1. news

The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
th
20 International
Pectinid Workshop
22
nd
– 28
th
APRIL 2015
BOOK OF ABSTRACTS & PROGRAM
Galway, Ireland
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
22nd to 28th April 2015 - Galway, Ireland
First published in 2015 by the International Pectinid Workshop
Print and bound in Ireland
ipw2015.com
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
20TH INTERNATIONAL PECTINID WORKSHOP
ORGANISED BY:
DOMMRS – Daithi O’Murchu Research Marine Station – Ireland
Havforskningsinstituttet – Institute of Marine Research – Norway
SPONSORED BY:
The Research Council of Norway
BIM – Bord Iascaigh Mhara – Irish Sea Fisheries Board
Food Safety Authority of Ireland
Marine Institute – Foras na Mara
Fáilte Ireland
Lantern-Net
North West Shell Fish Ltd
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Welcome Message
Céad Mile Fáilte!
Velkommen!
On behalf of the IPW organising committee, we are delighted to welcome you to the
20th International Pectinid Workshop. Even though this is the third time the workshop
has taken place in Ireland it is the first time that it has been co-hosted between two
countries. Our scientific programme is geographically rich with all continents
represented and varied with the usual mix of thematic sessions; Ecology and General
biology, Aquaculture, Fisheries, Physiology, Biochemistry, Genetics and Resource
Management. We have also included two special sessions; “Marine Protected Areas”
and “Pectinids – witnesses of their environment in a changing ocean”. We hope that
you enjoy the presentations and will join the discussion!
In addition to the scientific programme we have also several social events planned! So
we hope you find time to relax with friends old and new. Enjoy the scenery, the music
and the craic!
As hosts, we now understand that the success of the conference is down to the many
people who have worked tirelessly in planning and executing both the scientific and
social programmes. We would like to thank all the staff at the DOMMRS particularly
Dee McElligott who worked night and day. Also we would like to thank the scientific
committee and programme chairs for their thorough and timely reviewing of abstracts,
our sponsors who have helped us keep down the costs for you, and the “Aunts and
Uncles” for their sage advice!
So all that is left to say is we hope you have an enjoyable, productive and inspiring
time in Galway!
Julie Maguire & Ellen-Sofie Grefsrud
Joint chairs of the 20th International Pectinid Workshop
i
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
TABLE OF CONTENTS
COMMITTEES……………………………………………………………………….
i
HISTORY OF THE INTERNATIONAL PECTINID WORKSHOPS…………...
iii
WORKSHOP AGENDA…………………………………………………………….
iv
LIST OF ORAL ABSTRACTS……………………………………………………..
xi
LIST OF POSTER ABSTRACTS………………………………………………....
xvi
ORAL PRESENTATIONS………………………………………………………….
1
KEYNOTE……………………………………………………………………….
2
ECOLOGY AND GENERAL BIOLOGY I…………………………………….
4
AQUACULTURE………………………….……………………………………
17
FISHERIES………………………………...…………………………………...
36
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS I……………………...
60
MARINE PROTECTED AREAS………...……………………………………
72
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS II……………………..
92
PECTINIDS – WITNESSES OF THEIR ENVIRONMENT IN A
CHANGING OCEAN…………………………………………………………..
107
BIOTOXINS, POLLUTION AND CONTAMINATION……………………….
127
RESOURCE MANAGEMENT..………….……………………………………
129
POSTER PRESENTATION ……………….………………………………………
139
ii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
COMMITTEES
SCIENTIFIC COMMITTEE
Sissel Andersen – Institute of Marine Research, Norway
Dale Arendse – Fisheries Management, Department of Agriculture, Forestry and
Fisheries, South Africa
Norman Blake – University of South Florida, USA
Andrew Brand – University of Liverpool, England
Gavin Burnell – University College Cork, Ireland
Laurent Chauvaud – French National Centre for Scientific Research, France
Michael Dredge – Queensland Fisheries Service, Australia
Peter Duncan – Isle of Man Fisheries Department, Isle of Man
Freddie O’Mahony – Carton Point Shellfish Ltd., Ireland
Luz Pérez-Parallé – Universidad de Santiago de Compostela, Spain
Dee McElligott – Daithi O’Murchu Marine Research Station, Ireland
Dan Minchin - Marine Organism Investigations, Ireland
Guilherme S. Rupp - Empresa de Pesquisa Agropecuária e Extensão Rural de Santa
Catarina, Brasil
Marc Shorten – Daithi O’Murchu Marine Research Station, Ireland
Sandra Shumway – University of Connecticut, USA
Cat Smith – Daithi O’Murchu Marine Research Station, Ireland
Bryce Stewart – University of York, United Kingdom
Øivind Strand – Institute of Marine Research, Norway
Elisabeth von Brand – Universidad Católica del Norte, Chile
James Williams – National Institute of Water and Atmospheric Research, New
Zealand
i
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
LOCAL COMMITTEE
Ireland
Julie Maguire – Daithi O’Murchu Marine Research Station
Daryl Gunning - Daithi O’Murchu Marine Research Station
Fiona Moejes - Daithi O’Murchu Marine Research Station
Dee McElligott – Daithi O’Murchu Marine Research Station
Freddie O’Mahony – Carton Point Shellfish Ltd.
John O’Sullivan - Daithi O’Murchu Marine Research Station
Cat Smith – Daithi O’Murchu Marine Research Station
Marc Shorten – Daithi O’Murchu Marine Research Station
Thallis Boa Ventura - Daithi O’Murchu Marine Research Station
Norway
Ellen-Sofie Grefsrud – Institute of Marine Research
Sissel Andersen – Institute of Marine Research
Gyda Christophersen – Teknologisk Institutt, Norway
Arne Duinker – National Institute of Nutrition and Seafood Research
Thorolf Magnesen – University of Bergen
Øivind Strand – Institute of Marine Research
Tore Strohmeier - Institute of Marine Research
ii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
HISTORY OF THE INTERNATIONAL PECTINID WORKSHOPS
The first International Pectinid Workshop was held in 1976 in Ireland and has since
moved throughout the world. In the beginning, the Pectinid Workshop was a small
European meeting attended by some 30-40 people from half a dozen countries, but
over a 40-year period the Workshop has grown to a large international group attracting
well over 100 delegates from some 30 countries. Devoted Pectinid enthusiasts gather
every second year to exchange the latest developments within a range of scientific
fields as well as enjoying the company of other scallop fondlers. As the workshop has
moved between and across the continents the scientific focus has changed, some
disciplines have diminished and new ones have emerged, but the Pectinid Workshop
spirit has persisted. In 1995, the 10th Pectinid Workshop was held in Ireland and has
now returned to the Emerald Isle again to celebrate the 20th workshop. Who knows it
may be back again for the 30th in 2035?
1st
1976
Baltimore, Ireland
Dan Minchin
2nd
1978
Brest, france
Jean Claude Dao
3rd
1980
Port Erin, isle of Man
Andrew Brand
th
4
1983
Aberdeen, Scotland
Jim Mason
5th
1985
La Couña, Spain
Guillermo Román
6th
1987
Menai Bridges, Wales
Andy Beaumont
7th
1989
Portland, USA
Sandra Shumway
8th
1991
Cherbourg, France
Pierre Lubet
9th
1993
Nanaimo, Canada
Neil Bourne
10th
1995
Cork, Ireland
Gavin Burnell
11th
1997
La Paz, Mexio
Estaban Felix-Pico
12th
1999
Bergen, Norway
Sissel Andersen/Thorolf Magnesen
13th
2001
Coquimbo, Chile
Elizabeth von Brand/Juan Enrique Illanes
14th
2003
St. Petersburg, USA
Norman Blake/Don Sweat
15th
2005
Mooloolaba, Australia
Michael Dredge/Peter Duncan
16th
2007
Halifax, Canada
Jay Parsons
17th
2009
Santiago de Compostela, Spain
Luz Pérez-Parallé/José Luís Sánches
18th
2011
Quingdao, China
Guofan Zahang
19th
2013
Florianopólis, Brazil
Guillerme S. Rupp
iii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
WORKSHOP AGENDA
(NOTE: PCA – Pre-conference area where Scientific Posters will be presented throughout the conference)
WEDNESDAY 22ND APRIL 2015
04:30pm – 07:30pm
Registration opens
07:30pm – 10:00pm
ICEBREAKER EVENT
Welcome reception with nibbles and drinks
Setting the tone for the evening, a traditional Irish band as
well as Irish Céilí dancers will be proving us with plenty of
entertainment.
Hotel Lobby
Veranda
Lounge
THURSDAY 23RD APRIL 2015
08:30am – 09:15am
09:15am – 09:30am
09:30am – 10:00am
10:00am – 12:30pm
Registration
Hotel Lobby
Welcome and official opening
Julie Maguire (Ireland) & Ellen Sofie Grefsrud (Norway)
KEYNOTE: A Pectinids Passion – Dan Minchin (Ireland)
ECOLOGY AND GENERAL BIOLOGY SESSION I
Chairs: Elizabeth Von Brand (Chile), Romain Lavaud (USA)
10:00am – 10:20am
1) Links between morphology and behaviour in scallops
with different swimming styles – Isabelle Tremblay
(Canada)
10:20am – 10:40am
2) Spat settlement and juvenile scallop abundance after the
collapse of Iceland scallop (Chlamys islandica) fishery in
Breiðafjörður, Iceland. – Jóhann Arnfinnsson (Iceland)
10:40am – 11:00am
3) The first field evidence of fertilization success in the giant
sea scallop – Skylar Bayer (USA)
11:00am – 11:30am
MORNING BREAK
11:30am – 11:50am
4) A Dynamic Energy Budget model to better understand
the physiological response of the great scallop, Pecten
maximus, to environmental variability – Romain Lavaud
(USA)
11:50am – 12:10pm
5) Development of Sea Ranching of Japanese Scallop
Patinopecten yessoensis of Zhangzidao Group Co., Ltd.
In Northern Yellow Sea, China – Jianguang Fang
(China)
12:10pm – 12:30pm
6) Quantifying the morphodynamics of the great scallops
(Pecten maximus L.) shell : effect of environmental
variability on the resulting shape – Jean-Marc Guarini
(France)
Inis Mor
Ballroom
PCA
Inis Mor
Ballroom
iv
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
12:30pm - 02:00pm
02:00pm – 03:20pm
LUNCH BREAK
Marinas
Restaurant
AQUACULTURE SESSION
Chairs: Gavin Burnell (Ireland), Leigh Howarth (UK)
02:00pm – 02:20pm
7) An overview of scallop research in South Africa – Dale
Arendse (South Africa)
02:20pm – 02:40pm
8) Scallop aquaculture in Chile: Rise and collapse of a
promising industry – Elisabeth Von Brand (Chile)
02:40pm - 03:00pm
9) Progress in aquaculture of the scallop Nodipecten
nodosus in Brazil: challenges and prospective –
Guilherme Rupp (Brazil)
03:00pm – 03:20pm
10) Scallop Fisheries and Aquaculture in Mexico - César A.
Ruiz-Verdugo (Mexico)
03:20pm – 03:50pm
AFTERNOON BREAK
03:50pm - 04:10pm
11) Economic assessment of Argopecten nucleus spat
hatchery production to support the development of
scallop aquaculture in the Caribbean Basin – Diego
Valderrama (USA)
04:10pm – 04:30pm
12) Growth and survival of the Caribbean scallops
Argopecten nucleus and Nodipecten nodosus cultured
under different depths and nets change frequencies Luz Adriana Velasco (Colombia)
04:30pm – 04:50pm
13) Field testing of novel antifouling coatings for the
aquaculture industry – preliminary results – Sandra
Shumway (USA)
04:50pm – 05:10pm
14) Evaluation of post-mortem changes in the adductor
muscle length of Pacific calico scallop (Argopecten
ventricosus) as a simple method to assess the onset of
rigor mortis in scallops – Ana Isabel Beltrán Lugo
(Mexico)
05:10pm – 05:30pm
Q & A SESSION
Inis Mor
Ballroom
PCA
Inis Mor
Ballroom
BUFFET DINNER AND DRINKS at the Marine Institute
07:00pm – 10:00pm
Transport provided
Marine
Institute
Bus leaves Radisson Blu Hotel at 06:30pm
v
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
FRIDAY 24TH APRIL 2015
08:30am – 09:00am
09:00am – 12:30pm
Registration
Hotel Lobby
FISHERIES SESSION
Chairs: James Williams (New Zealand), Isobel Bloor (UK)
09:00am – 09:20am
1) An overview of New Zealand scallop fisheries in 2015 James Williams (New Zealand)
09:20am – 09:40am
2) Management and research responses to collapses in
three scallop stocks in Western Australia following an
extreme marine heat wave event – Mervi Kangas
(Australia)
09:40am – 10:00am
3) Discard mortality of sea scallops following capture and
handling in the commercial dredge fishery – David
Rudders (USA)
10:00am – 10:20am
4) Scallop area management: strategies to maximize yield
– William Du Paul (USA)
10:20am – 10:40am
5) Abundance, automated image detection, crowd
sourcing, and incidental mortality estimates of Sea
Scallops (Placopecten magellanicus) from AUV based
surveys – Arthur Trembanis (USA)
10:40am – 11:10am
MORNING BREAK
11:10am – 11:30am
6) Temporal changes in shell height-to-meat weight
relationships of the sea scallop (Placopecten
magellanicus) in the Maritimes region Canada in relation
to environmental conditions – Jessica Sameoto
(Canada)
11:30am – 11:50am
7) Fishing for data: Stock status and predator (fishing
vessel) response in the Isle of Man queen scallop fishery
– Isobel Bloor (Isle of Man)
11:50am – 12:10pm
8) Assessing the sustainability of a scallop dredge fishery:
population structure & habitat impacts – Claire
Catherall (UK)
12:10pm – 12:40pm
9) Estimation of sustainable yield for King and Queen
scallops (Pecten maximus and Aequipecten opercularis)
stocks in the Normand-Breton Gulf (Western English
Channel) – Eric Foucher (France)
12:40pm - 02:00pm
LUNCH BREAK
Inis Mor
Ballroom
PCA
Inis Mor
Ballroom
Marinas
Restaurant
vi
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
02:00pm – 04:10pm
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS
SESSION I
Chairs: Luz Pérez-Parallé (Spain), Daniel Speiser (USA)
02:00pm – 02:20pm
10) Updating homeobox genes in bivalve molluscs - Luz
Pérez-Parallé (Spain)
02:20pm – 02:40pm
11) QTL mapping and GWAS for orange muscle in Yesso
scallop (Patinopecten yessoensis, Jay, 1857) – Xiaoli Hu
(China)
02:40pm - 03:00pm
12) Diets rich in polyunsaturated fatty acids improve the
capacity to respond to stress through HSP70 synthesis in
the scallop Argopecten purpuratus after reproductive
investment – Katherina Brokordt (Chile)
03:00pm – 03:20pm
03:20pm - 03:50pm
AFTERNOON BREAK
13) Genome sequencing of yesso scallop Patinopecten
yessoensis: generating a genomic resource for
understanding the biology and evolution of pectinidae
(Mollusca: Bivalvia) – Zhenmin Bao (China)
03:50pm – 04:10pm
14) Image formation in the concave mirror eyes of scallops Daniel Speiser (USA)
04:15pm – 06:00pm
POSTER SESSION
TREASURE HUNT
06:30pm – 09:00pm
Starts at Radisson Blu Hotel and takes us across Galway
City
Inis Mor
Ballroom
PCS
Inis Mor
Ballroom
PCA
Galway
City
vii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
SATURDAY 25TH APRIL 2015
08:30am – 09:00am
09:00am – 12:00pm
Registration
Lobby
SPECIAL SESSION: MARINE PROTECTED AREA
Chairs: Bryce Beukers-Stewart (UK), Caitlin Cleaver (USA)
09:00am – 09:30am
1) KEYNOTE: Marine protected areas and the US sea
scallop fishery – Kevin Stokesbury (USA)
09:30am – 09:50am
2) Incorporating local knowledge into spatial management
of the sea scallop (Placopecten magellanicus) fishery in
Maine, USA – Carla Guenther (USA)
09:50am – 10:10am
3) The effect of small-scale closed areas on giant sea
scallop populations in Maine – Caitlin Cleaver (USA)
10:10am – 10:30am
4) Managing the Supply Side: Larval Dispersal from
Rotating Closures in the Atlantic Sea Scallop
(Placopecten magellanicus) Fishery – Deborah Hart
(USA)
10:30am – 11:00am
MORNING BREAK
11:00am – 11:20am
5) Managing fishers to manage themselves: Ramsey
fisheries management zone a learning experience – Sam
Dignan (Isle of Man)
11:20am – 11:40am
6) Scallops like it rough! - Recovery of complex habitat
boosts scallop settlement in a community-led temperate
marine reserve – Leigh Howarth (UK)
11:40am – 12:00pm
7) Can spatial management revive the Clyde? A plan for
ecosystem-based management of shellfish fisheries in a
simplified sea – Bryce Beukers-Stewart (UK)
12:00pm – 12:30pm
DISCUSSION
12:30pm - 02:00pm
02:00pm – 08:30pm
Hotel
LUNCH BREAK
CLIFFS OF MOHER TRIP
Transport will be provided
Bus leaves Radisson Blu Hotel at 02:00pm
Dinner on our way back at Paddy Burkes Oyster Inn
Inis Mor
Ballroom
PCA
Inis Mor
Ballroom
Marinas
Restaurant
Cliffs of
Moher
SUNDAY 26TH APRIL 2015
TOUR OF CONNEMARA
10:00am – 06:00pm
Transport will be provided. Bus leaves Radisson Blu
Hotel at 10:00am
Tour of
Connemara
viii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
MONDAY 27TH APRIL 2015
08:30am – 09:00am
Registration
09:00am – 10:40am
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS
SESSION II
Hotel
Lobby
Chairs: Luz Pérez-Parallé (Spain), Daniel Speiser (USA)
09:00am – 09:20am
1) Genetic diversity of natural and seeded populations of
great scallop (Pecten maximus), and identification of
hatchery-born seeds – Grégory Charrier (France)
09:20am – 09:40am
2) Apicomplexan infection and gray meat in Atlantic sea
scallops, Placopecten magellanicus – Susan Inglis
(USA)
09:40am – 10:00am
3) Candidate genes associated with growth variation in
Argopecten purpurtatus – Claudia Cárcamo (Chile)
10:00am – 10:20am
4) Transcriptome sequencing and candidate gene-based
association analysis for heat tolerance in the bay scallop
Argopecten irradians – Huayong Que (China)
10:20am – 10:40am
5) Integrated mechanistic study of the temporal effect of
temperature increase using Pecten maximus as a model
species – Joëlle Richard (France)
10:40am – 11:00am
MORNING BREAK
11:00am – 03:00pm
SPECIAL SESSION: PECTINIDS – WITNESSES OF
THEIR ENVIRONMENT IN A CHANGING OCEAN
Inis Mor
Ballroom
PCA
Chairs: Laurent Chauvaud (France), Burgel Schalkhausser (Germany)
11:00am – 11:30am
1) KEYNOTE: The shell of ‘Pecten Le Grand’ as a paleoand novo- ecological tools – Laurent Chauvaud
(France)
11:30am – 11:50am
2) Scallop shells as geochemical archives of paleoecological processes in coastal ecosystems – Julien
Thébault (France)
11:50am – 12:10pm
3) Pecten jacobaeus – archive of environmental variability in
the north Adriatic Sea – Melita Peharda (Croatia)
12:10pm – 12:30pm
4) The great scallop, Pecten maximus, the species which
has changed our methods, views and perspectives, in the
use of carbon stable isotope ratios (δ13C), as proxies, in
biogenic carbonates – Yves-Marie Paulet (France)
12:30pm - 02:00pm
LUNCH BREAK
02:00pm – 02:20pm
5) Using the growth of Pecten maximus as environmental
proxy – Clement Le Goff (France)
Inis Mor
Ballroom
Marinas
Restaurant
ix
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
02:20pm – 02:40pm
6) Easy prey? – Great scallop escape performance under
ocean
warming
and
acidification
–
Burgel
Schalkhausser (Germany)
Inis Mor
Ballroom
02:40pm – 03:00pm
7) Will future ocean acidification affect development of great
scallop (Pecten maximus L.) veliger larvae? – Sissel
Andersen (Norway)
03:00pm – 03:30pm
AFTERNOON BREAK
PCA
03:30pm – 05:00pm
ROUND TABLE DISCUSSION
Inis Mor
Ballroom
08:00pm – until late
GALA DINNER
Four-course dinner including wine followed by an evening
with ‘The Glitter Bugs’ band – a fun and energetic band
that will set the scene for a night of dancing
Inis Mor
Ballroom
TUESDAY 28TH APRIL 2015
09:15am – 09:45am
Registration
09:45am – 10:10am
BIOTOXINS SESSION
09:45am – 10:10am
10:10am – 12:10pm
10:10am – 10:30am
Hotel
Lobby
1) Pecten Maximus - The black sheep of the mollusc family
when it comes to biotoxin legislation – Dave Clarke
(Ireland)
RESOURCES MANAGEMENT SESSION
Chairs: Dale Arendse (SA), Claire Catherall (UK)
1) Thinking Outside the Box: Spatial Closures and the Maine
Sea Scallop Fishery – Trisha Cheney (USA)
10:30am – 10:50am
2) Towards the establishment of a standardized DNA tool to
improve food traceability and labelling – Sara Vandamme
(UK)
10:50am – 11:10am
3) Queen Scallops (Aequipecten opercularis) in Irish waters:
spatial & temporal landing patterns, fleet characteristics,
and estimated CPUE (2003-14) – Declan Quigley
(Ireland)
11:10am – 11:30am
MORNING BREAK
11:30am – 11:50am
4) Modelling larval dispersal of Pecten maximus in the
English Channel: a tool for spatial management of stocks
– Eric Thiebaut (France)
11:50am – 12:10pm
5) Extreme recruitment events in the United States sea
scallop fishery – N. David Bethoney (USA)
12:10pm – 12:30pm
CLOSING REMARKS
Inis Mor
Ballroom
PCA
Inis Mor
Ballroom
END OF IPW2015 WORKSHOP
x
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
ORAL PRESENTATION ABSTRACTS
ORAL PRESENTATIONS
1
KEYNOTE: A pectinid passion
Dan Minchin – Marine Organism Investigations, Ireland
2
ECOLOGY AND GENERAL BIOLOGY I
4
Links between morphology and behaviour in scallops with different swimming styles
Isabelle Tremblay – University of Laval, Canada
5
Spat settlement and juvenile scallop abundance after the collapse of Iceland scallop
(Chlamys islandica) fishery in Breiðafjörður, Iceland
Jóhann Arnfinsson – University of Iceland
7
The first field evidence of fertilization success in the giant sea scallops
Skylar Bayer – University of Maine, USA
10
A Dynamic Energy Budget model to better understand the physiological response of
the great scallop, Pecten maximus, to environmental variability
Romain Lavaud – Louisiana State University, USA
12
Development of Sea Ranching of Japanese Scallop Patinopecten yessoensis of
Zhangzidao Group Co., Ltd. In Northern Yellow Sea, China
Jianguang Fang – Sea Ranching Research Centre, China
15
Quantifying the morphodynamics of the great scallops (Pecten maximus L.) shell:
effect of environmental variability on the resulting shape
Jean-Marc Guarini – LEMAR, France
AQUACULTURE
16
17
An overview of scallop research in South Africa
Dale Arendse – Department of Agriculture, Forestry and Fisheries, South Africa
18
Scallop aquaculture in Chile: Rise and collapse of a promising industry
Elisabeth Von Brand – Catholic University of Norte, Chile
19
Progress in aquaculture of the scallop Nodipecten nodosus in Brazil: challenges and
prospective
Guilherme Rupp – EPAGRI, Brazil
22
Scallop Fisheries and Aquaculture in Mexico
César A. Ruiz-Verdugo – Autonomous University of Baja California Sur, Mexico
24
Economic assessment of Argopecten nucleus spat hatchery production to support the
development of scallop aquaculture in the Caribbean Basin
Diego Valderrama – University of Florida, USA
26
xi
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Growth and survival of the Caribbean scallops Argopecten nucleus and Nodipecten
nodosus cultured under different depths and nets change frequencies
Luz Adriana Velasco – University of Magdalena, Colombia
29
Field testing of novel antifouling coatings for the aquaculture industry – preliminary
results
Sandra Shumway – University of Connecticut, USA
32
Evaluation of post-mortem changes in the adductor muscle length of Pacific calico
scallop (Argopecten ventricosus) as a simple method to assess the onset of rigor
mortis in scallops
Ana Isabel Beltrán Lugo – Autonomous University of Baja California Sur, Mexico 33
FISHERIES
36
An overview of New Zealand scallop fisheries in 2015
James Williams – NIWA, New Zealand
37
Management and research responses to collapses in three scallop stocks in Western
Australia following an extreme marine heat wave event
Mervi Kangas – Department of Fisheries Western Australia
39
Discard mortality of sea scallops following capture and handling in the commercial
dredge fishery
David Rudders – University of New England, USA
42
Scallop area management: Strategies to maximize yield
William DuPaul – Virginia Institute of Marine Science, USA
45
Abundance, automated image detection, crowd sourcing, and incidental mortality
estimates of Sea Scallops (Placopecten Megallanicus) from AUV based surveys
Arthur Trembanis – University of Delaware, USA
48
Temporal changes in shell height-to-meat weight relationships of the sea scallop
(Placopecten magellanicus) in the Maritimes region Canada in relation to
environmental conditions
Jessica Sameoto – Bedford Institute of Oceanography, Canada
51
Fishing for data: Stock status and predator (fishing vessel) response in the Isle of
Man queen scallop fishery
Isobel Bloor – Bangor University, Isle of Man
52
Assessing the sustainability of a scallop dredge fishery: population structure & habitat
impacts
Claire Catherall – Bangor University, UK
55
Estimation of sustainable yield for King scallops (Pecten maximus) stocks in the
Normand-Breton Gulf (Western English Channel)
Eric Foucher – IFREMER, France
57
xii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS I
60
Updating homeobox genes in bivalve molluscs
Luz Pérez-Parallé – University of Santiago de Compostela, Spain
61
QTL mapping and GWAS for orange muscle in Yesso scallop (Patinopecten
yessoensis, Jay, 1857)
Xiaoli Hu – Ocean University of China
65
Diets rich in polyunsaturated fatty acids improve the capacity to respond to stress
through HSP70 synthesis in the scallop Argopecten purpuratus after reproductive
investment
Katherina Brokordt – Catholic University of Norte, Chile
67
Genome sequencing of yesso scallop Patinopecten yessoensis: generating a
genomic resource for understanding the biology and evolution of pectinidae
(mollusca: bivalvia)
Zhenmin Bao – Ocean University of China
69
Image formation in the concave mirror eyes of scallops
Daniel Speiser – University of South Carolina, USA
MARINE PROTECTED AREAS
71
72
KEYNOTE: Marine protected areas and the US sea scallop fishery
Kevin Stokesbury – University of Massachusetts, USA
73
Incorporating local knowledge into spatial management of the sea scallop
(Placopecten magellanicus) fishery in Maine, USA
Carla Guenther – Penobscot East Resource Center, USA
77
The effect of small-scale closed areas on giant sea scallop populations in Maine
Caitlin Cleaver – Hurricane Island Foundation, USA
80
Managing the Supply Side: Larval Dispersal from Rotating Closures in the Atlantic
Sea Scallop (Placopecten magellanicus) Fishery
Deborah Hart – North East Fisheries Science Center, USA
83
Managing fishers to manage themselves: Ramsey fisheries management zone a
learning experience
Sam Dignan – Bangor University, Isle of Man
84
Scallops like it rough! - Recovery of complex habitat boosts scallop settlement in a
community-led temperate marine reserve
Leigh Howarth – University of York, UK
87
Can spatial management revive the Clyde? A plan for ecosystem-based management
of shellfish fisheries in a simplified sea
Bryce Beukers-Stewart – University of York, UK
88
xiii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS II
92
Genetic diversity of natural and seeded populations of great scallop (Pecten
maximus), and identification of hatchery-born seeds
Grégory Charrier – LEMAR, France
93
Apicomplexan infection and gray meat in Atlantic sea scallops, Placopecten
magellanicus
Susan Inglis – University of Massachusetts-Dartmouth, USA
96
Candidate genes associated with growth variation in Argopecten purpuratus
Claudia Cárcamo – Catholic University of Norte, Chile
998
Transcriptome sequencing and candidate gene-based association analysis for heat
tolerance in the bay scallop Argopecten irradians
Huayong Que – Chinese Academy of Sciences, China
102
Integrated mechanistic study of the temporal effect of temperature increase using
Pecten maximus as a model species
Joëlle Richard – LEMAR, France
105
PECTINIDS – WITNESSES OF THEIR ENVIRONMENT IN A CHANGING OCEAN 107
KEYNOTE: The shell of ‘Pecten Le Grand’ as a paleo- and novo- ecological
tools
Laurent Chauvaud – CNRS, France
108
Scallop shells as geochemical archives of paleo-ecological processes in coastal
ecosystems
Julien Thébault – LEMAR, France
110
Pecten jacobaeus – archive of environmental variability in the north Adriatic Sea
Melita Peharda – Institute of Oceanography and Fisheries, Croatia
114
The great scallop, Pecten maximus, the species which has changed our methods,
views and perspectives, in the use of carbon stable isotope ratios (δ13C), as proxies,
in biogenic carbonates
Yves-Marie Paulet - IUEM, France
117
Using the growth of Pecten Maximus as environmental proxy
Clement Le Goff – CNRS, France
118
Easy prey? – Great scallop escape performance under ocean warming and
acidification
Burgel Schalkhausser – Alfred-Wegener-Institute, Germany
120
Will future ocean acidification affect development of great scallop (Pecten maximus
L.) veliger larvae?
Sissel Andersen – Institute of Marine Research, Norway
123
xiv
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
BIOTOXINS, POLLUTION AND CONTAMINATION
127
Pecten Maximus- The black sheep of the mollusc family when it comes to biotoxin
legislation
Dave Clarke - Marine Institute, Ireland
RESOURCE MANAGEMENT
128
129
Thinking Outside the Box: Spatial Closures and the Maine Sea Scallop Fishery
Trisha Cheney – Maine Department of Marine Resources, USA
130
Towards the establishment of a standardized DNA tool to improve food traceability
and labelling
Sara Vandamme – University of Salford, UK
131
Queen Scallops (Aequipecten opercularis) in Irish waters: Spatial & temporal landing
patterns, fleet characteristics and estimated CPUE (2003-14)
Declan Quigley – Fisheries Protection Authority, Ireland
132
Modelling larval dispersal of Pecten maximus in the English Channel: a tool for spatial
management of stocks
Eric Thiebaut – Roscoff Marine Station, France
133
Extreme recruitment events in United States sea scallop fishery
N. David Bethoney – University of Massachusetts-Dartmouth, USA
POSTER PRESENTATIONS
ECOLOGY AND GENERAL BIOLOGY
135
139
140
No 1: Biodiversity of the Order Pectinoida (Mollusca: Bivalvia) in Irish Waters
Declan Quigley – Sea Fisheries Protection Authority, Ireland
141
No 2: Some noteworthy & unusual pectinids recorded from irish waters
Declan Quigley – Dingle Seaworld, Ireland
143
No 3: Scallops in 3-D
Deborah D. Hart – Northeast Fisheries Science Center, USA
145
No 4: New insights of the seasonal feeding ecology of the great scallop, Pecten
maximus
Romain Lavaud – Louisiana State University, USA
146
No 5: Modelling the distribution of the Great scallop Pecten maximus in the English
Channel: linking physical and biological processes to define scallop habitat.
Clement Le Goff – CNRS, France
148
No 6: Northern distribution of Pecten maximus and Aequipecten opercularis
populations in Norway
Ellen Sofie Grefsrud – Institute of Marine Research, Norway
150
xv
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
AQUACULTURE
152
No 7: Making sense of water quality – the AquaMMS Project: Development of a
portable integrated sensing platform to monitor important, but technically difficult
parameters in aquaculture
Gyda Christophersen – Teknologisk Institutt as, Norway
153
No 8: Field testing of novel antifouling coatings for the aquaculture industry –
preliminary results
Sandra Shumway – University of Connecticut,USA
FISHERIES
156
157
No 9: Assessing benthic communities in 3D: Sea scallops swimming of the seafloor
produce significant measurement error in 2D
Scott M. Gallager – Woods Hole Oceanographic Institution, USA
158
No 10: Optimization of SeaFloorExplorer.org: A citizen cyber science project to asses
sea scallop distribution, benthic community composition and habitat through public
engagement
Scott M. Gallager - Woods Hole Oceanographic Institution, USA
159
No 11: An application for AUV seabed imaging to estimate Placopecten magellanicus
incidental mortality
Danielle Ferraro – University of Delaware, USA
160
No 12: Catch efficiency in a rotational diver based fishery of the scallop Pecten
maximus in Norway
Øivind Strand – Institute of Marine Research, Norway
163
No 13: Developing effective cooperative research methods for a small-scale closure
area in coastal Maine
Caitlin Cleaver – Hurricane Island Foundation, USA
165
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS
167
No 14. Expression of genes involved in multixenobiotic resistance (MXR) in different
tissues of Pecten maximus (Linnaeus, 1758)
José L. Sanchez – University of Santiago de Compostela, Spain
168
No 15: Scallop myosin overview: An exemplar molecule for folding to form the shutdown state and flexibility within the heads applicable to all muscle myosin-2
molecules
Peter D. Chantler – Royal Veterinary College, University of London, UK
171
No 16: Characterization and expression of Peroxiredoxin and HSP70 genes involved
in immune defense of Argopecten purpuratus scallop
Katherina Brokordt – Catholic University of Norte, Chile
173
xvi
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 17: Investigation of tonic muscle recruitment in swimming scallops using
behavioural techniques and electromyography (EMG)
Isabelle Tremblay – University of Laval, Canada
175
BIOTOXINS, POLLUTION AND CONTAMINATION
177
No 18: Contamination of cadmium from digestive glands to adductor muscle in frozen
and thawed samples of scallops
Arne Duinker – National Institute of Nutrition and Seafood Research, Norway
178
No 19: SAFI: Supporting our Aquaculture and Fisheries Industries; a tool to aid in
detecting suitable fishing grounds for shellfish and finfish
Dee McElligott – Daithi O’Murchu Marine Research Station, Ireland
180
PECTINIDS – WITNESSES OF THEIR ENVIRONMENT IN A CHANGING OCEAN 1822
No 20: Patterns and mechanisms of damage in a scallop dredge fishery
Bryce D. Stewart – University of York, UK
1833
No 21: The influence of sea surface temperature and climate indexes on King scallop
(Pecten maximus) recruitment in the Bay of Seine (Eastern English Channel, France)
Eric Foucher – IFREMER, France
1866
No 22: Coastal upwelling in Norway recorded in Great scallop shells
Aurélie Jolivet – LEMAR, France
190
No 23: Using soya DNA barcodes to trace feed and faeces from salmon aquaculture
to the benthic suspension feeder Pecten maximus
Christofer Troedsson – UNI Research, Norway
1944
No 24: An integrated assessment model for helping the United States sea scallop
(Placopecten magellanicus) fishery plan ahead for ocean acidification and warming
Deborah D. Hart – NOAA/NMFS/Northeast Fisheries Science Center, USA
1955
RESOURCE MANAGEMENT
1966
No 25: A comparison of model-based and design-based methods to estimate sea
scallop (Placopecten magellanicus) abundance and biomass from vessel-towed
underwater camera data
Deborah D. Hart – Northeast Fisheries Science Center, USA
1977
xvii
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
ORAL PRESENTATIONS
1
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
KEYNOTE
A pectinid passion
Dan Minchin
Marine Organism Investigations, Marina Village, Ballina, Killaloe, Co Clare
Having been grabbed by a scallop lying on the kitchen table at the age of three I finally
got my own back by dispatching many thousands of them in Canada, Ireland, France,
Norway, Japan and Australia. This approach changed almost half a century later when I
reformed to study what really upset scallops and the molluscan kind. On this journey a
wide range of interesting and unforgettable characters paved inspirational ways in the
name of science, from scallop trainers, frontier divers to working with those in
circumstantial screwed-up experiments. Many of these enthusiasts evolved from a small
meeting in Baltimore, Ireland, in 1976. The workshop series unexpectedly happened
from this meeting. The survival of our group relied on the enthusiasm of those members
in, and those that joined, to make it a living workshop; and to whom I am grateful for the
credit given to me for its present existence. The names of attendees adorn the literature
of the world and even have had mountains named after them. Here was a 'gene-pool'
mixing of ideas on an international basis. Concepts and imaginative research and
management developed from our group, irrigated with local high quality libations which
led to supple minds and highly motivated teams to form a ‘brother’-hood beyond the
realms of the bureaucracene. I am appreciative of my life’s journey and for being able to
share it with the scallop kind that surprised me at the age of three. After so many years I
now know some of their secrets although there are many more to be solved. Some who
contributed to our knowledge have sadly, along the way, left us.
Minchin D (1983) Predation on young Pecten maximus (L.) (Bivalvia) by the anemone
Anthopleura ballii (Cocks). Journal of Molluscan Studies, 49: 228-231.
2
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Minchin D, Duggan CB, King W (1987) Possible influence of organotins on scallop recruitment.
Marine Pollution Bulletin 18(11): 604-608.
Minchin D (1989) Up-slope movements in the scallop, Pecten maximus. Journal of Molluscan
Studies, 55: 423-425.
Minchin D, Duggan CB (1989) Biological control of the mussel in shellfish culture. Aquaculture
81: 97-100.
Minchin D (1991) Observations on shell colour in the scallop, Pecten maximus (L.). Journal of
Conchology, 34: 41-46.
Minchin D (1992) Induced spawning of the scallop, Pecten maximus, in the sea. Aquaculture,
101: 187-190.
Minchin D (1992) Biological observations on young scallops, Pecten maximus. Journal of the
Marine Biological Association of the United Kingdom. 72: 807-819.
Minchin D (1994) Gigantism in the scallop, Pecten maximus (L.) 27th European Marine Biology
Symposium (ed): J.C. Aldrich. Japaga Press, Wicklow, Ireland. 163-168.
Minchin D, Skjaeggestad H, Haugum GA, Strand Ø (2000) Righting and recessing ability of wild
and naïve cultivated scallops. Aquaculture Research 31: 473-474.
Minchin D, Haugum G, Skjæggestad, Strand Ø (2000)
Effect of air exposure on scallop
behaviour, and the implications for subsequent survival in culture. Aquaculture International 8:
169-182.
Minchin D (2002) The potential for ranching the scallop, Pecten maximus – past, present and
future: problems and opportunities. ICES Marine Science Symposia 215: 416-423.
Minchin D (2003) Introductions: some biological and ecological characteristics of scallops.
Aquatic Living Resources 16: 521-532.
Corresponding author: [email protected]
3
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
ECOLOGY AND GENERAL BIOLOGY I
4
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Links between morphology and behaviour in scallops with different swimming
styles
Isabelle Tremblay1,2 and Helga E. Guderley1
1Département
de Biologie, Université Laval, Québec city, Québec, Canada; 2Ressources Aquatiques
Québec, Institut des sciences de la mer de Rimouski, Université du Québec à Rimouski, Rimouski,
Québec, Canada
Scallops differentiate themselves from other bivalves by their swimming capacities.
Modifications in shell structure, mantle and adductor muscle are considered derived
adaptations that allowed scallops to swim. Swimming capacity is shared by scallops
exhibiting a wide range of shell morphologies and life styles ranging from the highly active
Amusium balloti to the byssally attached Mimachlamys asperrima. Logically, the
swimming ability of bivalves should be reflected in their morphological characteristics,
including adductor muscle size and position and shell characteristics. Several studies
have compared shell and adductor muscle morphology in swimming and non-swimming
monomyarian bivalves, inferring swimming abilities from the literature. However, the
literature does not reveal whether differences in shell and muscle morphology are
quantitatively linked with the wide range of scallop swimming strategies.
Various morphological characteristics of the shell (mass, aspect ratio and volume
between the valves) and the adductor muscle (size, position and arrangement in the
shell) were measured in 5 scallop species (Amusium balloti, Placopecten magellanicus,
Pecten fumatus, Mimachlamys asperrima, and Crassadoma gigantea) with distinct
escape responses, as documented by measurements of muscle use during escape
responses. Principal component analysis (PCA) was carried out on these morphological
characteristics to examine the links among them and how they differentiated the
experimental species. Next, PCA were carried out on the data for patterns of muscle use
during escape responses (Tremblay et al. 2012) to evaluate links among the principal
components describing morphology and those describing behaviour.
5
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Morphological characteristics of the shell and adductor muscle differed markedly
between the species, but did not always follow their swimming strategies. The PCA for
the morphological characteristics yielded three principal components (mass and
proportions, force and size, obliqueness and aspect ratio) that together accounted for
61% of the variance. The PCA for behavioural parameters yielded two principal
components (endurance and intensity of the escape response) that explained 70% of the
variability in the data. Integrating the results from the two principal components analyses
revealed that shell width, shell and muscle masses, and related morphological attributes
were closely linked with swimming endurance. The intensity of the escape response was
best predicted by the aspect ratio and the obliqueness of the adductor muscle. The
relationship between scallop behaviour and morphology is not simple, as it is the result
of compromises imposed by the habitats, lifestyle and predators. To understand how the
combinations of morphological parameters relate to the swimming behaviour of each
species, it is important to interpret these results in the overall context of the habitats in
which these scallops live.
6
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Spat settlement and juvenile scallop abundance after the collapse of Iceland
scallop (Chlamys islandica) fishery in Breiðafjörður, Iceland
Jóhann Arnfinsson1, Guðrún Þórarinsdóttir2 & Jónas Páll Jónasson2
1University
of Iceland, Vatnsmýrarvegur 16, 101 Reykjavík, Iceland; 2Marine Research Institute,
Skúlagötu 4, 101 Reykjavík, Iceland
Introduction
Commercial fishery of the Iceland scallop (Chlamys islandica) was performed in the bay
of Breiðafjörður west Iceland, from 1970 until 2003 when a fishing was prohibited after a
drastic decline in the stock index. Annual harvest was around 8500 tons in the years prior
to the collapse. Studies have proposed that poor recruitment combined with fishing and
high natural mortality caused by protozoan infestation in adult scallops led to the collapse
of the stock (Jonasson et al., 2007; Kristmundsson et al., 2011). The greatest decline in
the survey indices was between 2001 and 2006, and since then the indices have slowly
decreased to a historical minimum observed in 2013. However, from 2007-2011, the
proportion of the larger scallops in the stock has increased along with decreasing rates
of infection and natural mortality. After the collapse, there has been an anticipation if and
when the beds would replenish them self. In an effort to answer that the largest company
involved in the fishery (Agustson ehf) initiated a spat sampling monitoring program that
will be presented along with information from juvenile scallop found in the annual scallop
dredge survey carried out by the MRI.
Material and Methods
Annual spat collection initiated in 2005. During the first years the collectors were
deployed on the two main fishing grounds (north and south) in Breiðafjörður. Since 2008
collectors have only been put out in the southern ground. Each year were put out 3 or
more collectors at 25 - 40 different locations. In general there has been consistency
between the locations of collectors within years.
7
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Abundance indices of juvenile scallop were obtained from the annual scallop surveys
conducted by the MRI at both the northern and southern grounds in Breiðafjördur.
On each survey 120 fixed standardized dredge tows were taken, but fewer after the
collapse of the stock, due to large areas were scallops have been absent. During 2014
the traditional dredge survey was partly replaced with a camera survey and some new
areas in bay were investigated as well.
Results
During the last decade two years of good spatfall have been observed, 2007 and 2010.
During these years more than 100 spat were collected in several of the collectors and
the highest abundance was observed in collectors towards the deeper and outer end of
the southern fishing ground. In other years (2006, 2008, 2009, 2011, 2012, 2013) the
maximum number of spat in each collector did not exceed 50 and in 2005 less than 5
spat were collected in all locations. Juvenile abundance remained poor in the dredge
surveys until 2012 when year-classes from 2010 were observed. Scallops were found in
fishable quantities within new areas in the camera survey of 2014. More year-classes
were present there than on the conventional fishing grounds, where in many areas
Asteroidea dominated in biomass.
Discussion
The results from the spat collector and the observed number of small scallops at the
appropriate time lag on nearby grounds where not always in concordance. This was
mainly observed in areas where adult scallops had almost totally disappeared. The lack
of adult beds for successful settlement could explain the fate of the spat but predation
by starfish seems a more plausible explanation. An interesting spatial pattern was found
in the locations of the spat within a relatively small geographical area.
Conclusion
The recovery of the scallop stock in Breiðafjörður which collapsed in the beginning of the
century has been slow. There is an indication that recovery could be in progress but on
totally depleted areas recovery could still take some years or even decades.
8
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
References
Kristmundsson, Á., Helgason, S., Bambir, S. H., Eydal, M., Freeman, M. A. Previously unknown
apicomplexan species infecting Iceland scallop, Chlamys islandica (Müller, 1776), queen scallop,
Aequipecten opercularis L., and king scallop, Pecten maximus L., Journal of Invertebrate
Pathology, 108: 147-155.
Jonasson, J. P., Thorarinsdottir, G., Eiriksson, H., Solmundsson, J., and Marteinsdottir, G. 2007.
Collapse of the fishery for Iceland scallop (Chlamys islandica) in Breidafjordur, West Iceland.
ICES Journal of Marine Science, 64: 298–308.
9
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The first field evidence of fertilization success in the giant sea scallop
Skylar Bayer; Richard Wahle; Damian Brady; Pete Jumars
University of Maine School of Marine Sciences, Darling Marine Center, 193 Clark’s Cove Road, Walpole,
Maine, 04573 USA
Introduction
Fishing down sedentary broadcast spawners challenges their reproductive success by
depleting natural aggregations that are thought to promote high rates of fertilization. Here
I present the first field experiments on fertilization success in the giant sea scallop,
Placopecten magellanicus, a commercially valuable sedentary broadcast spawner in the
Northwest Atlantic.
Materials and Methods
Building on previous laboratory studies using time-integrated fertilization experiments,
we (1) developed and flume-tested a Nitex mesh chamber (Fig. 1a) to measure relative
rates of fertilization success in situ, and (2) assessed fertilization in a series of field
experiments conducted during the scallop spawning season that progressed from
dockside field manipulations to natural population in a coastal estuary.
Results
Notwithstanding fertilization chamber artifacts assessed in the laboratory, dockside
experiments spanning a 30-fold difference in spawner numbers demonstrated that
density effects were detectable during the spawning season (Fig. 1b). However, in both
manipulated and natural populations spanning 10-fold differences or less on the seabed
density effects were not significant, although we detected a peak in fertilization during
the spawning season.
Discussion
To our knowledge these experiments represent the first in situ measurements of
fertilization success for scallops. We suspect that the stronger density effects in the
10
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
dockside experiment may be attributed to the greater contrast in spawner density.
Failure to detect a density effect in the seabed trials may be attributed to the lower
contrast in density and asynchronous spawning, whereby only a fraction of the population
spawned on any given 24-h fertilization trial over the course of the 4-5 week spawning
season. If true, differences in fertilization may only be detectable across population
density gradients in the event of mass, synchronous, spawning or across more dramatic
differences in population density that we could only produce in dockside manipulations.
Conclusion
Although field deployed time-integrated fertilization experiments bring artifacts related to
the chamber shape and mesh size, we were able to detect scallop fertilization in the wild
for the first time. Density effects were evident in the most artificial dockside but not in
more naturalistic field populations spanning a 10-fold difference in density or less. The
implications of these results for depensatory effects in scallop stocks are not yet clear,
but the methodology demonstrates the feasibility of assessing the causes of variable
fertilization success in field populations of scallops and other bivalves.
Figure 1. (a) Fertilization chamber (15 mm inner diameter x 70 mm high) hanging on a weighted line for dockside
deployments; white arrows indicate flow-through areas with 40 µm Nitex mesh. (b) Dockside scallop fertilization
experiments showing mean (+1 SE) fertilization at three scallop densities. Scallops housed in lantern nets
spanning a 30-fold difference in density: high (30 males per raft), medium (4 males per raft) and low (1 male per
raft) at two locations in the Damariscotta River.
11
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
A Dynamic Energy Budget model to better understand the physiological
response of the great scallop, Pecten maximus, to environmental variability
Romain Lavaud
1,2,
Fred Jean 1, Jonathan Flye-Sainte-Marie 1, Øivind Strand 3,
Sebastian A.L.M. Kooijman 4
1Laboratoire
des Sciences de l’Environnement Marin (UMR 6539), Institut Universitaire Européen de la
Mer, Université de Bretagne Occidentale, Rue Dumont d'Urville, 29280 Plouzané, France; 2School of
Renewable Natural Resources, Louisiana State University Agricultural Center, Baton Rouge, LA, 70803,
USA (current address); 3Institute of Marine Research, P.O. Box 1870 Nordness, 5817 Bergen, Norway;
4Department
of Theoretical Biology, Vrije Universiteit, de Boelelaan 1085, 1081 HV Amsterdam, The
Netherlands
Introduction
The study of energy transfers between the environment and an organism, and within an
organism, allows a better understanding of the impact of environmental variability on
metabolism. Modelling is a powerful tool for the comprehension and the description of
mechanisms and rules behind these energy exchanges. The Dynamic Energy Budget
(DEB) theory provides a mechanistic approach for mass and energy budgets in relation
to environmental conditions. Based on simple and sound principles of thermodynamics,
this theoretical framework quantitatively describes energy flows and their allocation to
growth development, reproduction and maintenance.
The great scallop, Pecten maximus, show highly contrasted growth patterns along its
wide distribution range. On the basis of DEB theory, we tried to link these variations to
the environmental variability. We developed the first DEB model for the great scallop and
used it to (1) study the importance of trophic availability and origin as it determines the
energy input to the model, and (2) provide an individual ecophysiological model for a
large scale modelling of its distribution and physiological capacities in the English
Channel.
12
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Material and Methods
The DEB theory is a formal theory for the uptake and use of substrates (basically food)
by organisms and their use for maintenance, growth, maturation and reproduction. Two
forcing variables are necessary to feed the model: the temperature and a food density
proxy. Ingested food is converted with a constant efficiency into assimilates added to the
reserve compound. A fixed fraction of the energy mobilized from reserves is allocated to
somatic maintenance plus structural growth and the rest is directed to maturity
maintenance plus maturation before puberty, and to maturity plus reproduction during
the adult stage, with a priority to maintenance. The implementation of energy fluxes within
the organism and the estimation of a set of species-specific parameters allow the
simulation of any metabolic process such as growth in length or in weight, reproductive
activity, respiration, etc. during the whole life span of the individual.
The model was validated through simulations of length, weight and reproductive activity
over six years and compared to a field data collected in the bay of Brest. We used a set
of different food proxies (chlorophyll-a, microalgae cells counts, particulate organic
matter, etc.) and tested their relevance as energy inputs for the model. We also
developed a module to test the capacity of selection of different food sources by the great
scallop. The individual deb model was then coupled to a population dynamic model
(taking into account the whole life cycle), a biogeochemical model (providing forcing
variables to the DEB model) and a hydrodynamic model (allowing the dispersion of larvae
and food). This coupling allowed us to model the distribution of the great scallop in the
whole English Channel. Spatialized predictions of potential growth were produced and
the simulated distribution was compared to existing map of presence/absence of this
species in the study area.
Results
The model was validated in the bay of Brest, France over a 6 year period. The commonly
used food proxy for suspension feeding bivalves, i.e. chlorophyll-a, did not simulate in
satisfactory way the observed measuerements. A more detailed approach with two
different potential food sources were proposed at the entry of the model (microalgae cells
count and the rest of particulate organic matter, POM), which improved the results.
13
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The coupling of this individual model to a population model, a hydrodynamic model and
a biogeochemical model provided an extremely detailed mapping of the distribution and
growth potential of the great scallop in the English Channel. The simulated distribution
fitted the known area of presence, consisting mainly in fishery areas.
Discussion
The development of the first individual DEB model for P. maximus showed the difficulty
to accurately determine the trophic availability and its importance for the model. The
better fit that was obtained in simulations where cell counts were used instead of
chlorophyll-a confirms some features of the feeding ecology of filter-feeders: their ability
to select different food sources according to their quality.
The evaluation of the modelling of P. maximus distribution and its growth potential in the
English Channel was limited by the available data consisting only of presence/absence.
However, it provides an interesting tool to identify highly productive locations or critical
areas for the population development such as the different bays in the Channel, showing
increased reproductive activity as a result of the high primary production of these areas.
Conclusion
This study presents the first DEB model for the great scallop. The modeling approach of
the bioenergetics of P. maximus provides a powerful tool for the understanding of the
relationship between the environmental variability and the organism along its distribution
range. This work allowed us to better characterize the energy requirements of the great
scallop in natural conditions. This type of models might become an interesting tool to
help answering management issues, as it has already been the case for other
economically important species (oysters, mussels).
14
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Development of Sea Ranching of Japanese Scallop Patinopecten yessoensis of
Zhangzidao Group Co., Ltd. In Northern Yellow Sea, China
Jian-guang Fang 1,2, Jun Liang1, Øivind Strand1,3
1Sea
Ranching Research Centre, Zhangzidao Group Co., Ltd., Dalian China; 2Yellow Sea Fisheries
Research Institute, CAFS. Qingdao China; 3Institute of Marine Research, Bergen, Norway
Japanese Scallop was transferred from Japan to China in early 1980’s. After about 10
years domestication, the sea ranching of this scallop has become the major aquaculture
industry in the region of northern Yellow Sea, China, based on the success of seed
production in hatchery. Zhangzidao Group Co., Ltd. is the earliest and biggest company
engaging in sea ranching of Japanese scallop in that region. The activity of sea ranching
of the scallop in the company has developed rapidly from pilot scale to large scale since
early 1990’s. The sea ranching area was expanded from 150 km2 in 2005, 436 km2 in
2006, 1900 km2 in 2010, and 2500 km2 in 2013 respectively. The depth of sea ranching
of scallop has expanded from 20m in early 1990’s to 50m now. The total annual harvest
production of the scallop reached to 28,000 tons in 2013, with product value of RMB840
million Yuan (US$140 million). Nowadays, the development of sea ranching of Japanese
scallop of the company has been forcing several challenges since last several years,
such as the decline of average unit area harvest, the prolongation of culture period from
3 year to 4 years, the increase of predator on scallop in the areas of sea ranching,
increasing the cost of labor and heavy mortality of scallop occurred in summer. In order
to push the development of sea ranching in sustainable way, the collaboration project
“Environment and Aquaculture Governance (EAG)” between Institute of Marine
Research(IMR), Norway, Yellow Sea Fisheries Research Institute (YSFRI), China and
ZZD company was implemented from 2014 to 2017 mainly for assess of carrying capacity
of whole northern Yellow Sea, elaboration of methods to develop environmental impact
management and IMTA systems, Develop decision support systems (DSS) for
comprehensive management, and the impact of temperature variation caused by cold
water body in northern Yellow Sea on survival of scallop.
15
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Quantifying the morphodynamics of the great scallops (Pecten maximus L.)
shell: effect of environmental variability on the resulting shape
Jean-Marc Guarini1 and Laurent Chauvaud2
1LEMAR
– EBLab – University Pierre and Marie Curie, Banyuls sur Mer, FR-66650UMR 6539; 2IUEM
Technopole Brest-Iroise – Rue Dumont d’Urville, Plouzane, FR-29280
Morphodynamics of mollusks shells were found to be ruled by the same set of
constraints, mainly to preserve the same shape during terminal growth. Mathematically,
these constraints are respected by only one function, the equiangular spiral, implying that
the dilatation factor is exponential. In other words, at each successive time step, the new
band of calcium carbonate added to the existing structure should be exponentially larger
than the previous one. Previous studies performed on Great Scallop (Pecten maximus
L. 1758) have shown that this is not the case. Accretion fluctuates in time, as a function
of the environmental conditions in which the organism lives. In coastal temperate areas,
growth stops during more or less long winter periods, and fluctuates in between. The
morphodynamics of the shell of the Great Scallop was quantified with a model that takes
into account the growth fluctuations, allowing to reconstruct with precisions the
juxtaposition of bands as it is performed by individuals. It was found that the
morphodynamics can deviate, under conditions, from the ideal model of the equiangular
spiral, but this induces slight differences in the resulting shell, mainly for the round valve.
Further studies of pectinids shells in different populations along latitudinal gradients or
under different environmental regimes should provide a classification of the shapes
based of the typology of the fitted parameters of our model. It has potential applications
in the biology of the species, its ecology and its use as an archive to infer environmental
variability.
Corresponding author: [email protected]
16
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
AQUACULTURE
17
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
An overview of scallop research in South Africa
Dale Arendse1,2 and Grant Pitcher1,2
1Branch:
Fisheries Management, Department of Agriculture, Forestry and Fisheries, Cape Town, South Africa
2Department
of Biological Sciences, University of Cape Town, Cape Town, South Africa
One of the aims of the marine aquaculture policy of South Africa is to expand the resource base
by increasing the diversity of the species currently being farmed. The local scallop Pecten
sulcicostatus was identified as a possible species due to its size. Prior to our studies, P.
sulcicostatus had been poorly studied and its biology and life history were largely unknown. To
date we have investigated the reproductive life cycle, broodstock conditioning, the larval rearing
and settlement of pediveligers and the grow-out of spat in order to determine if P. sulcicostatus
is a viable aquaculture species.
The reproductive study demonstrated a clear seasonal cycle, with peak spawning in winter.
Natural spawning events were associated with a decline in bottom temperature and reduced
food availability. Laboratory held broodstock were artificially conditioned within two weeks when
maintained at a high feed concentration. The effect of temperature on larval growth and survival
(from D-larvae to pediveligers) was also investigated as was the settlement of pediveligers on
different substrata. These studies indicated that larvae reared at 22 ºC had the fastest growth
and development. The growth rate of 8.17 μm day-1 compared favourably to that of other
commercial species, but, survival was low. The assessment of settlement of pediveligers showed
they could settle on poly-amide mesh and oyster shells. Hatchery-reared, juvenile P.
sulcicostatus were placed in suspended culture in Saldanha bay and growth was assessed
monthly in relation to changing environmental conditions. The mean growth rate of 0.10 mm day1
after one year compared favourably with other commercially-cultured scallop species, but
survival was again low. Research to date has therefore demonstrated the potential of P.
sulcicostatus as a viable species for aquaculture in South Africa; however, increasing survival of
both larvae and spat is a prerequisite to commercial culture.
18
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallop aquaculture in Chile: Rise and collapse of a promising industry
Elisabeth von Brand1, Germán E. Merino2, Alejandro Abarca3, Wolfgang Stotz1
Universidad Católica del Norte, Facultad de Ciencias del Mar, Casilla 117, Coquimbo, Chile
(1Departamento de Biología Marina, 2Departamento de Acuicultura, 3Magister en Acuicultura)
Introduction
Scallop aquaculture in Chile started in the 1970s with laboratory experiments on the
scallop Argopecten purpuratus (Lamarck 1819), investigating aspects including life cycle,
growth, seed collection, gonadal maturation, larval growth, etc. Initial research to produce
this species using aquaculture methods (Akaboshi & Illanes, 1983) was promising, using
Japanese culture technology adapted to the northern scallop and the local conditions.
Already at the end of the 1980s 57MT of scallops were produced by six aquaculture
centres located in Tongoy Bay (Vega, 1996). Already, at the beginning of the 1990s, 26
aquaculture centres and 6 commercial hatcheries produced 200MT, obtaining most of
their seed through wild seed collection and a small proportion was produced by
hatcheries. The growth of this industry showed a steep ascending curve. At the beginning
of the new millennium already 12 hatcheries produced A. purpuratus between
Antofagasta and Puerto Montt, located even outside the natural distribution of this
species (Abarca 2001). Chile´s maximum scallop production was reached in 2004 with
24,577 MT (Table 1), with about 92% from aquaculture and the rest from fishing of the
southern scallop species Zygochlamys patagonica and Chlamys vitrea.
The scallop industry was the third income source for Coquimbo region after copper and
agriculture. However, the strong competence for the target markets and low production
costs from a similar scallop harvested in Perú from wild stocks, plus a tsunami after the
2011 earthquake in Japan ended up with the drowning of a productive industry. There
were more than 2000 people directly living from the scallop industry and today no more
than 100 are still working on it. Scallops were sold up to US$14/kg when the industry
was operating at Tongoy Bay and today the price is about US$23/kg mainly due to a
lower scallop offer and an increasing demand. Nowadays, the scenario for scallop
19
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
production at Tongoy Bay seems to be much promising due to the increase exchange
rate of local currency against American currency, followed by a lower scallop offer from
Perú and with a higher wild seed collection. During 2012 Perú decreased scallop
exportation to 4463 MT, which was 60.90% less than was exported during 2011. In
addition, scallop harvesting decreased from 52,000 MT in 2011 to 24,000 MT in 2012. In
Chile, there is an important local market demand for scallop which could be an
opportunity for starting small scale scallop farms focusing on internal markets first and
then moving to international markets later. Ten years ago local scallop consumption was
200 MT per year and now is 600 MT per year.
Table 1. Principal producing countries scallops based on aquaculture between 1991 and 2012 (amounts
are given in metric tons, MT).
Year
Chile(1)
Perú
China
Japan
1991
2,215
N.D.
188,832
367,911
1993
6,015
N.D.
728,411
465,27
1995
9,629
N.D.
916,514
502,702
1997
14,084
N.D.
1,001,539
515,25
1999
22,383
N.D.
712,442
515,645
2000
19,37
N.D.
919,681
514,989
2001
18,947
N.D.
960,341
526,587
2002
15,552
N.D.
935,61
578,662
2003
15,109
6,67
786,113
258,339
2004
24,577
10,484
796,518
215,203
2005
17,319
11,066
906,022
203,352
2006
16,076
12,337
1004,555
212,094
2007
20,072
18,518
1165,311
247,516
2008
21,277
14,802
1137,039
225,607
2009
16,864
16,047
1276,77
256,695
2010
8,84
58,101
1407,467
219,649
2011
11,018
52,213
1306,124
118,425
2012
5,798
24,782
1419,956
184,287
N.D. = no data available. Source: FAO (1999), Sernapesca1 (2003, 2013), FAOSTAT data 2005, 2012
(http://faostat.fao.org/faostat/collections?version=ext&hasbulk=0&subset=fisheries)
20
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Figure 1. Central-northern region of Chile
showing the three main areas for scallop
aquaculture (Lohrmann, 2009).
References
Abarca, A., 2001. Scallop hatcheries of Argopecten purpuratus (Lamarck, 1819) in Chile. A
survey of the present situation. Book of abstracts 13th International Pectinid Workshop,
Coquimbo, Chile. pp. 52–53.
Akaboshi, S., Illanes, J.E., 1983. Estudio experimental sobre la captación, precultivo, y cultivo
en ambiente natural de Chlamys (Argopecten) purpurata, Lamarck 1819, en Bahía Tongoy, IV
Región, Coquimbo. Proceedings Symposium Internacional: Avances y Perspectivas de la
Acuacultura en Chile. Coquimbo, Chile. pp. 233–254.
Lohrmann, K., 2009. How healthy are cultivated scallops (Argopecten purpuratus) from Chile? A
histopathological survey. Revista de Biología Marina y Oceanografía 44(1): 35-47
Vega, G., 1996. Principales dificultades en la producción industrial de semilla de ostión del norte
en ambiente controlado. En: Seminario: Desarrollo y perspectivas de la pectinicultura en Chile.
74 p.
Web 1 http://www.proyectosperuanos.com/conchas_de_abanico.html
Correspondence email: [email protected]
21
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Progress in aquaculture of the scallop Nodipecten nodosus in Brazil: challenges
and prospective
Guilherme S. Rupp
EPAGRI, Center for Development of Aquaculture and Fisheries, Rod. Admar Gonzaga 1347,
Florianópolis, SC, Brasil, 88034-901.
Initial studies aiming to establish scallop aquaculture in Brazil started in early 1990’s.
During this period, researches have been conducted in various aspects of scallop life
cycle, environmental influences and culture techniques so that a significant scope of
knowledge is currently available to permit the use of proper culture practices to grow N.
nodosus in Brazil. The initial constraint of unstable and limited hatchery spat production
is no longer a restriction for scallop aquaculture. At present two hatcheries, one in Rio
de Janeiro and one in Santa Catarina are able to produce more spat than the current
demand for their respective states. Efforts to establish commercial culture have been
carried out in the states of Santa Catarina, Rio de Janeiro and more recently in São
Paulo. Official production statistics are not available for Rio de Janeiro and São Paulo,
however, information from local growers associations indicate that production of whole
scallops reached about 21 tons in Rio de Janeiro and 4 tons in São Paulo in 2013. In
Santa Catarina, scallop production increased around 500% from 2012 to 2013 (Figure
1), reaching 28 tons.
Ton.
30
20
10
0
2006
2007
2008
2009
2010
2011
2012
2013
Figure 1. Production of the scallop Nodipecten nodosus in Santa Catarina, Brazil, from 2006 to 2013(1).
22
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallop production is still small and mainly carried out on artisanal scale without the use
of mechanization. In Santa Catarina there were 17 scallop growers in 2013. Most of them
are oyster or mussel producers growing scallops as an additional source of income. After
9 to 12 months post-nursery scallop size ranges from 7 to 8 cm yielding an adductor
muscle mean weight of 8 to 12 g. In Rio de Janeiro, scallop farming is mainly a part-time
activity in coastal fishing communities in the region of Angra dos Reis and farms are
maintained as a subsistence operation characterized by household ownership(2).
Current prices range from US$10-16/dozen when marketed locally or sent to gourmet
restaurants in Rio de Janeiro and São Paulo where prices may reach up to US$
25/dozen.
The culture of Nodipecten nodosus has a tremendous potential for development in Brazil,
but certain constraints such as legal aspects for concession of marine leases, lack of
access to credit, limited domestic market and high production costs still have to be
overcome in order to increase production. An overview of the current situation,
challenges and future prospects will be detailed.
References
(1) Epagri. 2014. Síntese Anual da Agricultura Catarinense 2012-2013. p. 127-128.
(2) Abelin, P. 2013. Scallop farming as a subsistence activity in coastal fishing communities of
Brazil: Lessons and opportunities. In: Book of Abstracts. 19th International Pectinid Workshop.
p. 33.
Corresponding author: [email protected]
23
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallop Fisheries and Aquaculture in Mexico
César A. Ruiz-Verdugo1, Esteban Félix-Pico2, Ana Isabel Beltran-Lugo1, Volker Koch3,
Carlos Cáceres-Martínez1, Miguel Robles-Mungaray4.
1Departamento
de Ingeniería en Pesquerías, Universidad Autónoma de Baja California Sur Ap. Postal
19-B, La Paz, Baja California Sur, México, 23080; 2Centro Interdisciplinario de Ciencias Marinas, Av. IPN
s/n, Col. Playa Palo de Santa Rita. La Paz, Baja California Sur, México, 23000; 3Deutsche Gesellschaft
für Internationale Zusammenarbeit (GIZ), Carretera Transpeninsular Al Norte km 5Esquina Bahia
Ballenas Depto. 3 Fracc. Fidepaz, La Paz B.C.S. 23094; 4 Acuacultura Robles, Privada Quintana Roo #
4120, La Paz, Baja California Sur, México, 23080
In Mexico three scallop species are harvested commercially, the Pacific Calico Scallop
Argopecten ventricosus (Sowerby II, 1842), the lion’s paw scallop Nodipecten
subnodosus (Sowerby, 1835) and the concave scallop Euvola vogdesi (Arnold 1906).
Scallops are historically the most important bivalve fishery in Northwest Mexico, with a
maximum production of 32,000 t in 1989 (Fig. 1).
The principal fishing area of A. ventricosus is Magdalena Bay with the species
representing 99 % of the total scallops catch in Mexico during the first decade of the 21st
century. During 2010 to 2013, landings declined steadily until fisheries were closed in
2014. The causes of this decline have not yet been established but large oscillations in
scallop catch have occurred several times in the past decades (Fig. 1). The N.
subnodosus fishery increased steadily until 2009, when the population in Scammon´s
lagoon crashed. The cause is not clear but boring polychaetes appear to be at least part
of the cause. Up to date, the population has not recovered. The fishery production of E.
vogdesi has been low for almost two decades but one site in the Peninsula of Baja
California continues to provide a small production.
The probable causes of the collapse of scallop fisheries may include any of the following
factors (or a combination of several factors): overfishing, diseases or climatic variations.
Fishing activities have been very intense and poorly regulated, with intense poaching on
top of the legal catch quota/season. Several potential disease agents, such as Herpes
virus and Perkinsus sp have been reported in scallop fishing areas, but no direct link to
24
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
high mortality has been established as yet. The presence of exceptionally warm surface
waters in the Eastern Pacific in 2014 may have also have contributed to the population
decline, a pattern which has been observed during several ENOS events in previous
years.
Figure 1. Scallop landings per year in México.
Despite a large number of studies on aquaculture of all three species, no commercial
aquaculture operations have been established as yet. In the case of A. ventricosus
cultivation was unprofitable due to the low price of adductor muscle in the market, caused
by large fisheries production. Since 2012, studies are conducted to repopulate the natural
populations of the Ensenada de La Paz, applying the cultivation techniques for spat
production and spat culture. in the case of N. subnodosus spat production in the lab is
still ridden with problems, and the hatcheries do not have sufficient capacity to produce
commercial quantities of lion´s paw spat as they are committed to Pacific oyster spat
production. This paper presents an analysis on fisheries and aquaculture efforts in recent
years, and also on other important advances in scallop research.
Corresponding autor: [email protected].
25
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Economic assessment of Argopecten nucleus spat hatchery production to
support the development of scallop aquaculture in the Caribbean Basin
Diego Valderrama1, Luz A. Velasco2, Niver Quiroz2, Charles M. Adams1
1Food
and Resource Economics Department, University of Florida, Gainesville, FL, USA; 2Shellfish and
Microalgae Lab, University of Magdalena, Santa Marta, Colombia
Introduction
The culture of mollusk species has acquired great importance worldwide with production
increasing at a very rapid pace over the last 30 years. Although not much development
has taken place in the Caribbean Basin yet, interest in the scallop species Argopecten
nucleus and Nodipecten nodosus has recently emerged given their potential for
commercial aquaculture production. Fisheries for these two species failed to develop in
the region given the low densities of natural populations; however, captures of wild
juveniles in artificial collectors and seed production by public hatcheries recently led to
the establishment of farmed stocks in the Colombian Caribbean. Although preliminary
financial analyses suggest that the farming of scallops is commercially viable due to their
high selling price, factors such as barriers to technology transfer and the lack of
information on financial and marketing aspects stand as obstacles for the development
of an aquaculture industry in Colombia and the wider Caribbean. It is also clear that the
long-term viability of the industry will depend on the consistent supply of economicallypriced spat. In order to assess this potential, this study developed an economic model
for the hatchery production of Argopecten nucleus spat based on the results of
experimental trials conducted at the Shellfish and Microalgae Lab (SML) of the University
of Magdalena in Taganga (Santa Marta), Colombia.
Materials and Methods
The SML was built at the University of Magdalena’s facilities in Taganga in 2000 to
support basic research on the life cycles and culture requirements of scallops and the
microalgae used as feed for the scallops’ larval stages. Data on production parameters
26
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
and investment and operating costs were collected during 2010-2013 to develop an
economic model for the construction and operation of a 240-m2 hatchery with an annual
production capacity of 3.9 million spat. Standard investment feasibility indicators such as
Net Present Value (NPV) and Internal Rate of Return (IRR) were calculated to examine
the long-term viability of the proposed operation. Monte Carlo simulations were also
conducted to examine the impact of variability in critical production parameters such as
survival rates through larval stages. The planning horizon was assumed to be 10 years.
Results
Table 1 summarizes the results of the investment feasibility analysis. Assuming a selling
price per spat of COP 65 (USD 0.035) and an annual production of 3.9 million spat, the
estimated 10-year NPV was COP 82 million (12% discount rate), corresponding to an
IRR of 19.2%.
Discussion
Although the baseline scenario led to positive investment indicators, it must be clarified
that a 115% increase in current production levels achieved at the SML (1.8 million spat
per year) was assumed. It is clear that the hatchery remains operational due to a number
of subsidies from the state and national governments. The analysis revealed that
production could realistically be increased to 3.9 million spat without a substantial
increase in variable costs by making better use of the existing infrastructure and available
lab space. Another important finding was the high energy costs incurred by the operation.
The cost of a kWh in the Caribbean Colombian is around USD 0.17, substantially higher
than what is paid in other countries of Latin America and in the U.S. (USD 0.12 on
average). Assuming a cost of USD 0.10/kW, the IRR increases to 31%.
The profitability of the operation is also highly sensitive to assumptions on survival rates
at critical larval stages. Monte Carlo simulations revealed that incorporating variability of
survival rates in the analysis (rather than assuming average survival rates as done in the
baseline scenario) leads to a 42 percent probability of not achieving a positive NPV over
the 10-year horizon of the project. Modest improvements in survival rates would lead to
substantial declines in risk levels.
27
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Conclusion
The analysis revealed that hatchery production of Argopecten nucleus spat is a
potentially profitable commercial proposition in Colombia and the wider Caribbean
provided a number of production and economic assumptions are met. For an operation
of this type, a minimum production of 3.8 million spat per year is needed to ensure
economic viability. High energy costs, which are typical of the region, were found to have
a sizable impact on total production costs. Despite these disadvantages, the SML
hatchery in Colombia offers a blueprint for scallop hatcheries in the wider Caribbean as
coastal communities affected by the decline of artisanal fisheries throughout the region
continue their search for alternative marine-based enterprises.
Table 1. Abridged investment feasibility analysis for a 240-m2 Argopecten nucleus hatchery in Santa
Marta, Colombia. Currency shown is Colombian Pesos (COP).
Item
Year 0
…
Year 1
Year 2
3,900,000
3,900,000
3,900,000
65
65
65
253,500,000
253,500,000
253,500,000
111,326,583
111,326,583
111,326,583
44,820,000
44,820,000
44,820,000
5,108,000
5,108,000
5,108,000
Total production cost
161,254,583
161,254,583
161,254,583
Pre-tax net revenue
92,245,417
92,245,417
92,245,417
Production (number of spat)
Price per spat (COP)
Gross revenue
Year 10
Production costs
Variable costs (exc. labor)
Labor
Fixed
costs
(exc.
depreciation)
Taxes
30,440,988
Net revenue (after tax)
92,245,417
Investment
NPV
(12%)
92,245,417
61,804,429
-330,241,537
–
COP
82,084,144
IRR – 19.3%
28
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Growth and survival of the Caribbean scallops Argopecten nucleus and
Nodipecten nodosus cultured under different depths and nets change
frequencies
Luz Adriana Velasco, Judith Barros
Laboratorio de Moluscos y Microalgas, Universidad del Magdalena. Carrera 2 No 18-27 Taganga, Santa
Marta, Colombia. [email protected]
Introduction
The Caribbean scallops, Argopecten nucleus and Nodipecten nodosus, are currently
farmed in Taganga, Santa Marta (Colombia). With the purpose to increase its culture
yield, the effect of depth and nets change frequency on their survival and growth was
assessed.
Materials and methods
Using hatchery-produced juveniles of A. nucleus and N. nodosus, three culture depths
(6, 9 and 12 m) and 2 nets change frequencies (monthly and bimonthly) were tested by
triplicated. Animals were kept in pearl nets at densities of 30% of bottom coverage, under
suspended culture. Monthly, animals from each replica were counted and its length shell
was individually measured. Also, environmental parameters such as temperature,
salinity, seston concentration, number and size of predators, and amount of fouling in the
nets were monitored.
Results
Juveniles of A. nucleus that began with a shell length of 11.3 mm reached between 37.5
and 42.2 mm after 7 months of culture, while the final cumulative survival was between
29 and 48% (Fig. 1). There was a significant influence of the culture depth and nets
change frequency on the A. nucleus growth, but not on its cumulative survival. Higher
growth values were verified in animals cultured at 12 m with monthly nets changes.
29
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Juveniles of N. nodosus that started with a shell length of 8.5 mm reached among 45.6
and 49.6 mm after 6 months of culture, while the final cumulative survival was between
2 and 24% (Fig. 2). It was found that growth was significantly affected by depth and nets
change frequency, while the cumulative survival was significantly influenced only by
depth. Lower growth values were recorded in animals cultured at 12 m with monthly
change of nets, while higher values of survival were obtained in animals with bimonthly
culture nets changes.
Discussion
The higher growth values of A. nucleus cultured at 12 m and the lower values of N.
nodosus obtained at this depth can be related with the greater values of seston
concentration registered there. Apparently, the high concentration of seston provided
more food and energy for growth in A. nucleus, whereas in N. nodosus caused gills
saturation and a consequent increase in energy losses by pseudofeces production.
The greater growth values of A. nucleus under monthly change of culture nets conditions
can be associated with the lower amount of fouling found over the nets under these
treatments. Fouling can restrict the availability of food and oxygen for bivalves inside the
pearl nets. Conversely, the lack of effect of nets change frequency on the growth of N.
nodosus suggest that the resource constraint imposed by fouling did not limits its energy
acquisition for growth.
The lack of influence of nets change frequency on the survival of A. nucleus should be
attributed to its high predation resistance. On the other hand, the higher survival of N.
nodosus under bimonthly culture nets changes suggests high predation resistance too
and also a high sensitiveness to the monthly manipulation which could cause its stress
mortality.
Conclusion
In order to obtain higher scallop yield in Taganga, we recommend to farm A. nucleus at
12 m deep and make monthly nets changes, whereas it is better to grow N. nodosus at
6 or 9 m with bimonthly nets changes.
30
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
6m
Argopecten nucleus
Monthly net changes
40
40
35
30
25
20
35
30
25
20
15
15
10
10
50
100
150
200
250
100
80
60
40
20
0
0
50
100
150
200
250
0
Accumulated survival (%)
0
Accumulated survival (%)
12 m
Bimonthly net changes
45
Lenght (mm)
Lenght (mm)
45
9m
50
100
150
200
250
50
100
150
200
250
100
80
60
40
20
0
0
Culture time (d)
Culture time (d)
Fig. 1. Growth in shell length and accumulated survival of Argopecten nucleus under different depths and
nets change frequencies.
Nodipecten nodosus
6m
Monthly net changes
60
Lenght (mm)
Lenght (mm)
40
30
20
50
40
30
20
10
10
0
0
30
60
90
120
150
180
210
100
80
60
40
20
0
0
30
60
90
120
150
Culture time (d)
180
210
Accumulated survival (%)
0
Accumulated survival (%)
12 m
Bimonthly net changes
60
50
9m
0
30
60
90
120
150
180
210
0
30
60
90
120
150
180
210
100
80
60
40
20
0
Culture time (d)
Fig. 1. Growth in shell length and accumulated survival of Nodipecten nodosus under different depths and
nets change frequencies.
31
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Field testing of novel antifouling coatings for the aquaculture industry –
preliminary results
Sandra E. Shumway1, Alex Walsh2, Stephan G. Bullard3, Steven W. Fisher4
1Department
of Marine Sciences, University of Connecticut, 1080 Shennecossett Road, Groton, CT
06340 USA; 2Netminder, LLC, 25 Research Road, East Falmouth, MA 02536 USA; 3University of
Hartford, Hillyer College, 200 Bloomfield Avenue, West Hartford, CT 0611; 4Netminder, LLC, 1155
Youngsford Road, Gladwyne, PA 19035
Biofouling is ubiquitous in the marine environment and inarguably one of the most serious
problems facing aquaculture. Considerable research has been carried out during the
past several decades to develop means of prevention and control of biofouling, yet most
methods are designed to remove fouling once established. Currently no cost-effective
means of eradication or control are available.
Novel non-toxic antifouling coating
technology developed for the aquaculture industry is presented which relies on the
photoactive generation of hydrogen peroxide to reduce the settlement of biofouling
organisms rather than the leaching of pesticides. Traditional antifouling paints used for
boat hulls are based on copper, and often contain booster biocides. Copper is toxic to
shellfish, impairs olfactory organs of anadromous fish, and persists in the environment.
Photoactive release coatings provide a viable solution for minimizing biofouling on
aquaculture netting, cages, and tanks. Biofouling resistance of photoactive coatings was
evaluated at the University of Connecticut (Avery Point) for 12 months. Biofouling weight
and percent coverage of test surfaces is reported. Antifouling efficacy of photoactive
coatings on nylon and HDPE netting, PVC-coated cage used for shellfish and finfish
aquaculture, and experimental panels was determined over 6 months in several
geographic regions globally through a controlled series of biofouling settlement assays.
Toxicity of coating materials to scallop and oyster larvae at concentrations of 0.02, 0.2
and 2.0 ppm is reported and compared to the toxicity of copper-based antifouling paint.
Results from antifouling resistance testing demonstrate the promise of photoactive
coatings for biofouling control.
32
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Evaluation of post-mortem changes in the adductor muscle length of Pacific
calico scallop (Argopecten ventricosus) as a simple method to assess the onset
of rigor mortis in scallops
Ana I. Beltrán-Lugo, Angel Álvarez-Almaraz, Dayana Méndez-Espinosa, Jesus A.
Leyva-Flores, César A. Ruiz-Verdugo
Universidad Autónoma de Baja California Sur (UABCS). La Paz, Baja California Sur, México.
Introduction
The Pacific calico scallop is the most commercially important species of scallops in
Mexico. The edible quality of its adductor muscle (the main edible portion) at the time of
catching or harvest progressively changes depending mainly on the handling and storage
temperatures. One of the most important post-mortem changes is the development of
rigor mortis, which consist in the irreversible contractile process that onset soon after
death. Rigor mortis in fish is well documented (Huss, 1995) however literature on rigor
mortis in scallops is sparse (Jiménez-Ruiz et al., 2013). Furthermore a direct, simple
method to measure the post-mortem contractile process in the adductor muscle has not
been reported. The aim of this study was to analyse the adductor muscle shortening by
a direct and simple method. Additionally this study aimed to compare the rigor mortis
onset from the adductor muscle of Pacific calico scallop obtained under different times
of shucking after harvest.
Material and Methods
The organisms used for this experiment were provided for a shellfish farm located at
Magdalena Bay on the Pacific coast of Baja California Peninsula, México. A total of 288
scallops of similar shell height (49.3 ± 3.17 mm) were sampled in September 2014. The
organisms were divided into three lots, and were subject to three different treatments of
elapsed time from harvest to shucking: 0, 4, and 48 h. After shucking scallop meats
obtained were washed, packed in plastic bags, and maintained in ice storage during 72
h. To assess the onset of rigor mortis, changes in the maximum lengths (along the
orientation of the muscle fiber) of the complete muscles were measured with an
33
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
electronic digital caliper and results reported as muscle shortening (%). Additionally,
parameters related to the rigor mortis process of adductor muscles such as pH, and
textures were also analyzed. Analyzes were performed at 0, 8, 16, 24, 36, 48 and 72 h
during the iced storage. One-way ANOVA was employed to test the effect of the season
on physiological indices and on quality parameters measured at a significance level of
95%. A Tukey’s test was applied when significant differences (P<0.05) were found.
Result and discussion
Significant differences (P < 0.05) in the evolution of rigor mortis were observed between
the adductor muscles obtained at different elapsed times from harvest to shucking. Fig.
1 shows the results of muscle shortening, hardness and flesh pH. As can be observed,
muscles from organism shucked immediately (0 h) after harvest presented the maximum
shrinkage around sixteen hours, while for that of four and 48 h, was presented around
eight hours.
Fig. 1 Changes in the muscle shortening, hardness and pH in adductor muscles of Pacific calico scallop,
obtained at 0, 4 or 48 hours elapsed from harvest to shucking and stored in ice. Data points are the mean
of n=12. Means with different capital letters within the same time elapsed to shucking means statistical
differences among different storage times. Means with different lower case letters within the same time
storage means statistical differences among different elapsed time to shucking.
34
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The evolution of rigor mortis observed in this work is similar to that observed to
Nodipecten subnodosus in a study based on measurement realized in the sarcomere
lengths (Jiménez-Ruiz et al., 2013), however the maximum extent of rigor mortis was
less (approximately 6 %) that the observed in this study with Pacific calico scallop
(superior to 12 %). On the other hand we also observe differences on hardness and the
ultimate pH among treatments. We conclude that the determination of the muscle
shortening as obtained in this work is a fast, inexpensive and simple method that can be
used as an index of rigor mortis in scallop adductor muscles.
References
Jiménez-Ruiz, E.I., Ocaño-Higuera, V.M., Maeda Martínez, A.N., Romero-Varela, A., MárquezRíos, E., Muhlia-Almazán, A., Castillo-Yáñez, F. 2013. Effect of seasonality and storage
temperature on rigor mortis in the adductor muscle of lion´s paw scallop Nodipecten subnodosus.
Aquaculture 388, 35-41.
Huss, H.H. 1995. Quality and quality changes in fresh fish. FAO. Fisheries Technical Paper. 348.
Food and Agriculture Organization of the United Nations. Rome. Italy. 202 pp.
Takeda, T., Akino, M., Imamura, T., Nozawa, H. 2010. Effects of low-temperature preservation
of Japanese scallop adductor muscle on rigor mortis. Nippon Suisan Gakkaishi 76(5), 946-952.
Corresponding autor: [email protected]
35
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
FISHERIES
36
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
An overview of New Zealand scallop fisheries in 2015
James Williams1, Julie Hills2, Vidette McGregor3
1National
Institute of Water and Atmospheric Research (NIWA), Auckland, New Zealand; 2Ministry for
Primary Industries (MPI), Wellington, New Zealand; 3National Institute of Water and Atmospheric
Research (NIWA), Wellington, New Zealand
This talk provides an overview of the situation in 2015 for New Zealand’s scallop (Pecten
novaezelandiae) fisheries. It covers the current status of the stocks, industry initiatives to
monitor fine scale CPUE, the development of an ATLANTIS ecosystem model for Golden
and Tasman Bays, and focuses on new work to improve assessment methods.
Scallops (Pecten novaezelandiae) have supported highly valued fisheries in New
Zealand for over 50 years. In general, fisheries in the three commercially fished stocks
(SCA 1, Northland; SCA CS, Coromandel; and SCA 7, Southern) are assessed using a
Current Annual Yield (CAY) approach applied at the broad spatial scale of each stock.
The CAY, the potential sustainable catch for one year, is calculated by applying an
instantaneous rate of fishing mortality (F0.1, the target reference point, derived from yieldper-recruit modelling) to an estimate of the recruited biomass (derived from a survey and
estimated dredge efficiency).
In some of the most important fishery areas, scallop populations have declined to low
levels, despite catches having been at or below the level of the CAY. Estimates of F0.1
are considered to be too high, and their application in calculating CAY using stock-wide
estimates of absolute biomass ignores spatial structure for productivity and may result in
overfishing of the most productive areas, reducing productivity in the long-term. Limit
reference points are set at 20% (soft limit) and 10% (hard limit) of virgin biomass (B0),
although there is no currently used method for assessing stock status in relation to these
limits.
In other areas, scallops continue to support annual fishing and new, previously unknown,
scallop beds have been discovered and are being exploited. Alongside the CAY-based
37
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
approach, SCA CS fishers have been implementing a CPUE-limit rule approach, closing
fine-scale reporting areas when catch rates fall below a threshold level.
To improve the assessment methods for New Zealand scallop fisheries, NIWA are
conducting a new research project from 2015 to 2016, based on the approach used in
stock assessments of sea scallop (Placopecten magellanicus) populations in the
Maritimes region, Canada. The project work involves three aspects: 1) grooming of
research survey and fishery catch and effort data; 2) analysis of groomed data to produce
standardised indices of abundance and catch-per-unit-effort (CPUE) at fine spatial
scales; and 3) applying a delay-difference model to model the population dynamics of
scallops at appropriate spatial scales.
Among other outputs, the work aims to produce time series of biomass and exploitation
rates that will be used to determine appropriate reference points, and estimate stock
status in relation to those reference points. Patterns and trends in population
(abundance, biomass, recruitment) and fishery (catch, effort, CPUE, exploitation rate)
parameters will be explored to investigate potential target and limit reference points. For
each area, exploitation rates that avoid biomass declines and instead promote rebuilding
of the stocks will be investigated. This project aims to provide improved scientific advice
that will better inform management decisions regarding the sustainable utilisation of New
Zealand’s scallop resources.
Corresponding authors:
James Williams: [email protected]
Julie Hills: [email protected]
Vidette McGregor: [email protected]
38
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Management and research responses to collapses in three scallop stocks in
Western Australia following an extreme marine heat wave event
Mervi Kangas, Nick Caputi, Errol Sporer and Ainslie Denham
Department of Fisheries Western Australia, Western Australian Marine and Research Laboratories,
PO Box 20, North Beach, WA 6920
Introduction
The saucer scallop Amusium balloti is fished commercially in four main regions of
Western Australia with the highest production historically from the two key fisheries in
Shark Bay and the Abrolhos Islands. The combined annual value of the two fisheries is
between AUD$5 and $20 million and these industries generate much needed
employment within regional Western Australia. These fisheries exhibit high natural
variability in annual landings and some correlation with the strength of the Leeuwin
Current which is influenced by ENSO events have been identified in the past (Joll and
Caputi 1995).
Methods and Results
Annual fishery-independent surveys are conducted in both fisheries which provide an
index of abundance (and size composition) of scallops and this is used to predict the
likely landings the following season using the significant correlation between the
abundance of recruits (0+) and residuals (1+) and the following year’s catch (Joll and
Caputi 1995; Caputi et al. 2014). These data allow the annual management
arrangements (and industry harvesting strategies) to be tailored to the expected
abundance of scallops available and allow industry the opportunity to optimise the value
of the landed product.
There has been an extremely low level of scallop abundance, both recruit (0+) and
residual (1+) scallops in both fisheries since mid/late 2011 through to 2014. Poor
recruitment of scallops has been observed, combined with poor survival of juveniles and
39
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
adults between 2011 and 2014, which is mainly attributed to poor environmental
conditions. A marine heat wave event (where mean water temperatures were up to 3 to
4 degrees Celsius higher than average) during the summer 2010/11 (Pearce and Feng
2013) and above-average water temperatures during the next two summers is believed
to have contributed to the present low stock abundance in Shark Bay and Abrolhos
Islands.
The three consecutive years of poor recruitment resulted in the scallop breeding stock
overall being at record-low levels which may compromise a significant stock recovery.
This prompted examination of ways to increase the breeding stock biomass in both
fisheries to augment successful recruitment. A pilot project, jointly funded by the
Department and industry, commenced in late 2014 to consider options for assisted
recovery of these extremely low spawning stocks. This project will be examining options
of deployment of hatchery-reared individuals and/or translocation of scallops from other
known sources of Amusium balloti within Western Australia.
Discussion
The abundance of scallop stocks in the Abrolhos Islands is well below anything
experienced in the history of that fishery. In Shark Bay, scallop abundance in the northern
grounds is also well below historical levels with only Denham Sound (a separate stock
with little connectivity with northern grounds) having a low level of recruitment which has
been observed previously but which took around 5 years to recover. In addition sub-lethal
impacts on scallops include slow growth (stunted scallops) and small meat size (adductor
muscle) compared to normal meat size for a particular shell size which has also
contributed to much poorer overall production levels in 2011. From 2012 both fisheries
have remained closed to scallop fishing due to the very low stock abundance. In Shark
Bay, where a fleet of 18 prawn (shrimp) trawlers also operate with some overlap of fishing
grounds for both prawns and scallops, a spatial closure of an area containing the highest
number of scallops in Denham Sound (albeit lower abundance than historical levels) was
implemented in 2012 and 2013 as a precautionary measure to minimise discard mortality
and trawlinduced sub-lethal impacts of scallops. There is a glimmer of light for scallop
fishers in November 2014 survey with some evidence of scallop recruitment in Denham
Sound as water temperatures returned to within normal ranges. The available catch will
40
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
allow conservative fishing during the latter part of 2015 in this part of the fishery however,
northern Shark Bay and the Abrolhos Islands still remain closed to any take of scallops
despite a small improvement in recruitment.
Conclusion
The unprecedented collapse of two major scallop fisheries in Western Australia, primarily
attributed to a marine heat-wave event, were identified quickly based on the survey
abundance of the 0+ recruits. This allowed early management intervention with complete
closures of these fisheries for three years to protect remaining scallops (breeding stock)
and avoided any fishing on the poor year-classes. It also saved industry the cost of
gearing up their fleet when there wasn’t any commercial quantities available.
Examination of additional measures to improve breeding stocks to assist stock recovery
are also being evaluated.
References
Caputi, N. S. de Lestang, A. Hart, M. Kangas, D. Johnston, J. Penn (2014). Catch Predictions in
stock assessment and management of invertebrate fisheries using pre-recruit abundance; case
studies from Western Australia. Reviews in Fisheries Science 22:1, 36-54
Joll, L.M. and N. Caputi (1995). Environmental influences on recruitment in the saucer scallop
(Amusium balloti) fishery of Shark Bay, Western Australia. ICES Marine Science Symposia
(Actes du symposium) 199: 47-53.
Pearce, A. F. and M. Feng (2013). The rise and fall of the “marine heat wave” off Western
Australia
during
the
summer
of
2010/2011.
J.
Mar.
Syst.
111-112:
139-156.
http://dx.doi.org/10.1016/j.jmarsys.2012.10.009
Corresponding author: [email protected]
41
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Discard mortality of sea scallops following capture and handling in the
commercial dredge fishery
Ryan J. Knotek1, David B. Rudders2, James A. Sulikowski1, John W. Mandleman3,
Hugues P. Benoit4, Kenneth J. Goldman5
1University
of New England, Marine Science Center,, Biddeford, ME USA; 2Virginia Institute of Marine
Science, College of William and Mary, Gloucester Point, VA USA; 3John H. Prescott Marine Laboratory,
New England Aquarium, Boston MA USA; 4Gulf Fisheries Centre, Fisheries and Oceans Canada,
Moncton, NB, Canada; 5Alaska Department of Fish and Game, Division of Commercial Fisheries, Homer,
AK USA
Introduction
The mortality associated with discarded animals can represent a significant source of
removals. This unobserved component of fishing mortality can go unaccounted for and
present difficulties in accurately assessing the stock and setting appropriate annual
fishery specifications.
Estimating discard mortality rates has traditionally been
challenging. Much of this challenge stems from selecting an appropriate experimental
design that tests the myriad of factors that can potentially affect survival during the
capture and handling process. Understanding this complex process can provide not only
an empirical basis for the inclusion of discard mortality rates in stock assessments, but
also form the foundation for the implementation of best management practices.
The sea scallop, Placopecten magellanicus, supports the most valuable single species
commercial fishery in the U.S. northwest Atlantic Ocean, with an estimated ex-vessel
value of over 467 million U.S. dollars in the 2013 fishing year. However, despite the
importance of the fishery, post-release mortality of discarded scallops has received little
recent attention. The current stock assessment includes a discard mortality estimate
(20%) based on a single mark-and-recapture study, and others studies with different
biotic and abiotic conditions. As such, the primary objective of the current study was to
assess the short-term survival of commercially captured scallops, with estimates
conditional on shell damage and reflex impairment indices. The secondary objective was
to evaluate the various factors that could affect survival, utilizing a flow through
refrigerated deck tank system and laboratory experiments.
42
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Materials and Methods
For the field portion of this study, trials were conducted aboard commercial scallop
vessels in the northwest Atlantic Ocean under normal fishing conditions and practices.
The suite of covariates attributed to the capture process that potentially influence scallop
discard mortality were recorded for each sample (tow duration, bottom and surface
seawater temperature, air temperature, and catch volume). Covariates from the handling
process that had the potential to influence discard mortality were also investigated. After
the catch was deposited on deck and culled by fishermen, the remaining discards were
subsampled. To account for variations in air exposure, scallops were sampled within a
range of 0 to 30 min. Individuals were then evaluated based on shell damage and reflex
impairment indices, and either released overboard, or kept in on-deck holding tanks to
assess mortality for up to 120 hours.
For the laboratory portion of this study, we endeavored to establish a control for the field
based portion of the study as well as conduct experiments to investigate the effects of
acute aerial exposure and elevated air temperatures on survival.
For these trials,
scallops were collected by divers off the coastal waters of Eastport, Maine USA and
subsequently exposed to varying air exposure treatments (0 to 30 min) during
approximated summer conditions. Scallops were also subject to elevated seawater
temperatures (i.e. surface conditions) pre and post air exposure, with exposure times
determined by dredge haul back rates and size specific scallop sinking rates. Scallops
were monitored at increasing time intervals over seven days to assess mortality.
Results
322 tows have been conducted over three research trips for the field portion of the study
during the 2014 fishing year. A total of 5,417 scallops were evaluated and scored with
shell and reflex indices. To quantify mortality rates associated with these indices, 889
scallops were retained in the on-deck tank system for up to 120 hours. A preliminary
analysis using Kaplan-Meier survival curves has revealed that scallop mortality increases
as a function of increasing shell damage (Figure 1A) and increasing reflex impairment
(e.g. unimpaired: 12.6% mortality; completely impaired: 89.2%).
43
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
100 scallops were subject to varying amounts of air exposure and elevated water
temperatures in the laboratory study. Based on a preliminary analysis using a fixedeffects logistic regression, air exposure and size of the animal were found to be
significant predictors of mortality (Figure 1B), such that the probability of mortality
increases for smaller sized scallops subjected to increased durations of air exposure.
B
1.00
0.8
1.0
A
Predicted probability
0.6
0.4
Survival probability
0.75
Air exposure
1
0.50
2
3
Shell Damage
0.0
0.2
Undamaged
Broken Margin
Cracked
Punctured
Broken Hinge
Crushed
0.25
0.00
0
20
40
60
80
100
4
Holding time (hrs)
6
8
10
12
Shell height (cm)
Figure 1. Left (A): Kaplan-Meier survival curves for scallops with varying degrees of shell damage. Crosses
represent censored observations. Right (B): Predicted probability of mortality as function of shell height
and air exposure group (1= 0-5 min; 2= 15 min; 3= 30 min). Shaded areas represent 95% confidence
intervals.
Discussion and conclusion
Preliminary findings suggest that the mortality of discarded scallops is increased for
smaller animals exposed to air for extended durations at high summer temperatures.
These results corroborates concerns related to the possibility of high mortality rates of
discarded scallops after being kept at the surface (on deck or in surface water) for long
durations in summer conditions. In addition, the probability of mortality is increased for
animals suffering shell damage during the capture and handling process. This project is
currently ongoing, with an additional five research trips planned for the upcoming 2015
fishing year.
44
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallop area management: Strategies to maximize yield
William D. DuPaul, David B. Rudders
Virginia Institute of Marine Science, College of William and Mary, Gloucester Point, VA., USA
Introduction
Spatial management has been an effective component of the overall management for
the Atlantic sea scallop, Placopecten magellanicus by closing or limiting harvest for
specific periods of time to allow newly recruited two-year old scallops to grow for an
additional three years thus resulting in gains in yield. Currently there are six spatial
management areas, three on Georges Bank that serve as both scallop rotational harvest
and groundfish mortality control areas and three in the mid-Atlantic region that serve as
scallop rotational harvest areas only. Over the past several years these areas have
accounted for approximately 40 percent of the total landings averaging 50 million pounds
per year.
The success of the spatial management strategy is dependent upon a
mechanism to define and monitor area specific occurrences of above average
recruitment and the ability to enforce fishing activity within the area. There are four types
of spatial management areas: 1) open areas where fishing can occur without quotas or
trip limits, 2) areas that are closed to protect small scallops and the annual increase in
biomass is greater than 30 percent, 3) areas that are closed to protect habitat and/or
groundfish and 4) areas that were previously closed that are open for restricted scallop
harvest and are commonly referred to as access areas. Overarching the obvious gains
in yield by closing areas to harvest for a period of time there are important and
complimentary strategies to further maximize yield. These measures include approaches
to understand the spatial and seasonal characteristics of the fishery resource, stabilizing
fishing mortality by controlling harvest removals and by employing gear modifications to
optimize size selectivity.
Discussion
Temporal aspects relating to the biological characteristics of the resource can be an
important consideration for optimizing yields. It has been well documented that seasonal
45
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
shifts in the shell height:meat weight relationships can fluctuate on the order of 20 percent
pre and post spawning. Periods of optimal yield and shell growth have been identified
for both the Georges Bank and mid-Atlantic scallop resource areas. Focusing harvest
during periods of optimum yields in scallop management areas with fixed quotas and trip
limits can be an effective tool to control both fishing and discard mortality. Unfortunately,
recent regulatory proposals to focus harvesting in the scallop management areas in the
mid-Atlantic and on Georges Bank during the period of greatest yield were not
successful. The fishing industry felt that such proposals were too controlling and fraught
with uncertainty. Future efforts may be more successful as new approaches for area
management are realized.
Controlling fishing effort in scallop area management is critical to both the sustainability
of the resource and to achieve the management objective of maximizing yield. Generally,
effort or harvest removals are controlled through quotas or trip limits based on the
exploitable biomass in the area and the duration of the management action, usually one
or two years. Controlling fishing effort by quotas or trip limits can only be accomplished
with accurate surveys to assess the status of the resource. Presently, the Atlantic sea
scallop resource areas are surveyed by multiple survey methodologies including optical
and traditional dredge surveys conducted by academic research institutions and
government agencies. In 2013, three independent surveys covered 16 resource areas
on Georges Bank and the mid-Atlantic region, found the resource abundance to be
113,242 metric tons with a standard error of less than 10 percent.
Fishing gear modifications offer a critical strategy to maximize yield. Matching size
selectivity characteristics of the gear with the size and growth of the population in the
management area is essential. This allows the targeting of scallops of an optimal size
and yield and reduces the discarding and incidental mortality of smaller less valuable
scallops. Initially, scallop dredges were constructed with 3 inch (76 mm) rings which
resulted in the harvest of 80 mm scallops. During the 1990’s, scallop dredge rings were
progressively increased to 3.25 inches (81 mm) and then to 3.5 inches (87 mm). Scallop
dredges constructed with 4 inch (101 mm) rings with an absolute selectivity of 115 mm
were tested for use in scallop management access areas which matched the desired size
and age for harvest. This gear modification has proved to be a valuable asset for
46
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
enhancing the size and yield of scallops outside management areas and is now used
throughout the fishery.
Conclusion
The concept of scallop area management enhanced with appropriate fishing gear,
accurate resource surveys, an understanding of the seasonal biological cycles of the
resource and a robust industry/academia/government cooperative research program
have resulted in a most successful scallop management program. From 2003 to 3013
scallop landings averaged 50 million pounds with ex-vessel values ranging from 400 to
550 million dollars; landings in 1999 were 20 million pounds. Overall fishing mortality in
1991 was over f=1.2 and presently ranges from f=0.2 to 0.3. The scallop resource is not
overfished and overfishing is not occurring. Sixty four percent of the scallops landed in
2003 were 20 to 30 meats per pound (22 to 66 meats per kg) by 2012 the percentage
dropped to 6 percent. In 2012 over 20 percent of scallops landed were 10 meats per
pound or less (less than 22 meats per kg). The abundance of large scallops has opened
new and high valued domestic and export markets. The average revenue per full time
vessel increased from $518,000 in 1994 to $1,728,000 in 2011.
With record revenues the scallop fishing fleet continues to invest heavily in vessel
modifications and upgrades to increase fishing capacity and efficiency. The productivity
of the scallop resource is at or near it’s limit given recent recruitment patterns and
concurrently, fishing effort and harvest removals will need to be stabilized. Any increases
in maximizing yield will be challenging and will require a sustained cooperative research
effort to fine tune present management approaches.
Corresponding autor: [email protected]
47
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Abundance, automated image detection, crowd sourcing, and incidental mortality
estimates of Sea Scallops (Placopecten Megallanicus) from AUV based surveys
Arthur Trembanis1, Doug Miller1, Danielle Ferraro1, Dave Rudders2, Justin Walker3, and
Prasanna Kannappan4
1School
of Marine Science and Policy University of Delaware, USA; 2Virginia Institute of Marine Science,
USA; 3Department of Geological Sciences University of Delaware, USA; 4Department of Mechanical
Engineering University of Delaware, USA
Introduction
The sea scallop (Placopecten magellanicus) fishery in the US EEZ of the northwest
Atlantic Ocean has been, and still is, one of the most valuable fisheries in the United
States. Since 2011, we have been developing and conducting AUV based photographic
surveys of sea scallops with four major research foci areas: 1) determination of
abundance; 2) development of automated imagery detection algorithms; 3) utilization of
crowd sourcing for image analysis and public outreach; and 4) assessment of incidental
mortality in scallops left behind from dredge activity. Here we lay out the results of our
detailed observational studies using a combination of an AUV platform and commercial
dredge.
48
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The fishery stock is monitored by both dredged based surveys and towed and drop
camera imagery surveys. Dredging is performed by dragging either a commercial or
survey dredge across the seafloor. The dredge catches a fraction (depending on the
efficiency of the dredge and bed type) of the epibenthic organisms that are not small
enough to pass through the metal rings of the dredge.
Material and Methods
This study utilized an autonomous underwater vehicle (AUV) to photograph a total of 257
km of seafloor at a constant height of 2 m above the seafloor at 22 dive sites within the
Mid-Atlantic Bight. Over 203,000 images were manually analyzed by trained observers
using photogrammetric software developed for this project. Scallop abundance and shell
heights were logged for each image. A total of 15,252 scallops were observed, sized,
and had a corresponding biomass calculated.
Results
Digitally measured shell heights were found to agree with co-located commercial dredge
scallop specimen measurements. The inshore scallop grounds near Long Island have a
density of 0.077 scallops per m2, while the inshore grounds of New Jersey and Delaware
had a density of 0.012 scallops per m2. Random subsampling simulations were
conducted on the image dataset to examine the effect of subsampling on the density
49
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
estimation. A 40,000 image random subsampling of the total image database (20%)
produced a scallop density of +/-5% the reported final densities based on analyzing 100%
of the photos. Recruit sized scallops (<70 mm) accounted for less than 1.0% of the
population, while harvestable scallops (>101.6 mm) accounted for 66.2%. Seasonal
fishing effort was estimated at each dive site by digitizing commercial dredge scars from
900 kHz side-scan sonar data obtained simultaneously with bottom images. Dredging
efforts determined in this manner were positively correlated (r = 0.61, P = 0.006) with the
skewness of the shell height distribution of the inhabitant sea scallops.
Discussion and Conclusion
The AUV makes an effective and productive platform for sea scallop stock assessment.
The ability to quickly deploy and retrieve the AUV from a support vessel allows for the
rapid acquisition of photographic and acoustic data that can be analyzed at sea during
transit time or after the completion of the cruise. Imaging the seafloor is a noninvasive
way to survey the scallop population, while also gathering data about the small scale
spatial structuring of the population, seafloor texture and morphology, and water quality
data. One of the major challenges of this and other optical imagery studies is the shear
abundance of images. Many studies randomly subset a small portion of the images, in
our study through the use of trained observers, citizen scientists, and efficient computer
software we were able to analyze 100% of the seafloor images and thus illustrate the
trade off between sub-sampling and the abundance estimates thus providing a useful
guide and basis for image subsampling. Our results indicate that at least 20% of a large
image dataset (>200,000 images) should be analyzed in order to be within a 10% window
of the abundance value from analyzing all of the images.
50
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Temporal changes in shell height-to-meat weight relationships of the sea scallop
(Placopecten magellanicus) in the Maritimes region Canada in relation to
environmental conditions
Jessica A. Sameoto, Stephen J. Smith and Leslie Nasmith
Department of Fisheries and Oceans, Bedford Institute of Oceanography, 1 Challenger Drive, Dartmouth,
Nova Scotia, Canada B2Y 4A2
Shell height-to-meat weight relationships play an important role in both the fishery and
stock assessment of sea scallop (Placopecten magellanicus) populations in the
Maritimes region, Canada. Outside of major recruitment events, annual variations in
growth underlie major fluctuations in catch rate and yield in scallop populations. In the
Maritimes region, Fisheries and Oceans Canada (DFO) manages sea scallop fisheries
using a number of tools including total allowable catch quotas, which are measured in
meat weight. DFO also conducts annual research surveys to monitor changes in
population numbers and biomass. During these surveys, detailed sampling of shell height
and meat weight of the adductor muscle is conducted from individual sea scallops from
a range of sizes and depths. These data are used to convert shell heights into biomass,
to calculate growth rates, and to model forecasts of biomass for future years. From the
survey, inter-annual variability in meat weight has been observed to change by as much
as 30% for a 100 mm shell height scallop. These inter-annual fluctuations can have
important consequences on the level of sustainable catch. For this study, we examine
yearly trends in scallop shell height-to-meat weight relationships using generalized linear
mixed models from the scallop beds near Grand Manan Island in the Bay of Fundy, Gulf
of Maine. We relate these yearly variations in meat weight to environmental data
collected as part of the Atlantic Zone Monitoring Program to better understand potential
influencing variables and discuss our findings in the context of providing advice for
fisheries management.
51
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Fishing for data: Stock status and predator (fishing vessel) response in the Isle
of Man queen scallop fishery
Isobel Bloor1, Sam Dignan1, Lee Murray1 and Michel Kaiser1
1Fisheries
and Conservation Science Group, Bangor University, Bangor, Gwynedd, LL57 2DG
Introduction
A fishery for queen scallops (Aequipecten opercularis), has been prosecuted in and
around the Isle of Man’s territorial sea since the 1950s and is the second most valuable
fishery to the Manx economy. Whilst queen scallops were until recently almost entirely
targeted by dredges, there has been an increasing tendency towards the use of more
environmentally friendly otter trawls by both Manx and UK vessels. A key aspect of
ensuring the sustainability of this fishery (and a requirement of the Marine Stewardship
Council certification process) is that management responds to stock status and that the
impact of the fishery on the seabed remains limited. Following the 2014 stock
assessment a decline in stock status was reported and management intervention
occurred rapidly with emergency management measures (closed areas, limited total
allowable catch (TAC), daily bag limits) introduced for the 2014 fishing season. Additional
reporting requirements were also put in place for all active vessels, requiring them to
carry and operate global positioning system (GPS) loggers (recording at 30 second
intervals) and to complete and submit daily catch returns (reporting tow by tow
information such as time fished and landings). This dataset has provided an
unprecedented resolution of data on fishing activity and behaviour of this fleet which has
allowed the response of fishermen (as predators) to queen scallop stock status and catch
rates around the Isle of Man to be explored at a fine-scale resolution.
Material and methods
The main aim of this research was to assess the response of fishermen, in terms of
fishing patterns, to changes in queen scallop stock status and catch per unit effort
(CPUE) and to quantify any associated impact on the seabed in order to advise longterm sustainable management priorities for the fishery.
52
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Queen scallop distribution and abundance data were taken from fishery independent
surveys that have been conducted twice a year (spring and autumn; before and after the
peak queen scallop fishing times) from 1992 to 2014 at up to 40 survey stations spread
across the main queen scallop fishing grounds. This dataset contains information on size
(shell height), biomass, density and spatial distribution of queen scallops within the
territorial sea. Data on stock status were taken from the annual stock assessment
undertaken for this species, the outputs of which include estimates of median biomass
that can be used to underpin fisheries management. Fine-scale resolution spatial
landings data were collected for the duration of the fishing season (2 nd July – 2nd October
2014) from the entire fleet using GPS loggers and daily catch returns. In addition, largerscale resolution data were collected, as is standard practice for all the IOM scallop
fisheries, from vessel monitoring system (VMS) data (2 hour ping intervals) and logbooks
(daily landings). GPS and VMS data were spatially joined to catch data from individual
tows and daily catches respectively to allow landings data to be spatially resolved and
standardised CPUE calculated.
Results
Queen scallop abundance increased sharply in the Isle of Man’s territorial sea between
2007 and 2010. This increase, combined with market demand, led to increased fishing
effort and landings with a peak of around 15,500t in 2011. However, from 2011 onwards
total biomass has declined following continued periods of high landings despite
decreases in estimated biomass. The median population biomass (approximately 5000t)
is now estimated to be at its lowest level since scientific surveys began in 1992 (Bloor et
al., 2013).
CPUE, calculated from both fine and large-scale spatially resolved landings data and
standardised using GAMs, was used to assess whether catch rates varied across the
open season (e.g. with regards to the number of days that the season had been open)
and/or among the main fishing grounds and investigate the response of individual fishing
vessel activity to these changes. Preliminary analysis indicates that despite areas of
known high queen scallop abundance within the territorial sea (indicated by both fisheries
dependent and independent data) the majority of fishing activity (time spent fishing at 1
to 4 knots) often occurred within areas of known low abundance and CPUE. These
53
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
counterintuitive patterns of fishing activity and behaviour from individual fishing vessels
were further explored and the associated impacts on the seabed quantified.
Discussion and conclusions
This presentation will discuss the response of fishermen to queen scallops densities and
consider the outcome of these responses in terms of the impact on the seabed and
population status. By using fishing vessels to collect high resolution spatial and catch
data we can significantly improve the quality of data obtained from the industry and move
towards the use of fishing vessels as robust scientific sampling tools. The results of this
study should assist in the planning and implementation of the long-term, sustainable
management strategy for this species to ensure the future of the Manx queen scallop
fishery.
References
Bloor, I.S.M., Murray, L.G., Dignan, S.P. and Kaiser, M.J. (2014). The Isle of Man Aequipecten
opercularis stock assessment 2014/2015. Bangor University Fisheries and Conservation Report
No. 37.
54
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Assessing the sustainability of a scallop dredge fishery: population structure &
habitat impacts
Claire L. Catherall1, Natalie Hold1, Lee G. Murray1, Ewen Bell2, Michel J. Kaiser1
1Bangor
University; 2CEFAS
Pecten maximus is the third most valuable species in UK fisheries, worth over US$90
mill p.a. to the economy. The fishery in the English Channel, within ICES Areas VIID and
VIIE (c. 90,000 km2), produces around 40 % of those landings. Scallop are a non-quota
species and the fishery is data poor as a result of limited research prioritisation and
funding. Changes in management and quota for other species have resulted in a
considerable increase in effort and landings of king scallops in the last decade. Hence,
there are clear that data gaps that need to be addressed to ensure the king scallop fishery
in the English Channel is sustainable in the long-term. Research was initially driven by
the aspiration of the UK scallop industry for a more sustainable fishery, as demonstrated
by other Marine Stewardship Council certified scallop dredge fisheries (e.g. north-eastern
Atlantic; Shetland Isles). To inform the development of appropriate and sustainable
management for the fishery, our research has focussed on two major questions:
- What is the biological structure of the scallop population on which management
boundaries should be based?
- What consideration needs to be given to the environmental impacts of the fishery in
relation to sustainable management?
A population genetics study was carried out on scallop tissue samples from 9 locations
in the English Channel as well as sites from Ireland, Scotland and Norway. Nine
previously developed microsatellite markers were used to assess the degree of
connectivity between populations. Results indicate that current management boundaries
do not align with reproductively independent stocks. We demonstrate that around the
UK, larval connectivity is limited at localised spatial scales in some areas, while at the
55
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
other end of the spectrum a degree of connectivity between populations is evident over
extensive distances, driven largely by major oceanographic characteristics.
Environmental data, such as seabed temperature (range and inter-annual variation);
surface chlorophyll-a concentration, depth and sediment type, were used to characterise
traditional scallop fishing grounds in the English Channel and account for the
environmental variation occurring across the fishery. Fishing intensity for the previous 3
years was calculated using Vessel Monitoring System (VMS) data and sample sites were
selected to cover a gradient of fishing intensities (2 - 93 hours of activity). A
comprehensive habitat survey was subsequently undertaken to quantify the biological
communities present at the selected sites. We found that the communities associated
with traditional dredge fishing grounds in the English Channel are maintained in a
permanently altered state, dominated by species resilient to disturbance. This is due to
the timescale (40+ years) at which the commercial dredge fishery has operated. Hence,
it is not possible to detect changes in the habitat across a gradient of recent fishing
activity, given the cyclical nature of harvesting. Recovery of sandy gravelly habitats such
as these is estimated at 3-8+ years; however scallop beds in the English Channel are
fished on a more frequent basis. A significant negative relationship was found between
natural physical disturbance (tidal bed shear stress) and species richness, diversity and
composition. This indicates that within the boundaries of the commercial fishery, natural
disturbance has an over-arching effect on species diversity and composition. As the
habitat exists in its current state, fishing activity has no significant impact on the
composition of the communities within the spatial extent of the fishery. This indicates that
on grounds previously fished, limiting fishing activity will be of little benefit to the
ecosystem, whereas prolonged removal of fishing activity would be more likely to result
in the system approaching a recovered state. Other scallop dredge fisheries around the
world have demonstrated that targeted management, underpinned by robust science,
can result in a sustainable, profitable fishery. As a result of this new evidence we are
able to provide tangible management recommendations for this valuable fishery.
56
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Estimation of sustainable yield for King scallops (Pecten maximus) stocks in the
Normand-Breton Gulf (Western English Channel)
Eric FOUCHER, Joël VIGNEAU and Juliette ALEMANY
Ifremer, Station de Port-en-Bessin, Avenue du Général de Gaulle 14520 Port-en-Bessin, France
Introduction
King scallop (Pecten maximus) is the first species, in tonnage and in value, harvested in
the South-Eastern part of the Western Channel (ICES subdivision VIIe) called Golfe
Normand-Breton (GNB). The Golfe Normand-Breton was one of the 6 case studies of
the VALMER project (Valuing Ecosystem services in the Western Channel), co-funded
by the InterReg IVa Channel program through the European Regional Development
Fund. This project aimed to evaluate how improved marine ecosystem services
assessment can support effective and informed marine management and planning.
Within the VALMER project and the GNB case study, we assumed the evaluation of the
main fisheries production as global food production. The sustainable yield estimated for
the main species were translated into landings value for the economical valuation of the
ecosystem service. The challenge was to evaluate a sustainable yield for King scallop
(Pecten maximus) when analytical model could not be used by lack of data. In the GNB,
only the very inshore King scallop fishery in the Bay of Saint-Brieuc is closely monitored,
through a direct assessment survey run by Ifremer. The stock is not included in the
extensive list of stocks to monitor in the EU Data Collection Framework, thus leading to
no biological information collected in routine. To overcome this impediment, we propose
a Data Limited approach to estimate a sustainable yield.
Material and methods
Methods for evaluating stocks with limited information started to be used in 2012 in ICES
as a basis for advice. Stocks were categorized depending on data availability and quality
and for those stocks where only a reliable long time series of landings was available, the
Depletion-corrected average catch model (DCAC, McCall 2009) was used to provide
57
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
insights on sustainable yield. The DCAC model, from the NOAA Fisheries Toolbox,
considers the average catch over a long term period, and a user-defined stock depletion
factor equivalent to a one-time reduction in stock biomass. The simple formula is an
extension of the potential yield formula, and provides useful estimates of sustainable
yield. Assumptions have to be made on natural mortality rate (M), target ratio of FMSY to
M and depletion rate.
The condition for using DCAC on the GNB King scallop was to build the longest possible
time-series, combining all possible sources. Several runs have been done to explore the
sensitivity of the outputs to the parameters assumptions, and to derive a confidence
interval.
Results
The King scallop fishery started in 1962 in the Bay of Saint-Brieuc and has gradually
expanded all over the GNB. The time-series has been built using data from local fish
market auction, local administration and Eurostat databases. The new French official
database (combination of data from declarative forms, auction markets and VMS) has
been used for the most recent years (2000 – today). The different DCAC runs lead to a
sustainable yield average of 5672 tons, with a 95% confidence interval between 4670t
and 6322t (Fig. 1).
Figure 1: King scallops landings in the GNB area, from 1962 to today.
58
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Discussion and conclusion
The conditions to use the DCAC model could be met for GNB King scallop, since this
species is considered a long-lived species with a life duration exceeding ten years, and
because the time series of landings could be considered reliable and discarding not
significant. Despite a comprehensive set of local management rules (limitation of fishing
days and hours, numerus clausus for vessels, regulation of fishing gears, TAC), only 3 4 cohorts are dominating the exploited population of the GNB King scallop stock. In this
situation, the yearly recruitment, which is strongly dependent on climatic conditions, is
mostly driving the annual fishing opportunities and thus the landings. During the start of
the time series until 1975, a situation of open access fishery without any management
lead to an overfishing situation, followed unsurprisingly by a strong decline of the
landings. The long recovery of the stock until recent years is probably the result of the
implementation of binding management rules and, more recently, a succession of good
recruitments.
The value given by the DCAC model could be considered, on a long time period, as a
good proxy for a sustainable yield for King scallop. This result, together with results for
the other main exploited species, has been used by economists to value food production
in the Golfe Normand-Breton.
References
MacCall, A.D. 2009. Depletion-corrected average catch: a simple formula for estimating
sustainable yields in data-poor situations. ICES Journal of marine Science, 66: 2267-2271.
59
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS I
60
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Updating homeobox genes in bivalve molluscs
M. Luz Pérez-Parallé, Antonio J. Pazos and José L. Sánchez.
Laboratorio de Biología Molecular y del Desarrollo. Departamento de Bioquímica y Biología Molecular.
Instituto de Acuicultura. Universidad de Santiago de Compostela.
Introduction
Homeobox genes are involved in body-plan formation and in the regulation of many
developmental processes. To study the connection between the modification of the
development and the evolution of the molluscan body plan, it would be essential to obtain
information on the genes that regulate the development of bivalves. The evolutionary
history of Hox, ParaHox, EHGbox and NK homeobox gene families is crucial to
understand the evolution of bilaterian body plans and phylogeny.
Materials and Methods
Specimens of five species belonging to different Bivalvia families were used: the black
scallop Mimachlamys varia (Pectinidae), the mussel Mytilus galloprovincialis (Mytilidae),
the flat oyster Ostrea edulis (Ostreidae), the razor clam Solen marginatus (Solenidae)
and the clam Venerupis pullastra (Veneridae). Genomic DNA isolation, PCR cloning and
sequencing of homeobox products were performed as previously described in PérezParallé et al. (2005) and Mesías-Gansbiller et al. (2012).
We collected amino acid sequences that encode homeobox genes of 15 bivalves: C.
gigas, C. virginica, E. ensis, M. varia, M. galloprovincialis, O. edulis, P. yessoensis, P.
maximus, P. fucata, P. magellanicus, R. philippinarum, S. marginatus, T. tantilla, V.
pullastra and Y. eightsi. The homeobox sequences isolated in this study were aligned to
the related known homeodomains of Bivalvia by Clustal Omega. For the phylogenetic
analyses we used the neighbour-joining, the maximum parsimony and the maximum
likelihood methods which were performed using the MEGA5 package.
61
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Results and Discussion
In the present study we identified 22 homeobox gene fragments from M. varia, M.
galloprovincialis, O. edulis, S. marginatus and V. pullastra and then we compared our
homeodomain sequences with those available from other bivalve molluscs. We identified
homologues from eight distinct Hox classes: lab and PG-2 genes from the anterior class,
PG-3 class genes, and PG-4, PG-5, Lox5, Hox7 and Lox4 genes from the central class.
Cdx genes from the ParaHox family were also isolated from four bivalve species.
According to De Rosa et al. (1999), the number of Hox genes increased from the
protostome ancestor (8 genes) to the lophotrochozoan ancestor (at least 10 genes).
Different studies are consistent with the presence of a single Hox cluster in Mollusca (de
Rosa et al. 1999, Carpintero et al. 2004; Canapa et al. 2005, Pérez-Parallé et al. 2005,
Iijima et al. 2006, Zhang et al. 2012). Adding the new sequences to the sequences
already known in bivalves, all Hox genes identified in other lophotrochozoan are also
present in bivalve molluscs. Bivalves possess orthologues to two anterior genes (Hox1
and Hox2), a PG-3 gene, six central class genes (PG-4, PG-5, Lox5, Hox7, Lox4, Lox2)
and two posterior class genes. Thus we proposed that the Hox cluster in bivalve molluscs
has probably 11 genes. This agrees with the results obtained in L. gigantea (ThomasChollier et al. 2010) and P. maximus and P. fucata (Canapa et al. 2005, Takeuchi et al.
2012). However, in Patella vulgata, only six Hox genes were described (de Rosa et al.,
1999). In C. gigas (Zhang et al. 2012) and P. yessoensis (Iijima et al. 2006) 9-10 Hox
genes have been identified. Lophotrochozoans are characterized by the presence of
Lox2, Lox4, Lox5, Post-1 and Post-2. These genes are a clue to help assign an organism
to one particular bilaterian clade. All these genes have been identified in bivalves
(Canapa et al. 2005; Iijima et al. 2006; Zhang et al. 2012; Pérez-Parallé et al. 2014).
Regarding the ParaHox cluster in Bivalvia, the three ParaHox genes (Gsh, Xlox and Cdx)
have only been identified in the oyster P. fucata (Takeuchi et al. 2012). In other bivalve
species (Canapa et al. 2005, Iijima et al. 2006, Pérez-Parallé et al. 2014) only Xlox and/or
Cdx genes have been identified. The presence of only two or a single ParaHox gene
could be due to secondary losses related to the modifications in body structure that took
place in the more evolved molluscan classes.
62
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The EHGbox cluster includes engrailed (en), motor neuron restricted (Mnx) and
gastrulation brain homeobox (Gbx). Two EHGbox genes are well conserved in bivalves
(en and Gbx), however there are no data about the presence of the third one (Mnx).
Moreover, the homeodomain of the Gbx family is highly conserved among five distinct
families of bivalve molluscs (Solenidae, Pectinidae, Veneridae, Ostreidae and Mytilidae).
The NK cluster in the last common ancestor to protostomes and deuterostomes probably
contained a cluster of nine Nk genes. The NK gene cluster has not been examined in
depth in Mollusca. In C. gigas, six Nk genes (Nk3, Tlx, Nk6, Hmx, Lbx and Nk2) have
been identified (Zhang et al. 2012). Moreover, the conservation of Tlx and Nk2 genes in
different bivalve species has also been confirmed (Mesías-Gansbiller et al. 2013, Morino
et al. 2013).
The list of the genes reported here and the investigation of their genetics activities will
contribute to our understanding of the morphological diversification within the phylum and
will facilitate elucidation of how the novel body plan of bivalves was established.
63
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
References
Canapa et al. 2005. Gene 348: 83-88.
Carpintero et al. 2004. J. Biochem. Mol. Biol. 37: 625-628.
De Rosa et al. 1999. Nature 399, 772-776.
Iijima et al. 2006. J. Mollusc. Stud. 72: 259-266.
Mesías-Gansbiller et al. 2012. Mol. Phylogenet. Evol. 63: 213-217.
Mesías-Gansbiller et al. 2013. Can J. Zool. 91: 275-280.
Morino et al. 2013. Zool. Sci. 30: 851-857.
Pérez-Parallé et al. 2005. Biochem. Genet. 43 (7/8), 417-424.
Pérez-Parallé et al. 2014. Mol. Phylogenet. Evol. (submitted)
Thomas-Chollier et al. 2010. BMC Evol. Biol. 10:73.
Takeuchi et al. 2012. DNA Res. 19:117-130.
Zhang et al. 2012. Nature 490: 49-54.
64
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
QTL mapping and GWAS for orange muscle in Yesso scallop (Patinopecten
yessoensis, Jay, 1857)
Xiaoli Hu, Xue Li, Shi Wang, Zhenmin Bao
Key Laboratory of Marine Genetics and Breeding (MGB), Ministry of Education, College
of Marine Life Sciences, Ocean University of China, Qingdao, 266003, China.
Introduction
Carotenoids are vitamin A precursor and powerful antioxidants which are synthesized by
plants, algae, bacteria, and fungi, but obtained only through diets in animals. Among the
carotenoids identified in nature, over one third of them are of marine origin, while
currently, researches on carotenoids absorption in marine species are limited. In bivalve,
whose adductor muscle was normally white, bright orange color produced by carotenoids
accumulation
in
adductor
muscle
was
reported
in
Yesso
scallops
(Patinopectenyessoensis, Jay, 1857). Then a new variety named “Haida golden” scallop
which was characterized by carotenoids enrichment was developed, providing a fine
model for studies on the mechanism underlying carotenoids accumulation in bivalve.
Material and Methods
The F1 families were generated by hybridizing “Haida golden” scallop and normal Yesso
scallop, and then F2 families were constructed. The parents and offsprings of three F2
families were genotyped using 2b-RAD methods for high-density linkage map
construction, QTL mapping and genome-wide association analysis (GWAS). Genome
re-sequencing and GWAS were performed in populations of normal and “Haida golden”
scallops. Real-time reverse transcription PCR (qRT-PCR) was used to detect the
expression levels of the candidate genes located in the QTL region in normal scallops
and “Haida golden” scallops.
Results and Discussion
The high-density linkage map contained 6012 SNP markers, and the average interval
between markers was 0.39 cM. Only one QTL for muscle color was detected, which was
65
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
further confirmed by GWAS. Genome re-sequencing and GWAS in populations of the
two kinds of scallops detected a more narrow region in the QTL found. Gene differentially
expressed between the two kinds of scallops was detected in this region by qRT-PCR
analysis.
Conclusion
We constructed a high-density linkage map for Yesso scallop, and identified a gene might
be responsible for carotenoids content difference between normal and “Haida golden”
scallops. Our results will benefit our understanding of carotenoid accumulation and
metabolism in marine bivalve and also the breeding of carotenoid-enriched scallop.
66
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Diets rich in polyunsaturated fatty acids improve the capacity to respond to
stress through HSP70 synthesis in the scallop Argopecten purpuratus after
reproductive investment
Katherina Brokordt and Hernán Perez
Laboratory of Marine Physiology and Genetics (FIGEMA), Centro de Estudios Avanzados en Zonas
Áridas (CEAZA), Universidad Católica del Norte, Larrondo 1281, Coquimbo, Chile.
Introduction
Reproductive investment reduces the energy available for other biological processes that
occur simultaneously. We have recently observed that after gonad maturation
Argopecten purpuratus scallops decrease their capacity to respond to environmental
stresses, as a reduction in their capacity to induce HSP70 when exposed to high
temperatures and hypoxia, compared with immature scallops. This was associated with
a decrease in the mitochondria metabolic capacity, as shown by a reduction in citrate
synthase enzymatic activity. By the other hand, it has been observed that mitochondria
membranes with high levels of polyunsaturated fatty acids (PUFAs) increase their
efficiency in ATP production. Therefore, the aim of this study was to evaluate the effect
of feeding A. purpuratus during their reproductive conditioning, with diets with high and
low contents of PUFAs, upon stress response capacity evaluated through gene
expression and protein abundance of the HSP70.
Material and Methods
Scallops (n=60) were fed during reproductive conditioning with diets based on
microalgae with high and low content of docosahexanoic (DHA) and eicosapentanoic
acid (EPA) (i.e., high and low PUFA diet, respectively) during 4 weeks. A control group
(n=30) was maintained in natural condition during the same period of reproductive
conditioning (i.e., “natural” diet). When the broodstock reached the mature reproductive
stage, 15 scallops of each treatment were stressed by exposing them to an increase of
6 ºC (i.e., 22 ºC) during 6 h, and the other 15 scallops from each treatment were kept at
normal temperature (18 ºC). The relative transcription of hsp70 mRNA was assessed by
67
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
real time qPCR and the levels of HSP70 proteins were quantified from the total proteins
by ELISA.
Results and Discussion
After reproductive conditioning with the 3 diets, scallops fed the high PUFA diet, showed
~1.5-2.0 fold more PUFAs in their tissues than scallop fed the low PUFA diet; and ~0.51.5 fold more than those fed in the natural environment. After exposure to heat stress,
hsp70 mRNA levels showed a significant increase in scallops fed with each diet treatment
or maintained in the natural environment. However, scallops fed with the diet high in
PUFAs and with the “natural” diet showed significantly higher hsp70 mRNA levels than
those fed with the diet low in PUFAs, after stress exposure. By contrast, the relative
HSP70 protein levels significantly increased only in the scallop fed with the diet high in
PUFAs, after stress exposure. Stress response is energetically costly, HSP70 at both
transcription and protein synthesis need a high amount of energy in terms of ATP that
can be limited by the energy demand of other important biological process like
reproduction. However, our results showed that a diet with high levels of PUFAs
compensated this energetic compromise.
20
a
30
25
a
20
15
b
b
10
b
5
a
18
c
Relative level of HSP70
Relative level of hsp70 mRNA
35
16
14
b
12
10
8
bc
c
c
c
6
4
2
0
0
Unstressed Stressed
Unstressed Stressed
Unstressed Stressed
Unstressed Stressed
Unstressed Stressed
Unstressed Stressed
Natural diet
High PUFA diet
Low PUFA diet
Natural diet
High PUFA diet
Low PUFA diet
Figure 1. Hsp70 mRNA and HSP70 protein relative levels in thermally stressed and not stressed scallop
Argopecten purpuratus, previously fed in the natural environment (natural diet) and with a mix of
microalgae high and low in PUFA content (high and low PUFA diets, respectively) (n = 15 per condition).
The diets were applied during the reproductive conditioning during 4 weeks.
Study financed by FONDECYT 3110101
Corresponding author: [email protected]
68
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Genome sequencing of yesso scallop Patinopecten yessoensis: generating a
genomic resource for understanding the biology and evolution of pectinidae
(mollusca: bivalvia)
Zhenmin Bao and Shi Wang
Key Laboratory of Marine Genetics and Breeding, College of Marine Life Sciences, Ocean University of
China, 5 Yushan Road, Qingdao 266003, China
Introduction
The Pectinidae family, also known as scallops, consists of more than 300 extant species
worldwide. Scallops represent one of the oldest and evolutionarily most successful
groups of invertebrates and many of them are also important fishery and aquaculture
species. However, this group of animals remains unexplored in terms of genome
sequencing. Here we report the whole genome sequencing and assembly for Yesso
scallop (Patinopecten yessoensis, Jay 1857), one of the most important maricultural
shellfish in the north of China.
Material and Methods
DNA libraries and cDNA libraries were all sequenced based on the Illumina’s HiSeq2000
platform. Due to the high genome heterozygosity (~1.3%), an efficient assembly
approach was adopted based on the idea of assembling the two haploid genomes
separately.
Results and Discussion
Totally, 467 Gb sequencing data (equivalent to ~338x genome coverage) were produced
from sequencing. The length of final assembly is 1.03 Gb, consisting of 139,690 contigs
(N50 = 38.5 Kb) and 76,886 scaffolds (N50 = 845 Kb) and covering genomic and genic
regions with 98% and 97%, respectively. A high-resolution genetic linkage map was
simultaneously constructed to assist chromosome assembly. The Yesso scallop genome
presumably contained 24,566 genes with an average CDS (coding DNA sequence)
69
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
length of 1,509 bp. Repetitive sequences are dominant in the genome with transposable
elements and tandem repeats accounting for 39% of the whole genome.
Conclusion
Here we present the high-quality scallop genome sequence for Patinopecten yessoensis.
Our work represents the first effort toward fully decoding of a scallop genome and will
pave the way for profound understanding the biology and evolution of Pectinidae.
70
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Image formation in the concave mirror eyes of scallops
Daniel Speiser
Department of Biological Sciences, University of South Carolina, 715 Sumter Street, Columbia, SC
29208 United States
Compared to other bivalves, scallops have complex sense organs and well-developed
nervous systems. In nearly all scallops, the mantle margins of the valves bear dozens to
hundreds of image-forming eyes. These eyes differ from those of other animals in a
number of ways. They are among the very few eyes in the natural world that use a
concave mirror to form focused images. They also contain two separate retinas that differ
from each other morphologically and physiologically. The distal retina contains ciliary
photoreceptors that depolarize in response to the removal of light (off-receptors); in
contrast, the proximal retina consists of rhabdomeric photoreceptors that depolarize in
response to increased amounts of light (on-receptors). Along with their complex eyes,
scallops demonstrate a wide range of visually-influenced behaviours. Here, I will discuss
the progress that we have made towards understanding the unique optics of the scallop
eye. I will also present and defend our hypothesis that scallops use their two retinas for
separate sets of tasks: the distal retinas for tasks that require the detection of movement
(e.g. the detection of predators) and their proximal retinas for tasks that require
information about relative levels of light intensity (e.g. the detection of preferred types of
habitat). Finally, I will argue that scallops are a promising system in which to study the
co-evolution of eyes and centralized nervous systems.
71
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
MARINE PROTECTED AREAS
72
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
KEYNOTE: Marine protected areas and the US sea scallop fishery
Kevin D. E. Stokesbury
School for Marine Science and Technology, University of Massachusetts Dartmouth, 200 Mill Road,
Fairhaven, Massachusetts, USA 02719; Phone: (508) 910-6373; Email: [email protected]
Introduction
Spatial management and the use of Marine Protected Areas, rather than providing
increased stability, creates a situation of dynamic imbalance and ballistic opportunity.
The sea scallop (Placopecten magellanicus) resource in the United States is an example
of this; experiencing unprecedented rebuilding over the past fifteen years. Factors
leading to the successful rebound of this resource include a revised spatial management
approach, investments in improved survey technologies, data-rich stock assessments,
favorable environmental conditions, and some luck. The spatial management approach
took advantage of large Marine Protected Areas combined with fishing effort reduction.
There is a continuing debate over the actual influence and effect of these protected
areas. Have the closed areas led to increased production? Have they restored the
habitat? Is it “better” for the scallop stock and the benthic habitat to be periodically
harvested in these areas or to leave them permanently closed? The US sea scallop
fishery provides a unique opportunity to explore these issues.
Materials and Methods
The SMAST video survey was developed cooperatively with scallop fishermen to provide
spatially explicit, accurate, precise, absolute estimates of scallop density and size
distributions (Stokesbury, 2002; Stokesbury et al., 2004). The SMAST video survey
deploys a video-quadrat sampling pyramid within a multistage centric systematic design
at stations on one of three grid resolutions (1.6, 2.3 and 5.6 km; Figure 1). Within each
quadrat, macroinvertebrates and fish are counted and standardized to individuals m -2,
and the substrate is identified (Stokesbury, 2002; Stokesbury et al., 2004; Carey and
Stokesbury, 2011).
The system is composed of a mobile video recording system
compatible with any scallop vessel wheelhouse layout, an electro-hydraulic winch and a
73
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
sampling pyramid. Since 1999, there have been 208 video cruises surveying Georges
Bank and the Mid-Atlantic (>1,000 days at sea), and since 2003 the SMAST survey has
covered the entire U.S. scallop resource, >60,000 km 2 (Stokesbury et al., 2004;
Stokesbury, 2012).
Results
In most years between 2003 and 2014 the US sea scallop resource consisted of about 8
billion individuals equaling a scallop meat biomass of 150,000 mt; averaging 78,000 mt
on Georges Bank and 72,000 mt in the Mid-Atlantic. In 2014, 20% of the Georges Bank
biomass was located in permanently closed areas, 49% in rotational areas and the
remainder in open areas; 70% of the Mid-Atlantic biomass was located in rotational
areas. The biomass of scallops in these areas have fluctuated, usually by 50% or less
between years, but occasionally increasing or decreasing significantly. Recruitment of
sea scallops seems to occur in two patterns, an annual recruitment between 20 and 35%
and occasional extreme recruitments. The most recent recruitment in 2014 was nine
times greater than the resource. Mass mortalities have occurred in several areas
reducing the density by 50% or more. Scallop predators, such as the sea star, can be
extremely abundant in closed areas and may be responsible for some of the observed
mass mortalities, while their absence may contribute to large recruitment events. In
diversity, distribution, and abundance of fish and invertebrate groups (representing over
50 species on Georges Bank), areas with rotational fishing and those that were closed
to fishing had similar patterns. Areas continually open to fishing had lower relative
presence and abundance than expected for all taxonomic groups except crabs, sponges
and flounders.
Discussion and Conclusion
There are pros, cons, and unknowns when implementing spatial management and
Marine Protected Areas. On the pro side, sea scallops are well suited to a rotational
management strategy; they are highly fecund, gonochoristic broadcast spawners with
pelagic larvae, annual mortality is relatively low, growth is fast, movement is limited,
abundances increases dramatically in favorable conditions, and they appear to be a key
species in a dynamic marine habitat providing structure for other animals (Caddy 1989,
Stokesbury & Himmelman 1996, Hart & Rago 2006, Harris & Stokesbury 2006,
74
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Stokesbury 2012). On the con side, sea scallops in closed areas are subject to mass
mortalities, possible crowding (limiting recruitment and growth), increased predator
densities, and increased frequency of disease. The greatest unknown is the stockrecruitment relationship, which hinders management. With advanced technology large
recruitment events have been identified and protected until they reach a harvestable size
in closed areas; but if continually fished severe discard mortality occurs (Stokesbury et
al 2011).
There is new information advancing our understanding of rotational
management and Marine Protected Areas but the use of these tools will continue to be
sharply debated as ideas and objectives differ with interest groups, all developing over
time.
References
Caddy, J.F. A perspective on the population dynamics and assessment of scallop fisheries, with
special reference to sea scallop, Placopecten magellanicus (Gmelin). In: Caddy JF (ed) Marine
invertebrate fisheries: their assessment and management. John Wiley & Sons, New-York p 559589 (1989).
Carey, J. D., & Stokesbury, K. D. E. An assessment of juvenile and adult sea scallop,
Placopecten magellanicus, distribution in the northwest Atlantic using high-resolution still
imagery. J. Shellfish Res. 30, 569-582 (2011).
Harris, B.P. & Stokesbury, K.D.E. Shell growth of sea scallops (Placopecten magellanicus) in the
southern and northern Great South Channel, USA. ICES J Mar Sci 63, 811-821(2006)
Hart, D. R, & Rago, P. J. Long-term dynamics of U.S. Atlantic sea scallop Placopecten
magellanicus populations. N. Am. J. Fish. Manag. 26, 490-501 (2006).
Stokesbury, K. D. E. Estimation of sea scallop abundance in closed areas of Georges Bank,
USA. Trans. Am. Fish. Soc. 131, 1081-1092 (2002).
Stokesbury, K. D. E. Stock Definition and Recruitment: Implications for the U.S. Sea Scallop
(Placopecten magellanicus) Fishery from 2003 to 2011. Rev. Fish. Sci. 20, 154-164 (2012).
Stokesbury, K.D.E & Himmelman, J. H. Experimental examination of movement of the giant
scallop, Placopecten magellanicus. Mar. Biol. 124, 651-660 (1996).
Stokesbury, K. D. E., Harris, B. P., Marino, M. C. II & Nogueira, J. I. Estimation of sea scallop
abundance using a video survey in off-shore US waters. J. Shellfish Res. 23, 33-40 (2004).
75
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Stokesbury, K. D. E., Carey, J. D., Harris, B. P. & O’Keefe, C. E. Incidental fishing mortality may
be responsible for the death of ten billion juvenile sea scallops in the mid-Atlantic. Mar. Ecol.
Prog. Ser. 425, 167-173 (2011).
Figure 1. The SMAST video survey sampling design, each dot represents a station with four quadrats
sampled per station. Scallop rotational areas; portions of these areas have been closed since 1994 and
portions are open to rotational fishing.
76
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Incorporating local knowledge into spatial management of the sea scallop
(Placopecten magellanicus) fishery in Maine, USA
Carla Guenther1 and Erin Owen2
1Penobscot
East Resource Center, Stonington, Maine USA; 2Husson University, Bangor, Maine USA
Introduction
The state of Maine implemented a 3-year rotational management plan for inshore beds
of the sea scallop, Placopecten magellanicus, beginning in 2012. The section of the
Maine coast using the rotational management strategy spans the largest area of Maine’s
inshore fishery and includes some of the most productive scallop grounds. Although
fishermen’s knowledge was taken into consideration in the design of the current rotational
management plan, ultimately the rotational areas established are roughly of equal size
and geographic placement and do not take into consideration the distribution of scallop
beds within an area (Fig. 1). Therefore, considerable concern exists among fishermen
that the both the spatial scale of the rotational areas and the temporal scale of rotation
(3 years) may not be a uniform fit for all rotational areas.
Study Area
Figure 2. Map of the rotational area management scheme for Zone 2. Each group of
colored areas will be open for fishing once every three years (Maine DMR 2012).
77
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Our research aims to document the spatial heterogeneity in distribution of scallop beds
within the rotational management areas in eastern Maine in order to more closely match
the size of the management area to that of the resource.
Maximizing the potential impact of spatial management strategies relies not only on
establishing connectivity patterns among management areas, but also on relating
sources and sinks to the rate of settlement, spatial distribution of fishing effort, and the
proportion of suitable fishery habitat within management areas (Botsford et al. 2008,
Kaplan et al. 2010). Aligning the scale of fishing effort and habitat distribution within
adaptive management areas potentially can double the economic value of a spatiallymanaged fishery (Costello et al. 2010).
Materials and Methods
We conducted semi-structured interviews with fishermen to identify the location of scallop
beds within the boundaries of the rotational management areas. Fishermen also
indicated beds that differed putatively in ecological and demographic characteristics
(habitat type or shell morphology). Only beds that were identified by a minimum of three
fishermen were included in the study. The location of beds within the rotational areas
were mapped and analyzed with respect to the spatial distribution of beds, habitat type,
and the proportion of fished bottom within each rotational area. The total area of scallop
beds within each rotational management area and the proportion of the rotational
management area that constitutes productive, fishable scallop bottom was calculated.
Based on the results from the interviews, fishermen will propose modified management
areas that more effectively distribute the scallop beds with respect to spatial and temporal
access. The current and proposed management areas will be compared with respect to
total area of scallop beds and descriptive statistics.
Results
The maps produced by this project will describe the spatial distribution of the state’s
scallop resource and aid in designing spatial management that best fits the scale of the
resource. Fishermen anecdotally describe the resource as patchy and, in some areas,
the patches are sparsely distributed. Closures that coincide with scallop patches will
ensure that when an area opens after having been closed, there will likely be scallops to
be fished, rather than opening an area that does not, and likely will not, have scallops.
78
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Additionally, closures that more closely align with the scale of the resource would allow
more flexibility in the rotation, such that communities will likely always have an
opportunity to fish productive scallop grounds within 15 miles from their home port.
Discussion
This research aims to increase the ability to match the scale of the resource to the spatial
rotational management scheme. Optimizing the scale of the rotational management
areas with respect to the spatial scale of the resource contributes to the goal of
maximizing the economic value of the fishery.
Conclusion
The benefits of this research project are fourfold: more effective management of the
resource, greater economic gain, achievement of fishermen’s social goals, and a long
term institutional structure that will assure continued involvement of fishermen in
monitoring and management.
References
Botsford, L.W., D.R. Brumbaugh, C. Grimes, J.G. Kellner, J. Largier, M.R. O’Farrell, S. Ralston,
E. Soulanille, and V. Wespestad. 2008. Connectivity, sustainability, and yield: bridging the gap
between conventional fisheries management and marine protected areas. Rev. Fish. Biol.
Fisheries (2009) 19:69–95.
Costello, C., A. Rassweiler, D. Siegel, G. DeLeo, F. Micheli, and A. Rosenberg. 2010. The value
of spatial information in MPA network design. Proc. Natl. Acad. Sci. 107: 18294–18299.
Kaplan, D.M, S. Planes, C. Fauvelot, T. Brochier, C. Lett, N. Bodin, F. Le Loc’h, Y. Tremblay,
and J.-Y. Georges. 2010. New tools for the spatial management of living marine resources.
Current Opinion in Environmental Sustainability 1: 1-6.
79
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The effect of small-scale closed areas on giant sea scallop populations in Maine
Caitlin Cleaver1; Suzanne Arnold2; Samuel Asci3; Skylar Bayer4; N. David Bethoney3;
Carla Guenther5; Ira Miller6; Erin Owen7; Kevin Stokesbury3; Richard Wahle4; Erik
Waterman7; James Wotton6
1Hurricane
Island Foundation; 2Island Institute; 3School for Marine Science and Technology, University of
Massachusetts Dartmouth; 4School of Marine Sciences, The University of Maine; 5Penobscot East
Resource Center; 2Husson University; 6Scallop Advisory Council; 7Commercial fisherman, South
Thomaston, ME
Introduction
Due to the success of groundfish closures in rebuilding giant sea scallop (Placopecten
magellanicus) populations in the US federal fishery, resource managers implemented a
rotational closure system to rebuild inshore sea scallop stocks in Maine state waters.
However, little is known about the effectiveness of the closures on resident P.
magellanicus populations. In October 2013, scallop harvesters, state managers, and
researchers implemented the industry-derived Lower Muscle Ridge Closed Area, a
three-year closure in western Penobscot Bay, Maine. Scallop harvesters hope to
understand the effect of a small-scale closed area in rebuilding inshore stocks. Project
objectives are twofold:
1) To determine the effectiveness of small-scale closures in rebuilding resident
scallop populations in the closure and in adjacent fished areas (i.e., does the
scallop population inside the closed area and in the adjacent control areas change
over the four year period?).
2) To develop a project approach and monitoring protocol that can be implemented
by the Maine scallop industry.
Material and Methods
To understand how small-scale closed areas influence P. magellanicus populations, we
monitored larval supply, adult density, abundance, and age and size distributions in two
80
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
small-scale closed areas in coastal Maine, the Lower Muscle Ridge Closed Area and the
Ocean Point Closed Area. The Ocean Point Closed Area near Boothbay Harbor, Maine
was monitored in 2014 as a comparative site with similar environmental conditions to the
Muscle Ridge Closed Area. We conducted dive surveys at depths of 10 – 20m, among
15 sites inside and adjacent to the Lower Muscle Ridge Closed Area and the Ocean Point
Closed Area. Divers surveyed one or two 50-m2 belt transects at each site. To determine
scallop abundance and density at depths > 20 m, we surveyed with drop cameras. Both
dive and drop camera surveys were performed from commercial fishing vessels. On all
dive surveys, we collected shell samples to age and measured the shell height of
individuals. We measured larval supply inside and outside of both closures with the
deployment and collection of spat bags after the scallop spawning season in 2013 and
2014.
Results
Baseline adult population survey data from 2013 show that population densities inside of
and adjacent to the Muscle Ridge Closed Area prior to the closure period are not
significantly different. The results from 2014 dive surveys will indicate if there is a
significant change in population density within the closure during the first year of closure.
We will also see if there is a difference of spat supplies and adult distributions between
the Ocean Point Closed Area, which has been closed since 2009, and the Lower Muscle
Ridge Closed Area within one year of the closure.
Discussion
The 2013 baseline data likely shows no significant difference in adult population density
inside and adjacent to the closure, because the Lower Muscle Ridge Closed Area had
just been implemented in October 2013. We expect to see an increase in adult population
density and abundance inside the closure when comparing 2013 to 2014; however, this
may not be the case if the closure is not appropriately located to match local scallop
population dynamics.
81
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Conclusion
Project findings will contribute to future management decisions for Maine’s scallop
fishery, particularly with regard to the Muscle Ridge and Ocean Point Closed Areas. By
monitoring two small-scale closures that are geographically distinct, results may
illuminate closure characteristics or scallop population dynamics, such as larval supply
or adult population density that can more effectively rebuild the resident scallop
population inside the closure. This project increases the state’s capacity to collect longterm data about scallop population dynamics and the harvesters involved in this project
see it as an opportunity to maintain the local scallop resource.
82
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Managing the Supply Side: Larval Dispersal from Rotating Closures in the
Atlantic Sea Scallop (Placopecten magellanicus) Fishery
Daphne Munroe1, Deborah R. Hart2*, Burton Shank2, Dale Haidvogel3, Zhiren Wang3,
Eric N. Powell4, John Klinck5, Eileen Hofmann5
1Haskin
2NMFS
Shellfish Research Laboratory, Rutgers University, 6959 Miller Ave. Port Norris, NJ 08349;
Northeast Fisheries Science Center 166 Water St., Woods Hole, MA, USA 02543; 3Institute of
Marine and Coastal Sciences, Rutgers University, New Brunswick, NJ; 4Gulf Coast Research Laboratory,
University of Southern Mississippi, 703 East Beach Drive Ocean Springs, MS 39564; 5Center for Coastal
Physical Oceanography, Department of Ocean, Earth and Atmospheric Sciences, 4111 Monarch Way,
3rd Floor, Old Dominion University, Norfolk, VA 23529
The Atlantic sea scallop (Placopecten magellanicus) fishery has made a remarkable
recovery from a severely overfished state in the early 1990s, possibly due in part to
rotational fishery closures that have enhanced broodstock biomass. Besides leading to
increased harvests when these areas were reopened, these rotational areas may have
also induced elevated downstream recruitment via larval spillover. To examine the link
between increased broodstock abundance and increased recruitment downstream, we
performed simulations of larval dispersal dynamics and connectivity using an ocean
circulation model (ROMS) coupled to an individual-based scallop larval model and
spatially-explicit distributions of spawning stock biomass from fishery resource surveys.
Larval dispersal out of a rotational area was simulated before, during and after a closure
(2006-2012). Results of these targeted hindcast simulations show that larval connectivity
from the rotational areas was highly variable both inter- and intra-annually. Observed
periods of strong downstream recruitment coincided with times with high spawning stock
biomass and good connectivity. Larval dispersal patterns provide information pertinent
to scallop management decisions such as frequency and duration of closures as well as
the utility of extending rotational management to the rest of the Mid-Atlantic Bight.
Further, information about sea scallop connectivity in the Mid-Atlantic will assist
development of metapopulation stock-recruit models, rather than a simple whole stock
dynamic pool relationship.
83
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Managing fishers to manage themselves: Ramsey fisheries management zone a
learning experience
Sam Dignan1, Isobel Bloor1, Peter Duncan2, Michel Kaiser1, Lee Murray1, Kevin
Kennington2 & Fiona Gell2
1.Fisheries
and Conservation Science Group , Bangor University, Bangor, Gwynedd, LL57 2DG;
2.Department
of Environment, Food and Agriculture, Isle of Man
Introduction
In 2009 Ramsey Bay, an area in the Isle of Man (IOM) where king scallops (Pecten
maximus) were traditionally fished was closed to scallop dredging in response to
declining scallop stocks. Subsequently the area was designated Ramsey Marine Nature
Reserve (RMNR) and spilt into five zones each with varying levels of protection. The
largest of the zones established within the reserve was the Fisheries Management Zone
(FMZ) totalling 45.9 km2. In 2011 a lease, containing the proviso that the ecological
integrity of the area be maintained, to manage fishing within the FMZ was granted to the
Manx Fish Producers Organisation (MFPO).
In December 2013 following scientific surveys and under the control of the MFPO the
FMZ was fished commercially for the first time since its closure. Following extensive
consultation the MFPO adopted a novel cooperative fishing strategy where a TAC was
agreed and three of its member vessels assigned to fish that TAC; the resulting profits
being split between all MFPO members. The 2013 fishery proved to be highly efficient
from both an economic and environmental point of view and it was accepted that a limited
fishery might again be possible in 2014.
Scientific surveys were again conducted in September 2014 and while they showed a
decline in abundance from the 2013 survey it was agreed that a limited fishery could
again take place. In response the MFPO decided to once again prosecute a fishery within
the FMZ in December 2014. Rather than adopting the same cooperative strategy that
had been shown to be highly efficient in 2013 the MFPO took a different approach
84
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
whereby a TAC was set from which all its members were allowed to fish a personal
allocation.
In order to maximise the profitability of their personal allocation some members elected
to combine their allowance and once again fish cooperatively. However, in total 17
vessels prosecuted the fishery compared to 3. This study seeks to quantify the outcomes
of these two contrasting fishing strategies and assess the relative efficiency of the 2013
and 2014 Ramsey Bay king scallop fisheries.
Materials and Methods
Vessels participating in the fisheries were required to carry GPS loggers which operated
independent of their Vessel Monitoring System (VMS) to compensate for the 2 hour
polling interval of VMS being insufficient within the confines of the FMZ. In 2013 a 5
second polling interval was used but this was increased to 30 seconds in 2014. Fishers
were also requested to complete logsheets detailing tow-by-tow details such as start and
end time of tows and catches. The fine scale resolution of the GPS data allows catches
to be accurately mapped and impacts on the area to be quantified.
Fuel use for the fisheries was estimated based on previous values provided by fishers
for the towing and steaming components of fishing activity. Based on the calculated
values for fuel use additional data such as edible energy return on investment (EROI)
ratio were quantified. EROI is a metric by which the efficiency of food production
processes can be measured. As the nutritional component of shellfish is primarily a
function of their protein content, edible protein energy output is the most appropriate
basis for comparison in this instance (Tyedmers et al., 2004). It is important to note that
in both instances only direct emissions as a result of the burning of fossil fuels were
considered.
Results and Discussion
In total ~171 hectares (1.71 km2) of seabed were dredged during the 2013 fishery
compared with ~199 (1.99 km2) in 2014. Catch rates were lower in 2014 at 1.03
bags/dredge/hour compared with 1.37 bags/dredge/hour in 2013. Additionally, yields
were lower in 2014 at ~19.8kg of scallop meat worth £255 per hectare dredged. The
corresponding values for the 2013 fishery were 27.5kg or £370.
85
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Steaming time was estimated based on the distance steamed and the average steaming
speed of the fleet. In 2014 17 vessels spent an estimated 48 hours steaming a total of
~658km to the FMZ compared with a total of 7.25 hours and 100km for the 3 vessels in
2013. Time spent actually dredging represented 54% of the total time in 2014 whereas
in 2013 the figure was 86%. Overall, including both fishing and steaming time the 2013
fishery caught 449kg/hr live weight of scallops while the 2014 fishery caught 196kg/hr;
the corresponding values for time actually fishing were 522kg/hr and 362kg/hr. In terms
of distance the 2013 fishery realised 3065kg of catch for every kilometre steamed
whereas the 2014 realised 425kg.
The calculated edible protein Energy Return On Investment (ep-EROI) ratios for the 2013
and 2014 Ramsey Bay fisheries, not taking into account fuel use while steaming which
has yet to be quantified, were ~0.712 and ~0.616 respectively. Therefore, for every kg of
chemical energy expended, in the form of fuel, 712g and 616g of edible energy, in the
form of protein were obtained. Additionally, in the case of the 2014 fishery the steaming
proportion of fuel use can be expected to have been ~6.5 times greater than in 2013.The
2013 Ramsey Bay fishery was as a result of its higher capture rate, the extremely short
steaming distances involved and the lack of interference between vessels, significantly
more efficient than the 2014 fishery. Even so both fisheries in Ramsey Bay were highly
efficient compared with the wider Manx scallop fishery, with the 2013 fishery being as
much as 9 times more energy efficient than islandwide values calculated from Walsh
(2010).
References
Tyedmers, P. H., Watson, R., and Pauly, D. 2005. Fueling global fishing fleets. AMBIO: a Journal
of the Human Environment, 34(8): 635-638.
Walsh, S. J. 2010. Emission Profile of a Keystone Fishery and Recommendations for Fuel
Management-A Case Study on the Isle of Man Scallop Fishery. MSc Thesis, pp. 84.
Corresponding author: [email protected]
86
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallops like it rough! - Recovery of complex habitat boosts scallop settlement
in a community-led temperate marine reserve
Leigh M. Howarth, Callum M. Roberts, Julie P. Hawkins, Daniel J. Steadman and Bryce
D. Beukers-Stewart
Ecosystems and Society Research Group, Department of Environment, University of York, Heslington,
York, YO10 5DD, England. Tel: 01904 324789. Fax: 01904 322998
This study investigated the effects of a newly established, fully protected marine reserve
on benthic habitats and two commercially valuable species of scallop in Lamlash Bay,
Isle of Arran, United Kingdom. Annual dive surveys from 2010 to 2013 showed the
abundance of juvenile scallops to be significantly greater within the marine reserve than
outside. Generalised linear models revealed this trend to be significantly related to the
greater presence of macroalgae and hydroids growing within the boundaries of the
reserve. These results suggest that structurally complex habitats growing within the
reserve have substantially increased spat settlement and / or survival. The density of
adult king scallops declined 3-fold with increasing distance from the boundaries of the
reserve, indicating possible evidence of spillover or reduced fishing effort directly outside
and around the marine reserve. However, there was no difference in the mean density
of adult scallops between the reserve and outside. Finally, the mean age, size, and
reproductive and exploitable biomass of king scallops were all significantly greater within
the reserve. In contrast to king scallops, the population dynamics of queen scallops
(Aequipecten opercularis) fluctuated randomly over the survey period and showed little
difference between the reserve and outside. Overall, this study is consistent with the
hypothesis that marine reserves can encourage the recovery of seafloor habitats, which
in turn, can benefit populations of commercially exploited species, emphasising the
importance of marine reserves in the ecosystem-based management of fisheries.
Published in Marine Biology Volume 162, Issue 4 (2015), Page 823-840
87
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Can spatial management revive the Clyde? A plan for ecosystem-based
management of shellfish fisheries in a simplified sea
Bryce D. Stewart1, Ruth Hoban2, Alex Watson-Crook2, Charles Millar2
1University
of York, York, North Yorkshire, United Kingdom; 2 Sustainable Inshore Fisheries Trust,
Edinburgh, Scotland, United Kingdom
Introduction
The Firth of Clyde, off the west coast of Scotland, is the largest enclosed sea in the
United Kingdom (UK) and historically supported highly productive fisheries for a diverse
range of species of both fish and shellfish. Unfortunately, progressive relaxation of
fisheries management regulations throughout the late 20th century, particularly the
removal of a 3 mile from shore limit on trawling and dredging, and increasing fishing
effort, saw the overfishing and subsequent collapse of all of the major fin-fish stocks. As
a result, in 2013 over 99% of landings were shellfish, of which prawns (Nephrops
norvegicus) and king scallops (Pecten maximus) made up 89%. Although the fisheries
for prawns and scallops remain reasonably productive, recent stocks assessments and
analyses of age structures indicate that populations of both species are being heavily
exploited, likely at maximum capacity. The simplification of this marine ecosystem and
its fisheries has raised serious concerns among managers and conservationists, with
some labelling it “an ecosystem in meltdown”. While that may be an over exaggeration,
the Clyde is certainly much less productive than it was in the past and the reliance on a
handful of species is worrying, particularly in light of growing threats such as disease,
ocean warming and acidification.
In recognition of this situation, the Sustainable Inshore Fisheries Trust, a Scottish NGO,
began a project in 2011 to attempt to restore diverse fisheries to the Clyde. The central
tenant of their approach is to apply for a Regulating Order (RO) under the 1967 Sea
Fisheries Act. If successful, this will allow them to establish an independent management
organisation (MO) which would be able to set and enforce its own regulations within the
Clyde sea area. Membership of this MO would be made up of a range of stakeholders
88
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
including mobile and static gear fishermen, local councillors, NGOs and scientists, to
ensure that the interests of a broad cross section are represented. SIFT intends for the
MO to use a range of fisheries management measures, but for these to be based around
a spatial management system, given the success of this approach in other shellfish
fisheries in Isle of Man and the USA sea scallop fishery. This paper will focus specifically
on the development of the spatial management plan which aims to benefit scallop and
prawn fisheries in Clyde, while minimising their effects on vulnerable seabed habitats
and allowing the diversity of the ecosystem to recover.
Methods
In order to develop a spatial management plan for the Clyde it was important to first set
a series of management objectives. These can briefly be described as follows:
1. Protect a network of scallop and prawn habitats in order to provide breeding refuges
and potential larval export to surrounding fisheries.
2. Protect areas of vulnerable habitat from disturbance by scallop dredging and prawn
trawling. This should be done in-line with existing and upcoming conservation
regulations. These measures are aimed particularly at recovering and protecting nursery
habitats in order to provide benefits to a range of species, including commercially
important fish and shellfish.
3. Reduce conflict between mobile (dredge and trawl), static (creel), diving (scallop) and
recreational fishermen.
The initial phase of the project was an information gathering exercise which involved
consulting with commercial and recreational fishermen, scientists, government bodies
and other stakeholders. The resultant data was entered into GIS in order to prepare a
multi-layered picture of the Clyde. Relevant information included seabed substrate types,
bathymetry, environmental parameters, the location of ports, existing and planned
marine protected areas, and maps of fishing activity and intensity gained from both vessel
monitoring systems (VMS) and interviews (See figure 1).
89
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The original plan was to set up four protected areas, distributed relatively evenly around
the Clyde, but away from fishing ports in order to minimise the effects on the travels times
for fishing vessels. This plan evolved further after the designation of 3 marine protected
areas (MPAs) in the Clyde by the Scottish government in July 2014. Although the
management of these areas is yet to be decided, our spatial management plan was
adapted to support the conservation objectives of these sites and also to align with
existing arrangements aimed to separate mobile and static fisheries for prawns in the
upper Clyde estuary. Finally, our plans were refined even further after a consultation with
key stakeholders in the month prior to submission of application for a Regulating Order
(RO).
Figure 1. The distribution and intensity of fishing for king
scallops (Pecten maximus) in the Clyde between 2010 and
2012 (VMS records of vessels over 15 m in length only).
Results and Discussion
SIFT submitted their formal application for a Regulating Order (RO) for shellfish fisheries
in the Clyde in spring 2015. The final spatial management plan used a zoned approach
which allowed for different activities in different areas. These included creel and dive only
areas, creel only areas and trawl only areas. A series of sites were also designated to
become restoration areas where all extractive activities were restricted. These
restoration areas were specifically designed to support objectives 1 and 2 above – to
90
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
provide both fisheries and wider ecosystem benefits. Full details of the plan will be
presented.
The RO application is now with the Scottish government and may go out for public
consultation at the Cabinet Secretary’s discretion. A final decision is expected in the
second half of 2015. Should the application be successful, the next task will be to set up
the management organisation and an advisory scientific trust made up of fisheries
scientists and marine ecologists. Several staff will also need to be employed on the
project to undertake day to day monitoring and enforcement.
We remain optimistic that the RO application will be successful and pave the way for
bringing back a more diverse marine ecosystem and productive fisheries in the Clyde.
We also envisage that our plans to take an ecosystem-based approach which combines
spatial and co-management will provide a blueprint for how coastal marine resources can
be better utilised around the world.
91
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS II
92
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Genetic diversity of natural and seeded populations of great scallop (Pecten
maximus), and identification of hatchery-born seeds
Grégory Charrier1, Romain Morvezen1, Pierre Boudry2, Jean Laroche1
1Laboratoire
des Sciences de l’Environnement Marin, UMR 6539 LEMAR (UBO/CNRS/IRD/Ifremer),
Institut Universitaire Européen de la Mer, rue Dumont d’Urville, Technopôle Brest-Iroise, 29280
Plouzané, France; 2Ifremer, Laboratoire des Sciences de l’Environnement Marin, UMR 6539 LEMAR
(UBO/CNRS/IRD/Ifremer), Centre de Bretagne, CS 10070, 29280 Plouzané, France.
Introduction
The great scallop (Pecten maximus), is broadly distributed in shallow waters along the
European coasts, from northern Norway to southern Spain. This species is of high
economical value, particularly in France and United-Kingdom (Beaumont and Gjedrem
2006). Great scallop fisheries are mostly based on the exploitation of natural beds.
However, some stocks are significantly enhanced with hatchery-raised spat in order to
ensure the sustainability of local fisheries. This is particularly the case in the Bay of Brest
(Brittany, France), where sea-ranching of P. maximus has developed since 1983, in order
to enhance the local population which has been insufficient to ensure a sustainable
fishery, after a drastic demographic collapse due to a particularly cold winter in 19621963 (Dao et al. 1999). The use of hatchery-born seeds to enhance natural beds appears
as a promising strategy to ensure the sustainability of scallop fisheries. However, this
practice might significantly impact the genetic diversity of local scallop populations, since
maintaining the genetic variability of cultivated stocks remains a major challenge in
hatcheries. Hence, a strong decrease of the genetic diversity has been reported in many
cultivated marine bivalves, such as the flat oyster (Ostrea edulis) (Lallias et al. 2010).
Such an erosion of the genetic diversity might compromise the capacity of scallop
population to adapt to future environmental changes. As a consequence, the present
study aimed at evaluating the possible impact of sea ranching practices on the genetic
diversity of natural great scallop populations, by addressing two issues. The first objective
of the study was to depict the level of genetic variability of natural and seeded
populations, and to explore the genetic structure of these populations. The second
93
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
objective was to track hatchery-born seeds after their release in local stocks by applying
molecular marker-based pedigrees.
Material and Methods
Twelve natural populations and one seeded population of great scallop were sampled
from northern Norway to northern Spain. In addition, hatchery-born scallops produced at
the Tinduff hatchery (Brest, France) between 2007 and 2013 were sampled, along with
the breeders used to produce these cohorts. All individual samples were gentoyped using
12 microsatellites, (Morvezen et al. 2013).
The level of genetic diversity of natural and seeded populations was evaluated by
estimating the allelic richness, as well as observed and expected heterozygosities. In
addition, the population genetic structure was assessed with pairwise Fst values and
using a MDS analysis.
Molecular marker-based pedigrees were assessed by performing parentage analyses.
For these parentage analyses, hatchery-born and natural scallops from the same yearclass were assigned to the breeders used to produce the hatchery cohort, in order to test
the potential to identify hatchery-born individuals released among natural populations.
Results
Genetic diversity of Great Scallop populations
The genetic diversity decreased with latitude. Interestingly, no significant loss of diversity
was found in the seeded population from the Bay of Brest. Moreover, a strong genetic
differentiation was observed between Norwegian and Atlantic populations (from Ireland
to Spain), but very little to no difference between populations within these two groups.
Genetic identification of hatchery-born seeds
For each year-class tested, molecular marker-based pedigrees successfully enabled the
identification of hatchery-born individuals seeded among natural scallops. Hatchery-born
individuals were successfully assigned to their parents, and families of hatchery-born
scallops were thus reconstructed.
94
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Discussion
Genetic data did not show any decrease of the genetic diversity in the seeded scallop
population from the Bay of Brest. This result may suggest that the breeding methodology
implemented at the Tinduff hatchery is possibly properly designed to avoid an erosion of
the genetic varaibitlity of the local populations. Alternatively, the high fishing pressure on
seeded scallops may reduce drastically their reproductive success, and thus reduce the
influence of hatchery-born individuals on the genetic diversity of the natural population.
Finally, it may hypothesized that the loss of of genetic diversity may be buffered by some
gene flow from other populations.
The successful identification of hatchery-born scallops using molecular marker-based
pedigrees opens new avenues for monitoring populations enhanced with hatchery-raised
spat. This methodology, which can be assimilated to parentage-based tagging, has
already been applied with success to monitor hatchery propagated salmonids (Steel et
aL. 2013). Parentage based tagging appears as a promising tool, which could be
developped in the future to efficiently (1) control the success of stock enhancement
programs, and (2) track the propagation of hatchery-born scallops.
References
Beaumont, A., Gjedrem, T., 2006. Scallops - Pecten maximus and P. jacobaeus
Dao J.-C., Fleury P.G. & Barret J. (1999) Scallop culture in Europe. In: Stock Enhancement and
Sea Ranching (ed. by B.Howell, E.Moksness & T.Svåsand), pp. 423–4435. Fishing News Books,
Blackwell Science, Oxford, UK
Lallias, D., Boudry, P., Lapègue, Sylvie., King, J.W., Beaumont, A.R. (2010) Strategies for the
retention of high genetic variability in European flat oyster (Ostrea edulis) restoration
programmes. Cons. Gen., 11: 1899-1910
Steele, C.A., Anderson, E.C., Ackerman, M.W., Hess, M.A., Campbell, NR., Narum, S.R.,
Campbell, M.R. (2013) A validation of parentage-based tagging using hatchery steelhead in the
Snake River basin. Can. J. Fish. Aquat. Sci., 70: 1046-1054
95
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Apicomplexan infection and gray meat in Atlantic sea scallops, Placopecten
magellanicus
Susan Inglis *1, Árni Kristmundsson 2, Mark A. Freeman2, Megan Levesque1, Kevin
Stokesbury1
1University
of Massachusetts-Dartmouth, SMAST, Fairhaven, MA USA;
2Institute
for Experimental
Pathology at Keldur, University of Iceland, Reykjavik, Iceland
The Atlantic sea scallop supports one of the most valuable fisheries in the United States
and is found along the western North Atlantic continental shelf from Newfoundland to
North Carolina. Atlantic sea scallop meat is normally firm and creamy white. However,
scallops with small, darkened and stringy adductor muscles (gray meat) periodically
occur along the Eastern Seaboard, and have recently been observed in the rotational
management areas of Georges Bank after extended fishing closures. In 2013, the
Closed Area I access fishing area on Georges Bank ended early due to the high number
of “gray meat” scallops landed. Gray meat scallops have a low meat yield, and the
discolored and low quality meat have low market value (Figure 1). Similar “gray meat”
descriptions have been documented in wild stocks of the Iceland scallop, Chlamys
islandica in Icelandic waters and the queen scallop, Aequipecten opercularis from the
Faroe Islands. For C. islandica, this condition was associated with a total collapse in the
stock with the subsequent introduction of a fishing ban (Eiriksson et al 2010,
Kristmundsson et al 2011). Abnormally high rates of natural mortality were also observed
in Aequipecten opercularis with this condition (Kristmundsson et al 2011).
The objective of this study was to identify the cause of gray meat in the Atlantic sea
scallop examining age, nutrition and disease as potential agents. In 2013, adult scallops
of different size classes (ages) exhibiting normal and gray adductor meat color were
collected from Georges Bank Closed Area 1 and Closed Area 2 fishing access areas
(n=613). The scallops were analyzed for meat quality and the presence of pathogens by
histopathological (n=80) and molecular (n=50) methods. Scallop size and reproductive
stage (n=613) did not significantly correlate with the gray meat condition (p>0.05), but
meat weight (yield) and gonadal somatic index (GSI) were both significantly reduced
96
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
(p<0.05). A progressive myodegeneration of the adductor muscle occurred in scallops
exhibiting gray meat; proximate analysis (n=88) revealed a dramatic reduction in protein
content (ANOVA; p<0.05) and an increase in moisture content, with a moisture:protein
ratio of 12.9 (±4.2) and 4.8 (±1.3) in gray and white meat respectively. The percentage
lipid and carbohydrate content were also reduced. Amino acid profiles confirmed a
metabolic response to the breakdown of muscle tissue.
Infection by an apicomplexan parasite was observed in the muscle tissue of all gray meat
scallops. The infections were found both intracellular in muscle and free in the
intercellular spaces and were associated with focal or disseminated muscle necrosis
(Figures 2 and 3). An intermediate pathology stage (brown meat) was observed and as
the parasitic infection increased, the meat quality decreased. Various developmental
stages of the apicomplexan parasite were identified in infected scallops, including
developing trophozoites, merozoites and sporozoites, suggesting a monoxenous life
cycle with direct transmission between scallops. This apicomplexan has an identical
rDNA sequence to a newly identified parasite observed in the Iceland scallop during the
mass mortality event and in the queen scallop from the Faroe Islands (Kristmundsson et
al 2011). The range and prevalence of this parasite in Atlantic sea scallops, and the effect
of abiotic and biotic stressors on pathogenicity are unknown.
Current research focusses on managing the propagation of this infection including
interviewing fishermen to map areas of historical and current gray meat outbreaks and
identifying the habitat characteristics of these locations. Laboratory studies are testing
the transmission and virulence of the parasite. Preliminary results from a laboratory
experiment examining the virulence of this infection found that scallops exhibiting gray
meat pathology are unable to recover under optimal growing conditions and the infection
is chronic and terminal. Based on the results from this study, combined with the impact
this parasite has had on the Icelandic and Faroe Island scallop fisheries and the
probability of direct transmission between hosts, the prevalence of this parasitic infection
in Atlantic sea scallops and the associated gray meat outbreaks should be carefully
examined and monitored.
97
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
References
Eiriksson, H., Thorarinsdottir, G. G., Jonasson, J. P., and A. Kristmundsson. 2010. Increase in
natural mortality of the Iceland Scallop (Chlamys Islandica) in West Iceland and collapse of the
fishery in the early 2000s. ICES CM: 20.
Kristmundsson, A., Helgason, S., Bambir, S.H., Eydal, M., and M.A. Freeman. 2011. Previously
unknown apicomplexan species infecting the Iceland scallop Chlamys Islandica (Muller, 1776),
a queen scallop, Aequipecten opercularis, L and king scallop, Pecten maximus,L. Journal of
Invertebrate Pathology, 108. 147-155.
Corresponding
autors:
[email protected]
[email protected];
[email protected],
[email protected]
Figure 1. Photograph of “gray” (left) and
normal ‘white” (right) scallop meat
Figures 2 and 3. Muscular necrosis associated
with a cluster of apicomplexan sporozoites in the
adductor
muscle
(left)
and
extensive
hyalinization of adductor muscle fibers in a
heavily infected scallop (right).
98
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Candidate genes associated with growth variation in Argopecten purpuratus
Claudia B. Cárcamo1, Teodoro Coba de la Peña2, Federico M. Winkler1, Katherina
Brokordt1
1Laboratory
of Marine Physiology and Genetics (FIGEMA), Centro de Estudios Avanzados en Zonas
Áridas (CEAZA), Universidad Católica del Norte, Larrondo 1281, Coquimbo, Chile. 2Instituto de Ciencias
Agrarias, Consejo Superior de Investigaciones Científicas (CSIC), Madrid, España.
Introduction
The Northern scallop (Argopecten purpuratus) has a great importance for aquaculture in
Chile. In recent years this industry is becoming in crisis due to a combination of biological
(low growth rate), oceanographic, and economical (high production costs) factors. This
has led to an attempt to improve the A. purpuratus growth rate through selective
breeding, but a low response to selection has been observed. An alternative strategy to
improve the growth rate is to apply selection using information of molecular markers
associated with the growth rate variation (Marker Assisted Selection or MAS). The first
step in applying MAS is to identify loci affecting the target trait. One strategy to identify
that kind of loci is to analyze variation in candidate genes, i.e., genes of known or inferred
function directly or indirectly related with the trait of interest.
In this study we evaluated the expression of 4 genes putatively associated with growth
rate in mollusks: two ferritin homologs (Fth), a myostatin (Msnt) homolog and a heat
shock protein 70 (Hsp70) homolog. FTH protein plays a central role in the intracellular
iron homeostasis in many organisms and has also been related with shell formation and
immune defense in mollusks. Myostatin negatively regulates skeletal muscle growth in
superior vertebrates and is involved in growth rate in Chlamys farreri. Hsp70 gene
products, in turn, are molecular chaperones involved in normal protein synthesis
mechanisms but also in stress and immune responses. We hypothesized that variations
in the expression of these genes are involved in growth variation in scallops.
99
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Material and Methods
Heights and shell lengths of 350 4-month-old A. purpuratus scallops from a single
reproduction batch were measured. From this batch, we selected the 20 largest and the
20 smallest, and tissue samples (mantle and muscle) were individually obtained and
preserved in RNAlater (Ambion). Total RNA was extracted for each individual using
AxyPrep Multisource Total RNA Miniprep Kit (Axygen). The cDNA was obtained with
PrimeScript RT Kit with gDNA Eraser (TAKARA). Specific primers were designed for
each gene using conserved regions. RACE (rapid amplification of cDNA ends) was
performed to isolate both the entire coding regions and part of the untranslated regions
(UTRs) for Fth, Mstn and Hsp70 genes.
Five pools with equal amounts of RNA from 4 individuals were obtained. After
retrotranscription, gene expression was characterized in different adult tissues (muscle,
mantle, gill, gonad and haemocytes) by quantitative real-time PCR using Maxima SYBR
green/ROX qPCR Master Mix (Thermo Scientific). Expression of genes in slow-growing
and fast-growing scallops was determined in mantle (Fth and Hsp70) and muscle (Mstn).
Results
The average height of the 350 measured individuals was 17.48 ± 3.73 mm. The mean
heights of the smallest and largest selected individuals were 10.88 ± 0.65 mm and 25.25
± 1.71 mm, respectively (n = 20 respectively).
cDNAs corresponding to 4 genes (Apfer1, Apfer2, ApMstn and ApHsp70) were obtained.
The two ferritin homologs encoded different ferritin subunits. The full-length clone of
Apfer1 was 660-bp long, with a 516-bp open reading frame (ORF). Apfer2 cDNA was a
707-bp full-length clone, with a 519-bp ORF. The deduced proteins contained 171 and
172 amino acidic residues, respectively. Both 5’UTR zones contained the highly
conserved iron responsive element (IRE) motif with a predicted stem-loop sequence,
being different between them. Both ferritin homologs of A. purpuratus clustered together
with other Pectinidae ferritins. The highest Apfer1 expression was detected in muscle
and gonad, and the highest Apfer2 expression was observed in muscle. Apfer2 showed
a higher expression levels in large scallops than in the smallest ones (p<0.05). The
100
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
positive association between growth and the expression of this gene could be related to
a higher capacity for shell formation.
The ApHsp70 cDNA clone of A. purpuratus is 2077-bp full length with a 1965-bp ORF.
The deduced protein contained 654 amino acids. Its highest expression was detected in
muscle and gill. Largest scallops showed higher levels of ApHsp70 in mantle than the
smallest individuals. The ApMstn gene has been previously described for A. purpuratus.
It was mainly expressed in muscle and no significant differences in expression were
detected between large and small scallops (p < 0.05).
Figure 1. Relative mRNA levels for small and large scallops of a) ferritin-1 (Apfer1), b) ferritin-2 (Apfer2),
c) heat shock protein 70 (ApHsp70), and d) myostatin (ApMstn) genes. Vertical bars represent the mean
± SE (n = 5 pools of 4 scallops each). Significant differences (p<0.05) are indicated with asterix.
Study financed by FONDECYT 1130960 and 1140849
Corresponding author: [email protected]
101
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Transcriptome sequencing and candidate gene-based association analysis for
heat tolerance in the bay scallop Argopecten irradians
Xuedi Du1,2, Li Li1, Huayong Que1, Guofan Zhang1
1National
& Local Joint Engineering Laboratory of Ecological Mariculture, Institute of Oceanology,
Chinese Academy of Sciences, Qingdao 266071, China; 2 University of Chinese Academy of Sciences,
Beijing 100049, China
Introduction
The northern bay scallop Argopecten irradians irradians (Lamarck) and the southern bay
scallop Argopecten irradians concentricus (Say) were introduced into China in the 1980s
and 1990s, and are now major aquaculture molluscs in China (Figure 1). Summer
mortality is a main challenge for bay scallop aquaculture in China, especially under the
context of global warming. However, little is known about the heat tolerance of the bay
scallop. Here, we report the transcriptome sequencing of the two subspecies and the
subsequent association analysis on heat tolerance.
A.i.irrandians
A.i.concentricus
A.i.amplicostatus
A.i.taylorae
Figure 1 Natural distribution of bay scallop in North America and main aqualculture regions in China. The
black balls and triangle along the coast of China represent four important aquculture regions of bay scallop,
i.e. QinHuangDao, Yantai, Qingdao and ZhanJiang from north to south.
102
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Material and Methods
In total, RNA from six tissues of 67 and 42 individuals of northern and southern bay
scallops were prepared, respectively, and sequenced on Illumina Genome Analyzer II
platform. De novo assembly was conducted using Trinity software followed by annotation
through blastx against NCBI non-redundant protein database and Swiss-prot database.
Putative SNPs of the two subspecies were identified and classified into four classes.
According to annotation and SNP allele frequency analysis, 399 putative SNPs were
selected for association analysis. Two intercrossed populations were chronic heat stress
treated, and both heat-susceptible and heat-resistant individuals were collected for casecontrol analysis. Fisher’s exact test was conducted for allele frequency comparison
between the heat-susceptible and heat-resistant groups.
Results
In total, 55.5 and 34.9 million raw reads were generated for northern and southern bay
scallops, respectively. De novo assembly produced 82,267 unigenes, of which 32,595
were annotated. Altogether, 32,206 and 23,312 high-quality SNPs were identified for
northern and southern bay scallops, respectively. There were 94 SNPs showed
polymorphism in both association populations, among which, SNP all-53308-760 C/T
showed a significant difference in allele frequency between the heat-susceptible and the
heat-resistant groups with allele T being favorable for heat tolerance (Table 1). Moreover,
quantitative expression analysis revealed different expression profile of alleles under
both control and heat stress conditions (Figure 2A, 2D) and that gene expression was
up-regulated under heat stress conditions (Figure 2B, 2C).
Table 1 Association between SNP all-53308-760 C/T and heat tolerance of the bay scallop
Frequencies in ZZ96
SNP
all-53308-760 C/T
P value
Allele
C
Frequencies in ZN96
susceptible
resistant
0.3404
0.1064
0.0001847
P value
susceptible
resistant
0.3295
0.106
0.0002715
103
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Discussion and Conclusion
In this study, RNA-seq using pooled RNA samples from multi-individuals was conducted
for both northern and southern bay scallops. De novo assembly produced 82,267
unigenes with 31,681 being annotated, providing useful resources for basic research.
Tens of thousands of high-quality SNPs were identified in both northern and southern
bay scallops, indicating a high genetic diversity of the two stocks of bay scallop in China
after nearly 30 years of farming.
Association analysis on heat tolerance identified a SNP closely related to heat tolerance
of the bay scallop. Quantitative expression analysis revealed a different expression
profile between alleles and the negative correlation between its expression level and heat
tolerance of the bay scallop. It was conjectured that SNP all-53308-760 C/T or a
haplotype containing this locus might indirectly influence the heat tolerance of the bay
scallop by altering gene expression.
Figure 2 Quantitative expression analysis of gene all-53308 under both control and heat stress conditions.
A) Relative expression in individuals with the TT, TC and CC genotypes under brachychronic heat stress
conditions. B) Relative expression in individuals with TT and TC genotypes under control and
brachychronic heat stress conditions. C) Relative allele expression in individuals with TC genotype under
control and brachychronic heat stress conditions. D) relative allele expression in individuals with TC
genotype under brachychronic heat stress conditions. The values are displayed as the mean ± SD of
triplicate independent experiments. Differences that were determined to be statistically significant are
indicated by asterisks (* P < 0.05 and ** P < 0.01); ns, not significant.
104
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Integrated mechanistic study of the temporal effect of temperature increase
using Pecten maximus as a model species
Joëlle Richard1, Sébastien Artigaud1, Laurent Chauvaud1, Melody Susan Clark2,
Jacques Clavier1, Frédéric Jean1, Jonathan Flye-Sainte-Marie1, Aurélie Jolivet1, Romain
Lavaud1, Clémentine Le Jouan1, Violette Marchais1, Lloyd Samuel Peck2, Vianney
Pichereau1, Michael Thorne2
1Institut
Universitaire Européen de la Mer, Laboratoire des Sciences de l’Environnement Marin, UMR6539,
Rue Dumont D’Urville, 29280 Plouzané, France; 2British Antarctic Survey, High Cross, Madingley Road,
Cambridge CB3 0ET, United Kingdom
Introduction
In their publication, Richard et al. (2012) used a new theoretical approach to determine
benthic species temperature limits ecologically relevant and that for different
environments. In this study, the objectives are to test experimentally if this theoretical
approach is relevant and look the impact of warming at different level of organization
from gene to individual. The scallop, Pecten maximus, is used here as a model species
for studying the physiological processes involved during a temperature increase.
Material and methods
The study was conducted at the experimental station of Argenton (Brittany, France) from
June 6 to September 20, 2011 using 1 year old Pecten maximus from the 2010 spat
Tinduff Hatchery. Three experimental conditions were tested: 15°C (control), 21°C
(maximum in situ temperature in the species' range) and 25°C. Individuals are fed ad
libitum for 2 months followed by a month of fasting. Various physiological parameters
(respiration and filtration rates, shell and tissues growth, energy allocation, proteins and
genes expression) are monitored during the experiment in order to highlight the
mechanisms implemented during heat stress.
Results
All analyzes from gene to individual levels show that, at 25 ° C, the animals are at their
temperature limit. The genes and proteins expression shows a profound remodeling of
the cell structure and suggests a diversion of energy metabolism towards the mobilization
105
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
of lipid stock. At the individual level, the results show that, during the treatment at 25°C,
the parameters analyzed (shell and tissues growth, filtration, respiration and aerobic
scope) are all lower than at the other two temperatures. Filtration is impacted significantly
before a difference can be detected in respiration (Figure 1). Moreover, the condition
indices survey shows a different impact according to the organs with a strong decrease
of the gills condition index (Figure 2). Indeed, the gills are completely regressed after 2
months at 25°C.
2.5
A
B
0.7
Filtration rate (L/h)
Respiration rate (mgO2/h)
0.8
0.6
0.5
0.4
0.3
0.2
2.0
1.5
1.0
0.5
0.1
0.0
06/06
01/07
26/07
20/08
0.0
06/06
14/09
01/07
26/07
20/08
14/09
Time
Time
Figure 1: Respiration and filtration rate during the experiment. A) Respiration rate (full symbols) and
standard metabolism (open symbols); B) Filtration rate. Black diamonds: 15°C treatment; dark gray
circles: 21°C treatment; light gray squares: 25°C treatment.
14
A
10
8
6
4
8
6
4
2
2
0
06/06
B
10
Gill condition index
Total condition Index
12
12
21/06
06/07
21/07
05/08
Time
20/08
04/09
19/09
0
06/06
21/06
06/07
21/07
05/08
Time
20/08
04/09
19/09
Figure 2: Condition indices during the experiment. A) Total condition index and B) Gill condition index.
Open black diamond: start of the experiment; black diamonds: 15°C treatment; dark gray circles: 21°C
treatment; light gray squares: 25°C treatment
Discussion and Conclusion
All these results indicate that the temperature of 25°C is close to the physiological limit
of the species. Pecten maximus appears to be resistance at 25°C while it seems to
acclimate at 21°C.
106
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PECTINIDS – WITNESSES OF THEIR ENVIRONMENT IN A
CHANGING OCEAN
107
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
KEYNOTE: The shell of ‘Pecten Le Grand’ as a paleo- and novo- ecological tools
Laurent Chauvaud1
1 Université
de Bretagne Occidentale; Institut Universitaire Européen de la Mer, Laboratoire des Sciences
de L'Environnement Marin (UMR CNRS 6539), Technopôle Brest Iroise,Place Nicolas Copernic, 29280
Plouzané, France
Since the XVIIIth siecle, research on earth environment past-history has not ceased.
During a first period, some pioneers as Buffon in France wanted to offer a credible frame
of earth story and accumulate proof for a very ancient age for earth, incompatible with
the bible proposition. One of its most convincing and efficient tools was the marine shell
remains found in current terrestrial environments. All along the XIXth siecle, fossils, but
also the sediment cores, have been key elements of a progressively emerging science:
the paleoclimatology. Briefly speaking, the biogenic constructions can be use as "proxies
holders" accumulated in sedimental deposits, generally giving some informations of low
resolution, or as organisms as a all, like corals and shells, allowing in some case some
incredibly fine temporal informations. Inescapably, days after days, the carbonate
skeleton builders fuel the planet environment memory, and among their, the scallops are
certainly the most performant.
First the shell of scallops often bears distinct concentric growth-rings that can indicate
the age of the shell (Dakin, 1909 ; Gibson, 1956) and then be use to study scallop
population dynamics and fisheries.
Since Clark (1968), many studies have focused on the rhythm of striae formation in
scallops. Most results have suggested a daily periodicity in CaCO3 deposition. However,
different growth periodicities have been observed in other bivalves. For example, in the
Northern Quahog Mercenaria mercenaria, six different periodicities were identified:
annual (350-380 days), monthly (29 days), tidal (14 days), bi-daily (2 days), daily (1 day),
and subdaily (< 1 day). Therefore, the cadence of calcification must be evaluated before
a new scallop species can be used as an "environmental sentinel". A daily periodicity of
striae formation has been suggested for many scallop species. In the genus Pecten, such
108
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
a periodicity has been demonstrated to exist in juveniles of P. diegensis and P. vogdesi
as well as in juveniles and adults of P. maximus. In the Argopecten genus, daily formation
of striae has been suggested for A. irradians, A. gibbus and A. circularis. The same
periodicity has also been identified in other genera, e.g., juveniles of Amusium balloti,
juveniles of Chlamys opercularis and larvae and post-larvae of Placopecten
magellanicus.
The daily pattern of striae in natural populations of P. maximus allows us to precisely
date carbonate deposits along the shell growth axis, enabling a precise calibration of geo
chemical tracers during the growth period something that is often impossible to do with
other species. These properties are routinely used to explore how scallop shell can be
study for reconstructing their present, our past. Scallop shell are now considered
multiproxies bioarchives inshore and offshore environments. Isotopic analyzes (d18O,
d13C) and elementary (Mn, Mg, Sr, Ba, Mo, Li ...) coupled to the measurement of growth
post allow simultaneous description of the environmental variables (T ° C, salinity,
primary production, O2, sedimentation, contamination, toxic bloom) affecting the benthic
life, pelagos-benthos coupling and thus a biological response (growth) to these variables.
The biological response to global change can be analyzed on these widely distributed
archives, which thus constitute Eulerian sensors "deployed" throughout the Atlantic
Ocean for decades. This work is based on multidisciplinary approaches involving
sclerochronology, analytical chemistry (trace elements, stable isotopes), physiology,
ecology. Calcified structures can thus provide information at different levels of biological
integration: 1) revealing individual stories of growth, reproduction and migration) applied
to the population-level, they can approach the recruitment process, mortality and may
reveal spatio-temporal structuring; 3) the level of the ecosystem, either as passive sensor
or through alteration of the physiological processes underlying their formation, they
produce information about past environmental conditions.
109
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Scallop shells as geochemical archives of paleo-ecological processes in coastal
ecosystems
Julien Thébault1, Aurélie Jolivet1, Christophe Pécheyran2, Claire Bassoullet3 and
Laurent Chauvaud1
1Université
de Brest, Institut Universitaire Européen de la Mer, Laboratoire des sciences de
l'environnement marin (UMR6539 LEMAR), rue Dumont d'Urville, 29280 Plouzané, France; 2Université
de Pau et des Pays de l’Adour – CNRS, 64053 Pau, France;3Université de Brest, Institut Universitaire
Européen de la Mer, UMS3113, rue Dumont d'Urville, 29280 Plouzané, France
Introduction
It is now widely accepted that human activities affect the structure and functioning of
coastal ecosystems. One of the most significant consequences is related to changes in
nutrient input that can induce changes of trophic conditions (up to eutrophication) and
disturbances of phytoplankton dynamics, keystone of the functioning of coastal
ecosystems. This includes changes in primary production levels, in bloom frequency, and
in the composition of microalgal communities.
However, this global outlook conceals major temporal and spatial disparities. As
conventional monitoring time-series are quite sparse and scattered, biological records of
environmental variability are relevant tools to gain insight into phytoplankton dynamics
over larger temporal and spatial scales. In this context, bivalve mollusc shells, and
especially scallops, appear as valuable biogenic archives as they form their external
calcium carbonate skeleton periodically, leading to the formation of concentric growth
lines that can be used as chronological landmarks.
Here, we present results of several interdisciplinary projects dealing with skeletal growth
rates and geochemical information archived in shells of two scallop species:
Comptopallium radula in New Caledonia (SW Pacific Ocean) and Pecten maximus in
Brittany (Western France).
110
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Material and Methods
C. radula forms external growth lines with a weird 2-day periodicity (Thébault et al., 2006.
Mar. Biol. 149: 257-267) whereas P. maximus is known to form daily growth lines on its
shell surface between March and November in the Bay of Brest (Fig. 1; Chauvaud et al.,
1998. J. Exp. Mar. Biol. Ecol. 227: 83-111). Several specimens of each species were
collected either by SCUBA diving or dredging over the past two decades. At each
location, extensive environmental surveys of physical, chemical and biological
Figure 1: (A) Upper surface of the left valve of P. maximus.
(B) Zoom in on daily growth increments.
parameters were carried out with a weekly resolution, in the vicinity of the scallop
populations. All specimens were analysed in order to investigate (i) their shell growth
rates, and (ii) their shell geochemical composition using Inductively Coupled Plasma
Mass Spectrometers (ICP-MS). We focus here on results dealing with barium, lithium,
and molybdenum concentrations in shells.
Results
For each element and each species, inter-individual variability of element:Ca ratios was
low, suggesting an environmental control on the incorporation of these elements within
shells. Time-series were characterized by a background level punctuated by sharp
peaks. In C. radula, Ba:Ca and Mo:Ca profiles presented some similarities with
phytoplankton dynamics (Fig. 2). A similar correlation was sometimes found for P.
maximus, depending on the year the shells were collected. Finally, we found a strong
correlation between Li:Ca in P. maximus and (i) shell growth rates, and (ii) diatom blooms
(Fig. 3).
111
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Figure 3: Time series of Ba:Ca ratio archived in shells of three C. radula specimens (left panel) and
average Ba:Ca profile in shells overlain with Chl a concentration (right panel).
Figure 2: Time series of Li:Caexcess in P. maximus and counts of edible diatoms measured in the Bay of
Brest.
Discussion
The ingestion of diatoms enriched in Ba (adsorbed on iron oxyhydroxides associated with
the frustules) is the most likely cause of the formation of Ba:Ca peaks in C. radula. Some
contribution of diatom-associated barite is also possible. In every instance, Ba:Ca would
possibly be a proxy for the timing and magnitude of diatom blooms in the SW lagoon.
This is less obvious in the Bay of Brest, probably because this ecosystem and its
phytoplankton dynamics is much more complex than in New Caledonia. Interpretation of
Mo:Ca peaks in shells of both species is still under debate but might be related to hypoxia
events at the sediment-water interface. Finally, we suggest that Li is incorporated in
shells of P. maximus proportionally to the growth rate of the shell, except during diatom
blooms when large amounts of Li are trapped within the shell. We conclude that Li:Ca in
112
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
P. maximus shells could be used, after removal of the shell growth rate contribution, as
a proxy for timing and magnitude of diatom blooms.
Conclusion
Comparison of these high-resolution geochemical time-series with results of extensive
environmental surveys highlighted that hypoxia and phytoplankton dynamics can explain
the incorporation of these elements in scallop shells that can in turn be used as powerful
archives for paleo-ecological processes in coastal waters.
113
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Pecten jacobaeus – archive of environmental variability in the north Adriatic Sea
Melita Peharda1, Julien Thébault2, Aurélie Jolivet2, Bernd Schöne3, Daria Ezgeta-Balić1,
Ivica Janeković4, Laurent Chauvaud2
1 Institute
of Oceanography and Fisheries, Split, Croatia; 2 Université de Bretagne Occidentale, Institut
Universitaire Européen de la Mer, Laboratoire des Sciences de l'Environnement Marin (UMR6539
UBO/IRD/CNRS), Plouzané, France; 3 Johannes Gutenberg-Universität Mainz, Institut für
Geowissenschaften, Mainz, Germany; 4 Rudjer Bošković Institute, Division for Marine and Environmental
Research, Zagreb, Croatia
Introduction
Over the past decade a supra disciplinary field of sclerochronolology has been rapidly
developing by investigating structural elements as well as geochemical composition of
bivalve shells with the objective of obtaining information on the environment collected
over the organism’s life cycle (Schöne and Gillikin, 2013; Palaeogeogr. Palaeoclimatol.
Palaeoecol. 373(1):1-5). Pecten jacobaeus is one of the commercially most important
bivalve species in the Adriatic Sea and can live for more than 13 years (Peharda et al.
2003; J. Shellfish Res. 22(3):639-642), thereby presenting an interesting model for
sclerochronological research. The principal objectives of this study were to i) obtain data
on daily shell growth rates and periods of seasonal growth slowdowns, and to evaluate
potential of ii) δ18O and δ13C and iii) trace element composition from P. jacobaeus shell
for the reconstruction of environmental variability.
Material and Methods
Pecten jacobaeus samples were collected by a commercial beam trawl in January 2014
from 25-30 m depth along the western coast of Istria peninsula (north Adriatic). Daily
shell growth rates (DSGR) were determined by measuring distances between successive
daily growth patterns (increments and lines) at the surface of the left shell valve, along
the axis of maximum growth. Samples for the oxygen (δ18O) and carbon (δ13C) isotope
values of the calcium carbonate were collected by drilling shell powder from the shells
by hand under stereo microscope using a DREMEL Fortiflex drill equipped with a 300
µm tungsten carbide drill bit. All samples were analysed at the University of Mainz,
114
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Germany, in a Thermo Finnigan MAT 253 continuous flow isotope ratio mass
spectrometer, equipped with a Gas Bench II. Results are expressed in parts per thousand
with respect to the Vienna Pee Dee Belemnite standard (‰ V-PDB). Seawater
temperature at the time of shell formation was calculated using the equation of Chauvaud
et al. (2005; Geochem. Geophys. Geosyst. 6(8):Q08001), calibrated for a closely related
species, Pecten maximus, in the Bay of Brest (France):
T(ºC) = 14.84 – 3.75 * (δ18Oc-PBD - δ18Ow-SMOW)
As δ18Ow-SMOW of the water was not monitored over the lifespan of the studied specimens,
we used an average value of 1.29‰ measured in this area by Stenni et al. (1995;
Oceanol. Acta 18(3):319-328.). Elemental concentrations in shell calcite were analysed
using HR-LA-ICP-MS at the Pôle Spectrométrie Océan (Plouzané, France). A highresolution ICP-MS Thermo Electron Element2 (inductively coupled plasma mass
spectrometer) was coupled to a GeoLas Pro laser ablation system (Coherent Inc.)
operating at 193 nm. Laser was operated with a pulse energy of 15 J·cm-2, a repetition
rate of 5 Hz, and a spot diameter of 90 µm. During acquisition, signal intensities were
recorded for 7Li, 97Mo, 138Ba, and 43Ca (among other elements not reported in this article).
Elemental quantification was carried out using an external calibration standard (NIST
SRM 612) measured several times over the analytical run.
Temperature and salinity in the catchment area (in front of West Istria) and at the bottom
of water column were modelled using 3D numerical model -- ROMS (Janeković et al.,
2014; J. Geophys. Res. Oceans 119:3200-3218). During the period of 2009 till 2014
model used real atmospheric forcing, lateral boundary conditions, and 41 river inputs
providing accurate values for temperature in the whole water column, as well as other
model variables.
Results
Daily shell growth rates varied with respect to age and season, and reached values over
500 µm·d-1 (based on the assumption of a daily periodicity in growth increment
formation). The δ18O values ranged from 0.01 to 3.08‰ ( =1.26±0.65‰), with
corresponding reconstructed seawater temperatures (Tδ18Oshell) ranging between 8.0°
and 19.6°C (Fig. 1). Observed cyclicity in the δ18O values corresponds to the number of
seasonal growth slowdowns (N=5) observed on the external shell surface of the P.
115
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
jacobaeus, thereby validating annual periodicity of these slowdowns. Moreover, it
appears that these slowdowns occurred in late summer. Temperature values obtained
through modelling correspond to reconstructed seawater temperatures values. Winter
temperatures were recorded by shell calcite (especially the cold February 2012
temperatures), whereas late summer temperatures were not. According to the timing
provided by Tδ18Oshell, elemental analyses were performed on shell portions precipitated
between January and October 2010. As previously observed on Pecten maximus, Li/Ca
tended to track the daily shell growth rate. Ba/Ca and Mo/Ca profiles presented a
baseline punctuated with one main peak that occurred in late spring 2010 (Ba/Ca peak)
and summer 2010 (Mo/Ca peak).
Figure 1. δ18O values (black circles), and reconstructed temperature (white circles) for Pecten jacobaeus.
Perpendicular grey lines indicate position of seasonal growth slowdown. Black arrow indicates position of
temperature minima.
Discussion and conclusions
Our data confirm that P. jacobeus could likely be used as archive of environmental
variability in the north Adriatic Sea, as is currently done with P. maximus in Western
Europe. In February 2012, extreme cooling of sea water and dense water formation
occurred in the Adriatic Sea (Janeković et al. 2014), an event that was recorded by P.
jacobaeus shells; as well as high bottom sea water temperatures (>19°C) occurring in
2009. Preliminary data on shell geochemistry indicate the potential use of some trace
elements as proxies for environmental variability. More specifically, Ba/Ca and Mo/Ca
ratios may be related to phytoplankton dynamics and subsequent hypoxia at the
sediment-water interface.
116
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The great scallop, Pecten maximus, the species which has changed our
methods, views and perspectives, in the use of carbon stable isotope ratios
(δ13C), as proxies, in biogenic carbonates.
Yves-Marie Paulet, Laurent Chauvaud, Anne Lorrain, Julien Thebaud, Violette
Marchais, Aurélie Jolivet, Joëlle Richard
Since Urey (1947) the proportions of the different atomic mass of the elements are
became essential tools in sciences, from medicine to ecology and universe studies.
Among these, so called, proxies, the δ13C in carbonates has appeared, along with
oxygen one, the most potentially informative for tracking the organic material sources
and fates and especially to retrospectively estimate the paleo-productivities in the
biosphere.
Alas, carbon isotope signal in biogenic carbonates rapidly appeared as a complex signal,
mixing direct environmental information with ones coming from the metabolic activity of
the carbonates builders.
During the last years, the stake of deciphering environmental signals from physiological
influences in marine shells and bones has greatly motivated scientists around the world.
Finally, through monitoring and observation, and more recently with experimental
designs, it has been found that scallops constituted the best model for conclusive
advances. Their very well-known anatomy-physiology, their large distribution, and mainly
their elevated growth performance associated with daily striae production in their shell,
has allowed great advances in the science of carbonates proxies, and particularly of
carbon isotopic ratios.
The communication proposes a review of the more recent works on the subject and offers
a perspective on the unexplored potential of this species in this field.
117
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Using the growth of Pecten Maximus as environmental proxy
Clément Le Goff1, Aurélie Jolivet2, Adeline.Williams3, Yves.Marie Paulet2, Ronan
Fablet1, Christophe Cassou4, Laurent Chauvaud2
1Institut
Mines-Telecom, Telecom Bretagne, CNRS UMR 6285 LabSTICC, Pôle CID, Technopôle Brest
Iroise, CS 83818, 29238 BREST Cedex, France; 2Université de Bretagne Occidentale, Institut
Universitaire Européen de la Mer, Laboratoire des sciences de l'environnement marin (UMR CNRS
6539) Technopôle Brest Iroise, Plouzané , France ; 3Ifremer, LOS Laboratoire d'oceanographie spatiale
ZI Pointe du Diable, CS 10070, 29280 Plouzané, France ; 4CNRS-Cerfacs, Global Change and Climate
Modelling project, 42 Avenue G. Coriolis, 31057 Toulouse, France
Introduction
Our research group measure the growth of Pecten maximus since 1987 on individual
sampled in the Bay of Brest. The growth of this scallop is characterized by successive
accretions of calcium carbonate forming striae of the order of hundred micrometers.
Chauvaud et al (1998 ; J Exp Mar Biol Ecol 227 : 83-111) showed that such striae are
built at a daily rhythm. And it is now commonly admitted that this accretional growth
(calcium carbonate) should be considered as high frequency records of the
environmental variations. Nevertheless, growth do not occur during the entire whole year
and stop when the environmental conditions are unfavorable making so called winter
marks on the surface of the left valves. In this study we focus on the growth of individuals
occuring between their first and second winter (class I) and we highlight surprising
relationships between atmospheric conditions in Brittany and growth trends of scallops
living on the bottom of the Bay of Brest.
Material and methods
For each individual, we estimated the daily growth rate by measuring the distance
between consecutive daily growth striae. We applied this method on the age class I,
between the first and the second winter mark. The daily growth patterns of each
individual's flat valve were examined on images acquired using a high-resolution video
camera (Sony DFW-X700) and analyzed with image analysis software (Visilog ®, Noesis,
see Chauvaud et al. 1998; J Exp Mar Biol Ecol
227: 83-111, for additional
118
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
information).The growth of marine invertebrates is controlled by the temperature of
seawater and food avaibility (Kooijman 2000; Dynamic Energy and Mass Budgets in
Biological Systems. Cambridge: Cambridge University Press). And, theorical studies
dealing with the bioenergetics claims that metabolisms of the animals are strongly linked
to temperature by the mean of the Arrhenius law (Brown et al., 2015; Ecology 85:1771–
1789). In such approach the metabolism expenditure is assessed by the respiration rate
even if the massic growth rate could also be a proxy of this assessment. Moreover, a
systematic record of the temperature in the bay of Brest has been processed during the
whole period covering the time series. In the present work we apply the Arrhenius law to
the massic growth rate. We convert the daily linear growth rate to a body growth (weight)
of scallop (Lorrain et al, 2004; Cosmochimica Acta 68: 3509–3519).
Results and discussion
To test the Arrhenius law we use two year 2011 and 2012 who was particularly well
sampled. The mean body growth rate curves fit to the temperature variations (r 2=0.97
p<0.05) for 2011 and (r2=0.86 p<0.05) for 2012. These very interesting results suggest
that we could use the growth of Pecten Maximus to make paleotemperature.
Nevertheless, it can be seen on 2012 that residuals of the regression between
temperature and massic growth rate are more important and structured than for 2011.
By analyzing the residuals we show they highly correspond to the primary production
represented in our study by the chlorophyll a. Another aspect of this result is the
possibility to use this model to know exactly when growth occurs during the year. By
applying it on the 26 years composing the time series, it is then possible to know when
the growth restarts each year. The inter annual variability of this date of restart shows a
high correlation with weather winter conditions.
Conclusion
From these preliminary results, we already demonstrate that temperature and primary
production of the water column can be assessed by the shell growth rate of Pecten
maximus. We also show that we can back calculate information about the climate from
past scallop growth variations. We propose to apply this pool of results to describe from
fossil shell on paleo-climate variations.
119
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Easy prey? –
Great scallop escape performance under ocean warming and acidification
Burgel Schalkhausser, Christian Bock, Hans-Otto Pörtner, Gisela Lannig
Integrative Ökophysiologie, Alfred-Wegener-Institut Helmholtz-Zentrum für Polar- und Meeresforschung,
Am Handelshafen 12, 27570, Bremerhaven, Germany
Introduction
Marine invertebrates, especially mollusc calcifiers seem to be most sensitive to ocean
acidification (Wittmann and Pörtner 2013). This also concerns pectinids which due to
their swimming capacity are an ideal model organism to investigate various impacts of
Ocean (O) Warming (W) and Acidification (A) under the frame work of the concept of
oxygen and capacity limited thermal tolerance (OCLTT). Aerobic metabolic rates in
scallops are closely dependent on the surrounding temperature regime, but also reflect
metabolic temperature compensation for maximized scope for growth in various climate
regimes (Aldridge et al. 1995, Heilmayer et al 2005). According to OCLTT (Pörtner 2010)
and the concept of the aerobic power budget (Guderley and Pörtner 2010) increasing
costs for maintenance can reduce aerobic scope with trade-offs between energyconsuming processes affecting performance parameters such as growth or locomotion
– in particular at the boarders of the thermal tolerance window. For the present study we
hypothesized that OWA-induced disturbances in aerobic energy metabolism and
extracellular acid-base status will impair swimming performance in scallops. We
compared the performance capacity and associated physiological responses of two
populations of the great scallop Pecten maximus under near-future OWA scenarios.
Materials & Methods
Detailed information can be found in Schalkhausser et al. (2013, 2014). Briefly,
specimens from two populations (boreal from Norway, temperate from France) were
incubated long-term under present and near future OWA conditions (0.04 kPa CO 2 =
normocapnia, 0.11 kPa CO2 = hypercapnia, boreal: 4 vs. 10°C; temperate: 10 vs. 20°C)
We determined routine and maximal metabolic rates (RMR, MMR) by intermitted flow
120
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
respirometry and calculated the factorial aerobic scope (FAS = MMR/RMR). Parameters
of swimming performance such as number of claps and force strengths of muscle
contractions (Ftonic, Fmean
phasic)
were measured using a force gauge. Haemolymph
parameters, PeO2, PeCO2 and pHe were analysed using a blood gas analyzer and total
CO2 (CeCO2) by gas chromatography. Apparent bicarbonate concentration [HCO3–]e was
calculated.
Main results
After OA exposure both populations showed a drop in pH e indicating that the
accumulation of [HCO3–]e was insufficient to fully compensate the OA-induced
extracellular acidosis. Interestingly, the observed pHe drop was stronger in boreal than
temperate P. maximus under OWA conditions. Irrespective of OA, warming from 10 to
20°C reduced PeO2 of temperate P. maximus by nearly 50%. The lack of haemolymph
data at 4°C hampered a direct comparison between 4 and 10°C groups of boreal P.
maximus but both populations showed similarly low PeO2 values (between 6-8 kPa) at
the respective high temperatures indicating that both populations were then in the upper
pejus range. In temperate P. maximus, warming increased RMR but not MMR resulting
in lower FAS at 20 than at 10°C, and the time needed to recover from exercise increased.
Exposure to 20°C increased Ftonic but decreased Fmean phasic, while the number of claps
was unaffected. Exposure to OA did not change these patterns. In contrast, boreal
scallops were affected by OA exposure in the warmth. While RMR was similar between
normo- and hypercapnic scallops, the rise in metabolic rates measured after exercise
(MMR) was higher in normo- than in hypercapnic boreal P. maximus resulting in a
lowered FAS in the latter group. Swimming performance of boreal P. maximus fell under
OA as shown by reduced Fmean phasic at both temperatures. Exposure to 10°C increased
Ftonic as well as Fmax, but additional exposure to OA reduced both parameters.
Discussion & Conclusion
In line with literature findings on bivalves, P. maximus displayed limited capacity for acidbase regulation which seemed less in boreal than in temperate scallops when exposed
to elevated CO2 levels at higher temperature. The warming protocol brought both
populations into their upper pejus range, when PeO2 values decreased indicating that
oxygen supply mechanisms could not keep up with the warming-induced rise in RMR.
121
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Although warming impaired swimming performance in temperate P. maximus, we
observed no further impact of additional OA exposure. In contrast, additional OA
exposure decreased swimming performance of boreal P. maximus in the warmth,
paralleled by less efficient pHe regulation. In line with the OCLTT concept the present
findings revealed impaired performance of scallops in a warming ocean suggesting
negative implications for the capacity of scallops to evade predatory pressure. At thermal
extremes this may be intensified under OA as seen in the boreal population. The role of
pHe variations for shaping the capacities of muscular performance and aerobic or
anaerobic metabolism merits further investigations.
Literature
Aldridge DW, Payne BS, Miller AC (1995) Oxygen consumption, nitrogenous excretion, and
filtration rates of Dreissena polymorpha at acclimation temperatures between 20 and 32 °C. Can
J Fish Aquat Sci 52(8): 1761-1767. doi:10.1139/f95-768
Guderley H, Pörtner HO (2010) Metabolic power budgeting and adaptive strategies in zoology:
examples from scallops and fish. Can J Zool 88: 753-763.
Heilmayer O, Honnen C, Jacob U, Chiantore M, Cattaneo-Vietti R, Brey T (2005) Temperature
effects on summer growth rates in the Antarctic scallop, Adamussium colbecki. Polar Biol 28:
523-527. doi:10.1007/s00300-005-0716-7
Pörtner H-O (2010) Oxygen- and capacity-limitation of thermal tolerance: a matrix for integrating
climate-related stressor effects in marine ecosystems. J Exp Biol 213: 881-893.
Schalkhausser B, Bock C, Pörtner H-O, Lannig G (2014) Escape performance of temperate
Pecten maximus under ocean warming and acidification. Mar Biol 161(12): 2819-2829.
doi:10.1007/s00227-014-2548-x
Schalkhausser B, Bock C, Stemmer K, Brey T, Pörtner HO, Lannig G (2013) Impact of ocean
acidification on escape performance of the king scallop, Pecten maximus, from Norway. Mar Biol
160(8): 1995-2006. doi: 10.1007/s00227-012-2057-8
Wittmann A, Pörtner HO (2013) Sensitivities of extant animal taxa to ocean acidification. Nat Clim
Chang 3:995-1001. doi:10.1038/nclimate1982
122
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Will future ocean acidification affect development of great scallop (Pecten
maximus L.) veliger larvae?
Sissel Andersen1, Ellen Sofie Grefsrud2 and Torstein Harboe1
1Institute
of Marine Research, Austevoll Research Station, 5392 Storebø, Norway 2Institute of Marine
Research, P.O. Box 1870 Nordnes, 5817 Bergen, Norway
Introduction
As a result of high anthropogenic CO2 emissions, the concentration of CO2 in the oceans
has increased causing a decrease in pH, known as ocean acidification (OA). Models
have shown that the oceanic CO2-level will continue to increase over the next 50-200
years. Numerous studies have shown negative effects on marine invertebrates, and that
the early life stages are the most sensitive to OA. An ongoing research project at the
Institute of Marine Research in Norway is looking at possible acute effects of OA on
embryo and veliger larvae development of the great scallop Pecten maximus L.
Material and methods
Local scallop broodstock was conditioned in a hatchery for eight weeks (Jan-Mar) and
spawning induced by an increase in temperature. Eggs were cross-fertilized with sperm
from 2-3 individuals and when cell division was observed embryos were incubated in the
exposure tanks at a stocking density of 13 ml-1. Ocean acidification scenarios were
produced by adding CO2 gas to seawater. An acid stock solution was diluted to give three
different pHtot -levels: ambient 7.94 (control, pH1), 7.74 (pH2) and 7.54 (pH3),
corresponding to a pCO2-level of 472, 780 and 1323 µatm. Each pH was run with four
replicate flow-through 38 liters exposure tanks. Larvae were fed from day 2 until day 14
using standard algal diet with increasing concentration from day 2 until day 14.
Temperature, pH and flow were recorded daily or several times per day. Alkalinity was
analyzed twice during the experiments.
Larvae were preserved in formalin at different times during the experiment and stored in
ethanol for later observations of survival, and shell deformities and shell size was
investigated using a microscope connected with a Canon 5D MARK II camera. Larvae
123
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
from each tank were concentrated at the end of the experiment and small subsamples
were taken to calculate survival. Live larvae were exposed to UV in the microscope setup showing algal cell fluorescence in photographs. Feeding incidence was then
calculated as the ratio of larvae containing algal cells.
Results
OA affected both survival and shell growth negatively. Survival based on initial
concentration of fertilized eggs was affected after seven days (fig. 1), but shell size was
affected after only three days. Survival on day 14 post-spawn was reduced from 16 % in
the ambient group to 3 % in the lowest pH-group. Shell length and height were reduced
with around 10 % on day 14, when pH decreased from ambient to 7.74 (pH2) or 7.54
(pH3).
Development of normal shell shape was negatively affected by elevated CO 2-levels in
both trochophore larvae after two days and veliger larvae from day 3 post-spawn (fig.2).
In general, the percent of normally shaped larvae was highest in the ambient group,
lowest in the pH3 group, and intermediate in the pH2 group. However, the ambient group
and pH2 were only significantly different in normally shaped larvae on day 7 and 14, while
the group pH3 was significantly different from the other groups on all days. Feeding
incidence results were based on few replicates on day 3 and 7, but on day 14 the results
show a negative trend from ambient group to the pH3 group.
Figure 1. Mean relative survival on
day 3, day 7 and day 14 based on
the theoretical number of fertilized
eggs that was incubated on day 0.
The mean pH-values are: ambient
pHtot 7.94 (control, pH1), 7.74
(pH2) and 7.54 (pH3). Error bars
denote std (n=4).
124
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Figure 2. Normally shaped larvae,
given as mean % of total number of
live larvae, for three different pHlevels. On day 2 only the hinge was
observed. The mean pH-values are:
ambient pHtot 7.94 (control, pH1),
7.74 (pH2) and 7.54 (pH3). Error
bars denote std (n=4).
Figure 3. Feeding incidence given
as % of the observed larvae. Values
are gives as medians and error bars
are max-min for day 3 (n=2) and day
7 (n=1 in the ambient group, and
n=2 at 780 and 1323 µatm), and
percentiles on day 14 (n=4).
Discussion
The acute effects of OA on the earliest life stages of P. maximus we measured in our
experiment were similar or even stronger than what we measured in the same facility
one year earlier with unfed P. maximus larvae (Andersen et al., 2013). Based on the
results from these two investigations, the earliest life stages of P. maximus seem to be
very sensitive to OA. This is consistent with reports on other bivalve species (summarized
in Andersen et al., 2013), and one may expect future OA scenarios to reduce the ability
for recruitment of great scallop in natural populations. However, similarly with the other
investigations reported on OA-effects on bivalve larvae, we measured the effects of acute
exposure to OA. Some improvement in larval reaction to OA if parents were exposed has
been reported, and one may also expect genetically selection to occur when generations
are exposed to OA. Also, most investigations have focused on the single effect of OA. In
nature, OA will co-occur with climatic changes and increasing temperature or other
climatic stressors may alter the effects of OA on different species. A few studies have
shown temperature increase to have a higher impact on early life stages than OA.
125
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Conclusion
Our results show that P. maximus embryos and early larvae were negatively affected by
acute exposure to elevated CO2-levels using the range projected within the next 50-100
years. To simulate the situation in nature, future work should focus on long term rather
than acute effects. Also, additional effects of climatic stressors should be included in
multi-stressor studies since ocean acidification is co-occurring with climatic changes.
Correspinding author: [email protected]
126
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
BIOTOXINS, POLLUTION AND CONTAMINATION
127
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Pecten Maximus- The black sheep of the mollusc family when it comes to
biotoxin legislation
Dave Clarke1, Conor Duffy1
1Marine
Institute, Oranmore, Galway, Ireland
European legislation in relation to marine biotoxins in molluscs was written to cover all
molluscs but not all molluscs are the same. The legislation, by and large, works well for
mussels, oysters and some of the smaller clam species and when adhered to, offers a
high level of consumer protection and also allows for the opportunity to have a viable
industry. Unfortunately the legislation doesn’t work as well for Scallop (Pecten maximus)
and in some circumstances the legislation prevents the marketing of safe scallops. This
is particularly the case for offshore caught scallops that are eviscerated so as only
adductor mussel and gonad tissue are marketed. Scallops have been shown to
accumulate marine toxins to dangerously elevated levels when the whole animal is
tested. Testing of the compartments edible separately (adductor muscle and gonad)
result in low toxin levels even when the whole animal has marine toxins (ASP, DSP &
AZP) significantly above the regulatory limit.
The Marine Institute have been testing scallops for more than ten years as part of the
National Biotoxin Monitoring Programme. The presentation will cover some of the
difficulties associated with the legislation for marine toxins in scallops and also present
biotoxin monitoring data to demonstrate that scallops that are eviscerated are low risk
once appropriate testing and management of the product and production area is
undertaken.
128
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
RESOURCE MANAGEMENT
129
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Thinking Outside the Box: Spatial Closures and the Maine Sea Scallop Fishery
Trisha Cheney
Maine Department of Marine Resources
The Maine sea scallop (Placopecten magellanicus) fishery was formerly a valuable
winter/spring fishery providing a substantial source of income to fishing businesses and
coastal communities during winter months when other economic opportunities are
minimal. At its height, the fishery landed over 3.8 million pounds of scallop meats in
1981 valued at $15.2 million. Since that time, the fishery has experienced decline,
reaching an all-time low in 2005 with just over 33,000 pounds of sea scallop meats
harvested from Maine waters.
This prompted the Maine Department of Marine
Resources (ME DMR) to initiate a forward-thinking approach to rebuild this once robust
fishery. The ME DMR has been working closely with the industry-based Scallop Advisory
Council and members of the industry through a co-management approach to rebuild a
sustainable resource that will provide stable economic opportunities to coastal Maine
communities. Beginning in 2009, the ME DMR adopted a spatial management approach
modeled after the successful US federal sea scallop fishery that has included targeted
spatio-temporal closures and Limited Access Areas, as well as implementing a 10-year
Rotational Management Plan. The combination of these conservation measures appear
to be effective as demonstrated by 424,547 meat pounds being landed in 2013, a 13
year high, valued at $5,194,553, a 15 year high. Also, participation in the fishery has
grown from 131 active harvesters in 2008 to 421 in 2013 as many of the new entrants
have been displaced from the downturn in the New England multispecies (groundfish)
fishery and complete closure of the winter shrimp fishery for the past two years. This
presentation will focus on the evolution of the current management approach being
employed in the Maine sea scallop fishery, the lessons learned and challenges to its
implementation as well as the current status of the Fishery Management Planning
process being undertaken by the industry.
130
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Towards the establishment of a standardized DNA tool to improve food
traceability and labelling
Sara Vandamme1, Andrew Griffiths1,2, Amaya Velasco3, Kristina Kappel4, Carmen G.
Sotelo3, Ricardo I. Pérez-Martín3, Marc Jerome5, Ute Schröder4, Véronique VerrezBagnis5, Belgees Boufana2, Peter Shum2, Cat Smith6, Helena A. Silva7, Rogério
Mendes7 and Stefano Mariani2
1School
of Environment & Life Sciences, University of Salford, Greater Manchester, UK; 2School of
Biological Sciences, University of Bristol, Bristol, UK; 3Instituto de Investigaciones Marinas, Consejo
Superior de Investigaciones Científicas, Vigo, Spain; 4Max Rubner-Institute, Department of Safety and
Quality of Milk and Fish Products, Germany; 5Ifremer, rue de l’Ile d’Yeu, B.P. 21105, F-44311 Nantes 03,
France; 6Indigo Rock Marine Research Station, Gearhies, Bantry, Co. Cork, Ireland; 7Portuguese
Institute for the Sea and Atmosphere (IPMA), Department for the Sea and Marine Resources, Av.
Brasília, 1449-006 Lisbon, Portugal
In recent years, a number of studies have unveiled unacceptable rates of species
substitution in several valuable products worldwide (e.g. cod, tuna, hake, snappers,
groupers). Although there is a clear set of European Union (EU) regulations relating to
food traceability and labelling, these will only be effective if there is efficient enforcement.
Within the LABELFISH project we focus on a few aspects which may hamper the
effectiveness of these EU regulations, such as the lack of guidance on what techniques
should be applied and what reference database should be assessed to identify species.
We tackled these problems by 1) evaluating the current techniques for fish species
authentication, 2) developing a standard methodology to identify several species and 3)
exchanging reference samples among partners and external laboratories for validation
purposes. The results shown here illustrate the huge potential for the authentication of
marketed finfish products. Furthermore, preliminary results on scampi illustrate both the
need and the opportunity for similar methodologies in invertebrate species.
131
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Queen Scallops (Aequipecten opercularis) in Irish waters: Spatial & temporal
landing patterns, fleet characteristics and estimated CPUE (2003-14)
Declan T.G. Quigley and Declan MacGabhann
Sea Fisheries Protection Authority, Howth, Co Dublin, Ireland
Logbook data relating to the commercial exploitation Queen Scallops (Aequipecten
opercularis) in Irish waters was analysed for the 12-year period, 2003-14. The data
provided insights about spatial (ICES Divisions & Statistical Rectangles) and temporal
(annual, monthly, daily & hourly) landing patterns, fleet characteristics (vessel numbers,
nationalities, lengths, engine power, gear types), and recent trends in CPUE.
An estimated minimum of 6347 tonnes of Queen Scallops was recorded from Irish waters
during the period 2003-14. There was a significant increase in landings during the 3-year
period 2010-12. However, following a peak of 2500 tonnes recorded during 2012, there
was a dramatic reduction (90%) in landings over the last two years; 250 tonnes was
recorded during 2014.
Almost 90% of the landing volume was taken by UK-registered vessels (N=25) and the
remainder by Irish vessels (N=36). The average length and engine power of vessels was
19.7 m and 320 KW respectively; 72% of vessels were within the 15-24 m length range.
The top ten vessels accounted for 92% of the landings, 2 UK-registered vessels
accounted for 60%. It was clear that the vast majority of 61 vessels who recorded Queen
Scallops only done so as an occasional and relatively small by-catch. Dredges (85%)
and demersal trawls (13%) accounted for the vast majority of the volume recorded.
Over 97% of landings were recorded from ICES Division VIa, particularly from Statistical
Rectangle 39E3 (84%). The main landing port was Greencastle, Co Donegal, which
accounted for 89% of the total volume.
The estimated CPUE (kg/KW day) for all gear types employed in 39E3 increased
exponentially from 1.3 in 2007 to a peak of 52.8 in 2010, but thereafter, declined rapidly
to 12.2 during 2014. The latter cycle coincided with an almost 300% increase in vessel
numbers, a significant increase in the use of dredges, and a decline in the use of
demersal trawls.
132
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Modelling larval dispersal of Pecten maximus in the English Channel: a tool for
spatial management of stocks
Eric Thiébaut1,5, Amandine Nicolle2, Julien Ogor1, Franck Dumas3 and Eric Foucher4
1CNRS,
UMR 7144, Adaptation et Diversité en Milieu Marin, Station Biologique de Roscoff, 29680
Roscoff (France); 2ENSTA Bretagne, Pôle STIC/OSM, 2 rue François Verny 29806 Brest Cedex 9
(France); 3IFREMER, Département DYNECO, Technopole Brest-Iroise, BP70, 29280 Plouzané (France);
4IFREMER,
Laboratoire Ressources Halieutiques, Avenue du Général de Gaulle, BP 32, 14520 Port-en-
Bessin (France); 5UPMC Univ Paris 06, UMR 7144, Station Biologique de Roscoff, 29680 Roscoff,
France
The king scallop (Pecten maximus) is one of the most important benthic species of the
English Channel as it constitutes the first fishery in terms of landings in this area. To
support strategies of spatial fishery management, we developed a high-resolution
biophysical model to describe scallop dispersal in English Channel and to quantify the
relative roles of local hydrodynamic processes, temperature dependent planktonic larval
duration (PLD) and active swimming behaviour (SB) on the connectivity between 18
stocks identified from different sources (e.g. ICES data, VMS data). The English Channel
currents and temperature were simulated for 10 years (2000-2010) with the MARS-3D
code and then used by the Lagrangian module of MARS-3D to model the larval dispersal
pathways.
Results were analysed in terms of larval distribution at settlement, the larval retention
rate and the self-recruitment rate, two metrics commonly reported in studies on local
populations’ persistence, and connectivity among stocks. Furthermore, the connectivity
among areas within a stock was assessed in detail on the examples of the two main
stocks in the English Channel (i.e. Bay of Saint Brieuc and Bay of Seine) for which the
distribution of scallops is well documented from annual stock surveys. While larval
transport in the English Channel depends both on the tidal residual circulation and the
wind induced currents, the relative role of these two hydrodynamic processes varied
among stocks so that the intra- and inter-annual variability of dispersal is more or less
important. The main effect of a variable PLD in relation to the thermal history of each
larva was to reduce the spread of dispersal while the swimming behaviour has a minor
133
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
role on larval distribution at settlement. Within a stock, the main sources of larvae for the
stock replenishment depend on both the characteristics of local hydrodynamics and the
spatial heterogeneity in the reproductive outputs. Although self-recruitment plays a major
role for some stocks, the maintenance of other stocks is highly dependent of external
larval supply. Using a graph theoretic approach, three major management units which
act as metapopulation have been identified: the eastern Channel, the Gulf of Saint-Malo,
the SW of England. Complex patterns of exchanges are reported within each
metapopulation with local populations acting as source or sink.
134
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Extreme recruitment events in United States sea scallop fishery
N. David Bethoney and Kevin D. E. Stokesbury
School for Marine Science and Technology, University of Massachusetts Dartmouth, 706 South Rodney
French Boulevard, New Bedford, Massachusetts, USA 02744-1221; Phone: (508) 910-6386; Email:
[email protected]
Introduction
The US sea scallop (Placopecten magellanicus) fishery has grown from a low of 5,500
metric tons landed in 1998 to an average over 25,000 metric tons landed from 2003 to
2014 (NEFSC 2014). Using a unique video survey of the resource, we documented
recruitment patterns during this period. In 2014 we documented the largest scallop
recruitment event ever observed. We examined the spatial distribution and magnitude of
this event and compared it to two previous recruitment events in 2003 and 2009. These
and past (Hart and Rago 2006) examples of large recruitment events suggest that scallop
populations do not grow at a constant rate and instantaneous rates or weighted averages
of recruitment used in current population models may inaccurately describe population
dynamics (Stokesbury 2012, NEFSC 2014).
Materials and Methods
Estimates of scallop densities on Georges Bank and the Mid-Atlantic Bight were
generated using a video survey with a centric systematic sampling design. Stations were
positioned on a 5.6 km grid and a sampling pyramid was lowered to the sea floor four
times at each station (Stokesbury 2004, 2012). Mounted on the pyramid were two
downward facing video cameras, which provided quadrats of 0.60 m2 and 2.84 m2,
respectively. The smaller quadrat size was used to estimate pre-recruit density, as it
gives the best estimate of small scallops (30 to 75 mm shell height) (Carey and
Stokesbury 2011). The time, depth, number of live and dead scallops, latitude and
longitude were recorded at each station. After each survey the video recordings were
reviewed in the laboratory and a still image of each quadrat was captured. The shell
height (mm) of each scallop was measured in the still image. Mean densities and
135
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
standard errors of scallops and sea stars were calculated using equations for a two-stage
sampling design (Stokesbury 2004, 2012). The absolute number of scallops within a
survey area was calculated by multiplying scallop density by the total area surveyed
(Stokesbury 2004).
Results
In 2014, 34.4 billion scallops were observed on Georges Bank. The shell height
frequency distribution was skewed with an average shell height of 51.8 mm (SD = 21.70,
n = 5227). The mean density of scallops was 0.64 scallops per m2 (quadrat area of 3.02
m2, SE = 0.14). This resulted in a total biomass of 87,000 mt (SE = 19,500 mt). Prerecruits (scallops less than 75 mm shell height) totaled about 31 billion, with large
concentrations around the Nantucket Lightship Closed Area (Figs. 1, 2).
In the Mid-Atlantic, 5.5 billion scallops were observed. The shell height frequency
distribution had two peaks with an average shell height of 76.8 mm (SD = 27.07, n =
1704). The mean density of scallops was 0.15 scallops per m2 (quadrat area of 3.12 m2,
SE = 0.01). This resulted in a total biomass of 59,500 mt (SE = 4,000 mt). Small amounts
of recruits, about 3 billion, were mainly located in the southern portion of the survey area
(Figs. 1, 2).
136
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Fig. 1. The number of pre-recruit (scallops less than 75 mm shell height) observed by the SMAST scallop
video survey in 2003, 2009, and 2014. Hatched marks identify portions of closed areas that are periodically
open to scallop fishing.
Fig. 2. The number of pre-recruit scallops observed by the SMAST scallop video survey in the Mid-Atlantic
(black line) and Georges Bank (grey line) from 2003 to 2014. The resource wide video survey was not
conduced in 2013, thus an estimate from this year is not included.
Discussion and Conclusion
In the past 15 years three regional, extreme recruitment events have occurred (Fig. 1).
On average there were 8 billion (SD = 1.4) scallops on Georges Bank and in the MidAtlantic between 2004 and 2012 and 3 billion (SD = 1.1) of these were pre-recruits
(Stokesbury et al. 2011, Stokesbury 2012). In 2003, 12 billion pre-recruit scallops were
observed in the Mid-Atlantic, while the total scallop population in the Mid-Atlantic and
Georges Bank was 16 billion scallops (Stokesbury et al. 2004) (Fig. 2). In 2009, close to
half a billion pre-recruit scallops were observed on several banks and ledges in the Gulf
of Maine (Fig. 1). Scallop densities in these small areas, totaling approximately 300 km 2,
ranged from 1.6 to 4.7 scallops per m2 (Stokesbury et al. 2010). Typical adult densities
over the entire footprint of the fishery are less than 1 scallop per m 2 (Stokesbury et al.
2004). In 2014 a pre-recruit abundance of 31 billion scallops was observed on Georges
Bank, the largest abundance ever recorded and nine times more than the number of
adult scallops (Figs. 1, 2).
137
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
It is possible that the scallop stock-recruitment relationship is so unpredictable that
present models are unable to capture the dynamics of the system (Stokesbury 2012). An
alternative approach could be to focus on the pre-recruit distribution and abundance and
base management decisions and catch predictions on pre-recruit observations (Caputi
et al. 2014). This approach would circumvent the complexities of the stock-recruitment
relationship and aid fisheries managers in capitalizing on these extreme recruitment
events by reducing fishing induced mortality through area closure.
References
Caputi, N. et al. Catch Predictions in Stock Assessment and Management of Invertebrate
Fisheries Using Pre-Recruit Abundance-Case Studies from Western Australia. Rev. Fish. Sci.
22, 36-54 (2014).
Hart, D. R, & Rago, P. J. Long-term dynamics of U.S. Atlantic sea scallop Placopecten
magellanicus populations. N. Am. J. Fish. Manag. 26, 490-501 (2006).
Northeast Fisheries Science Center (NEFSC). 59th Northeast Regional Stock Assessment
Workshop (59th SAW) Assessment Report. US Dept. Commer., (2014)
Stokesbury, K. D. E. Stock Definition and Recruitment: Implications for the U.S. Sea Scallop
(Placopecten magellanicus) Fishery from 2003 to 2011. Rev. Fish. Sci. 20, 154-164 (2012).
Stokesbury, K. D. E., Harris, B. P., Marino, M. C. II & Nogueira, J. I. Estimation of sea scallop
abundance using a video survey in off-shore US waters. J. Shellfish Res. 23, 33-40 (2004).
Stokesbury, K. D. E, Carey, J. D., Harris, B. P. & O’Keefe, C. E. High densities of juvenile sea
scallops (Placopecten magellanicus) on banks and ledges in the central Gulf of Maine. J.
Shellfish Res. 29, 369-372 (2010).
Stokesbury, K. D. E., Carey, J. D., Harris, B. P. & O’Keefe, C. E. Incidental fishing mortality may
be responsible for the death of ten billion juvenile sea scallops in the mid-Atlantic. Mar. Ecol.
Prog. Ser. 425, 167-173 (2011).
138
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
POSTER PRESENTATIONS
139
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
ECOLOGY AND GENERAL BIOLOGY
140
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 1: Biodiversity of the Order Pectinoida (Mollusca: Bivalvia) in Irish Waters
Declan T.G. Quigley
Sea Fisheries Protection Authority, Howth, Co Dublin, Ireland
The Pectinid fossil record dates back to the late Devonian (c.370 million years ago - Mya)
and subsequent radiations during the early Triassic (c.250 Mya) resulted in a successful
and diverse group. Pectinids are found in all the world’s seas, inhabiting a wide variety
of environments ranging from polar to tropical regions and from the inter-tidal zone to
hadal depths. They represent an extremely important part of many benthic communities,
displaying a wide range of shell shapes, sizes, sculpture and color and are characterised
by three different adult life-styles: swimming, byssally attached to hard substrates, and
cemented to rocks by one valve. Several species are of significant economic importance.
Despite their ecological and economic importance, the phylogenetic relationships and
systematics of Pectinids has a long and confusing taxonomic history which is still very
much in a state of flux. More than 5600 species of Pectinidae have been described, albeit
the vast majority as fossils. Indeed, at least 69 species of Pecten have been described
from Irish Carboniferous strata (c.300-360 Mya). In a recent taxonomic revision of the
Class Bivalvia, Bieler et al. (2010) recognised a total of 9 extant families, including 95
genera and 613 species within the Order Pectinoida. The Pectinidae, representing one
of the largest marine bivalve families, accounted for 73% of the genera (69) and 47% of
the species (288).
Although at least 70 extinct Pectinid species have been described from Irish
Carboniferous geological strata (c.300-360 Mya), only 25 living species are now known
to occur in Irish waters today. The extant Irish Pectinid group is currently represented by
18 genera and three families (Anomiidae, 4 spp., Pectinidae, 13 spp., and
Propeamussidae, 8 spp.), including two recently described species (Cyclopecten
ambiannulatus Schein, 1988 and Similipecten oskarssoni Dijkstra, Warén &
Gudmundsson, 2009). However, since the vast majority of species (80%) are relatively
small (maximum shell width <70mm), and a significant percentage (60%) are found in
141
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
poorly explored deep offshore waters beyond the continental shelf (depths >200m), it is
likely that many more Pectinid species await discovery.
Despite the relatively small number of extant Pectinid species reported from Irish waters
to date, a number of noteworthy and unusual specimens have been recorded and many
of these are housed in the collections of the National Museum of Ireland (Natural History
Division) [NMINH], Dublin. The following ten native species which are not represented in
the current NMINH collections would be welcomed: Monia squama, Hyalopecten
pudicus, Palliolum incomparabile, Pseudamussium sulcatum, Catillopecten eucymatus,
Cyclopecten ambiannulatus, C. hoskynsi, Parvamussium permirum, Propeamussium
lucidum, and Similipecten oskarssoni.
The NMINH collections include the largest known specimens of Pecten maximus (214.3
mm) and Mimachlamys varia (103 mm), and the deepest reported record of Anomia
ephippium (1000 m). Although not included in the NMINH collections, the largest known
specimens of Delectopecten vitreus (23.21 mm), Talochlamys pusio (49.6 mm),
Palliolum tigerinum (35.33 mm), Aequipecten opercularis (106.3 mm), and M. varia nivea
(89.17 mm) have been recorded from nearby UK waters. The NMINH collections also
include some interesting Pectinid specimens found attached to unusual biotic (e.g.
Lophelia pertusa, Hiatella rugosa, H. arctica, Cidaris cidaris, Ostrea edulis, P. maximus,
M. varia and Himanthalia sp.) and abiotic substrates (e.g. plastic, metal, floats and stone),
in association with various epifauna (e.g. A. ephippium, Suberites ficus, and Leuckartiara
octona) and epiflora (e.g. Chorda filum and Leathesia sp.), as a component of fish dietary
items (Limanda limanda and Pleuronectes platessa), and as various shell deformities
and aberrant colourations.
142
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 2: Some noteworthy & unusual pectinids recorded from irish waters
Declan T.G. Quigley
Dingle Oceanworld (Mara Beo Teo), The Wood, Dingle, Co Kerry
Although at least 70 extinct Pectinid species have been described from Irish
Carboniferous geological strata (c.300-360 Mya), only 25 living species are now known
to occur in Irish waters today. The extant Irish Pectinid group is currently represented by
18 genera and three families (Anomiidae, 4 spp., Pectinidae, 13 spp., and
Propeamussidae, 8 spp.), including two recently described species (Cyclopecten
ambiannulatus Schein, 1988 and Similipecten oskarssoni Dijkstra, Warén &
Gudmundsson, 2009). However, since the vast majority of species (80%) are relatively
small (maximum shell width <70mm), and a significant percentage (60%) are found in
poorly explored deep offshore waters beyond the continental shelf (depths >200m), it is
likely that many more Pectinid species await discovery.
Despite the relatively small number of extant Pectinid species reported from Irish waters
to date, a number of noteworthy and unusual specimens have been recorded and many
of these are housed in the collections of the National Museum of Ireland (Natural History
Division) [NMINH], Dublin. The following ten native species which are not represented in
the current NMINH collections would be welcomed: Monia squama, Hyalopecten
pudicus, Palliolum incomparabile, Pseudamussium sulcatum, Catillopecten eucymatus,
Cyclopecten ambiannulatus, C. hoskynsi, Parvamussium permirum, Propeamussium
lucidum, and Similipecten oskarssoni.
The NMINH collections include the largest known specimens of Pecten maximus (214.3
mm) and Mimachlamys varia (103 mm), and the deepest reported record of Anomia
ephippium (1000 m). Although not included in the NMINH collections, the largest known
specimens of Delectopecten vitreus (23.21 mm), Talochlamys pusio (49.6 mm),
Palliolum tigerinum (35.33 mm), Aequipecten opercularis (106.3 mm), and M. varia nivea
(89.17 mm) have been recorded from nearby UK waters. The NMINH collections also
include some interesting Pectinid specimens found attached to unusual biotic (e.g.
143
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Lophelia pertusa, Hiatella rugosa, H. arctica, Cidaris cidaris, Ostrea edulis, P. maximus,
M. varia and Himanthalia sp.) and abiotic substrates (e.g. plastic, metal, floats and stone),
in association with various epifauna (e.g. A. ephippium, Suberites ficus, and Leuckartiara
octona) and epiflora (e.g. Chorda filum and Leathesia sp.), as a component of fish dietary
items (Limanda limanda and Pleuronectes platessa), and as various shell deformities
and aberrant colourations.
Corresponding autor: [email protected]
144
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 3: Scallops in 3-D
Deborah R. Hart1, Jui-Han Chang1, Burton V. Shank1, Amber York2 and Scott
Gallager2
1Northeast
Fisheries Science Center, 166 Water St., Woods Hole MA 02543 USA 2Biology Department,
Woods Hole Oceanographic Institution, Woods Hole MA 02543 USA
The NOAA Habcam system is a towed underwater vehicle with paired stereo digital still
cameras synched to four strobes and an array of oceanographic sensors. The stereo
cameras allow the construction of 3-D images by, for example, coloring one image of the
pair as red and the other cyan. We will present some example 3-D images that give a
unique view of sea scallops (Placopecten magellanicus), their environment and behavior.
145
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 4: New insights of the seasonal feeding ecology of the great scallop, Pecten
maximus
Romain Lavaud1,2, Sébastien Artigaud1, Anne Donval1, Fabienne Le Grand1, Philippe
Soudant 1, Tore Strohmeier 3, Øivind Strand3, Aude Leynaert1, Beatriz Beker1, Arnab
Chatterjee1, Jonathan Flye-Sainte-Marie1, Fred Jean1
1Laboratoire
des Sciences de l’Environnement Marin (UMR 6539), Institut Universitaire Européen de la
Mer, Université de Bretagne Occidentale, Rue Dumont d'Urville, 29280 Plouzané, France; 2School of
Renewable Natural Resources, Louisiana State University Agricultural Center, Baton Rouge, LA, 70803,
USA (current address); 3Institute of Marine Research, P.O. Box 1870 Nordness, 5817 Bergen, Norway
Introduction
In coastal environments, the availability of food for benthic suspension feeders depends
on the strong seasonality of hydrological and biochemical conditions. Therefore,
scallops, and more particularly Pecten maximus, must have evolved to develop a plastic
trophic niche, potentially including pelagic and benthic microalgae, protozoans,
zooplankton, dissolved organic carbon and detrital organic matter. In this study we
described the seasonal qualitative and quantitative variations in trophic sources foraged
by the great scallop, in an approach combining three well established trophic markers:
pigments, fatty acids and sterols, in the seawater, digestive contents of P. maximus.
Material and Methods
The study was conducted in the Bay of Brest during the year 2011, from March 14th until
October 24th. On a biweekly to twice-weekly basis, seawater from the water column and
the water-sediment interface and three individuals were collected. Phytoplankton
identification was performed in seawater samples. Pigment compositions and
concentration in seawater filtrates and in the stomach and rectum content were analyzed
by HPLC. Fatty acids and sterols from digestive gland (DG) tissue were analyzed by gas
chromatography.
146
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Results
Feeding activity, assessed by the total amount of pigments in the stomach content,
seemed to be correlated with phytoplankton dynamics of the water column rather than
the water-sediment interface. Fucoxanthin, used as a Bacillariophyceae (diatom) marker,
dominated the pigment concentration detected in the gut of P. maximus. Peridinin,
characterizing Dinophyceae, occurred in high proportions in the gut, as compared to the
low ambient concentration, suggesting a selection of this microalgae group by the
scallop. The proportions of fucoxanthin and peridinin in the stomach and rectum content
alternated in time. This switch of feeding was confirmed by the proportions in the DG of
20:5(n-3), 16:1(n-7) and 24 methylene cholesterol (marking diatoms) and 22:6(n-3),
18:5(n-3) and brassicasterol (tracing dinoflagellates). Chlorophyceae and green
macroalgae, traced by \chlb, 18:2(n-6) and 18:3(n-3) were found in low proportions,
suggesting
they
were
not
actually ingested.
Markers
of
Prymnesiophyceae
(19'hexanoyloxyfucoxanthin and 18:4(n-3)) were also observed at significant levels.
Zeaxanthin, used as a cyanobacteria tracer showed that this microalgae class was not
ingested by the scallops during the monitoring. The proportion of iso 17:0, characteristic
of bacteria, was higher in March and October in the DG of scallops.
Discussion
The clear relationship between pigment concentration and composition in the water
samples and the phytoplankton cell microscopic observations allowed us to validate the
pigment markers. Lipid dynamics in the digestive gland fluctuated less than pigments in
the gut content which can be explained by the fact that the intake of lipids in the tissues
of the organism is a regulated process, smoothed by homeostasis and selective
incorporation mechanisms. The results highlighted the importance of Dinophyceae in the
diet of the great scallop, despite their relatively low presence in the water. On the other
hand, green algae seemed to be neglected, which suggests a capacity of selection of
food sources by P. maximus. The orientation of scallop’s feeding activity toward pelagic
or benthic microalgae varied throughout the year, indicating a capacity to switch from
one source to the other, depending on its availability and probably its quality. Overall, the
ingestion during this study was more closely linked to food sources originating from the
water column and not the water-sediment interface, confirming the importance of pelagicbenthic coupling.
147
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 5: Modelling the distribution of the Great scallop Pecten maximus in the
English Channel: linking physical and biological processes to define scallop
habitat.
Le Goff1, R. Lavaud2, P. Cugier3,F. Jean2, J. Flye-Sainte-Marie2, E. Foucher4, S. Fifas5
1
Institut Mines-Telecom, Telecom Bretagne, CNRS UMR 6285 LabSTICC, Pôle CID, Technopôle Brest Iroise,
CS 83818, 29238 BREST Cedex, France; 2Université de Bretagne Occidentale, Institut Universitaire Européen
de la Mer, Laboratoire des sciences de l'environnement marin (UMR CNRS 6539) Technopôle Brest Iroise,
Plouzané , France; 3Ifremer, ODE/DYNECO/ Laboratoire d’Ecologie Benthique, ZI Pointe du Diable, CS 10070,
29280 Plouzané, France; 4Ifremer, RBE/HMMN/ Laboratoire de Ressources Halieutiques, Station de Port en
Bessin - Av. du Général de Gaulle - BP 32 - 14520 Port en Bessin, France. 5Ifremer, RBE/STH/ Laboratoire de
Biologie Halieutique, ZI Pointe du Diable, CS 10070, 29280 Plouzané, France
Introduction
The great scallop Pecten maximus is currently the most important species in landings
(as well in tons as in value) for the French inshore fleet of the English Channel. A French
scientific program “COMANCHE” funded by the French National Research Agency
(ANR) was conducted to improve our knowledge on the great scallop within the English
Channel ecosystem. In that context, a modelling approach has been proposed in order
to better understand the determinism of the distribution of the great scallop, integrating
both physical and trophic constraints. Thus a 3D bio-hydrodynamical model
(ECOMARS3D developed at Ifremer) providing environmental conditions has been
coupled to a population dynamics model and an individual physiological model of scallop.
Material and method
The population model for the scallop describes the whole life cycle (planktonic and
benthic) and is structured in age classes [1]. The adult benthic compartment is split into
12 annual age classes, each being described by its abundance (ind/m 2). The larval
pelagic compartment is split into ten age classes of three days which results in a total
larval life cycle of 30 days. Each age class is described by the larval abundance in the
water column (ind/m3).
The bioenergetic model, based on the dynamic energetic budget theory (DEB) [2,3]
allows calculating the potential of growth in each part of the English Channel. This
approach let us know where the environmental parameters are favorable enough to allow
148
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
the survival. It gives also informations about adult’s fecundity (intensity and distribution)
that are used in the population dynamic model. These models have been coupled step
by step: (1) the population dynamic model with the hydrodynamic part model of ECOMARS-3D; (2) the growth model with the primary production model (ECO-MARS-3D); (3)
the three models are coupled all together.
Results and discussion
The first coupling was to evaluate mainly the role of hydrodynamic factors on the
establishment of the population in the Channel (larval dispersal by currents). From a
homogenous and unrealistic distribution of scallop as initial condition, the population
reaches a stable state after approximately 30 years, and the biogeographical distribution
obtained is quite similar to the repartition of the well known stock of Pecten maximus in
the English Channel.
Nevertheless densities of Pecten obtained by this first approach are unrealistic and the
second and third steps aims at bringing more realistic biological facts in our model,
especially to explain part of the scallop distribution thanks to their physiology and the
food availability. Results shows again that most of the higher simulated density spots
correspond to the main fishery areas but a more realistic densities are obtained.
Conclusions
Both these approaches contribute to the understanding of the biogeographical
distribution and especially enlighten the respective role of biological or physical factors
in defining P. maximus habitat in the English Channel.
References
[1] Savina, M. and Ménesguen, 2008.A. A deterministic population dynamics model to study the
distribution of a benthic bivalve with planktonic larvae Paphia rhomboïdes in the English Channel
(NW Europe)
[2] Kooijman SALM (2000) Dynamic Energy and Mass Budgets in Biological Systems.
Cambridge: Cambridge University Press.
[3] Lavaud, R. and Flye-Sainte-Marie, J. and Jean, F. and Emmery, A. and Strand, O. and
Kooijman, S. A. L. M. 2013. Feeding and energetics of the great scallop, Pecten maximus,
through a DEB model Journal of Sea Research 10.011.
Corresponding author: [email protected]
149
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 6: Northern distribution of Pecten maximus and Aequipecten opercularis
populations in Norway
Ellen Sofie Grefsrud1, Maria Jenssen2 and Øivind Strand1
1Institute
of Marine Research, P.O. Box 1870 Nordnes, 5817 Bergen, Norway; 2Institute of Marine
Research, P:O.Box 6404, 9294 Tromsø, Norway
In Norway, the great scallop Pecten maximus has its major distribution area in MidNorway. The northernmost find has been reported from Andøy, about 68-69 oN, but this
was a fresh-looking valve and not a living specimen (Soot-Ryen, 1951). The
northernmost recording of a living specimen was at Grønholmen, west off Bodø (67 o 16’
N; 14o 09’ E) (Strand, personal observation). Based on knowledge from monitoring and
recreational diving the northernmost viable populations are assumed to be located south
of Bodø (67o 16’; 14o 22’ E). In Norway the queen scallop Aequipecten opercularis is
distributed from Skagerrak to Lofoten in North Norway. Although some juvenile living
specimens have been taken as far north as Vågsfjord in Troms (68 o 52’ N; 16o 53’ E),
the northernmost limit has been set to Gildeskål (66o 59’ N; 14o 3’ E) (Soot-Ryen, 1951).
The queen scallop is not a commercially exploited species in Norway and not much
attention has been given to any change in distribution area during the last decades.
As a part of the ongoing “National marine habitat mapping program” areas of high
abundance of king scallop P. maximus and Iceland scallop Chlamys islandica has been
mapped in Norwegian coastal areas The combination of a long coast line (100 000 km
including the mainland coast and islands) with high variability in bottom topography and
sediment types over short distances, makes scallop mapping a challenge. The scallop
beds are mapped using a vessel-towed camera platform collecting real-time video along
survey lines. These lines are chosen combining topographic information from sea maps
with anecdotal knowledge about scallop distribution pattern. In 2012 great scallop
populations was found north of Bodø at Helligvær (67 o 26’ N; 14o 3’ E). In 2013 the
Lofoten area was mapped and live P. maximus were found at low densities at Sund and
Skjellfjorden (68o 1’ N; 13o 13’ E) and a small but dense population was found in Nusfjord
68o 2’ N; 13o 21’ E). This is, to our knowledge, the northernmost verified live P. maximus
150
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
population in Norway. During the same survey high abundances of A. opercularis were
observed throughout the strait of Risøysundet and as far north as 68 o 59’ N; 15o 39’ E.
Juveniles of this species was observed in Vågsfjord before 1950, but to our knowledge
this is the first verified observation of an adult population this far north.
Soot-Ryen (1951) noted that both P. maximus and A. opercularis were newcomers to the
area of Lofoten and northwards. As both are considered southern species the distribution
pattern found in the mapping study may be a result of the ongoing warming of the coastal
waters, making these species able to settle and reproduce further north than recorded in
the early 1950’s.
References
Soot-Ryen T, 195. New records on the distribution of marine mollusca in Northern Norway.
Astarte, 1: 1-11.
151
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
AQUACULTURE
152
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 7: Making sense of water quality – the AquaMMS Project: Development of a
portable integrated sensing platform to monitor important, but technically
difficult parameters in aquaculture
Gyda Christophersen1, Dag Hammer1, Iain S. Young2, Simon Maher2, Lei Su2, Behnam
Bastani2, Liam Lewis3, Urszula Salaj-Kosla3, Jean-Michel Mortz4, Pat O’Leary5, Allan
MacMaster6, Mads Dorenfeldt Jenssen7, Steve Taylor8
1Teknologisk
Institutt as, Oslo, Norway; 2Inst.of Integrative Biology/ Dep. of Electrical Engineering &
Electronics, University of Liverpool, UK; 3Centre for Advanced Photonics and Process Analysis, Cork
Institute of Technology, Ireland; 4BAMO-IER GmbH, Mannheim, Germany; 5Faaltech Technologies,
Cork, Ireland; 6Anglesey Aquaculture Ltd, Beaumaris, UK; 7Telemarkrøye AS, Fyresdal, Norway; 8QTechnologies, Liverpool, UK
Introduction
Seafood production through intensive aquaculture in water reuse and recirculating
systems (WRAS and RAS) is increasing. This may be the solution for shellfish rearing in
general and for scallop juvenile production in particular. A number of unwanted
substances may accumulate to unsafe levels for the organisms in WRAS and RAS
systems. The AquaMMS project was created to develop a new robust and real-time
online multi-sensor monitoring device for the aquaculture industry. The device will use
an array of advanced approaches, including mass spectrometry and optical technologies,
to measure a wide range of parameters that can affect the water quality in aquaculture
farms.
Material and Methods
Mass spectrometers (MS) analyse substances according to the mass-to-charge ratio
(m/z) of constituent molecules. This allows both qualitative and quantitative
determination. A low power, small footprint membrane inlet mass spectrometer is utilised
which allows real time in situ monitoring of dissolved gases and organic compounds in
the water matrix. The fluorescence sensor particularly targets harmful substances such
as heavy metal ions, bromides, nitrides, nitrates and ammonium. Not all of compounds
153
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
of these elements are detectable by the MS methodology utilized, so the optical
fluorescence sensor complements the MS sensor providing additional and important
sensing capabilities to the combined instrument. An optical pH sensor is being developed
for integration with the other two components of the AquaMMS instrument. The
AquaMMS Monitor system will be responsible for collecting data from one or more
instruments and present the status of the system on a screen showing the measured
data in a suitable manner for the farmer.
Results
The AquaMMS system is a novel sensor combining MS and UV fluorescence as
orthogonal, complementary techniques. Both dissolved gases and VOCs can be
monitored to sub ppm levels by the MS sensor, whereas heavy metal ions are monitored
by using UV technique. The optical pH sensor has been developed by using the sol-gel
process. The pH-sensitive dye is immobilized within the silica thin film made by acidic
hydrolysis and condensation of tetraethyl orthosilicate (TEOS) and deposited onto the
glass slide through the dip-coating process. The instrument has been optimized for
monitoring of dissolved gases (CO2, O2, and N2) and volatile organic compounds of
interest in an aquaculture environment. On site testing focuses on real time monitoring
of the water quality in response to farming practices.
Discussion
The risk of sudden mass mortalities and stress may be hindered by having proper control
and monitoring of the water quality. It is expected that the application of the AquaMMS
technology will reduce the risk of chronic levels of harmful substances impacting growth
and survival of the fish/shellfish in WRAS and RAS farms.
Conclusion
This new technology will provide immediate advanced warning of potential harmful
substances which allow the aquaculture/scallop farmer time to take a management
decision like increasing water flow or initiate other sorts of water treatment to counteract
the problem of suboptimal water quality.
154
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Acknowledgement
The AquaMMS project is a “Research for the benefit of SMEs” project which has received
funding from the European Union’s Seventh Framework Programme for research,
technological development and demonstration under grant agreement no 606496. Web
site address: http://www.aquamms.com/
155
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 8: Field testing of novel antifouling coatings for the aquaculture industry –
preliminary results
Sandra E. Shumway1, Alex Walsh2, Stephan G. Bullard3, Steven W. Fisher4
1Department
2Netminder,
of Marine Sciences, University of Connecticut, 1080 Shennecossett Road, Groton, CT 06340 USA;
LLC, 25 Research Road, East Falmouth, MA 02536 USA; 3University of Hartford, Hillyer College, 200
Bloomfield Avenue, West Hartford, CT 0611; 4Netminder, LLC, 1155 Youngsford Road, Gladwyne, PA 19035
Biofouling is ubiquitous in the marine environment and inarguably one of the most serious
problems facing aquaculture. Considerable research has been carried out during the past
several decades to develop means of prevention and control of biofouling, yet most methods are
designed to remove fouling once established. Currently no cost-effective means of eradication
or control are available. Novel non-toxic antifouling coating technology developed for the
aquaculture industry is presented which relies on the photoactive generation of hydrogen
peroxide to reduce the settlement of biofouling organisms rather than the leaching of pesticides.
Traditional antifouling paints used for boat hulls are based on copper, and often contain booster
biocides. Copper is toxic to shellfish, impairs olfactory organs of anadromous fish, and persists
in the environment.
Photoactive release coatings provide a viable solution for minimizing
biofouling on aquaculture netting, cages, and tanks.
Biofouling resistance of photoactive
coatings was evaluated at the University of Connecticut (Avery Point) for 12 months. Biofouling
weight and percent coverage of test surfaces is reported. Antifouling efficacy of photoactive
coatings on nylon and HDPE netting, PVC-coated cage used for shellfish and finfish aquaculture,
and experimental panels was determined over 6 months in several geographic regions globally
through a controlled series of biofouling settlement assays. Toxicity of coating materials to
scallop and oyster larvae at concentrations of 0.02, 0.2 and 2.0 ppm is reported and compared
to the toxicity of copper-based antifouling paint. Results from antifouling resistance testing
demonstrate the promise of photoactive coatings for biofouling control.
156
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
FISHERIES
157
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 9: Assessing benthic communities in 3D: Sea scallops swimming of the
seafloor produce significant measurement error in 2D
Scott M. Gallager1, Amber York1, Deborah R. Hart2, Jui-Han Chang2, Burton V. Shank2
1Biology
Department, Woods Hole Oceanographic Institution, Woods Hole MA; 2Northeast Fisheries
Science Center, 166 Water St., Woods Hole MA 02543 USA
Supported by NOAA’s Office of Science and Technology, the latest version of a habitat
mapping camera system, HabCam-4, provides the most extensive picture of the seafloor
yet achieved. The system uses stereo optical imaging and side scan acoustics to
accurately survey commercially important benthic organisms such as sea scallops and
some species of groundfish and enables quantification of habitat. Quantifying seafloor
structure is now possible with stereo imagery, where depressions in the seafloor and
other microhabitats are plainly visible, and even flatfish are easily segmented against the
background. HabCam-4 has been used in NOAA’s annual scallop survey conducted in
June and July along the northeast continental shelf since 2012. Over seven million stereo
paired images are collected for each survey. The stereo information is now used to
quantitatively and accurately measure scallops although they may be found in all
orientations, swimming of the bottom, and partially buried in the sediment. The errors
associated with 2D versus 3D measurements of shell dimensions can exceed 30% due
to angular displacement and up 100% due to distance from the camera for swimming
scallops. Future assessments of scallops that include those that are swimming require
stereo measurements to ensure accurate results
158
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 10: Optimization of SeaFloorExplorer.org: A citizen cyber science project to
asses sea scallop distribution, benthic community composition and habitat
through public engagement
Scott M. Gallager1, Amber York1, Deborah R. Hart2
1Biology
Department, Woods Hole Oceanographic Institution, Woods Hole MA; 2Northeast Fisheries
Science Center, 166 Water St., Woods Hole MA 02543 USA
SeaFloorExplorer.org is a Citizen Cyber Science (CCS) project that currently enlists tens
of thousands of people in analyzing benthic imagery produced by HabCam, the Habitat
Camera system, with the intent of providing analyses of extremely large image datasets
that would otherwise go unprocessed for lack of manpower. As part of ongoing annual
surveys of sea scallops and groundfish, our collaboration with NOAA is producing
millions of images per year along the northeast continental shelf that contain information
on the location and abundance of a wide range of benthic organisms, predator prey
interactions, substrate composition, and migration patterns in relation to climate change.
This project allows us to tap into the wealth of information contained within these images
and provide a unique, ongoing time series of benthic data for the foreseeable future. This
study is developing algorithms for the optimal quality control and utilization of CCS effort
in the annotation of HabCam images for the identification of sea scallop Placopecten
magellanticus, groundfish and other organisms as well as substrate in the image. These
algorithms are incorporating information derived from the image data directly and the
unsupervised annotation process (convergence of multiple CCS annotations to a
common attribute), and information from supervised classification of annotations, in
which images ground-truthed by experts are presented to CCS annotators at intervals to
assess their accuracy. Extraordinary accuracy (>95%) can be expected when CCS data
are carefully processed and vetted.
159
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 11: An application for AUV seabed imaging to estimate Placopecten
magellanicus incidental mortality
Danielle Ferraro, Art Trembanis, Doug Miller, Hunter Brown
School of Marine Science and Policy, University of Delaware, USA
Introduction
The sea scallop (Placopecten magellanicus) fishery in the northwestern Atlantic is
considered a management success after regulations and fishing methods were reformed
following record population lows in 1993. Now, the sea scallop stock in the exclusive
economic zone off of the northeast coast of the United States is one of the most abundant
and lucrative fisheries in the country. Dredging is carried out for surveying or commercial
fishing purposes by towing one of several types of dredges along the seafloor, collecting
scallops and other benthic fauna in its path. The fraction of scallops that are fatally
damaged after encountering the dredge but pass through the rings or otherwise remain
uncaptured are considered losses to incidental mortality. We aim to estimate scallop
incidental mortality from seafloor images within a Before-After-Control-Impact (BACI)
study utilizing images collected by an autonomous underwater vehicle (AUV). Using an
AUV enabled us to survey
the
benthos
intrusive
in
remote
a
non-
sensing
manner that is repeatable
with
precise
robotic
dead scallop
example
positioning control. Here, our
objective is to ensure the set
of images can be accurately
post-processed
and
live scallop
examples
annotated so that incidental
mortality estimates can be
computed confidently from
the dataset.
Example of a seabed image containing both live and dead
scallops taken with the Gavia AUV (inset).
160
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
Materials and Methods
This study utilized a Gavia AUV to photograph the seafloor in the Elephant Trunk Closed
Area, a 60 x 60 mile region of sandy substrate off the southeastern coast of Delaware.
The AUV’s downward facing color camera is located in the nose cone of the vehicle and
is equipped with a flash strobe lighting system. We designated three sites in the Elephant
Trunk Closed Area
that were each split
into three sub-sites.
The
AUV
photographed
each
sub-site at 2 frames
per
second
in
a
lawnmower
pattern
made
of
up
10
parallel lines with a
The three study sites in the Elephant Trunk Closed Area and the three
sub-sites within each (inset).
length of ~750 m.
The 10 lines were
spaced 2 m apart, allowing for enough overlap both along and between lines to produce
100% image coverage of the seabed. Each sub-site was either dredged with low intensity
(1 tow), high intensity (5 tows), or not at all (control), and then immediately resurveyed
with the AUV. Eight weeks later, the sub-sites were resurveyed again by the AUV
operating along the same mission lines in order to evaluate the recovery (or lack thereof)
of the seabed scallop communities.
Results
Approximately 230,000 images were taken at the Elephant Trunk at 2 m constant height.
The images vary in brightness and contrast with respect to the time of day during
collection. Images were batch enhanced using a color model and brightness gain that
best clarified the seabed over the variety of conditions observed. Scallops are easily
visible in the corrected photos and dead animals are visually distinct from live based
upon disarticulation or shell damage. The AUV’s camera was calibrated with the Camera
Calibration Toolbox for MATLAB that generates intrinsic and extrinsic parameters based
on a series of underwater images of a planar checkerboard. We noted slight barrel
161
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
distortion, which was largest at image edges. Because of the sheer abundance of seabed
photos taken, it was necessary to create a streamlined photogrammetric image analysis
process. We designed a scallop image annotation software (SIAS) that allowed us to
load the post-processed seabed images into a user-friendly, click-driven GUI. We
completed beta testing of SIAS in which users were able to successfully annotate a series
of images, including the presence or absence of scallops (live or dead), the bed type,
and image clarity. Upon the submission of each annotated and object-demarcated
image, a report was created in a relational database linking the annotated image to the
objects it contains and
the user. This will enable
us to query the database
and
create
data
summaries from which
our
final
incidental
mortality estimates will
be drawn.
Scallop image annotation software (SIAS) being used to annotate a
seabed image.
Discussion and Conclusion
A variety of factors need to be taken into consideration before parameters can be
estimated or calculated from image datasets. Lens distortion can impact the relative
length frequency distributions of scallops, which is commonly used to measure
population dynamics as well as investigate the stability of recruitment. Our results
indicate that lens distortion in our AUV’s camera is slight, but may offset measurements
of shell length for scallops around the edges of the image frame. There is also a need for
standardized photogrammetry software to precisely acquire data from image datasets.
The development and initial use and evaluation of SIAS have demonstrated that large
sets of images can be successfully streamlined into user-friendly annotation software.
Analyzing 100% of the collected images by training a group of analysts to adhere to strict
annotation guidelines will enable us to standardize the process and retrieve the most
accurate estimates of population incidental mortality.
162
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 12: Catch efficiency in a rotational diver based fishery of the scallop Pecten
maximus in Norway
Øivind Strand, Ellen S. Grefsrud, Tore Strohmeier
Institute of Marine Research, Bergen, Norway
The great scallop Pecten maximus is distributed along the European Atlantic coasts,
north to Lofoten Islands in Norway (69N). Dredge exploitation of great scallop in Norway
has been impeded by the unfavourable bottom conditions, and scuba diving has been
the only harvesting method. A commercial diver fishery was developed during the early
1990s in the main fishing areas west of Trondheim (64N), and data on catch appeared
from a statutory marketing data. Since 1999 the catch has been 400–800 tonnes with a
value of 2–3 million Euro.
Since the fishery developed, the possibility of over-exploitation of the harvestable stock
has been an issue of concern. The fishery was initially not regulated, while sale of
scallops was regulated through licensed distributors. The increase in diver participation
in the scallop fishery during 1998–2000 incited the Norwegian Labor Inspection Authority
to set new requirements on diver certification for scallop harvesters. This restricted the
recruitment of diver-fishermen and contributed to regulate the fishing effort. Based on
input from a reference group representing industry, management authorities and
research, a minimum landing size of 100 mm shell length was implemented in 2009 for
both commercial and leisure catch. Suggested management measures on principles of
closed areas were refused based on cost-benefit considerations on enforcement and an
appraisal of the existing rotational fishery between areas applied by the main harvesters.
The anecdotal experience is that the harvestable stock is restored after 2–4 years. It is
unclear to what extent restoration of the stock is caused by growth into legal size and/or
migration of scallops from deeper beds, the latter being contended as dominant by the
fishermen.
Data on individual diver catch per dive (CPUE) has been extracted from log books during
the period 2003–11. In a diver-fishermen team a diver may catch 150–300 kg scallops
163
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
per day (3–4 scallops per kg), 3–4 days a week. The individual diver catch efficiency
tends to increase over several years until it levels out and is believed to be more
regulated by scallop abundance on the beds. Development of individual catch efficiency
will be presented and discussed in relation to the use of these data as indices of stock
development and an assessment of the self-imposed rotational exploitation strategy in
the diver-based fishery.
164
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 13: Developing effective cooperative research methods for a small-scale
closure area in coastal Maine
Caitlin Cleaver1; Skylar Bayer; Erin Owen3; Carla Guenther4
1Hurricane
Island Foundation, 2University of Maine, 3Husson University, 4Penobscot East Resource
Center
Introduction
Fisheries managers, scientists, and fishermen are at a critical juncture with regard to the
future ecological sustainability of Maine fisheries and an aging population of fishermen
with limited access for the next generation. To resolve these issues, creative, adaptive
management and research initiatives are needed to restore the ecological resilience and
species diversity of the Gulf of Maine. Scallop fishery managers implemented a rotational
closure system to rebuild inshore sea scallop stocks in Maine coastal waters. However,
little is known about how the closures benefit resident P. magellanicus populations and
adjacent fished areas. In October 2013, scallop harvesters, managers and researchers
implemented the industry-derived Lower Muscle Ridge Closed Area, a three-year closure
in western Penobscot Bay, Maine. Scallop harvesters hope to understand the effect of a
small-scale closed area in rebuilding inshore stocks and develop a cooperative project
approach and monitoring protocol, involving scientists and harvesters that can be
implemented by the Maine scallop industry where interest in similar cooperative
approaches exist along the coast.
Material and Methods
To develop a cooperative approach that could be successfully implemented by industry
members, scientists and managers, the project team discussed survey methods that
would collect data necessary to determine how small-scale closed areas affect P.
magellanicus population density, abundance and age and size distributions while
engaging harvesters throughout the process. To determine P. magellanicus density and
abundance, we conducted dive and drop camera surveys in and adjacent to the Lower
Muscle Ridge Closed Area in western Penobscot Bay, Maine while working from
165
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
commercial fishing vessels and dive surveys in and adjacent to the Ocean Point Closed
Area near Boothbay Harbor, Maine. To maintain strong communication among the
project team, we meet in-person quarterly, provide regular email updates, and revisit
goals as a group.
Results
The project began in June 2013 when harvesters initiated discussions with a local
nonprofit organization about closing Lower Muscle Ridge to harvesting. The organization
then facilitated meetings with state managers, the harvesters, and scientists. A
cooperative project approach was developed at subsequent meetings where harvester
input was taken into consideration in survey design. Commercial fishing vessels owned
by harvesters were used as research platforms and we have successfully completed two
field seasons in monitoring the Muscle Ridge Closed Area.
Discussion
We have learned through the collaborative research approach important factors to a
successful cooperative research project including the timing of meetings to
accommodate various schedules, recognizing the true cost of peoples’ involvement and
developing ways to adequately compensate them for their contribution, and developing
a data use and sharing policy that guides how and with whom project results are shared.
This project models cooperative partnerships between researchers and fishermen and
increases the state’s capacity to collect data about scallop population dynamics.
Fishermen involved in this project see it as an opportunity to maintain the local scallop
resource and empowers them to participate in management discussions. Fishermen
partners have been engaged throughout, from initiating closure implementation to
helping with data collection. This engagement is essential in redefining the future of the
fisheries management process.
Conclusion
Project findings will contribute to identifying components necessary to developing a
cooperative research approach that emphasizes long-term harvester participation and
affordability.
166
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PHYSIOLOGY, BIOCHEMISTRY AND GENETICS
167
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 14. Expression of genes involved in multixenobiotic resistance (MXR) in
different tissues of Pecten maximus (Linnaeus, 1758)
Pablo Ventoso, Roi Martínez-Escauriaza, José L. Sánchez, M. Luz Pérez-Parallé and
Antonio J. Pazos.
Departamento de Bioquímica y Biología Molecular. Instituto de Acuicultura. Universidad de Santiago de
Compostela. 15782. Santiago de Compostela. Spain.
Introduction
The multixenobiotic resistance mechanism (MXR) acts as a first line of defence against
environmental toxins. Multixenobiotic resistance genes encode for a set of membrane
transporter proteins, belonging to the superfamily of ABC (ATP binding cassette)
proteins, responsible for the active transport of toxins across the cell membrane. Several
studies have demonstrated the presence of MXR pumps in aquatic organisms (Bard,
2000). In this study we investigated, by quantitative real time PCR (RT-qPCR), the
expression pattern of five genes involved in MXR in different tissues of the scallop Pecten
maximus. These genes belong to abcb (mdr1 and mdr2), abcc (mrp1 and mrp2) and
abcg (abcg2) families.
Material and Methods
Total RNA was extracted from digestive gland (DG), gill (GI), female gonad (FG) and
male gonad (MG) of adult scallops by using NucleoSpin RNA II (Machery-Nagel). The
first strand cDNA was synthesised from 0.5 µg of total RNA using the iScript cDNA
Synthesis kit (Bio-Rad) according to the manufacturer´s protocol. Five target genes were
analysed: mdr1, mdr2, mrp1, mrp2 and abcg2. Moreover, four candidate reference
genes, gapdh, ndufa7, cox1 and ef1a (Mauriz et al., 2012), were evaluated using three
software applications (NormFinder, geNorm and BestKeeper).
RT-qPCR was performed on a Bio-Rad iCycler iQ machine. The PCR final volume was
20 μl, containing 4 μl of 1:5 diluted cDNA (500 ng of cDNA), 10 μl SsoFast EvaGreen
Supermix (Bio-Rad), 400 nM forward and reverse primers (Table 1), and 4.4 μl PCR-
168
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
grade water. The cycling conditions were as follows: 30 s at 95ºC, and 40 cycles of 5 s
at 95ºC followed by 10 s at 60ºC and 10 s at 75ºC.
The gene expression levels in different tissues were compared using ANOVA followed
by a posteriori Tukey's HSD test (IBM SPSS Statistics 19.0 package). Differences of
P<0.05 were considered significant.
Table 1. Primers used in this study, amplicon length (bp) and efficiency (E).
Gene
Sense primer (5’-3’)
Antisense primer (5’-3’)
Amplicon E
mdr1
GGTTTCTGCGTACAGTATTTG
GCCATAAAAGGTGTAAGTGAC
107
0.88
mdr2
GAATCTGGAGAGCTGAACACC
GCCGTAGTAGAAGCCAATCG
135
0.86
mrp1
GCTGAAGCTGTATGCCTGGG
CAGCAAAGGTCACCAAGGAC
158
0.89
mrp2
TTGCTGGCTTTGGATCTCTC
AAGAACCTCTGTGATGACCT
128
0.88
abcg2
GGCAGATTGATGATGACTGTAC
AAGAGTTCTACAGCAGACAGG
106
0.88
gapdh TCCGGATGTGTCTGTTGTTGAC
TTCAGATCTCCATCAGCTGCAC
102
0.89
ef1a
TGAGCGGTCTCGAACTTCCAC
100
0.81
ndufa7 ATTACACACGAGATGGACGCTG
ACATCAGAGCTGGCTGTTTCAG
115
0.89
cox1
AGACCTAGGCCGATTTCCAAAC
119
0.84
AGGGCTCCTTCAAGTATGCCTG
AGTGGAGAACTATTGGGTGTGC
Results and Discussion
Quantification cycle (Cq) values were transformed to quantities (Q) by using the equation:
Q = (1+E)–Cq. For accurate quantification of gene expression a normalisation using
internal genes must be performed. The normalization factor was the geometric mean of
the quantities (Q) of the reference genes most stably expressed: ndufa7, gapdh and ef1a
(Table 2).
Table 2. Ranking of candidate reference genes in Pecten maximus.
Rank
1
2
3
4
Normfinder stability
ef1a
0.207
ndufa7
0.211
gapdh
0.721
cox1
1.110
GeNorm average M
ndufa7-gapdh
0.74
ndufa7-gapdh
0.74
ef1a
0.91
cox1
1.31
BestKeeper r
ef1a
gapdh
ndufa7
cox1
0.93
0.92
0.89
0.21
Significant differences in gene expression among tissues were found, except for mrp1
gene (Fig. 1). The highest expression level of mdr1 was found in the digestive gland, and
those of mdr2 and mrp2 in the gills. The abcg2 gene was expressed at similar level in all
169
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
tissues except the male gonad, which showed the lowest levels. The digestive gland is
involved in the biotransformation of xenobiotics, while the gills can act as barriers
between the organism and its environment. Our data are in agreement with other studies
in marine bivalves (Kingtong et al., 2007; Miao et al., 2014, Xu et al., 2014).
b
a
a
a
a
a
a a
b
a
a a
a
a
a,b
b
b,c
a
b
c
Fig. 1: Box-and-whisker plots showing the normalized gene expression relative to the
mean expression of mdr1. For a given gene, different letters above the bars denote
significant differences (P<0.05) between tissues.
Conclusion
Genes from the ABC superfamily (mdr1, mdr2, mrp1, mrp2 and abcg2), putatively
involved in multixenobiotic resistance mechanism (MXR), showed differential expression
between tissues of P. maximus. In general, higher levels of expression were observed in
the digestive gland (the main organ responsible for biotransformation processes in
bivalve molluscs) and the gill (which has a barrier function). These findings suggest the
implication of these genes in MXR.
References
Bard S.M., 2000. Aquatic Toxicology, 48: 357–389
Kingtong S., et al., 2007. Aquatic Toxicology 85 (2007) 124–132
Mauriz O., et al., 2012. Aquaculture, 370-371: 158-165
Miao J., et al., 2014. Ecotoxicology and Environmental Safety 110: 136–142
Xu Y.Y., et al., 2014. Aquaculture 418–419: 39–47
170
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 15: Scallop myosin overview: An exemplar molecule for folding to form the
shut-down state and flexibility within the heads applicable to all muscle myosin-2
molecules
Peter D Chantler 1, Peter J Knight 2, Neil Billington 2, Hyungsuk Jung 3, Stan Burgess 2,
Derek Revill 2, Kavitha Thirumurugan 2, Bridget Salzameda 4, Christine Cremo 4, Joseph
Chalovich 5, Hitesh Patel 1
1
Department of Comparative Biomedical Sciences, Royal Veterinary College, University of London,
London NW1 0TU UK; 2 School of Molecular and Cellular Biology and Astbury Centre for Structural
Molecular Biology, University of Leeds, LS2 9JT UK; 3 Division of Electron Microscopic Research, Korea
Basic Science Institute, 52 Eoeun-dong, Daejeon 305-333, South Korea; 4 Department of Biochemistry
and Molecular Biology, University of Nevada School of Medicine, 1664 N. Virginia Street, Reno, NV
89557 USA; 5 Department of Biochemistry and Molecular Biology, Brody School of Medicine, East
Carolina University, Greenville, North Carolina 27858-4354 USA
Negative stain electron microscopy and single particle imaging and processing of scallop
striated muscle myosin-2 molecules and head subfragment-1 (S1), has proven capable
of resolving significant amounts of structural detail, which has been compared with
smooth and striated myosins from vertebrate sources. The overall appearance of the
motor and the lever is similar in scallop, rabbit and chicken S1. Furthermore, the folded,
shutdown, structures of both vertebrate smooth muscle myosin-2 and scallop striated
adductor myosin appear remarkably similar at this degree of resolution. Both aspects
are addressed in this overview.
The molecular lever, which extends from each myosin head, is found to vary in its angle
of attachment to the motor domain, with a hinge point located in the so-called pliant
region between the converter and essential light chain of the lever. The Gaussian spread
of angles of flexion suggests that flexibility is driven thermally, from which a torsion spring
constant of ~23 pN·nm/rad2 is estimated on average for all S1 types, which is equivalent
to an apparent cantilever-type stiffness at the tip of the lever of 0.37 pN/nm. Because this
stiffness is lower than recent estimates from myosin-2 heads attached to actin, we
suggest that binding of the myosin head to actin leads to an allosteric stiffening of the
motor-lever junction.
171
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
In the shutdown myosin monomer, not only are the two heads compactly packed
together, but the long tail is folded into three closely-packed segments that are
associated chiefly with one of the heads. Sequence comparisons among both the RLCs
and segment 3 of the tail suggest that folding of the tail is stabilised by ionic interactions
between the N-terminal sequence of the RLC and the tail, and that phosphorylation of
the RLC could upset these interactions. Close packing of the three tail segments may
use the same ionic interactions between segments that stabilise interactions between
extended tails in thick filaments. Our results support the view that interactions between
the heads and the distal tail perform a critical role in reducing basal ATPase activity of
myosin 2 molecules in the shutdown state.
172
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 16: Characterization and expression of Peroxiredoxin and HSP70 genes
involved in immune defense of Argopecten purpuratus scallop
Roxana González1-2, Katherina Brokordt2, Claudia Cárcamo2, Federico Winkler2, Luis
Mercado3 Teodoro Coba de la Peña4
1Magíster
en Ciencias del Mar, Facultad de Ciencias del Mar, Universidad Católica del Norte, Larrondo
1281, Coquimbo, Chile. 2Laboratory of Marine Physiology and Genetics (FIGEMA), Centro de Estudios
Avanzados en Zonas Áridas (CEAZA), Universidad Católica del Norte, Larrondo 1281, Coquimbo, Chile.
3Institutode
Biología, Pontificia Universidad Católica de Valparaíso, Chile. 4Instituto de Ciencias Agrarias,
Consejo Superior de Investigaciones Científicas (CSIC), Madrid, España.
Introduction
Mollusks, as most invertebrates, only possess an innate immune system and is
composed by humoral and cellular (mediated by the haemocytes) defense mechanisms.
Peroxiredoxin (Prx) and HSP70 are among the molecules synthesised as part of the
humoral response. In invertebrates, Prx and HSPs are immune effectors. Prx are a
ubiquitous family of enzymes that represent one pivotal role in defense against reactive
oxygen species (ROS) generated during the macrophage active immune response.
HSPs are immune effectors (acute-phase proteins) and have been described as potent
activators of the innate immune system. The aim of this study was to characterize the
gene structures of Prx and HSP70; and the expression pattern of these genes in
haemocytes of immuno-stimulated scallop Argopecten purpuratus.
Material and Methods
Adult A. purpuratus (n = 192) were collected from a scallop farm and kept in aerated
seawater at 16 °C for one week before the challenge. 96 scallops were injected with dead
bacteria Vibrio splendidus (1×107 CFU /individual in 100 ul of sterile seawater). Another
group of 96 scallops were injected with 100 ul of sterile seawater (injection control).
Sixteen individuals from each group were randomly sampled at 2, 6, 12, 24, 48 and 72 h
into the experiment. The haemolymph from the control and the stimulated groups were
collected by using a syringe from the adductor muscles. The haemolymph samples were
173
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
immediately centrifuged at 600 x g, 4 °C for 5 min to harvest the haemocytes. The
haemocyte pellets were immediately used for RNA extraction. Total RNA was extracted
using SV Total RNA Isolation System (Promega). By using primers designed from
conserved regions, RACE (rapid amplification of cDNA ends) was performed to isolate
both the entire coding regions and part of the untranslated regions (UTRs) of Prx and
HSP70. The cDNA was obtained by reverse transcription with Affinity Script QPCR
cDNA Synthesis Kit (Agilent), and the qPCR was realized using Maxima SYBR
green/ROX qPCR Master Mix (Thermo Scientific).
Results and Discussion
The cDNA clone corresponding to ApPrx is 720-bp full length containing a 567-bp open
reading frame (ORF). The HSP70 cDNA clone of A. purpuratus is 2077-bp full length with
a 1965-bp ORF. The deduced proteins contain 188 and 654 amino acids, respectively.
The mRNA transcript of Peroxiredoxin (ApPrx) could be detected both in the treated
(injected with the bacteria) and control (injected with SSW) groups at a low level,
excepted in scallops treated scallops 12 and 24 h post challenge (Fig. 1A). These
scallops showed around 5 times more Prx mRNA transcript than other challenged
scallops. Thus a clearly time-dependent expression pattern of APprx was observed after
the scallops were challenged by Vibrio splendidus. The mRNA transcript of HSP70
(ApHSP70) were also detected both in the treated and control groups at a low level,
however a small but significant over expression was observed in treated scallops at 24
h post challenge (Fig. 1B).
Our results indicated that Peroxiredoxin and HSP70 could play important roles in
mediating the immune response in A. purpuratus.
Corresponding author: [email protected]
174
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 17: Investigation of tonic muscle recruitment in swimming scallops using
behavioural techniques and electromyography (EMG)
Isabelle Tremblay1,2, Roger P. Croll3, and Helga E. Guderley1
1Département
de Biologie, Université Laval, Québec, Québec, Canada; 2Ressources Aquatiques
Québec, Institut des sciences de la mer de Rimouski, Université du Québec à Rimouski, Rimouski,
Québec, Canada; 3Departmentof Physiology and Biophysics, Dalhousie University, Halifax, Nova Scotia,
Canada
While most bivalve species possess two adductor muscles composed of smooth fibres,
scallops have only a single adductor muscle which is divided into two distinct parts:
smooth and striated. According to their structure and function, these two parts of the
adductor muscle are used differently. The striated phasic part of the muscle contracts
rapidly and is responsible for rapid valve closures that produce water jets for swimming.
The smooth tonic part of the muscle contracts slowly and is mainly used for prolonged
valve closure or to maintain the valves partially open during filter feeding. The role and
utilisation of the phasic adductor during swimming is well studied, but less is known about
the tonic adductor. A recent comparative study revealed that the use of phasic and tonic
contractions varied markedly among species during escape responses (Tremblay et al.
2012). Active species made more phasic contractions during their escape response than
more sedentary ones. More sedentary scallops tended to rely more on valve closure.
Indeed, they made prolonged tonic contractions and sometimes started their response
with tonic contractions, while active species made shorter tonic contractions between
series of phasic contractions. The giant scallop, Placopecten magellanicus, made
extensive use of short (<5 s) tonic contractions during its escape response. This
extensive use of short tonic contractions by P. magellanicus has not been observed in
other species so far. Given the absence of a plausible metabolic role for these short tonic
contractions, we propose that these short tonic contractions have a functional role during
swimming.
175
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The recruitment of tonic muscle during escape responses was investigated in P.
magellanicus using various techniques. Electromyography and muscle force recordings
were used to confirm the recruitment of tonic muscle during an escape response.
Unfettered swimming behaviour was compared between normal scallops and scallops
with sectioned tonic muscles. Scallops were filmed during an escape response and
various parameters were determined from the films. The total number of phasic
contractions was noted as well as the presence/absence of some parameters related to
the swimming behaviour.
Electromyography recordings showed activity in both muscles during an escape
response, but the strong signal in the phasic muscle hindered detection of electrical
activity in the tonic muscle when a short tonic contraction followed a phasic contraction.
Force recordings during an escape response showed that short tonic contractions on the
recordings disappear when the tonic muscle is sectioned. This confirms that the short
tonic contractions detected during force recordings are produced by the tonic muscle.
Scallops with their tonic muscle sectioned made a similar total number of phasic
contractions as normal scallops, but the percentage of phasic contractions resulting in
physical displacement of the scallop was reduced. Scallops with their tonic muscle
sectioned were capable of swimming, but fewer swam and some of the stereotypical
swimming behaviours were affected. These observations suggest that tonic muscle
activity contributes to the coordination of swimming.
176
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
BIOTOXINS, POLLUTION AND CONTAMINATION
177
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 18: Contamination of cadmium from digestive glands to adductor muscle in
frozen and thawed samples of scallops
Arne Duinker, Sylvia Frantzen, Amund Måge
National Institute of Nutrition and Seafood Research (NIFES)
Whole soft tissues of great scallops (Pecten maximus) by far exceed the regulatory limit
for the heavy metal cadmium. Due to the clearly distinct organs in scallops it is well
documented that the high cadmium concentrations are due to very high levels the
digestive gland, while the edible parts, defined as adductor muscle and gonad, have very
low levels (Julshamn et al., 2008). The digestive gland is in close contact with both
adductor muscle and gonad. Since 2014, the European regulation states that in case of
Pecten maximus, the maximum level applies to the adductor muscle and gonad only.
During the early years of bivalve monitoring our lab experienced unusually high
concentrations of cadmium in adductor muscle samples that had been dissected after
freezing and thawing. Since all samples that had been dissected fresh had lower levels,
the most probable explanation was that water containing cadmium was transferred from
digestive glands to muscle tissue during thawing and dissection. The routine after this
was always to dissect scallops fresh.
The problem was obviously not unique to our lab, and in the following years scallop
exports from Norway were stopped in border control in two European countries due to
high levels of cadmium. In one of the cases the problem was solved by supplying
information about how scallops should be dissected fresh or before thawing. In the other
case Norwegian great scallops were not accepted since at that time the tradition was to
consume whole scallops in this country.
The problem with leakage of cadmium is relevant for several types of seafood, like
cadmium from kidneys transferring to fillets in fish and from hepatopancreas to claw meat
in crabs. The transfer of cadmium was therefore studies in our lab using scallops as
model species. A group of scallops was divided into three treatment groups with
dissection of adductor muscles fresh, dissected in frozen condition and dissected after
178
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
freezing and thawing. The different muscle samples were analysed for cadmium
concentrations, and the results will be presented and discussed.
References
Julshamn, K., Duinker, A., Frantzen, S., Torkildsen, L., Maage, A., 2008. Organ Distribution and
Food Safety Aspects of Cadmium and Lead in Great Scallops, Pecten maximus L., and Horse
Mussels, Modiolus modiolus L., from Norwegian Waters. Bull. Environ. Contam. Toxicol. 80, 385389.
179
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
SAFI: Supporting our Aquaculture and Fisheries Industries; a tool to aid in
detecting suitable fishing grounds for shellfish and finfish
Shorten, M.1, McElligott, D.1, Scarrott, R.G.2, Dwyer, N.2, Lecouffe, C.3, Gaspar, M.4,
Santos, M.4, Rufino, M.4, Morales, J.5, Moreno, O.5 Mangin, A.6, Vincent, C.6
1Daithi
O’Murchu Marine Research Station, Bantry, Cork, Ireland. 2Beaufort Research, University College
Cork, Cork, Ireland. 3COFREPECHE, 32, rue de Paradis, Paris, France, 4Instituto Português do Mar e
da
Atmosfera
(IPMA)
(Portuguese
Oceanic
and
Atmospheric
Institute)
Av.
Brasilia Lisbon, Portugal, 5IFAPA Centro "Agua del Pino" P.O. Box 104 Huelva, Spain. 6ACRI-HE 260
Route du Pin Montard, Sophia-Antipolis, France.
Introduction
With the launch of the Sentinel satellite series progressing, the task remains to
adapt Europe’s use of Earth Observation data and integrate it into applications that can
facilitate more informed decision making that balances the need between environmental
protection and economic activity. The aquaculture and fisheries sectors present obvious
opportunities for this, with operational and planning decisions often made on the basis of
limited data and information.
These industries could significantly benefit from the
availability of and easy access to satellite-derived information products that can
complement information from in-situ sensors and models.
The FP7-funded “Supporting our Fisheries and Aquaculture Industries” (SAFI) project
(http://www.safiservices.eu) will develop a decision support service specifically for these
sectors. The pan-European collaboration is using Earth Observation data products,
combined with in-situ environmental data, species habitat and growth data, to derive a
series of indicators which can inform operators and managers about factors affecting
commercial species (e.g. habitat suitability, potential relative productivity levels, potential
growth rates, physiochemical environmental conditions). All will be available via an online
web-GIS based decision support service providing information in a clear and easy to
interpret way.
180
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The products and service are being developed in close consultation with operators and
key stakeholders in the aquaculture and fisheries sectors across Europe. This shall
ensure that, once developed, the Earth Observation data is being processed, refined and
delivered as targeted information that is of maximum benefit to the industry and related
regulatory bodies.
181
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
PECTINIDS – WITNESSES OF THEIR ENVIRONMENT IN A
CHANGING OCEAN
182
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 20: Patterns and mechanisms of damage in a scallop dredge fishery
Bryce D. Stewart1, Charlotte Boig1, Roland Kroger1, Catherine Sinfield2, Andrew R.
Brand2, Kevin Kennington3, William Lart4, and Stuart R. Jenkins5
1.University
of York, York North Yorkshire, United Kingdom; 2University of Liverpool, Isle of Man; 3DEFA,
Isle of Man government, Isle of Man; 4Seafish Industry Authority, Hull, United Kingdom; 5Bangor University,
Bangor, Wales.
Introduction
Dredging for marine bivalves has the potential to cause considerable damage to both
target and non-target benthic species. Indeed the Newhaven dredges used throughout
the UK fishery for king scallops, Pecten maximus, are considered to be one of the most
damaging of all types of fishing gear. These effects can lead to mortality of undersized
or uncaptured individuals of the target species and consequently significant loss of future
yield. Damage to non-target species and habitats can also result in loss of biodiversity
and potentially negative consequences for the functioning of ecosystems. Given the
recent rapid rise in the UK scallop fishery, these issues are of considerable concern to
fisheries managers, conservation bodies and seafood consumers. One way in which the
impact of dredging could be reduced is to gain a better understanding of mechanisms
involved, so as to guide improvements in gear design and fishing practice.
Methods and Results
In this study we took a variety of approaches to describe and understand damage to king
scallops and key non-target species in the dredge fishery around the Isle of Man, in the
north Irish Sea. Levels of fatal damage to captured target and non-target species were
consistently higher on some fishing grounds than others during bi-annual stock surveys.
We assessed a number of potential explanatory variables for these observations
including volume of rocks retained in dredges, dredge fullness and the level of potential
stress experienced by captured scallops using a novel “Robo-Scallop”, (a fibreglass
replica scallop fitted with internal accelerometers). However, these variables were poor
predictors of spatial variability in damage levels, except for a significant positive
183
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
relationship between damage sustained to the common starfish, Asterias rubens, and
the volume of stones. Contrary to expectations, the highest damage to king scallops was
on a sandy fishing ground (Laxey) where there were no stones. We then conducted a
field experiment whereby tagged but undamaged scallops were placed into dredges prior
to deployment at Laxey and a stony ground (Bradda Inshore) and then towed for 50
minutes (replicating commercial practice). On both grounds the tagged scallops
remained undamaged, indicating
that scallops are damaged during
the
initial encounter with
the
dredge teeth, rather than in the
dredge bag or upon landing.
Finally, we measured the shell
strength of scallops on six of the
fishing grounds using a Tinius
Olsen machine fitted with the tooth
from a scallop dredge. There was
significant spatial variation in the
strength
correlated
of
scallops,
strongly
with
which
the
damage levels observed during
our stock surveys.
In order to investigate the causes of this variation in shell strength, we examined the data
for any correlations between environmental variables such as depth and substrate, and
biological parameters such as scallop growth rate. None of these variables showed any
significant relationships with shell strength. However, a subsequent more in-depth
examination of the shells from Bradda Inshore and Laxey revealed distinct differences in
shell structure. The stronger shells from Bradda had much thicker valves, particularly on
the upper side and in the first few years of growth. There were also differences in the
internal microstructure of the shells, with an apparent discontinuity present in all of the
Laxey shells we examined (figure 2).
184
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
a)
b)
Figure 2. Differences in the internal shell structure of king scallops (Pecten maximus) from the Laxey (a)
and Bradda Inshore (b) fishing grounds around the Isle of Man.
Based on a history of mining on the coast adjacent to the Laxey site, we then sampled
the seabed sediments at both Laxey and Bradda to investigate whether run off from the
mines had resulted in any differences in concentrations of heavy metals. The Laxey
sediments contained significantly higher (approximately 3 fold) levels of copper, lead and
zinc, suggesting a possible influence of these elements on shell formation, although the
physiological mechanism remains to be discovered.
Discussion and Conclusion
As our results indicate that dredge teeth play the key role in causing damage,
replacement or adaptation of the teeth should therefore be a priority for gear
technologists and managers. Understanding the drivers of spatial variation in shell
strength is also a priority for further research. Fishing effort may need to be limited in
vulnerable areas if high levels of indirect fishing mortality are to be avoided. The
increased susceptibility of weaker shells to damage also presents an analogy for what
may become a widespread phenomenon under future scenarios of ocean acidification.
Fishing practices may therefore need to be substantially altered in the medium term
future to maintain the viability of stocks.
185
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 21: The influence of sea surface temperature and climate indexes on King
scallop (Pecten maximus) recruitment in the Bay of Seine (Eastern English
Channel, France)
Eric Foucher1 and Edouard Duhem2
1Ifremer,
Station de Port-en-Bessin, Avenue du Général de Gaulle 14520 Port-en-Bessin, France;
2Université
de Caen Basse-Normandie, Esplanade de la Paix, 14032 Caen Cedex 5, France
Introduction.
The King scallop (Pecten maximus) is one of the main species landed in metropolitan
France and the bay of Seine is the most productive and highly exploited area of the
Eastern English Channel. Every year assessment surveys in the bay of Seine are used
to estimate recruitment abundance, which shows high inter-annual variability. Many
previous studies have shown that these fluctuations are not link to the status of the
spawning biomass (Thouzeau 1991). However, weather affects life cycles of marine
species especially shellfishes, but how are we able to link climate and recruitment
variations? The aim of this study is double: as a first step, we would like to highlight the
influence of environmental conditions on recruitment and show how these conditions
could explain the variability, and as a second step we propose a predictive model of
recruitment based on sea surface temperature and on a climate index.
These study is part of the COMANCHE project (Ecosystem Interactions and
anthropogenic impacts on King scallop populations in the English Channel) coordinated
by Ifremer and co-funded by the French National Agency for Research.
Material and methods.
Since 1992, the King scallop bed of the bay of Seine is assess by an annual scientific
survey, conducted by Ifremer and based on a standardized stratified random sampling
protocol. The recruitment (R) occurs at age 2, and corresponds to young scallops which
had just reached the minimal landing size (11cm width in Eastern Channel). Data
collected during these surveys are used to estimate the annual recruitment.
186
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
As environmental data we use daily sea surface temperature (SST) from 1990 to 2010
and climate indexes for the same period. In Northern Atlantic, climatic variations are
driven by 2 action centers: the Icelandic Low and the Azores High. Each day, the
difference between atmospheric pressures measured in the Azores and in Iceland allows
to define the climate situation, which could be classified into 4 recurring situations called
“Negative North Atlantic Oscillation” (NAO-), “Positive North Atlantic Oscillation” (NAO+)
[or “Atlantic Low” in summer (AL)], “Scandinavian Blocking” (BL) and “Atlantic Ridge”
(AR). The sum of these occurrences constitutes a variable called “climate index” (Cassou
et al. 2004) (Fig.1).
Figure 1: Different climate situations in Northern Atlantic Ocean.
We assume here two 2 working assumptions: the influence of environment particularly
occurs during the previous winter of spawning (during gametogenesis) and just after the
spawning (end of spring and early summer). We are looking to explain recruitment
variations observed during year N with environmental conditions at the cohort date of
birth (year N-2).
We use a classic Generalized Linear Model to fit the relationship between recruitment
and environmental indices.
Results
No real correspondence could be observed between December to March average SST
and recruitment. However, there is a strong link between average SST at the beginning
187
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
of summer (from May to July) and recruitment (Fig. 2), SST explaining around 65% of
the variability. We also test the relationship between the four climate indexes and
recruitment in winter (December to March) and in summer (May to July). The best fitting
adjustment is given by Atlantic Low (AL) situation in summer. The fluctuations of
recruitment have been fit using a GLM model with SST and AL variables. The model
explains 70% of the variability of R (Fig. 3).
Figure 2: Relationship between sea surface temperature and recruitment.
Figure 3: Recruitment R modelling by environmental variables.
Discussion and conclusion
The winter climate conditions do not seem decisive. However, environmental conditions
during the spawning period and larval life (during the end of spring and the beginning of
summer) play a key role in the future renewal of King scallop populations. Early summer
average temperature appears to be the main factor explaining most of the recruitment
variability, but AL climate situation is also important for the successful of recruitment. In
fact, climate indexes (and so the 4 recurring situations observed in North Eastern
Atlantic) describe wind schemes, which have in the bay of Seine a real influence on larval
drift (Nicolle et al. 2013), and could influence the connectivity between scallop beds or
188
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
stocks. AL situations (generating westerly wind) are often linked to heat wave episodes,
like in 2003. Could that situation explain alone the peak of abundance observed in 2005?
Finally, how to explain the 30% remaining variability? We did not explore what happens
during the two first winters after settlement, and before the recruitment. Is there high
natural mortality on juveniles at 6 months old, which also could explain a significant part
of recruitment variability?
References
Cassou C., Terray L., Hurrell J. W. and Deser C. (2004). North Atlantic Winter Climate Regimes:
Spatial Asymmetry, Stationarity with Time and Oceanic Forcing. American Meteorological
Society, 1055–1068.
Nicolle A., Dumas F., Foveau A., Foucher E. and Thiébaut E. (2013) Modelling larval dispersal
of the king scallop (Pecten maximus) in the English Channel: examples from the bay of SaintBrieuc and the bay of Seine. Ocean Dyn., 63, 661-678.
Thouzeau, G. (1991). Déterminisme du pré-recrutement de Pecten maximus (L.) en baie de
Saint-Brieuc: processus régulateurs de l’abondance, de la survie et de la croissance des postlarves et juvéniles. Aquatic Living Resources (4), 77–99.
189
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 22: Coastal upwelling in Norway recorded in Great scallop shells
Aurélie Jolivet1, Lars Asplin2, Øivind Strand2, Julien Thébault1, Laurent Chauvaud1
1Université
de Brest, Institut Universitaire Européen de la Mer, Laboratoire des sciences de
l'environnement marin (UMR6539 LEMAR), rue Dumont d'Urville, 29280 Plouzané, France; 2Institute of
Marine Research, Boks 1870 Nordnes, N-5817 Bergen, Norway
Introduction
Reconstructing the history of the oceans is a major prerequisite for understanding natural
climate variability and the mechanisms of climatic change. Physical processes regulating
the vertical structure of the ocean partly determine marine productivity. In particular,
coastal upwelling systems are of fundamental importance in the study of the physics,
chemistry and fertility of the ocean and in global fisheries. While extensive knowledge
are now available on the major systems of upwellings, many questions remain in suspend
on the functioning of local upwellings and their impacts on organisms as benthic
populations. This paper demonstrates that Pecten maximus shells contain information,
through its growth and stable isotope composition, to describe and characterize local
upwelling events (duration and frequency) in the environments in which they grew.
Material and Methods
Seventy live Pecten maximus were collected by scuba divers at 15- 25 m depth in
Austevoll on the western coast of Norway from May 1987 to December 1988. These
shells were aged 3-6 years and had shell heights of 65-105 mm. Daily growth rate was
determined individually on the external surface of the left valve according to Chauvaud
et al. (1998; J. Exp. Mar. Biol. Ecol. 227: 83-111) by measuring the distances between
two successive daily growth striae from the outer edge of the shell, along the axis of
maximum growth.
Samples for the oxygen (δ18O) and carbon (δ13C) isotope values of the calcium carbonate
were collected by drilling shell powder from the four shells, from closer to the umbo to
the ventral edge of the shell. Results are expressed in parts per thousand with respect
to the Vienna Pee Dee Belemnite standard (‰ V-PDB). Seawater temperature at the
190
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
time of shell formation was calculated using the equation of Chauvaud et al. (2005;
Geochem. Geophys. Geosyst. 6(8):Q08001), calibrated from scallops collected in the
Bay of Brest (France):
T(ºC) = 14.84 – 3.75 * (δ18Oshell - δ18Owater)
δ18Owater is the oxygen isotope value of the water relative to Vienna standard mean ocean
water standard, estimated as a function of the salinity by the relation determined by
Mikalsen and Sejrup (2000; Estuar. Coast. Shelf. Sci. 50: 441-448) at Sognefjorden basin
65 km north of Austevoll:
δ18Owater = 0.31× salinity - 10.492
Based on this established association between δ 18Oshell and water temperature, the
oxygen isotopic signal of each shell was compared and synchronized with in situ
temperature, assigning a calendar date to each isotope sample (Chauvaud et al. 2005;
Geochem. Geophys. Geosyst. 6(8):Q08001). As no data were available for Austevoll,
salinity was estimated from the in situ water temperature and based on the δ18Oshell (Eq.
1 and 2).
Temperature and salinity were obtained from the coastal monitoring station of the
Institute of Marine Research at Utsira, Norway. Water temperatures in the catchment
area were simulated with a numerical coastal model system for mid-June to August in
1985, 1986, and 1987 for depths of 10 m, 20 m, 50 m, and 100 m.
Wind data
representing the outer coastal area were obtained from the Norwegian Meteorological
Institute and compiled in two wind indices: a positive index corresponding to north wind
speed (in m s-1, 330-30°) and a negative index for south wind speed (in m s-1, 150-210°).
Results
At the beginning of July 1986, the water temperature dropped by 5.3 °C and 2.8 °C at 10
and 20 m depth, respectively (Fig. 1A), while salinity increased from 30 to 33.3 and from
32.1 to 34.3, respectively. Below 50 m depth, water masses remained stable.
Simultaneously, winds measured at Slåtterøy were mainly from the south except for 1014 July 1986, a period characterized by strong northerly winds. The change in wind
direction induced an upwelling of deep cold water along the coast.
191
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
The growth trajectories of four age classes (III-VI) demonstrated that a slowdown in
growth occurred in 1986, resulting in a decrease in growth rate of nearly 45 % over 10
days (on average from 229.4 µm day-1 to 127 µm day-1), before returning to values close
to 200 µm day-1 (Fig. 1B). For the four studied shells, the slowdown in growth observed
in 1986 was concurrent with a sudden increase in δ 18O signal of: 1.3 ± 0.2‰ (mean ±
standard deviation) for 12-17 July (± 1 day) (Fig. 1B). The salinity estimated at Austevoll
from the temperature given by the numerical model and δ 18Oshell values indicated an
increase of 3.4 ± 1.2 (from 30.4 to 33.8). These variations were closed to the salinities
measured at Utsira at 20 m depth. During 1986, the carbon isotopic signal of the four
shells did not exhibit a particular increase or fall during growth slowdown.
Figure 1. A) Environmental parameters measured in 1986: temperatures simulated at 10 and 20 m
depth and wind indices. B) Comparison of daily growth increments (dark continuous line) and δ18O
shell (grey continuous shell) measured for one shell in 1986. Arrow indicate the upwelling event of July
1986.
Discussion and conclusions
The validated numerical coastal model system NorKyst-800 indicated that an upwelling
event occurred along the western coast of Norway in July 1986, affecting the area of
Austevoll from which we sampled scallop shells. The subsequent drop in water
temperature of ~3-5 °C and the increase in salinity of 2-3 PSU for the upper 20 m
represents an event that is not uncommon along the Norwegian west coast. Here, our
joint analysis of growth patterns and stable isotopes showed that the upwelling of July
1986 had a clear impact on shell growth (slowdown of nearly 45%) in scallops. This study
is the first demonstration of the effect of sudden changes in temperature on shell growth
of the Great Scallop Pecten maximus. Here, regional climatic phenomena acting on an
192
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
oceanographic process clearly impacted a benthic invertebrate at 15-25 m depth. P.
maximus can thus be used as an eulerian sensor to record both the frequency and the
duration of upwelling. Analyzing the isotopic signals in scallop shells allowed us to
describe the dynamics of both modern and past continental-shelf upwelling systems
during the Holocene. Additionally the daily growth patterns of P. maximus provide insight
into local upwellings that occur at small scales, on the order of a few days.
193
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 23: Using soya DNA barcodes to trace feed and faeces from salmon
aquaculture to the benthic suspension feeder Pecten maximus
Christofer Troedsson1, Tore Strohmeier2, Katrine Sandnes Skaar1, Pablo Balseiro3,
Øivind Strand2
1UNI
Research, Bergen, Norway; 2Institute of Marine Research, Bergen, Norway; 3University of Bergen,
Department of biology, Bergen, Norway
Environmental responses to organic and inorganic effluents from Salmonid aquaculture
in Norway is of significant concern today and are expected to escalate with predicted
future production levels due to restructuring of the industry towards larger farming units.
To understand these responses, different tracers were used and developed to establish
a toolbox for detecting organic and inorganic effluents in marine ecosystems at local and
regional scale. Using the great scallop Pecten maximus as a model species, we tested
and evaluated a specific genomic DNA barcode for soya as a tracer of fish feed and
faeces uptake in the vicinity of salmon farms.
In this study the potential dispersion of the particulate organic effluent (feed and faeces)
was traced using soya genomic DNA analysis on samples from faeces, organic material
from sediment traps in the water column near the cages, surface sediment, and digestive
system from the scallop P. maximus, at distances 0.1-0.2, 1-3 and 20 kilometer from the
salmon farm site. Our data suggest that we can use soy barcodes to assess primary
uptake of faeces and fish feed in the ecosystem, hence tracing the influence of salmon
farm discharge towards higher trophic levels.
194
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 24: An integrated assessment model for helping the United States sea scallop
(Placopecten magellanicus) fishery plan ahead for ocean acidification and
warming
Sarah R. Cooley1,2*, Jennie E. Rheuban2, Deborah R. Hart3, Victoria Luu4, David M.
Glover2, Jonathan A. Hare5, Scott C. Doney2
1
Ocean Conservancy, Washington, DC USA 20036; 2Department of Marine Chemistry and Geochemistry,
Woods Hole Oceanographic Institution, Woods Hole, MA USA 02543; 3NOAA NMFS Northeast Fisheries
Science Center, Woods Hole, MA USA 02543; 4Department of Earth and Environmental Sciences, Boston
College, Chestnut Hill, MA USA 02467: 5NOAA NMFS Northeast Fisheries Science Center, Narragansett, RI
USA 02881
Ocean acidification, the progressive change in ocean chemistry caused by uptake of
atmospheric CO2, may negatively impact scallop populations. We describe an integrated
assessment model (IAM) that numerically simulates oceanographic, population dynamic,
and socioeconomic relationships for the U.S. sea scallop (Placopecten magellanicus)
fishery, the most valuable single-species commercial fishery in the United States. Our
primary goal is to inform resource management deliberations by offering both short- and
long-term insight into the system and generating detailed policy-relevant information
about the relative effects of ocean acidification, temperature rise, fishing pressure, and
socioeconomic factors on the fishery using basic forecasting methodology. Starting with
relationships and data used for current sea scallop fishery management, the model adds
socioeconomic decision making based on static economic theory, and includes ocean
biogeochemical change resulting from CO2 emissions. The model skillfully reproduces
scallop population dynamics, market dynamics, and seawater carbonate chemistry since
2000. It indicates sea scallop harvests could decline substantially by 2050 under RCP
8.5 CO2 emissions and current harvest rules, assuming that ocean acidification affects
P. magellanicus by decreasing recruitment and slowing growth, and that ocean warming
increases growth. Future work will explore different economic and management
scenarios and test how potential impacts of ocean acidification on other scallop biological
parameters may influence the social-ecological system. Future empirical work on the
effect of ocean acidification on sea scallops is also needed.
Corresponding author: [email protected]
195
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
RESOURCE MANAGEMENT
196
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
No 25: A comparison of model-based and design-based methods to estimate sea
scallop (Placopecten magellanicus) abundance and biomass from vessel-towed
underwater camera data
Jui-Han Chang, Burton V. Shank and Deborah R. Hart
Northeast Fisheries Science Center, 166 Water St., Woods Hole MA 02543
Scallop counts from vessel-towed underwater camera systems are highly spatially
autocorrelated and zero inflated, reflecting the patchiness of scallop distributions. Modelbased estimation methods can be used to extrapolate observations along the observed
track to larger areas. Such data are often spatially aggregated before analysis to increase
the proportion of positive observations and reduce random noise. We evaluated three
different model-based estimation methods for this type of data: (1) ordinary kriging (OK)
on aggregated data, (2) zero-inflated Generalized Additive Models on aggregated data
with kriged model residuals (GAM+OK), and (3) zero-inflated Generalized Additive Mixed
Models where small scale variations are treated as random effects, combined with kriged
model residuals (GAMM+OK). These three methods were tested along with a designbased method (stratified means, SM) using both simulations and real data. Effects of
anisotropy and the aggregation scale were evaluated. The GAM+OK method with
relatively small aggregation length was found to give the best performance of the modelbased methods in the simulations in terms of accuracy and precision. SM estimates were
more accurate and precise than the model-based estimates but only when the study
region was stratified more correctly than might be expected in practice. For the real data,
no single modeling approach and segment length was consistently superior but
GAM+OK generally performed better than OK and GAMM+OK. Based on these results,
we selected the GAM+OK method to estimate scallop abundance and biomass for the
GB and MAB stock for 2011 to 2014. SM estimates estimated with careful stratifications
were also calculated to validate the model-based estimates.
197
The 20th International Pectinid Workshop, 22nd-28th April 2015, Galway, Ireland
22
nd
th
– 28 April 2015
Galway, Ireland
198