-80.
Hickey, M.A. and Chesselet, M.F. (2003). Apoptosis in Huntington's disease. Progress in NeuroPsychopharmacology and Biological Psychiatry 27(2): 255-65.
Hodgson, J.G., Agopyan, N., Gutekunst, C.A., Leavitt, B.R., LePiane, F., Singaraja, R., Smith, D.J.,
Bissada, N., McCutcheon, K., Nasir, J., Jamot, L., Li, X.J., Stevens, M.E., Rosemond, E.,
Roder, J.C., Phillips, A.G., Rubin, E.M., Hersch, S.M. and Hayden, M.R. (1999). A YAC mouse
model for Huntington's disease with full-length mutant huntingtin, cytoplasmic toxicity, and
selective striatal neurodegeneration. Neuron 23(1): 181-92.
Hsich, G., Sena-Esteves, M. and Breakefield, X.O. (2002). Critical issues in gene therapy for
neurologic disease. Human Gene Therapy 13: 579-604.
Hu, Y., Leaver, S.G., Plant, G.W., Hendriks, W.T., Niclou, S.P., Verhaagen, J., Harvey, A.R. and
Cui, Q. (2005). Lentiviral-mediated transfer of CNTF to schwann cells within reconstructed
peripheral nerve grafts enhances adult retinal ganglion cell survival and axonal regeneration.
Molecular Therapy 11(6): 906-15.
Huang, D.C. and Strasser, A. (2000). BH3-Only proteins-essential initiators of apoptotic cell death.
Cell 103(6): 839-42.
231
Literature References
Huang, E.J. and Reichardt, L.F. (2001). Neurotrophins: roles in neuronal development and function.
Annual Review of Neuroscience 24: 677-736.
Hudson, J., Granholm, A.C., Gerhardt, G.A., Henry, M.A., Hoffman, A., Biddle, P., Leela, N.S.,
Mackerlova, L., Lile, J.D., Collins, F. and et al. (1995). Glial cell line-derived neurotrophic
factor augments midbrain dopaminergic circuits in vivo. Brain Research Bulletin 36(5): 42532.
Hughes, P.E., Alexi, T., Yoshida, T., Schreiber, S.S. and Knusel, B. (1996). Excitotoxic lesion of rat
brain with quinolinic acid induces expression of p53 messenger RNA and protein and p53inducible genes Bax and Gadd-45 in brain areas showing DNA fragmentation. Neuroscience
74(4): 1143-60.
Hughes, P.E., Alexi, T., Williams, C.E., Clark, R.G. and Gluckman, P.D. (1999). Administration of
recombinant human Activin-A has powerful neurotrophic effects on select striatal phenotypes in
the quinolinic acid lesion model of Huntington's disease. Neuroscience 92(1): 197-209.
Huntington's Disease Collaborative Research Group (1993). A novel gene containing a trinucleotide
repeat that is expanded and unstable on Huntington's disease chromosomes. The Huntington's
Disease Collaborative Research Group. Cell 72(6): 971-83.
Ip, N.Y., McClain, J., Barrezueta, N.X., Aldrich, T.H., Pan, L., Li, Y., Wiegand, S.J., Friedman, B.,
Davis, S. and Yancopoulos, G.D. (1993). The alpha component of the CNTF receptor is
required for signaling and defines potential CNTF targets in the adult and during development.
Neuron 10(1): 89-102.
Isacson, O., Dunnett, S.B. and Bjorklund, A. (1986). Graft-induced behavioral recovery in an animal
model of Huntington disease. Proceedings of the National Academy of Sciences of the
United States of America 83(8): 2728-32.
Ito, H., Nakajima, A., Nomoto, H. and Furukawa, S. (2003). Neurotrophins facilitate neuronal
differentiation of cultured neural stem cells via induction of mRNA expression of basic helixloop-helix transcription factors Mash1 and Math1. Journal of Neuroscience Research 71(5):
648-58.
Ivkovic, S. and Ehrlich, M.E. (1999). Expression of the striatal DARPP-32/ARPP-21 phenotype in
GABAergic neurons requires neurotrophins in vivo and in vitro. Journal of Neuroscience
19(13): 5409-19.
Jana, N.R., Zemskov, E.A., Wang, G. and Nukina, N. (2001). Altered proteasomal function due to
the expression of polyglutamine-expanded truncated N-terminal huntingtin induces apoptosis
by caspase activation through mitochondrial cytochrome c release. Human Molecular
Genetics 10(10): 1049-59.
Jiang, L., Rampalli, S., George, D., Press, C., Bremer, E.G., O'Gorman, M.R. and Bohn, M.C.
(2004). Tight regulation from a single tet-off rAAV vector as demonstrated by flow cytometry
and quantitative, real-time PCR. Gene Therapy 11(13): 1057-67.
Jing, S., Wen, D., Yu, Y., Holst, P.L., Luo, Y., Fang, M., Tamir, R., Antonio, L., Hu, Z., Cupples, R.,
Louis, J.C., Hu, S., Altrock, B.W. and Fox, G.M. (1996). GDNF-induced activation of the ret
protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell 85(7):
1113-24.
Joel, D., Ayalon, L., Tarrasch, R., Veenman, L., Feldon, J. and Weiner, I. (1998). Electrolytic lesion
of globus pallidus ameliorates the behavioral and neurodegenerative effects of quinolinic acid
lesion of the striatum: a potential novel treatment in a rat model of Huntington's disease. Brain
Research 787(1): 143-8.
232
Literature References
Joel, D. (2001). Open interconnected model of basal ganglia-thalamocortical circuitry and its
relevance to the clinical syndrome of Huntington's disease. Movement Disorders 16(3): 40723.
Johnson, E.M., Jr., Chang, J.Y., Koike, T. and Martin, D.P. (1989). Why do neurons die when
deprived of trophic factor? Neurobiology of Aging 10(5): 549-52; discussion 552-3.
Jooss, K., Yang, Y., Fisher, K.J. and Wilson, J.M. (1998). Transduction of dendritic cells by DNA
viral vectors directs the immune response to transgene products in muscle fibers. Journal of
Virology 72(5): 4212-23.
Kantor, O., Temel, Y., Holzmann, C., Raber, K., Nguyen, H.P., Cao, C., Turkoglu, H.O., Rutten,
B.P., Visser-Vandewalle, V., Steinbusch, H.W., Blokland, A., Korr, H., Riess, O., von Horsten,
S. and Schmitz, C. (2006). Selective striatal neuron loss and alterations in behavior correlate
with impaired striatal function in Huntington's disease transgenic rats. Neurobiology of
Disease 22(3): 538-47.
Kaspar, B.K., Erickson, D., Schaffer, D., Hinh, L., Gage, F.H. and Peterson, D.A. (2002). Targeted
retrograde gene delivery for neuronal protection. Molecular Therapy 5(1): 50-6.
Katoh-Semba, R., Semba, R., Takeuchi, I.K. and Kato, K. (1998). Age-related changes in levels of
brain-derived neurotrophic factor in selected brain regions of rats, normal mice and
senescence-accelerated mice: a comparison to those of nerve growth factor and neurotrophin3. Neuroscience Research 31(3): 227-34.
Kells, A.P., Fong, D.M., Dragunow, M., During, M.J., Young, D. and Connor, B. (2004). AAVmediated gene delivery of BDNF or GDNF is neuroprotective in a model of Huntington disease.
Molecular Therapy 9(5): 682-8.
Kells, A.P., Henry, R.A., Hughes, S.M. and Connor, B. (2006). Verification of functional AAVmediated neurotrophic and anti-apoptotic factor expression. Journal of Neuroscience
Methods: doi:10.1016/j.jneumeth.2006.11.006.
Kernie, S.G., Liebl, D.J. and Parada, L.F. (2000). BDNF regulates eating behavior and locomotor
activity in mice. EMBO Journal 19(6): 1290-300.
Kerr, J.F., Wyllie, A.H. and Currie, A.R. (1972). Apoptosis: a basic biological phenomenon with
wide-ranging implications in tissue kinetics. British Journal of Cancer 26(4): 239-57.
Kiechle, T., Dedeoglu, A., Kubilus, J., Kowall, N.W., Beal, M.F., Friedlander, R.M., Hersch, S.M.
and Ferrante, R.J. (2002). Cytochrome C and caspase-9 expression in Huntington's disease.
Neuromolecular Medicine 1(3): 183-95.
Kim, R. (2005). Unknotting the roles of Bcl-2 and Bcl-xL in cell death. Biochemical and
Biophysical Research Communications 333(2): 336-43.
Kirik, D., Rosenblad, C. and Bjorklund, A. (2000a). Preservation of a functional nigrostriatal
dopamine pathway by GDNF in the intrastriatal 6-OHDA lesion model depends on the site of
administration of the trophic factor. European Journal of Neuroscience 12(11): 3871-82.
Kirik, D., Rosenblad, C., Bjorklund, A. and Mandel, R.J. (2000b). Long-Term rAAV-Mediated Gene
Transfer of GDNF in the Rat Parkinson’s Model: Intrastriatal But Not Intranigral
Transduction Promotes Functional Regeneration in the Lesioned Nigrostriatal System. Journal
of Neuroscience 20(12): 4686-4700.
Kirschner, P.B., Henshaw, R., Weise, J., Trubetskoy, V., Finklestein, S., Schulz, J.B. and Beal, M.F.
(1995). Basic fibroblast growth factor protects against excitotoxicity and chemical hypoxia in
both neonatal and adult rats. Journal of Cerebral Blood Flow & Metabolism 15(4): 619-23.
233
Literature References
Klein, R.L., Hamby, A.E., Gong, Y., Hirko, A.C., Wang, S., Hughes, J.A., King, M.A. and Meyer,
E.M. (2002). Dose and promoter effects of adeno-associated viral vector for green fluorescent
protein expression in the rat brain. Experimental Neurology 176: 66-72.
Klugmann, M., Symes, C.W., Leichtlein, C.B., Klaussner, B.K., Dunning, J., Fong, D., Young, D.
and During, M.J. (2005). AAV-mediated hippocampal expression of short and long Homer 1
proteins differentially affect cognition and seizure activity in adult rats. Molecular & Cellular
Neurosciences 28(2): 347-60.
Knapska, E. and Kaczmarek, L. (2004). A gene for neuronal plasticity in the mammalian brain:
Zif268/Egr-1/NGFI-A/Krox-24/TIS8/ZENK? Progress in Neurobiology 74(4): 183-211.
Kokaia, Z., Bengzon, J., Metsis, M., Kokaia, M., Persson, H. and Lindvall, O. (1993). Coexpression
of neurotrophins and their receptors in neurons of the central nervous system. Proceedings of
the National Academy of Sciences of the United States of America 90(14): 6711-5.
Kokaia, Z., Andsberg, G., Yan, Q. and Lindvall, O. (1998). Rapid alterations of BDNF protein levels
in the rat brain after focal ischemia: evidence for increased synthesis and anterograde axonal
transport. Experimental Neurology 154(2): 289-301.
Kordower, J.H., Chen, E.Y., Winkler, C., Fricker, R., Charles, V., Messing, A., Mufson, E.J., Wong,
S.C., Rosenstein, J.M., Bjorklund, A., Emerich, D.F., Hammang, J. and Carpenter, M.K.
(1997). Grafts of EGF-responsive neural stem cells derived from GFAP-hNGF transgenic
mice: trophic and tropic effects in a rodent model of Huntington's disease. Journal of
Comparative Neurology 387(1): 96-113.
Kordower, J.H., Bloch, J., Ma, S.Y., Chu, Y., Palfi, S., Roitberg, B.Z., Emborg, M., Hantraye, P.,
Deglon, N. and Aebischer, P. (1999). Lentiviral gene transfer to the nonhuman primate brain.
Experimental Neurology 160(1): 1-16.
Kordower, J.H., Emborg, M.E., Bloch, J., Ma, S.Y., Chu, Y., Leventhal, L., McBride, J., Chen, E.Y.,
Palfi, S., Roitberg, B.Z., Brown, W.D., Holden, J.E., Pyzalski, R., Taylor, M.D., Carvey, P.,
Ling, Z., Trono, D., Hantraye, P., Deglon, N. and Aebischer, P. (2000). Neurodegeneration
prevented by lentiviral vector delivery of GDNF in primate models of Parkinson's disease.
Science 290(5492): 767-73.
Kotin, R.M., Linden, R.M. and Berns, K.I. (1992). Characterization of a preferred site on human
chromosome 19q for integration of adeno-associated virus DNA by non-homologous
recombination. EMBO Journal 11(13): 5071-8.
Krestel, H.E., Mihaljevic, A.L., Hoffman, D.A. and Schneider, A. (2004). Neuronal co-expression of
EGFP and beta-galactosidase in mice causes neuropathology and premature death.
Neurobiology of Disease 17(2): 310-8.
Krieglstein, K. (2004). Factors promoting survival of mesencephalic dopaminergic neurons. Cell
and Tissue Research 318(1): 73-80.
Kugler, S., Straten, G., Kreppel, F., Isenmann, S., Liston, P. and Bahr, M. (2000). The X-linked
inhibitor of apoptosis (XIAP) prevents cell death in axotomized CNS neurons in vivo. Cell
Death and Differentiation 7(9): 815-24.
Kuipers, S.D. and Bramham, C.R. (2006). Brain-derived neurotrophic factor mechanisms and
function in adult synaptic plasticity: new insights and implications for therapy. Current
Opinion in Drug Discovery and Development 9(5): 580-6.
Kuwana, T., Mackey, M.R., Perkins, G., Ellisman, M.H., Latterich, M., Schneiter, R., Green, D.R.
and Newmeyer, D.D. (2002). Bid, Bax, and lipids cooperate to form supramolecular openings
in the outer mitochondrial membrane. Cell 111(3): 331-42.
234
Literature References
Laforet, G.A., Sapp, E., Chase, K., McIntyre, C., Boyce, F.M., Campbell, M., Cadigan, B.A.,
Warzecki, L., Tagle, D.A., Reddy, P.H., Cepeda, C., Calvert, C.R., Jokel, E.S., Klapstein, G.J.,
Ariano, M.A., Levine, M.S., DiFiglia, M. and Aronin, N. (2001). Changes in cortical and
striatal neurons predict behavioral and electrophysiological abnormalities in a transgenic
murine model of Huntington's disease. Journal of Neuroscience 21(23): 9112-23.
Landwehrmeyer, G.B., Standaert, D.G., Testa, C.M., Penney, J.B., Jr. and Young, A.B. (1995).
NMDA receptor subunit mRNA expression by projection neurons and interneurons in rat
striatum. Journal of Neuroscience 15(7 Pt 2): 5297-307.
Lauterbach, H., Ried, C., Epstein, A.L., Marconi, P. and Brocker, T. (2005). Reduced immune
responses after vaccination with a recombinant herpes simplex virus type 1 vector in the
presence of antiviral immunity. Journal of General Virology 86(Pt 9): 2401-10.
Leavitt, B.R., van Raamsdonk, J.M., Shehadeh, J., Fernandes, H., Murphy, Z., Graham, R.K.,
Wellington, C.L., Raymond, L.A. and Hayden, M.R. (2006). Wild-type huntingtin protects
neurons from excitotoxicity. Journal of Neurochemistry 96(4): 1121-9.
Lee, R., Kermani, P., Teng, K.K. and Hempstead, B.L. (2001). Regulation of cell survival by
secreted proneurotrophins. Science 294(5548): 1945-8.
Leegwater-Kim, J. and Cha, J.H. (2004). The paradigm of Huntington's disease: therapeutic
opportunities in neurodegeneration. Neurorx 1(1): 128-38.
Levi-Montalcini, R. and Hamburger, V. (1953). A diffusible agent of mouse sarcoma producing
hyperplasia of sympathetic ganglia and hyperneurotization of viscera in the chick embryo.
Journal of Experimental Zoology 123: 233-287.
Levi-Montalcini, R. (1987). The nerve growth factor 35 years later. Science 237(4819): 1154-62.
Levine, M.S., Klapstein, G.J., Koppel, A., Gruen, E., Cepeda, C., Vargas, M.E., Jokel, E.S.,
Carpenter, E.M., Zanjani, H., Hurst, R.S., Efstratiadis, A., Zeitlin, S. and Chesselet, M.F.
(1999). Enhanced sensitivity to N-methyl-D-aspartate receptor activation in transgenic and
knockin mouse models of Huntington's disease. Journal of Neuroscience Research 58(4): 51532.
Levy, Y.S., Gilgun-Sherki, Y., Melamed, E. and Offen, D. (2005). Therapeutic potential of
neurotrophic factors in neurodegenerative diseases. BioDrugs 19(2): 97-127.
Li, H., Li, S.H., Johnston, H., Shelbourne, P.F. and Li, X.J. (2000). Amino-terminal fragments of
mutant huntingtin show selective accumulation in striatal neurons and synaptic toxicity. Nature
Genetics 25(4): 385-9.
Li, S.H., Lam, S., Cheng, A.L. and Li, X.J. (2000). Intranuclear huntingtin increases the expression
of caspase-1 and induces apoptosis. Human Molecular Genetics 9(19): 2859-67.
Li, T., Fan, Y., Luo, Y., Xiao, B. and Lu, C. (2006). In vivo delivery of a XIAP (BIR3-RING) fusion
protein containing the protein transduction domain protects against neuronal death induced by
seizures. Experimental Neurology 197(2): 301-8.
Lin, C.H., Tallaksen-Greene, S., Chien, W.M., Cearley, J.A., Jackson, W.S., Crouse, A.B., Ren, S.,
Li, X.J., Albin, R.L. and Detloff, P.J. (2001). Neurological abnormalities in a knock-in mouse
model of Huntington's disease. Human Molecular Genetics 10(2): 137-44.
Lin, L.F., Doherty, D.H., Lile, J.D., Bektesh, S. and Collins, F. (1993). GDNF: a glial cell linederived neurotrophic factor for midbrain dopaminergic neurons. Science 260(5111): 1130-2.
235
Literature References
Linden, R.M., Winocour, E. and Berns, K.I. (1996). The recombination signals for adeno-associated
virus site-specific integration. Proceedings of the National Academy of Sciences of the
United States of America 93(15): 7966-72.
Lindsay, R.M., Wiegand, S.J., Altar, C.A. and DiStefano, P.S. (1994). Neurotrophic factors: from
molecule to man. Trends in Neurosciences 17(5): 182-90.
Loeb, J.E., Cordier, W.S., Harris, M.E., Weitzman, M.D. and Hope, T.J. (1999). Enhanced
expression of transgenes from adeno-associated virus vectors with the woodchuck hepatitis
virus posttranscriptional regulatory element: implications for gene therapy. Human Gene
Therapy 10(14): 2295-305.
Loo, D.T. and Rillema, J.R. (1998). Measurement of cell death. Methods in Cell Biology 57: 25164.
Lu, B. (2003). BDNF and activity-dependent synaptic modulation. Learning and Memory 10(2):
86-98.
Luthi-Carter, R., Strand, A., Peters, N.L., Solano, S.M., Hollingsworth, Z.R., Menon, A.S., Frey,
A.S., Spektor, B.S., Penney, E.B., Schilling, G., Ross, C.A., Borchelt, D.R., Tapscott, S.J.,
Young, A.B., Cha, J.H. and Olson, J.M. (2000). Decreased expression of striatal signaling
genes in a mouse model of Huntington's disease. Human Molecular Genetics 9(9): 1259-71.
Macdonald, V. and Halliday, G. (2002). Pyramidal cell loss in motor cortices in Huntington's
disease. Neurobiology of Disease 10(3): 378-86.
MacGibbon, G.A., Lawlor, P.A., Hughes, P., Young, D. and Dragunow, M. (1995). Differential
expression of inducible transcription factors in basal ganglia neurons. Brain Research.
Molecular Brain Research 34(2): 294-302.
Maciel, E.N., Kaminski Schierle, G.S., Hansson, O., Brundin, P. and Castilho, R.F. (2003).
Cyclosporin A and Bcl-2 do not inhibit quinolinic acid-induced striatal excitotoxicity in
rodents. Experimental Neurology 183(2): 430-7.
Malik, J.M., Shevtsova, Z., Bahr, M. and Kugler, S. (2005). Long-term in vivo inhibition of CNS
neurodegeneration by Bcl-XL gene transfer. Molecular Therapy 11(3): 373-81.
Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., Hetherington, C., Lawton, M.,
Trottier, Y., Lehrach, H., Davies, S.W. and Bates, G.P. (1996). Exon 1 of the HD gene with an
expanded CAG repeat is sufficient to cause a progressive neurological phenotype in transgenic
mice. Cell 87(3): 493-506.
Marco, S., Canudas, A.M., Canals, J.M., Gavalda, N., Perez-Navarro, E. and Alberch, J. (2002).
Excitatory amino acids differentially regulate the expression of GDNF, neurturin, and their
receptors in the adult rat striatum. Experimental Neurology 174(2): 243-52.
Martin, S.J. and Green, D.R. (1995). Protease activation during apoptosis: death by a thousand
cuts? Cell 82(3): 349-52.
Martinez-Serrano, A., Lundberg, C., Horellou, P., Fischer, W., Bentlage, C., Campbell, K., McKay,
R.D., Mallet, J. and Bjorklund, A. (1995). CNS-derived neural progenitor cells for gene
transfer of nerve growth factor to the adult rat brain: complete rescue of axotomized
cholinergic neurons after transplantation into the septum. Journal of Neuroscience 15(8):
5668-80.
Martinez-Serrano, A. and Bjorklund, A. (1996). Protection of the neostriatum against excitotoxic
damage by neurotrophin-producing, genetically modified neural stem cells. Journal of
Neuroscience 16(15): 4604-4616.
236
Literature References
Martin-Iverson, M.T., Todd, K.G. and Altar, C.A. (1994). Brain-derived neurotrophic factor and
neurotrophin-3 activate striatal dopamine and serotonin metabolism and related behaviors:
interactions with amphetamine. Journal of Neuroscience 14(3 Pt 1): 1262-70.
Martin-Iverson, M.T. and Altar, C.A. (1996). Spontaneous behaviours of rats are differentially
affected by substantia nigra infusions of brain-derived neurotrophic factor and neurotrophin-3.
European Journal of Neuroscience 8(8): 1696-706.
Martinou, J.C. and Green, D.R. (2001). Breaking the mitochondrial barrier. Nature Reviews.
Molecular Cell Biology 2(1): 63-7.
Marty, S., Berzaghi Mda, P. and Berninger, B. (1997). Neurotrophins and activity-dependent
plasticity of cortical interneurons. Trends in Neurosciences 20(5): 198-202.
Marx, J. (2005). Neurodegeneration. Huntington's research points to possible new therapies.
Science 310(5745): 43-5.
Mastakov, M.Y., Baer, K., Xu, R., Fitzsimons, H. and During, M.J. (2001). Combined injection of
rAAV with mannitol enhances gene expression in the rat brain. Molecular Therapy 3(2): 22532.
Mastakov, M.Y., Baer, K., Symes, C.W., Leichtlein, C.B., Kotin, R.M. and During, M.J. (2002).
Immunological aspects of recombinant adeno-associated virus delivery to the mammalian
brain. Journal of Virology 76(16): 8446-54.
Masu, Y., Wolf, E., Holtmann, B., Sendtner, M., Brem, G. and Thoenen, H. (1993). Disruption of the
CNTF gene results in motor neuron degeneration. Nature 365(6441): 27-32.
Matsushita, T., Elliger, S., Elliger, C., Podsakoff, G., Villarreal, L., Kurtzman, G.J., Iwaki, Y. and
Colosi, P. (1998). Adeno-associated virus vectors can be efficiently produced without helper
virus. Gene Therapy 5(7): 938-45.
Mattson, M.P. (2000). Neuroprotective signaling and the aging brain: take away my food and let me
run. Brain Research 886(1-2): 47-53.
McBride, J.L., During, M.J., Wuu, J., Chen, E.Y., Leurgans, S.E. and Kordower, J.H. (2003).
Structural and functional neuroprotection in a rat model of Huntington's disease by viral gene
transfer of GDNF. Experimental Neurology 181(2): 213-23.
McBride, J.L., Ramaswamy, S., Gasmi, M., Bartus, R.T., Herzog, C.D., Brandon, E.P., Zhou, L.,
Pitzer, M.R., Berry-Kravis, E.M. and Kordower, J.H. (2006). Viral delivery of glial cell linederived neurotrophic factor improves behavior and protects striatal neurons in a mouse model
of Huntington's disease. Proceedings of the National Academy of Sciences of the United
States of America 103(24): 9345-50.
McGeorge, A.J. and Faull, R.L. (1989). The organization of the projection from the cerebral cortex
to the striatum in the rat. Neuroscience 29(3): 503-37.
Merlio, J.P., Ernfors, P., Kokaia, Z., Middlemas, D.S., Bengzon, J., Kokaia, M., Smith, M.L., Siesjo,
B.K., Hunter, T. and Lindvall, O. (1993). Increased production of the TrkB protein tyrosine
kinase receptor after brain insults. Neuron 10(2): 151-64.
Merten, O.W., Geny-Fiamma, C. and Douar, A.M. (2005). Current issues in adeno-associated viral
vector production. Gene Therapy 12 Suppl 1: S51-61.
Meyer-Franke, A., Wilkinson, G.A., Kruttgen, A., Hu, M., Munro, E., Hanson, M.G., Jr., Reichardt,
L.F. and Barres, B.A. (1998). Depolarization and cAMP elevation rapidly recruit TrkB to the
plasma membrane of CNS neurons. Neuron 21(4): 681-93.
237
Literature References
Miagkov, A., Turchan, J., Nath, A. and Drachman, D.B. (2004). Gene transfer of baculoviral p35 by
adenoviral vector protects human cerebral neurons from apoptosis. DNA & Cell Biology
23(8): 496-501.
Miranda, R.C., Sohrabji, F. and Toran-Allerand, C.D. (1993). Neuronal colocalization of mRNAs for
neurotrophins and their receptors in the developing central nervous system suggests a potential
for autocrine interactions. Proceedings of the National Academy of Sciences of the United
States of America 90(14): 6439-43.
Mitchell, I.J. (1990). Striatal outputs and dsykinesia. Journal of Psychopharmacology 4: 188-197.
Mittoux, V., Joseph, J.M., Conde, F., Palfi, S., Dautry, C., Poyot, T., Bloch, J., Deglon, N., Ouary,
S., Nimchinsky, E.A., Brouillet, E., Hof, P.R., Peschanski, M., Aebischer, P. and Hantraye, P.
(2000). Restoration of cognitive and motor functions by ciliary neurotrophic factor in a primate
model of Huntington's disease. Human Gene Therapy 11(8): 1177-87.
Mittoux, V., Ouary, S., Monville, C., Lisovoski, F., Poyot, T., Conde, F., Escartin, C., Robichon, R.,
Brouillet, E., Peschanski, M. and Hantraye, P. (2002). Corticostriatopallidal neuroprotection by
adenovirus-mediated ciliary neurotrophic factor gene transfer in a rat model of progressive
striatal degeneration. Journal of Neuroscience 22(11): 4478-86.
Miyoshi, H., Blomer, U., Takahashi, M., Gage, F.H. and Verma, I.M. (1998). Development of a selfinactivating lentivirus vector. Journal of Virology 72(10): 8150-7.
Mizuno, K., Carnahan, J. and Nawa, H. (1994). Brain-derived neurotrophic factor promotes
differentiation of striatal GABAergic neurons. Developmental Biology 165(1): 243-56.
Mobley, W.C., Woo, J.E., Edwards, R.H., Riopelle, R.J., Longo, F.M., Weskamp, G., Otten, U.,
Valletta, J.S. and Johnston, M.V. (1989). Developmental regulation of nerve growth factor and
its receptor in the rat caudate-putamen. Neuron 3(5): 655-64.
Mochizuki, H., Miura, M., Shimada, T. and Mizuno, Y. (2002). Adeno-associated virus-mediated
antiapoptotic gene delivery: in vivo gene therapy for neurological disorders. Methods 28(2):
248-52.
Monahan, P.E. and Samulski, R.J. (2000). Adeno-associated virus vectors for gene therapy: more
pros than cons? Molecular Medicine Today 6(11): 433-40.
Montoya, C.P., Astell, S. and Dunnett, S.B. (1990). Effects of nigral and striatal grafts on skilled
forelimb use in the rat. Progress in Brain Research 82: 459-66.
Montoya, C.P., Campbell-Hope, L.J., Pemberton, K.D. and Dunnett, S.B. (1991). The "staircase
test": a measure of independent forelimb reaching and grasping abilities in rats. Journal of
Neuroscience Methods 36(2-3): 219-28.
Morton, A.J., Lagan, M.A., Skepper, J.N. and Dunnett, S.B. (2000). Progressive formation of
inclusions in the striatum and hippocampus of mice transgenic for the human Huntington's
disease mutation. Journal of Neurocytology 29(9): 679-702.
Mowla, S.J., Farhadi, H.F., Pareek, S., Atwal, J.K., Morris, S.J., Seidah, N.G. and Murphy, R.A.
(2001). Biosynthesis and post-translational processing of the precursor to brain-derived
neurotrophic factor. Journal of Biological Chemistry 276(16): 12660-6.
Muchmore, S.W., Sattler, M., Liang, H., Meadows, R.P., Harlan, J.E., Yoon, H.S., Nettesheim, D.,
Chang, B.S., Thompson, C.B., Wong, S.L., Ng, S.L. and Fesik, S.W. (1996). X-ray and NMR
structure of human Bcl-xL, an inhibitor of programmed cell death. Nature 381(6580): 335-41.
238
Literature References
Mufson, E.J., Conner, J.M., Varon, S. and Kordower, J.H. (1994). Nerve growth factor-like
immunoreactive profiles in the primate basal forebrain and hippocampal formation. Journal of
Comparative Neurology 341(4): 507-19.
Mufson, E.J., Kroin, J.S., Sendera, T.J. and Sobreviela, T. (1999). Distribution and retrograde
transport of trophic factors in the central nervous system: functional implications for the
treatment of neurodegenerative diseases. Progress in Neurobiology 57(4): 451-84.
Murer, M.G., Yan, Q. and Raisman-Vozari, R. (2001). Brain-derived neurotrophic factor in the
control human brain, and in Alzheimer's disease and Parkinson's disease. Progress in
Neurobiology 63(1): 71-124.
Muzyczka, N. and Warrington, K.H., Jr. (2005). Custom adeno-associated virus capsids: the next
generation of recombinant vectors with novel tropism. Human Gene Therapy 16(4): 408-16.
Naert, G., Ixart, G., Tapia-Arancibia, L. and Givalois, L. (2006). Continuous i.c.v. infusion of brainderived neurotrophic factor modifies hypothalamic-pituitary-adrenal axis activity, locomotor
activity and body temperature rhythms in adult male rats. Neuroscience 139(2): 779-89.
Nakai, M., Qin, Z.H., Wang, Y. and Chase, T.N. (1999). Free radical scavenger OPC-14117
attenuates quinolinic acid-induced NF-kappaB activation and apoptosis in rat striatum. Brain
Research. Molecular Brain Research 64(1): 59-68.
Nakao, N., Brundin, P., Funa, K., Lindvall, O. and Odin, P. (1995). Trophic and protective actions of
brain-derived neurotrophic factor on striatal DARPP-32-containing neurons in vitro. Brain
Research. Developmental Brain Research 90(1-2): 92-101.
Nakao, N., Grasbon-Frodl, E.M., Widner, H. and Brundin, P. (1996). Antioxidant treatment protects
striatal neurons against excitotoxic insults. Neuroscience 73(1): 185-200.
Nakao, N. and Brundin, P. (1997). Effects of alpha-phenyl-tert-butyl nitrone on neuronal survival
and motor function following intrastriatal injections of quinolinate or 3-nitropropionic acid.
Neuroscience 76(3): 749-61.
Nakao, N. and Itakura, T. (2000). Fetal tissue transplants in animal models of Huntington's disease:
the effects on damaged neuronal circuitry and behavioral deficits. Progress in Neurobiology
61(3): 313-38.
Natsume, A., Mata, M., Goss, J., Huang, S., Wolfe, D., Oligino, T., Glorioso, J. and Fink, D.J.
(2001). Bcl-2 and GDNF delivered by HSV-mediated gene transfer act additively to protect
dopaminergic neurons from 6-OHDA-induced degeneration. Experimental Neurology 169(2):
231-8.
Newmeyer, D.D. and Ferguson-Miller, S. (2003). Mitochondria: releasing power for life and
unleashing the machineries of death. Cell 112(4): 481-90.
Nguyen, J.B., Sanchez-Pernaute, R., Cunningham, J. and Bankiewicz, K.S. (2001). Convectionenhanced delivery of AAV-2 combined with heparin increases TK gene transfer in the rat brain.
Neuroreport 12(9): 1961-4.
Nishino, H., Shimano, Y., Kumazaki, M. and Sakurai, T. (1995). Chronically administered 3nitropropionic acid induces striatal lesions attributed to dysfunction of the blood-brain barrier.
Neuroscience Letters 186(2-3): 161-4.
Norman, A.B., Norgren, R.B., Wyatt, L.M., Hildebrand, J.P. and Sanberg, P.R. (1992). The direction
of apomorphine-induced rotation behavior is dependent on the location of excitotoxin lesions in
the rat basal ganglia. Brain Research 569(1): 169-72.
239
Literature References
Nucifora, F.C., Jr., Sasaki, M., Peters, M.F., Huang, H., Cooper, J.K., Yamada, M., Takahashi, H.,
Tsuji, S., Troncoso, J., Dawson, V.L., Dawson, T.M. and Ross, C.A. (2001). Interference by
huntingtin and atrophin-1 with cbp-mediated transcription leading to cellular toxicity. Science
291(5512): 2423-8.
Nykjaer, A., Lee, R., Teng, K.K., Jansen, P., Madsen, P., Nielsen, M.S., Jacobsen, C., Kliemannel,
M., Schwarz, E., Willnow, T.E., Hempstead, B.L. and Petersen, C.M. (2004). Sortilin is
essential for proNGF-induced neuronal cell death. Nature 427(6977): 843-8.
Olsson, M., Nikkhah, G., Bentlage, C. and Bjorklund, A. (1995). Forelimb akinesia in the rat
Parkinson model: differential effects of dopamine agonists and nigral transplants as assessed
by a new stepping test. Journal of Neuroscience 15(5 Pt 2): 3863-75.
Oppenheim, R.W. (1991). Cell death during development of the nervous system. Annual Review of
Neuroscience 14: 453-501.
Orrenius, S., Zhivotovsky, B. and Nicotera, P. (2003). Regulation of cell death: the calciumapoptosis link. Nature Reviews. Molecular Cell Biology 4(7): 552-65.
Ouimet, C.C., Miller, P.E., Hemmings, H.C., Jr., Walaas, S.I. and Greengard, P. (1984). DARPP-32,
a dopamine- and adenosine 3':5'-monophosphate-regulated phosphoprotein enriched in
dopamine-innervated brain regions. III. Immunocytochemical localization. Journal of
Neuroscience 4(1): 111-24.
Ouimet, C.C., Langley-Gullion, K.C. and Greengard, P. (1998). Quantitative immunocytochemistry
of DARPP-32-expressing neurons in the rat caudatoputamen. Brain Research 808(1): 8-12.
Palfi, S., Leventhal, L., Chu, Y., Ma, S.Y., Emborg, M., Bakay, R., Deglon, N., Hantraye, P.,
Aebischer, P. and Kordower, J.H. (2002). Lentivirally delivered glial cell line-derived
neurotrophic factor increases the number of striatal dopaminergic neurons in primate models
of nigrostriatal degeneration. Journal of Neuroscience 22(12): 4942-54.
Pang, P.T., Teng, H.K., Zaitsev, E., Woo, N.T., Sakata, K., Zhen, S., Teng, K.K., Yung, W.H.,
Hempstead, B.L. and Lu, B. (2004). Cleavage of proBDNF by tPA/plasmin is essential for
long-term hippocampal plasticity. Science 306(5695): 487-91.
Panov, A.V., Gutekunst, C.A., Leavitt, B.R., Hayden, M.R., Burke, J.R., Strittmatter, W.J. and
Greenamyre, J.T. (2002). Early mitochondrial calcium defects in Huntington's disease are a
direct effect of polyglutamines. Nature Neuroscience 5(8): 731-6.
Paterna, J.C., Moccetti, T., Mura, A., Feldon, J. and Bueler, H. (2000). Influence of promoter and
WHV post-transcriptional regulatory element on AAV-mediated transgene expression in the rat
brain. Gene Therapy 7(15): 1304-11.
Paxinos, G. and Watson, C. (1986). The Rat Brain in Stereotaxic Coordinates. Academic Press.
Peel, A.L. and Klein, R.L. (2000). Adeno-associated virus vectors: activity and applications in the
CNS. Journal of Neuroscience Methods 98(2): 95-104.
Pelleymounter, M.A., Cullen, M.J. and Wellman, C.L. (1995). Characteristics of BDNF-induced
weight loss. Experimental Neurology 131(2): 229-38.
Penney, J.B., Jr. and Young, A.B. (1986). Striatal inhomogeneities and basal ganglia function.
Movement Disorders 1(1): 3-15.
Perez-Navarro, E., Alberch, J., Arenas, E., Calvo, N. and Marsal, J. (1994). Nerve growth factor and
basic fibroblast growth factor protect cholinergic neurons against quinolinic acid excitotoxicity
in rat neostriatum. European Journal of Neuroscience 6(5): 706-11.
240
Literature References
Perez-Navarro, E., Arenas, E., Reiriz, J., Calvo, N. and Alberch, J. (1996). Glial cell line-derived
neurotrophic factor protects striatal calbindin-immunoreactive neurons from excitotoxic
damage. Neuroscience 75(2): 345-52.
Perez-Navarro, E., Arenas, E., Marco, S. and Alberch, J. (1999). Intrastriatal grafting of a GDNFproducing cell line protects striatonigral neurons from quinolinic acid excitotoxicity in vivo.
European Journal of Neuroscience 11(1): 241-9.
Perez-Navarro, E., Akerud, P., Marco, S., Canals, J.M., Tolosa, E., Arenas, E. and Alberch, J.
(2000). Neurturin protects striatal projection neurons but not interneurons in a rat model of
Huntington's disease. Neuroscience 98(1): 89-96.
Perez-Navarro, E., Canudas, A.M., Akerund, P., Alberch, J. and Arenas, E. (2000a). Brain-derived
neurotrophic factor, neurotrophin-3, and neurotrophin-4/5 prevent the death of striatal
projection neurons in a rodent model of Huntington's disease. Journal of Neurochemistry
75(5): 2190-9.
Perez-Navarro, E., Gavalda, N., Gratacos, E. and Alberch, J. (2005). Brain-derived neurotrophic
factor prevents changes in Bcl-2 family members and caspase-3 activation induced by
excitotoxicity in the striatum. Journal of Neurochemistry 92(3): 678-91.
Perrelet, D., Ferri, A., MacKenzie, A.E., Smith, G.M., Korneluk, R.G., Liston, P., Sagot, Y.,
Terrado, J., Monnier, D. and Kato, A.C. (2000). IAP family proteins delay motoneuron cell
death in vivo. European Journal of Neuroscience 12(6): 2059-67.
Perrelet, D., Ferri, A., Liston, P., Muzzin, P., Korneluk, R.G. and Kato, A.C. (2002). IAPs are
essential for GDNF-mediated neuroprotective effects in injured motor neurons in vivo. Nature
Cell Biology 4(2): 175-9.
Petrin, D., Baker, A., Coupland, S.G., Liston, P., Narang, M., Damji, K., Leonard, B., Chiodo, V.A.,
Timmers, A., Hauswirth, W., Korneluk, R.G. and Tsilfidis, C. (2003a). Structural and
functional protection of photoreceptors from MNU-induced retinal degeneration by the Xlinked inhibitor of apoptosis. Investigative Ophthalmology & Visual Science 44(6): 2757-63.
Petrin, D., Baker, A., Brousseau, J., Coupland, S., Liston, P., Hauswirth, W.W., Komeluk, R.G. and
Tsilfidis, C. (2003b). XIAP protects photoreceptors from n-methyl-n-nitrosourea-induced
retinal degeneration. Advances in Experimental Medicine and Biology 533: 385-93.
Pisa, M., Sanberg, P.R. and Fibiger, H.C. (1981). Striatal injections of kainic acid selectively impair
serial memory performance in the rat. Experimental Neurology 74(3): 633-53.
Pochon, N.A., Menoud, A., Tseng, J.L., Zurn, A.D. and Aebischer, P. (1997). Neuronal GDNF
expression in the adult rat nervous system identified by in situ hybridization. European
Journal of Neuroscience 9(3): 463-71.
Poeschla, E.M. (2003). Non-primate lentiviral vectors. Current Opinion in Molecular
Therapeutics 5(5): 529-40.
Ponnazhagan, S., Erikson, D., Kearns, W.G., Zhou, S.Z., Nahreini, P., Wang, X.S. and Srivastava, A.
(1997). Lack of site-specific integration of the recombinant adeno-associated virus 2 genomes
in human cells. Human Gene Therapy 8(3): 275-84.
Popoli, P., Pezzola, A., Domenici, M.R., Sagratella, S., Diana, G., Caporali, M.G., Bronzetti, E.,
Vega, J. and Scotti de Carolis, A. (1994). Behavioral and electrophysiological correlates of the
quinolinic acid rat model of Huntington's disease in rats. Brain Research Bulletin 35(4): 32935.
241
Literature References
Popovic, N., Maingay, M., Kirik, D. and Brundin, P. (2005). Lentiviral gene delivery of GDNF into
the striatum of R6/2 Huntington mice fails to attenuate behavioral and neuropathological
changes. Experimental Neurology 193(1): 65-74.
Portera-Cailliau, C., Hedreen, J.C., Price, D.L. and Koliatsos, V.E. (1995). Evidence for apoptotic
cell death in Huntington disease and excitotoxic animal models. Journal of Neuroscience 15(5
Pt 2): 3775-87.
Prakash, N. and Wurst, W. (2006). Development of dopaminergic neurons in the mammalian brain.
Cellular & Molecular Life Sciences 63(2): 187-206.
Prosch, S., Stein, J., Staak, K., Liebenthal, C., Volk, H.D. and Kruger, D.H. (1996). Inactivation of
the very strong HCMV immediate early promoter by DNA CpG methylation in vitro. Biological
Chemistry Hoppe Seyler 377(3): 195-201.
Purves, D. (1988). Body and Brain. A Trophic Theory of Neural Connections. Harvard University
Press, Cambridge, MA.
Qin, Y., Soghomonian, J.J. and Chesselet, M.F. (1992). Effects of quinolinic acid on messenger
RNAs encoding somatostatin and glutamic acid decarboxylases in the striatum of adult rats.
Experimental Neurology 115(2): 200-11.
Qin, Z.H., Wang, Y. and Chase, T.N. (1996). Stimulation of N-methyl-D-aspartate receptors induces
apoptosis in rat brain. Brain Research 725(2): 166-76.
Qin, Z.H., Wang, J. and Gu, Z.L. (2005). Development of novel therapies for Huntington's disease:
hope and challenge. Acta Pharmacologica Sinica 26(2): 129-42.
Rabinowitz, J.E., Bowles, D.E., Faust, S.M., Ledford, J.G., Cunningham, S.E. and Samulski, R.J.
(2004). Cross-dressing the virion: the transcapsidation of adeno-associated virus serotypes
functionally defines subgroups. Journal of Virology 78(9): 4421-32.
Reddy, P.H., Williams, M., Charles, V., Garrett, L., Pike-Buchanan, L., Whetsell, W.O., Jr., Miller,
G. and Tagle, D.A. (1998). Behavioural abnormalities and selective neuronal loss in HD
transgenic mice expressing mutated full-length HD cDNA. Nature Genetics 20(2): 198-202.
Reiner, A., Albin, R.L., Anderson, K.D., D'Amato, C.J., Penney, J.B. and Young, A.B. (1988).
Differential loss of striatal projection neurons in Huntington disease. Proceedings of the
National Academy of Sciences of the United States of America 85(15): 5733-7.
Reiner, A. (2004). Can lesions of GPe correct HD deficits? Experimental Neurology 186(1): 1-5.
Reis, D.J., Gilad, G., Pickel, V.M. and Joh, T.H. (1978). Reversible changes in the activities and
amounts of tyrosine hydroxylase in dopamine neurons of the substantia nigra in response to
axonal injury as studied by immunochemical and immunocytochemical methods. Brain
Research 144(2): 325-42.
Richichi, C., Lin, E.J., Stefanin, D., Colella, D., Ravizza, T., Grignaschi, G., Veglianese, P., Sperk,
G., During, M.J. and Vezzani, A. (2004). Anticonvulsant and antiepileptogenic effects mediated
by adeno-associated virus vector neuropeptide Y expression in the rat hippocampus. Journal of
Neuroscience 24(12): 3051-9.
Rigamonti, D., Bauer, J.H., De-Fraja, C., Conti, L., Sipione, S., Sciorati, C., Clementi, E., Hackam,
A., Hayden, M.R., Li, Y., Cooper, J.K., Ross, C.A., Govoni, S., Vincenz, C. and Cattaneo, E.
(2000). Wild-type huntingtin protects from apoptosis upstream of caspase-3. Journal of
Neuroscience 20(10): 3705-13.
242
Literature References
Rigamonti, D., Sipione, S., Goffredo, D., Zuccato, C., Fossale, E. and Cattaneo, E. (2001).
Huntingtin's neuroprotective activity occurs via inhibition of procaspase-9 processing. Journal
of Biological Chemistry 276(18): 14545-8.
Ringstedt, T., Lagercrantz, H. and Persson, H. (1993). Expression of members of the trk family in the
developing postnatal rat brain. Brain Research. Developmental Brain Research 72(1): 11931.
Robertson, G.S., Crocker, S.J., Nicholson, D.W. and Schulz, J.B. (2000). Neuroprotection by the
inhibition of apoptosis. Brain Pathology 10(2): 283-92.
Rosenblad, C., Kirik, D. and Bjorklund, A. (2000). Sequential administration of GDNF into the
substantia nigra and striatum promotes dopamine neuron survival and axonal sprouting but not
striatal reinnervation or functional recovery in the partial 6-OHDA lesion model.
Experimental Neurology 161(2): 503-16.
Rubio, N. (1997). Mouse astrocytes store and deliver brain-derived neurotrophic factor using the
non-catalytic gp95trkB receptor. European Journal of Neuroscience 9(9): 1847-53.
Rudge, J.S., Li, Y., Pasnikowski, E.M., Mattsson, K., Pan, L., Yancopoulos, G.D., Wiegand, S.J.,
Lindsay, R.M. and Ip, N.Y. (1994). Neurotrophic factor receptors and their signal transduction
capabilities in rat astrocytes. European Journal of Neuroscience 6(5): 693-705.
Rudge, J.S., Pasnikowski, E.M., Holst, P. and Lindsay, R.M. (1995). Changes in neurotrophic factor
expression and receptor activation following exposure of hippocampal neuron/astrocyte
cocultures to kainic acid. Journal of Neuroscience 15(10): 6856-67.
Ryu, J.K., Kim, S.U. and McLarnon, J.G. (2003). Neuroprotective effects of pyruvate in the
quinolinic acid rat model of Huntington's disease. Experimental Neurology 183(2): 700-4.
Ryu, J.K., Choi, H.B. and McLarnon, J.G. (2006). Combined minocycline plus pyruvate treatment
enhances effects of each agent to inhibit inflammation, oxidative damage, and neuronal loss in
an excitotoxic animal model of Huntington's disease. Neuroscience 141(4): 1835-48.
Saelens, X., Festjens, N., Vande Walle, L., van Gurp, M., van Loo, G. and Vandenabeele, P. (2004).
Toxic proteins released from mitochondria in cell death. Oncogene 23(16): 2861-74.
Sakamoto, T., Kawazoe, Y., Shen, J.S., Takeda, Y., Arakawa, Y., Ogawa, J., Oyanagi, K., Ohashi,
T., Watanabe, K., Inoue, K., Eto, Y. and Watabe, K. (2003). Adenoviral gene transfer of
GDNF, BDNF and TGF beta 2, but not CNTF, cardiotrophin-1 or IGF1, protects injured adult
motoneurons after facial nerve avulsion. Journal of Neuroscience Methods 72(1): 54-64.
Salzberg-Brenhouse, H.C., Chen, E.Y., Emerich, D.F., Baldwin, S., Hogeland, K., Ranelli, S.,
Lafreniere, D., Perdomo, B., Novak, L., Kladis, T., Fu, K., Basile, A.S., Kordower, J.H. and
Bartus, R.T. (2003). Inhibitors of cyclooxygenase-2, but not cyclooxygenase-1 provide
structural and functional protection against quinolinic acid-induced neurodegeneration.
Journal of Pharmacology and Experimental Therapeutics 306(1): 218-28.
Samaniego, L.A., Wu, N. and DeLuca, N.A. (1997). The herpes simplex virus immediate-early
protein ICP0 affects transcription from the viral genome and infected-cell survival in the
absence of ICP4 and ICP27. Journal of Virology 71(6): 4614-25.
Samulski, R.J., Berns, K.I., Tan, M. and Muzyczka, N. (1982). Cloning of adeno-associated virus
into pBR322: rescue of intact virus from the recombinant plasmid in human cells. Proceedings
of the National Academy of Sciences of the United States of America 79(6): 2077-81.
Sapp, E., Ge, P., Aizawa, H., Bird, E., Penney, J., Young, A.B., Vonsattel, J.P. and DiFiglia, M.
(1995). Evidence for a preferential loss of enkephalin immunoreactivity in the external globus
243
Literature References
pallidus in low grade Huntington's disease using high resolution image analysis. Neuroscience
64(2): 397-404.
Sastry, P.S. and Rao, K.S. (2000). Apoptosis and the nervous system. Journal of Neurochemistry
74(1): 1-20.
Saudou, F., Finkbeiner, S., Devys, D. and Greenberg, M.E. (1998). Huntingtin acts in the nucleus to
induce apoptosis but death does not correlate with the formation of intranuclear inclusions.
Cell 95(1): 55-66.
Sauer, H. and Oertel, W.H. (1994). Progressive degeneration of nigrostriatal dopamine neurons
following intrastriatal terminal lesions with 6-hydroxydopamine: a combined retrograde
tracing and immunocytochemical study in the rat. Neuroscience 59(2): 401-15.
Sawa, A., Wiegand, G.W., Cooper, J., Margolis, R.L., Sharp, A.H., Lawler, J.F., Jr., Greenamyre,
J.T., Snyder, S.H. and Ross, C.A. (1999). Increased apoptosis of Huntington disease
lymphoblasts associated with repeat length-dependent mitochondrial depolarization. Nature
Medicine 5(10): 1194-8.
Sawa, A., Tomoda, T. and Bae, B.I. (2003). Mechanisms of neuronal cell death in Huntington's
disease. Cytogenetic and Genome Research 100(1-4): 287-95.
Scattoni, M.L., Valanzano, A., Popoli, P., Pezzola, A., Reggio, R. and Calamandrei, G. (2004).
Progressive behavioural changes in the spatial open-field in the quinolinic acid rat model of
Huntington's disease. Behavioural Brain Research 152(2): 375-83.
Schaar, D.G., Sieber, B.A., Dreyfus, C.F. and Black, I.B. (1993). Regional and cell-specific
expression of GDNF in rat brain. Experimental Neurology 124(2): 368-71.
Schabitz, W.R., Sommer, C., Zoder, W., Kiessling, M., Schwaninger, M. and Schwab, S. (2000).
Intravenous brain-derived neurotrophic factor reduces infarct size and counterregulates Bax
and Bcl-2 expression after temporary focal cerebral ischemia. Stroke 31(9): 2212-7.
Schallert, T., Kozlowski, D.A., Humm, J.L. and Cocke, R.R. (1997). Use-dependent structural
events in recovery of function. Advances in Neurology 73: 229-38.
Schallert, T., Fleming, S.M., Leasure, J.L., Tillerson, J.L. and Bland, S.T. (2000). CNS plasticity and
assessment of forelimb sensorimotor outcome in unilateral rat models of stroke, cortical
ablation, parkinsonism and spinal cord injury. Neuropharmacology 39(5): 777-87.
Scharfman, H.E. (1997). Hyperexcitability in combined entorhinal/hippocampal slices of adult rat
after exposure to brain-derived neurotrophic factor. Journal of Neurophysiology 78(2): 108295.
Schilling, G., Becher, M.W., Sharp, A.H., Jinnah, H.A., Duan, K., Kotzuk, J.A., Slunt, H.H.,
Ratovitski, T., Cooper, J.K., Jenkins, N.A., Copeland, N.G., Price, D.L., Ross, C.A. and
Borchelt, D.R. (1999). Intranuclear inclusions and neuritic aggregates in transgenic mice
expressing a mutant N-terminal fragment of huntingtin. Human Molecular Genetics 8(3): 397407.
Schnepp, B.C., Jensen, R.L., Chen, C.L., Johnson, P.R. and Clark, K.R. (2005). Characterization of
adeno-associated virus genomes isolated from human tissues. Journal of Virology 79(23):
14793-803.
Schumacher, J.M., Short, M.P., Hyman, B.T., Breakefield, X.O. and Isacson, O. (1991).
Intracerebral implantation of nerve growth factor-producing fibroblasts protects striatum
against neurotoxic levels of excitatory amino acids. Neuroscience 45(3): 561-570.
244
Literature References
Schwarcz, R., Fuxe, K., Agnati, L.F., Hokfelt, T. and Coyle, J.T. (1979). Rotational behaviour in
rats with unilateral striatal kainic acid lesions: a behavioural model for studies on intact
dopamine receptors. Brain Research 170(3): 485-95.
Schwarcz, R. and Kohler, C. (1983). Differential vulnerability of central neurons of the rat to
quinolinic acid. Neuroscience Letters 38(1): 85-90.
Schwarcz, R., Foster, A.C., French, E.D., Whetsell, W.O., Jr. and Kohler, C. (1984). Excitotoxic
models for neurodegenerative disorders. Life Sciences 35(1): 19-32.
Schwarcz, R., Tamminga, C.A., Kurlan, R. and Shoulson, I. (1988). Cerebrospinal fluid levels of
quinolinic acid in Huntington's disease and schizophrenia. Annals of Neurology 24(4): 580-2.
Selemon, L.D. and Goldman-Rakic, P.S. (1985). Longitudinal topography and interdigitation of
corticostriatal projections in the rhesus monkey. Journal of Neuroscience 5(3): 776-94.
Shear, D.A., Dong, J., Gundy, C.D., Haik-Creguer, K.L. and Dunbar, G.L. (1998). Comparison of
intrastriatal injections of quinolinic acid and 3-nitropropionic acid for use in animal models of
Huntington's disease. Progress in Neuropsychopharmacology & Biological Psychiatry
22(7): 1217-40.
Shelbourne, P.F., Killeen, N., Hevner, R.F., Johnston, H.M., Tecott, L., Lewandoski, M., Ennis, M.,
Ramirez, L., Li, Z., Iannicola, C., Littman, D.R. and Myers, R.M. (1999). A Huntington's
disease CAG expansion at the murine Hdh locus is unstable and associated with behavioural
abnormalities in mice. Human Molecular Genetics 8(5): 763-74.
Shimazaki, K., Urabe, M., Monahan, J., Ozawa, K. and Kawai, N. (2000). Adeno-associated virus
vector-mediated bcl-2 gene transfer into post-ischemic gerbil brain in vivo: prospects for gene
therapy of ischemia-induced neuronal death. Gene Therapy 7(14): 1244-9.
Shirao, T., Evinger, M.J., Iacovitti, L. and Reis, D.J. (1992). Lesions of nigrostriatal pathway reduce
expression of tyrosine hydroxylase gene in residual dopaminergic neurons of substantia nigra.
Neuroscience Letters 141(2): 208-12.
Simons, M., Beinroth, S., Gleichmann, M., Liston, P., Korneluk, R.G., MacKenzie, A.E., Bahr, M.,
Klockgether, T., Robertson, G.S., Weller, M. and Schulz, J.B. (1999). Adenovirus-mediated
gene transfer of inhibitors of apoptosis protein delays apoptosis in cerebellar granule neurons.
Journal of Neurochemistry 72(1): 292-301.
Sleeman, M.W., Anderson, K.D., Lambert, P.D., Yancopoulos, G.D. and Wiegand, S.J. (2000). The
ciliary neurotrophic factor and its receptor, CNTFR alpha. Pharmaceutica Acta Helvetiae
74(2-3): 265-72.
Smith, Y., Bevan, M.D., Shink, E. and Bolam, J.P. (1998). Microcircuitry of the direct and indirect
pathways of the basal ganglia. Neuroscience 86(2): 353-87.
Sofroniew, M.V., Howe, C.L. and Mobley, W.C. (2001). Nerve growth factor signaling,
neuroprotection, and neural repair. Annual Review of Neuroscience 24: 1217-81.
Soule, J., Messaoudi, E. and Bramham, C.R. (2006). Brain-derived neurotrophic factor and control
of synaptic consolidation in the adult brain. Biochemical Society Transactions 34(Pt 4): 6004.
Springer, J.E., Mu, X., Bergmann, L.W. and Trojanowski, J.Q. (1994). Expression of GDNF mRNA
in rat and human nervous tissue. Experimental Neurology 127(2): 167-70.
Srinivasula, S.M., Gupta, S., Datta, P., Zhang, Z., Hegde, R., Cheong, N., Fernandes-Alnemri, T. and
Alnemri, E.S. (2003). Inhibitor of apoptosis proteins are substrates for the mitochondrial serine
protease Omi/HtrA2. Journal of Biological Chemistry 278(34): 31469-72.
245
Literature References
Srivastava, A., Lusby, E.W. and Berns, K.I. (1983). Nucleotide sequence and organization of the
adeno-associated virus 2 genome. Journal of Virology 45(2): 555-64.
Steffan, J.S., Kazantsev, A., Spasic-Boskovic, O., Greenwald, M., Zhu, Y.Z., Gohler, H., Wanker,
E.E., Bates, G.P., Housman, D.E. and Thompson, L.M. (2000). The Huntington's disease
protein interacts with p53 and CREB-binding protein and represses transcription. Proceedings
of the National Academy of Sciences of the United States of America 97(12): 6763-8.
Steininger, T.L., Wainer, B.H., Klein, R., Barbacid, M. and Palfrey, H.C. (1993). High-affinity nerve
growth factor receptor (Trk) immunoreactivity is localized in cholinergic neurons of the basal
forebrain and striatum in the adult rat brain. Brain Research 612(1-2): 330-5.
Strauss, S., Otten, U., Joggerst, B., Pluss, K. and Volk, B. (1994). Increased levels of nerve growth
factor (NGF) protein and mRNA and reactive gliosis following kainic acid injection into the rat
striatum. Neuroscience Letters 168(1-2): 193-6.
Stromberg, I., Bjorklund, L., Johansson, M., Tomac, A., Collins, F., Olson, L., Hoffer, B. and
Humpel, C. (1993). Glial cell line-derived neurotrophic factor is expressed in the developing
but not adult striatum and stimulates developing dopamine neurons in vivo. Experimental
Neurology 124(2): 401-12.
Summerford, C. and Samulski, R.J. (1998). Membrane-associated heparan sulfate proteoglycan is a
receptor for adeno-associated virus type 2 virions. Journal of Virology 72(2): 1438-45.
Sun, Y., Savanenin, A., Reddy, P.H. and Liu, Y.F. (2001). Polyglutamine-expanded huntingtin
promotes sensitization of N-methyl-D-aspartate receptors via post-synaptic density 95. Journal
of Biological Chemistry 276(27): 24713-8.
Sun, Z., Xie, J. and Reiner, A. (2002). The differential vulnerability of striatal projection neurons in
3-nitropropionic acid-treated rats does not match that typical of adult-onset Huntington's
disease. Experimental Neurology 176(1): 55-65.
Takahashi, R., Yokoji, H., Misawa, H., Hayashi, M., Hu, J. and Deguchi, T. (1994). A null mutation
in the human CNTF gene is not causally related to neurological diseases. [see comments.]
[erratum appears in Nat Genet 1994 Jun;7(2):215.]. Nature Genetics 7(1): 79-84.
Tan, S.A. and Aebischer, P. (1996). The problems of delivering neuroactive molecules to the CNS.
Ciba Foundation Symposium 196: 211-36; discussion 236-9.
Tang, T.S., Slow, E., Lupu, V., Stavrovskaya, I.G., Sugimori, M., Llinas, R., Kristal, B.S., Hayden,
M.R. and Bezprozvanny, I. (2005). Disturbed Ca2+ signaling and apoptosis of medium spiny
neurons in Huntington's disease. Proceedings of the National Academy of Sciences of the
United States of America 102(7): 2602-7.
Tattersfield, A.S., Croon, R.J., Liu, Y.W., Kells, A.P., Faull, R.L. and Connor, B. (2004).
Neurogenesis in the striatum of the quinolinic acid lesion model of Huntington's disease.
Neuroscience 127(2): 319-32.
Temel, Y., Cao, C., Vlamings, R., Blokland, A., Ozen, H., Steinbusch, H.W., Michelsen, K.A., von
Horsten, S., Schmitz, C. and Visser-Vandewalle, V. (2006). Motor and cognitive improvement
by deep brain stimulation in a transgenic rat model of Huntington's disease. Neuroscience
Letters 406(1-2): 138-41.
Teng, H.K., Teng, K.K., Lee, R., Wright, S., Tevar, S., Almeida, R.D., Kermani, P., Torkin, R.,
Chen, Z.Y., Lee, F.S., Kraemer, R.T., Nykjaer, A. and Hempstead, B.L. (2005). ProBDNF
induces neuronal apoptosis via activation of a receptor complex of p75NTR and sortilin.
Journal of Neuroscience 25(22): 5455-63.
246
Literature References
Testa, C.M., Standaert, D.G., Landwehrmeyer, G.B., Penney, J.B., Jr. and Young, A.B. (1995).
Differential expression of mGluR5 metabotropic glutamate receptor mRNA by rat striatal
neurons. Journal of Comparative Neurology 354(2): 241-52.
Thomas, C.E., Schiedner, G., Kochanek, S., Castro, M.G. and Lowenstein, P.R. (2000). Peripheral
infection with adenovirus causes unexpected long-term brain inflammation in animals injected
intracranially with first-generation, but not with high-capacity, adenovirus vectors: toward
realistic long-term neurological gene therapy for chronic diseases. Proceedings of the
National Academy of Sciences of the United States of America 97(13): 7482-7.
Thomas, C.E., Ehrhardt, A. and Kay, M.A. (2003). Progress and problems with the use of viral
vectors for gene therapy. Nature Reviews Genetics 4(5): 346-58.
Thomas, L.B., Gates, D.J., Richfield, E.K., O'Brien, T.F., Schweitzer, J.B. and Steindler, D.A.
(1995). DNA end labeling (TUNEL) in Huntington's disease and other neuropathological
conditions. Experimental Neurology 133(2): 265-72.
Timpe, J., Bevington, J., Casper, J., Dignam, J.D. and Trempe, J.P. (2005). Mechanisms of adenoassociated virus genome encapsidation. Current Gene Therapy 5(3): 273-84.
Tobin, A.J. and Signer, E.R. (2000). Huntington's disease: the challenge for cell biologists. Trends
in Cell Biology 10(12): 531-6.
Tomac, A., Widenfalk, J., Lin, L.F., Kohno, T., Ebendal, T., Hoffer, B.J. and Olson, L. (1995).
Retrograde axonal transport of glial cell line-derived neurotrophic factor in the adult
nigrostriatal system suggests a trophic role in the adult. Proceedings of the National
Academy of Sciences of the United States of America 92(18): 8274-8.
Tongiorgi, E., Righi, M. and Cattaneo, A. (1997). Activity-dependent dendritic targeting of BDNF
and TrkB mRNAs in hippocampal neurons. Journal of Neuroscience 17(24): 9492-505.
Treanor, J.J., Goodman, L., de Sauvage, F., Stone, D.M., Poulsen, K.T., Beck, C.D., Gray, C.,
Armanini, M.P., Pollock, R.A., Hefti, F., Phillips, H.S., Goddard, A., Moore, M.W., Buj-Bello,
A., Davies, A.M., Asai, N., Takahashi, M., Vandlen, R., Henderson, C.E. and Rosenthal, A.
(1996). Characterization of a multicomponent receptor for GDNF. Nature 382(6586): 80-3.
Trottier, Y., Devys, D., Imbert, G., Saudou, F., An, I., Lutz, Y., Weber, C., Agid, Y., Hirsch, E.C.
and Mandel, J.L. (1995). Cellular localization of the Huntington's disease protein and
discrimination of the normal and mutated form. [see comments.]. Nature Genetics 10(1): 10410.
Troy, C.M., Friedman, J.E. and Friedman, W.J. (2002). Mechanisms of p75-mediated death of
hippocampal neurons. Role of caspases. Journal of Biological Chemistry 277(37): 34295-302.
Trupp, M., Belluardo, N., Funakoshi, H. and Ibanez, C.F. (1997). Complementary and overlapping
expression of glial cell line-derived neurotrophic factor (GDNF), c-ret proto-oncogene, and
GDNF receptor-alpha indicates multiple mechanisms of trophic actions in the adult rat CNS.
Journal of Neuroscience 17(10): 3554-67.
Ungerstedt, U. (1971). Striatal dopamine release after amphetamine or nerve degeneration revealed
by rotational behaviour. Acta Physiologica Scandinavica. Supplementum 367: 49-68.
Vaillant, A.R., Mazzoni, I., Tudan, C., Boudreau, M., Kaplan, D.R. and Miller, F.D. (1999).
Depolarization and neurotrophins converge on the phosphatidylinositol 3-kinase-Akt pathway
to synergistically regulate neuronal survival. Journal of Cell Biology 146(5): 955-66.
Valjent, E., Pascoli, V., Svenningsson, P., Paul, S., Enslen, H., Corvol, J.C., Stipanovich, A.,
Caboche, J., Lombroso, P.J., Nairn, A.C., Greengard, P., Herve, D. and Girault, J.A. (2005).
Regulation of a protein phosphatase cascade allows convergent dopamine and glutamate
247
Literature References
signals to activate ERK in the striatum. Proceedings of the National Academy of Sciences of
the United States of America 102(2): 491-6.
Van Ooyen, A. (2005). Competition in neurite outgrowth and the development of nerve connections.
Progress in Brain Research 147: 81-99.
Venero, J.L., Beck, K.D. and Hefti, F. (1994). Intrastriatal infusion of nerve growth factor after
quinolinic acid prevents reduction of cellular expression of choline acetyltransferase messenger
RNA and trkA messenger RNA, but not glutamate decarboxylase messenger RNA.
Neuroscience 61(2): 257-68.
Ventimiglia, R., Mather, P.E., Jones, B.E. and Lindsay, R.M. (1995). The neurotrophins BDNF, NT3 and NT-4/5 promote survival and morphological and biochemical differentiation of striatal
neurons in vitro. European Journal of Neuroscience 7(2): 213-22.
Vis, J.C., Schipper, E., de Boer-van Huizen, R.T., Verbeek, M.M., de Waal, R.M., Wesseling, P., ten
Donkelaar, H.J. and Kremer, B. (2005). Expression pattern of apoptosis-related markers in
Huntington's disease. Acta Neuropathologica 109(3): 321-8.
von Horsten, S., Schmitt, I., Nguyen, H.P., Holzmann, C., Schmidt, T., Walther, T., Bader, M.,
Pabst, R., Kobbe, P., Krotova, J., Stiller, D., Kask, A., Vaarmann, A., Rathke-Hartlieb, S.,
Schulz, J.B., Grasshoff, U., Bauer, I., Vieira-Saecker, A.M., Paul, M., Jones, L., Lindenberg,
K.S., Landwehrmeyer, B., Bauer, A., Li, X.J. and Riess, O. (2003). Transgenic rat model of
Huntington's disease. Human Molecular Genetics 12(6): 617-24.
Vonsattel, J.P., Myers, R.H., Stevens, T.J., Ferrante, R.J., Bird, E.D. and Richardson, E.P., Jr.
(1985). Neuropathological classification of Huntington's disease. Journal of Neuropathology
& Experimental Neurology 44(6): 559-77.
Vonsattel, J.P. and DiFiglia, M. (1998). Huntington disease. Journal of Neuropathology &
Experimental Neurology 57(5): 369-84.
Waldvogel, H.J., Faull, R.L., Williams, M.N. and Dragunow, M. (1991). Differential sensitivity of
calbindin and parvalbumin immunoreactive cells in the striatum to excitotoxins. Brain
Research 546(2): 329-35.
Wang, G.H., Mitsui, K., Kotliarova, S., Yamashita, A., Nagao, Y., Tokuhiro, S., Iwatsubo, T.,
Kanazawa, I. and Nukina, N. (1999). Caspase activation during apoptotic cell death induced by
expanded polyglutamine in N2a cells. Neuroreport 10(12): 2435-8.
Watabe, K., Ohashi, T., Sakamoto, T., Kawazoe, Y., Takeshima, T., Oyanagi, K., Inoue, K., Eto, Y.
and Kim, S.U. (2000). Rescue of lesioned adult rat spinal motoneurons by adenoviral gene
transfer of glial cell line-derived neurotrophic factor. Journal of Neuroscience Research
60(4): 511-9.
Watson, D.J., Kobinger, G.P., Passini, M.A., Wilson, J.M. and Wolfe, J.H. (2002). Targeted
transduction patterns in the mouse brain by lentivirus vectors pseudotyped with VSV, Ebola,
Mokola, LCMV, or MuLV envelope proteins. Molecular Therapy 5(5 Pt 1): 528-37.
Watson, F.L., Heerssen, H.M., Moheban, D.B., Lin, M.Z., Sauvageot, C.M., Bhattacharyya, A.,
Pomeroy, S.L. and Segal, R.A. (1999). Rapid nuclear responses to target-derived
neurotrophins require retrograde transport of ligand-receptor complex. Journal of
Neuroscience 19(18): 7889-900.
Wellington, C.L., Ellerby, L.M., Gutekunst, C.A., Rogers, D., Warby, S., Graham, R.K., Loubser,
O., van Raamsdonk, J., Singaraja, R., Yang, Y.Z., Gafni, J., Bredesen, D., Hersch, S.M.,
Leavitt, B.R., Roy, S., Nicholson, D.W. and Hayden, M.R. (2002). Caspase cleavage of mutant
248
Literature References
huntingtin precedes neurodegeneration in Huntington's disease. Journal of Neuroscience
22(18): 7862-72.
Wheeler, V.C., White, J.K., Gutekunst, C.A., Vrbanac, V., Weaver, M., Li, X.J., Li, S.H., Yi, H.,
Vonsattel, J.P., Gusella, J.F., Hersch, S., Auerbach, W., Joyner, A.L. and MacDonald, M.E.
(2000). Long glutamine tracts cause nuclear localization of a novel form of huntingtin in
medium spiny striatal neurons in HdhQ92 and HdhQ111 knock-in mice. Human Molecular
Genetics 9(4): 503-13.
Widmer, H.R. and Hefti, F. (1994). Stimulation of GABAergic neuron differentiation by NT-4/5 in
cultures of rat cerebral cortex. Brain Research. Developmental Brain Research 80(1-2):
279-84.
Widmer, H.R., Schaller, B., Meyer, M. and Seiler, R.W. (2000). Glial cell line-derived neurotrophic
factor stimulates the morphological differentiation of cultured ventral mesencephalic calbindinand calretinin-expressing neurons. Experimental Neurology 164(1): 71-81.
Winkler, C., Gil, J.M., Araujo, I.M., Riess, O., Skripuletz, T., von Horsten, S. and Petersen, A.
(2006). Normal sensitivity to excitotoxicity in a transgenic Huntington's disease rat. Brain
Research Bulletin 69(3): 306-10.
Wiznerowicz, M. and Trono, D. (2005). Harnessing HIV for therapy, basic research and
biotechnology. Trends in Biotechnology 23(1): 42-7.
Wong, L.F., Azzouz, M., Walmsley, L.E., Askham, Z., Wilkes, F.J., Mitrophanous, K.A., Kingsman,
S.M. and Mazarakis, N.D. (2004). Transduction patterns of pseudotyped lentiviral vectors in
the nervous system. Molecular Therapy 9(1): 101-11.
Wong, L.F., Ralph, G.S., Walmsley, L.E., Bienemann, A.S., Parham, S., Kingsman, S.M., Uney, J.B.
and Mazarakis, N.D. (2005). Lentiviral-mediated delivery of Bcl-2 or GDNF protects against
excitotoxicity in the rat hippocampus. Molecular Therapy 11(1): 89-95.
Wong, L.F., Goodhead, L., Prat, C., Mitrophanous, K.A., Kingsman, S.M. and Mazarakis, N.D.
(2006). Lentivirus-mediated gene transfer to the central nervous system: therapeutic and
research applications. Human Gene Therapy 17(1): 1-9.
Wu, Z., Asokan, A. and Samulski, R.J. (2006). Adeno-associated virus serotypes: vector toolkit for
human gene therapy. Molecular Therapy 14(3): 316-27.
Xiao, X., Li, J. and Samulski, R.J. (1998). Production of high-titer recombinant adeno-associated
virus vectors in the absence of helper adenovirus. Journal of Virology 72(3): 2224-32.
Xu, D., Bureau, Y., McIntyre, D.C., Nicholson, D.W., Liston, P., Zhu, Y., Fong, W.G., Crocker, S.J.,
Korneluk, R.G. and Robertson, G.S. (1999). Attenuation of ischemia-induced cellular and
behavioral deficits by X chromosome-linked inhibitor of apoptosis protein overexpression in the
rat hippocampus. Journal of Neuroscience 19(12): 5026-33.
Xu, D.G., Crocker, S.J., Doucet, J.P., St-Jean, M., Tamai, K., Hakim, A.M., Ikeda, J.E., Liston, P.,
Thompson, C.S., Korneluk, R.G., MacKenzie, A. and Robertson, G.S. (1997). Elevation of
neuronal expression of NAIP reduces ischemic damage in the rat hippocampus. Nature
Medicine 3(9): 997-1004.
Xu, L., Daly, T., Gao, C., Flotte, T.R., Song, S., Byrne, B.J., Sands, M.S. and Parker Ponder, K.
(2001). CMV-beta-actin promoter directs higher expression from an adeno-associated viral
vector in the liver than the cytomegalovirus or elongation factor 1 alpha promoter and results
in therapeutic levels of human factor X in mice. Human Gene Therapy 12(5): 563-73.
Xu, R., Janson, C.G., Mastakov, M., Lawlor, P., Young, D., Mouravlev, A., Fitzsimons, H., Choi,
K.L., Ma, H., Dragunow, M., Leone, P., Chen, Q., Dicker, B. and During, M.J. (2001).
249
Literature References
Quantitative comparison of expression with adeno-associated virus (AAV-2) brain-specific gene
cassettes. Gene Therapy 8(17): 1323-32.
Yamada, M., Oligino, T., Mata, M., Goss, J.R., Glorioso, J.C. and Fink, D.J. (1999). Herpes simplex
virus vector-mediated expression of Bcl-2 prevents 6-hydroxydopamine-induced degeneration
of neurons in the substantia nigra in vivo. Proceedings of the National Academy of Sciences
of the United States of America 96(7): 4078-83.
Yan, Q., Matheson, C., Sun, J., Radeke, M.J., Feinstein, S.C. and Miller, J.A. (1994). Distribution of
intracerebral ventricularly administered neurotrophins in rat brain and its correlation with trk
receptor expression. Experimental Neurology 127(1): 23-36.
Yang, C.C., Xiao, X., Zhu, X., Ansardi, D.C., Epstein, N.D., Frey, M.R., Matera, A.G. and Samulski,
R.J. (1997). Cellular recombination pathways and viral terminal repeat hairpin structures are
sufficient for adeno-associated virus integration in vivo and in vitro. Journal of Virology
71(12): 9231-47.
Young, K.M., Merson, T.D., Sotthibundhu, A., Coulson, E.J. and Bartlett, P.F. (2007). p75
neurotrophin receptor expression defines a population of BDNF-responsive neurogenic
precursor cells. Journal of Neuroscience 27(19): 5146-55.
Yu, T., Scully, S., Yu, Y., Fox, G.M., Jing, S. and Zhou, R. (1998). Expression of GDNF family
receptor components during development: implications in the mechanisms of interaction.
Journal of Neuroscience 18(12): 4684-96.
Zeron, M.M., Chen, N., Moshaver, A., Lee, A.T., Wellington, C.L., Hayden, M.R. and Raymond,
L.A. (2001). Mutant huntingtin enhances excitotoxic cell death. Molecular and Cellular
Neurosciences 17(1): 41-53.
Zeron, M.M., Hansson, O., Chen, N., Wellington, C.L., Leavitt, B.R., Brundin, P., Hayden, M.R. and
Raymond, L.A. (2002). Increased sensitivity to N-methyl-D-aspartate receptor-mediated
excitotoxicity in a mouse model of Huntington's disease. Neuron 33(6): 849-60.
Zhang, X.D., Gillespie, S.K. and Hersey, P. (2004). Staurosporine induces apoptosis of melanoma by
both caspase-dependent and -independent apoptotic pathways. Molecular Cancer
Therapeutics 3(2): 187-97.
Zigova, T., Pencea, V., Wiegand, S.J. and Luskin, M.B. (1998). Intraventricular administration of
BDNF increases the number of newly generated neurons in the adult olfactory bulb. Molecular
and Cellular Neurosciences 11(4): 234-45.
Zimmermann, K.C., Bonzon, C. and Green, D.R. (2001). The machinery of programmed cell death.
Pharmacological & Therapeutics 92(1): 57-70.
Zolotukhin, S., Byrne, B.J., Mason, E., Zolotukhin, I., Potter, M., Chesnut, K., Summerford, C.,
Samulski, R.J. and Muzyczka, N. (1999). Recombinant adeno-associated virus purification
using novel methods improves infectious titer and yield. Gene Therapy 6(6): 973-85.
Zoltick, P.W., Chirmule, N., Schnell, M.A., Gao, G.P., Hughes, J.V. and Wilson, J.M. (2001).
Biology of E1-deleted adenovirus vectors in nonhuman primate muscle. Journal of Virology
75(11): 5222-9.
Zuccato, C., Ciammola, A., Rigamonti, D., Leavitt, B.R., Goffredo, D., Conti, L., MacDonald, M.E.,
Friedlander, R.M., Silani, V., Hayden, M.R., Timmusk, T., Sipione, S. and Cattaneo, E. (2001).
Loss of huntingtin-mediated BDNF gene transcription in Huntington's disease. Science
293(5529): 493-8.
Zuccato, C., Tartari, M., Crotti, A., Goffredo, D., Valenza, M., Conti, L., Cataudella, T., Leavitt,
B.R., Hayden, M.R., Timmusk, T., Rigamonti, D. and Cattaneo, E. (2003). Huntingtin interacts
250
Literature References
with REST/NRSF to modulate the transcription of NRSE-controlled neuronal genes. Nature
Genetics 35(1): 76-83.
Zuccato, C., Liber, D., Ramos, C., Tarditi, A., Rigamonti, D., Tartari, M., Valenza, M. and Cattaneo,
E. (2005). Progressive loss of BDNF in a mouse model of Huntington's disease and rescue by
BDNF delivery. Pharmacological Research 52(2): 133-9.
Zufferey, R., Dull, T., Mandel, R.J., Bukovsky, A., Quiroz, D., Naldini, L. and Trono, D. (1998).
Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. Journal of
Virology 72(12): 9873-80.
251