Brain Advance Access published December 2, 2006
doi:10.1093/brain/awl334
Brain (2006) Page 1 of 11
The genetic spectrum of a population-based sample
of familial hemiplegic migraine
L. L. Thomsen,1 M. Kirchmann,1 A. Bjornsson,2 H. Stefansson,2 R. M. Jensen,1 A. C. Fasquel,2
H. Petursson,2 M. Stefansson,2 M. L. Frigge,2 A. Kong,2 J. Gulcher,2 K. Stefansson2 and J. Olesen1
1
Danish Headache Center, University of Copenhagen, Department of Neurology, Glostrup Hospital, Copenhagen,
Denmark and 2deCODE Genetics, Reykjavik, Iceland
Correspondence to: Lise Lykke Thomsen, MD, PhD, Danish Headache Center, University of Copenhagen,
Department of Neurology, Glostrup Hospital, Nordre Ringvej 57, DK-2600 Glostrup, Denmark
E-mail: [email protected]
Keywords: familial hemiplegic migraine; mutations; genome scan; genetics; loci
Abbreviations: FHM ¼ familial hemiplegic migraine; HM ¼ hemiplegic migraine; MA ¼ migraine with aura; MO ¼ migraine
without aura; SHM ¼ sporadic hemiplegic migraine; TTH ¼ tension type headache; ICHD-1 ¼ International Classification of
Headache Disorders 1st Edition
Received August 7, 2006. Revised October 20, 2006. Accepted October 26, 2006
Introduction
Familial hemiplegic migraine (FHM) is a rare subtype of
migraine with aura, where the aura includes some degree
of hemiparesis and where at least one first- or second-degree
relative has attacks of migraine with some degree of
hemiparesis. In most large FHM families studied FHM
is inherited in an autosomal dominant manner. Mutation
screening of such families has revealed missense mutations
in the CACNA1A gene on chromosome 19p13 encoding a
Cav2.1 calcium channel subunit (FHM1) (Ophoff et al.,
1996); missense mutations in the ATP1A2 gene on
chromosome 1q23 encoding a Na+/K+-ATPase pump
subunit (FHM2) (De Fusco et al., 2003); or a heterozygote
missense mutation in the SCN1A gene on chromosome
2q24 encoding a Nav2.1 sodium channel subunit (FHM3)
(Dichgans et al., 2005). Seventeen different missense
mutations have been identified in the CACNA1A gene
worldwide causing FHM1 (Ophoff et al., 1996; Battistini
et al., 1999; Ducros et al., 1999, 2001; Friend et al., 1999;
Lykke Thomsen et al., 2002; Takahashi et al., 2002; Terwindt
et al., 2002; Wada et al., 2002; Alonso et al., 2003; Kors et al.,
# The Author (2006). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: [email protected]
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Familial hemiplegic migraine (FHM) is a rare subtype of migraine with aura and transient hemiplegia.
FHM mutations are known in three genes, the CACNA1A (FHM1) gene, the ATP1A2 (FHM2) and the SCN1A
(FHM3) gene and seem to have an autosomal-dominant mode of inheritance. The aim of this study was to search
for FHM mutations in FHM families identified through a screen of the Danish population of 5.2 million people. FHM
patients were diagnosed according to the International Classification of Headache Disorders and all FHM patients
had a physical and neurological examination by a physician. A total of 147 FHM patients from 44 different families
were identified; 43 FHM families participated in this study. Linkage analysis of these families shows clear linkage to
the FHM locus (FHM1) on chromosome 19, supportive linkage to the FHM2 locus whereas no linkage was found to
the FHM3 locus. Furthermore, we sequenced all exons and promoter regions of the CACNA1A and ATP1A2 genes
and screened for the Q1489K mutation in the SCN1A gene.CACNA1A gene mutations were identified in three of the
FHM families, two known FHM mutations, R583Q and T666M and one novel C1369Y mutation. Three FHM
families were identified with novel mutations in the ATP1A2 gene; a family with a V138A mutation, a family with a
R202Q mutation and a family with a R763C mutation. None of the Danish FHM families have the Q1489K mutation
in the SCN1A gene. Our study shows that only 14% (6/42) of FHM families in the general Danish population have
exonic FHM mutations in the CACNA1A or ATP1A2 gene. The families we identified with FHM mutations in the
CACNA1A and ATP1A2 genes were extended, multiple affected families whereas the remaining FHM families were
smaller. The existence of many small families in the Danish FHM cohort may reflect less bias in FHM family
ascertainment and/or more locus heterogeneity than described previously.
Page 2 of 11
Brain (2006)
Material and methods
Ascertainment of families with FHM
A systematic search was performed employing three different
strategies in the entire Danish population of 5.2 million people.
The search included a computer search of the Danish National
Patient Register of all hospitalized patients with a discharge
diagnosis of migraine with aura (MA) or migraine with
complication (ICD-10 diagnosis DG431 or DG433), screening of
>27 000 case records from headache clinics and practising
neurologists in Denmark and additionally, advertisements for
patients with hemiplegic migraine (HM) were placed in the major
Danish Medical Journal and in the journal of the major Danish
organization of headache patients (Lykke Thomsen et al., 2002).
The recruited patients received information in print about
the project, before they were contacted by telephone. Out of
1828 recruited patients, 1446 took part in a screening telephone
interview of whom 195 probands were diagnosed with HM
(Lykke Thomsen et al., 2002). To stratify these patients into FHM
or sporadic hemiplegic migraine (SHM) cases, we subsequently
screened their relatives. All first-degree relatives were screened
and second-degree, third-degree or more distant relatives were
screened by two different strategies depending on whether an
affected first-degree relative had been identified or not (Lykke
Thomsen et al., 2002). All first-degree relatives above 15 years of
age were contacted for a telephone interview. Relatives aged
15 years or below were only contacted for a telephone interview if
suspected of having or previously having had headache or aura
symptoms. If the screening interview diagnosed the proband with
hemiplegic migraine, the proband and all available relatives were
diagnosed according to the International Classification of Headache
Disorders 1st Edition (ICHD-1) (Headache Classification Committee of the International Headache Society, 1988; Lykke Thomsen
et al., 2002) in an extensive validated semi-structured telephone
interview (Russell et al., 1995) performed by a trained physician.
Out of 1486 (722 M; 764 F) recruited relatives, contact was sought
in 903 living relatives of whom 859 took part in an interview
(Lykke Thomsen et al., 2002).
In accordance with the ICHD-1 (Headache Classification
Committee of the International Headache Society, 1988), HM
patients with at least one affected first-degree relative were
diagnosed as having FHM, whereas HM patients without any
affected relatives were diagnosed as having SHM. All HM
patients had a physical and neurological examination (Lykke
Thomsen et al., 2002).
In total 291 patients were diagnosed with HM of whom
147 patients had FHM, 105 had SHM and 39 had unclassifiable
hemiplegic migraine due to an unknown family history of
hemiplegic migraine (Lykke Thomsen et al., 2002). The 147 patients
with FHM were from 44 families and were available for this study.
Overall, the number of FHM patients in each of the families was 11
(1 family), 7 (2 families), 6 (1 family), 5 (4 families), 4 (6 families),
3 (12 families), 2 (18 families). The project was approved by the
Danish Ethics Committee.
Among the FHM families, one family (F6035) and two individuals from separate FHM families did not want to give blood for
unspecified reasons. Twelve families consisted of an affected parent
and child only (6008, 6011, 6013, 6014, 6022, 6024, 6028, 6031,
6036, 6043, 6047) or only with genotypes to that extent (family
6021), making them uninformative in linkage analysis. Thus, the
genome-wide linkage scan was conducted on the 31 FHM families
that were informative and available. In contrast, all 43 families that
gave blood samples were screened by sequence analysis for exonic
mutations in CACNA1A and ATP1A2, and by SNP assay for the
known Q1489K mutation in the SCN1A gene.
After obtaining informed consent according to the Declaration
of Helsinki, venous blood samples were collected from these
families including all participating, unaffected relatives. Further
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
2003, 2004; Vanmolkot et al., 2003; Beauvais et al., 2004;
Jen et al., 2004; Jurkat-Rott et al., 2004; Spadaro et al., 2004).
The T666M mutation is the most frequent CACNA1A
mutation reported, having been found in 20 families
worldwide (Ophoff et al., 1996; Ducros et al., 1999, 2001;
Friend et al., 1999; Takahashi et al., 2002; Terwindt et al.,
2002; Wada et al., 2002; Kors et al., 2003; Jen et al., 2004),
and the R583Q mutation is the second most recurrent
mutation reported in six families (Battistini et al., 1999;
Ducros et al., 2001; Terwindt et al., 2002; Alonso et al.,
2003). Most other CACNA1A mutations have been found in
only one or two FHM families worldwide. In FHM1,
patients with cerebellar ataxia tend to have hemiplegic
attacks with interictal ataxia. There is though some
phenotype variation in one family with the R583Q mutation
in the CACNA1A gene, where some of the patients have
only cerebellar ataxia (Alonso et al., 2003).
In the ATP1A2 gene 27 different missense mutations
have been identified causing FHM2 (Headache Classification
Committee of the International Headache Society, 1988;
Russell et al., 1995; Rozen and Skaletsky, 2000; Kong et al.,
2002; Thomsen et al., 2002; Bjornsson et al., 2003; De Fusco
et al., 2003; Fossdal et al., 2004; Gudbjartsson et al., 2005;
Eriksen et al., 2006). In FHM2 families cerebellar signs are
rare; however, transient and permanent cerebellar signs have
been reported in an Italian FHM family with a G301R
mutation (Spadaro et al., 2004).
In the newly identified SCN1A gene on chromosome
2q24 a heterozygous missense mutation (Q1489K) was
identified in 3 FHM families (18 FHM-affected individuals)
of European origin. None of these patients had cerebellar
symptoms; however, three patients had epileptic seizures
during infancy. Thus co-occurrence of infantile seizures
and FHM has been reported in FHM1, FHM2 and FHM3
(De Fusco et al., 2003; Vanmolkot et al., 2003; Beauvais et al.,
2004; Jurkat-Rott et al., 2004; Kors et al., 2004; Spadaro et al.,
2004). Mutations in the CACNA1A, ATP1A2 and SCN1A
genes explain 50–70% of published families with FHM.
However, these families are selected from hospitals or
specialist practice and very likely represent families with
higher penetrance and more severe symptomatology
compared with cases from the general population. It is
therefore possible that the frequency of mutations in the
CACNA1A, ATP1A2 and SCN1A genes described previously
may be different in families with FHM from the general
population. In order to describe the full genetic spectrum of
FHM in the reported genes and to identify new genes
involved in FHM, we investigated a population-based
sample of families with FHM.
L. L. Thomsen et al.
Genetics of familial hemiplegic migraine
details about material, participation/non-participation and the
clinical characteristics of the families have been reported elsewhere
(Thomsen et al., 2002).
Population controls were recruited by the Danish Headache
Center, and are migraine-free as determined by standard headache
diagnostic interview (Russell et al., 1995).
Genotyping and linkage analysis
Sequence analysis
All exons and promoter regions of the CACNA1A and ATP1A2
genes were sequenced in at least two patients with FHM from each
of the 42 FHM families. These patients were also genotyped with a
SNP assay for the Q1489K mutation in the SCN1A gene. Because
reported FHM mutations are rare and with high penetrance,
mutations that were identified in two FHM patients of at least one
family and not in healthy controls were considered as possible
causative mutations (Ophoff et al., 1996). Co-segregation of the
FHM phenotype in families with a possible mutation was
established by sequencing the mutation-bearing exon in all the
remaining patients and unaffected relatives in the relevant families.
A population control group consisting of 92 unrelated persons
without migraine, diagnosed in an extensive interview by a
physician, was included in the initial sequence screen. For all novel
mutations identified a total of 460 population controls were
sequenced.
The 48 exons of the CACNA1A (19p13) and the 23 exons of the
ATP1A2 (1q23) genes were sequenced, including promoter and
flanking intron sequences (Eriksen et al., 2006). The primers were
18–30 bp long depending on the size of each exon and GC content
of the region. The amplimers were selected from 200 to 750 bp,
amplifying a minimum of 60–200 bp of the intronic sequence
flanking the exons. PCR and cycle sequencing primers were
designed by WinSeq1.6, a software based on the Primer3 software
(Rozen and Skaletsky, 2000). PCR amplifications were set up on
Sciclone ALH 300 and run on MJR TetradÔ. PCR products were
Page 3 of 11
verified for correct length on an agarose gel before being purified
using AMPureÔ from Agencourt. Cycle sequencing reactions were
set up on Sciclone ALH 300, run on MJR TetradÔ and excess dye
terminators were removed using CleanSEQÔ from Agencourt.
Amplimers were sequenced directly on an Applied Biosystems
3730 Capillary DNA Sequencer using an ABI PRISMÒ Fluorescent
Dye Terminator System (Perkin–Elmer, Foster City, CA, USA). The
sequence analysis was conducted with Clinical GenomeMinerÔ 1.5,
a deCODE software comparable to Consed (Gordon et al., 1998).
Results
The genomewide linkage analysis
The results of linkage analysis of the 31 Danish FHM
families that are informative for linkage are shown in Fig. 1,
for both dominant parametric models allowing for heterogeneity (HLOD-D) and a non-parametric model (LOD-N).
A major linkage is observed only at the FHM1 locus, with a
HLOD-D of 4.58 and LOD-N of 2.82 at marker D19S226
on chromosome 19. Interestingly, a HLOD-D reaching
0.60 is observed at the FHM2 locus at marker D1S2768 on
chromosome 1. No linkage is seen at the FHM3 loci on
chromosome 2. LOD scores between 1 and 2 are observed
on chromosomes 5, 8 and 10. The best single-family LOD
scores at the FHM1 locus are observed for family 6002 (LOD
score of 1.4) and family 6034 (LOD score of 4.2), indicating
that these families are the major contributors to the genomewide linkage to this locus. At the FHM2 locus, only family
6005 has a notable LOD score (2.1 at marker D1S2768). No
single family has a LOD score exceeding 1 at the FHM3
locus. Regarding other genome locations, only family
6000 has a notable LOD score of 2.4 at marker D18S1152
on chromosome 18, which by itself is not significant.
Mutation screen
All exons in the CACNA1A and ATP1A2 genes were
sequenced, and the Q1489K mutation in the SCN1A gene
was screened by an SNP assay. A total of six exonic
mutations were detected that are either probable or known
FHM mutations, three mutations in the CACNA1A gene
(R583Q, T666M and C1369Y) and three mutations in the
ATP1A2 gene (V138A, R202Q and R763C). Also, two
additional polymorphisms were discovered that did not
correlate to the FHM phenotype: a R510S polymorphism in
ATP1A2 and a R2233Q polymorphism in CACNA1A. None
of the FHM families had the Q1489K mutation in the
SCN1A gene. Pedigrees of the 6 FHM families with
mutations are shown in Fig. 2. The location of the three
mutations in the CACNA1A gene is indicated in Fig. 3A. The
location of the three mutations in the ATP1A2 gene is shown
in Fig. 3B. The clinical characteristics of all patients with
FHM and mutations in either the CACNA1A or ATP1A2
genes are listed in Table 1.
FHM mutations in the CACNA1A gene were found in
27 persons in 3 families. Only 18 of these persons have been
diagnosed with FHM, which corresponds to a penetrance
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
The genotyping of microsatellite markers and linkage analysis
were performed as described previously (Bjornsson et al., 2003).
For the linkage analysis 141 FHM patients, of which 119 were in the
31 families informative for linkage and 567 unaffected relatives
were genotyped using a genome-wide framework marker set
of 1000 markers. The genetic position of markers used is according
to deCODE’s High-Resolution Genetic Map (Kong et al., 2002).
The method of genotyping and genotype quality evaluation
was as described previously (Fossdal et al., 2004). Linkage analysis
was performed for both a non-parametric model (LOD-N) and
autosomal dominant parametric model allowing for heterogeneity
(HLOD-D) (allele frequency 0.0001 with autosomal penetrance:
0.9/0.9/0.01 and X chromosomal penetrance 0.9/0.9/0.01 for
females and 0.9/0.01 for males), using an affected only analysis,
with affected status for FHM patients and unknown status for
relatives. LOD scores were generated with the Allegro 2 program
(Gudbjartsson et al., 2005) and are based on multipoint calculations using all the genotyped markers. The Q1489K mutation in the
SCN1A gene was typed with primers (SG02S408Fw: CCTTGAACCTGTTTATTGGTGTCATCATAG; SG02S408Rv: CTCA*TTTGGCA*GAGAAAACACT; probe 1: AT TTCAACCAGC; probe 2: TA
ATT* TCAACCAGA; enhancer: GAAAAAGAAGATAAGTATTTCTAATAT; with * to indicate superbase), using the Centaurus SNP
genotyping platform (Nanogen).
Brain (2006)
Page 4 of 11
Brain (2006)
L. L. Thomsen et al.
of 67%. For the ATP1A2 gene FHM mutations were found
in 19 persons in 3 families. Only 12 of these persons have an
FHM diagnosis which corresponds to a penetrance of 63%.
Mutation data and clinical characteristics
Family 6034 had a R583Q mutation [arginine (R, CGA) to
glutamine (Q, CAA)] in the CACNA1A gene. The R583Q
mutation is an FHM missense mutation (Battistini et al.,
1999; Ducros et al., 2001; Terwindt et al., 2002; Alonso et al.,
2003) reported previously. Eleven family members with
FHM from family 6034 were included in the study (Fig. 2).
Three patients with FHM had died and two patients did not
want to participate for unspecified reasons. The sequencing
data show that all patients with FHM have the mutation and
three of the unaffected relatives (P22F34, P16F34, P53F34)
(Fig. 2). The R583Q mutation was not identified in any of
the 92 controls analysed.
Clinical characteristics
Among the 11 patients with FHM, 10 patients had slowly
progressive cerebellar ataxia. Two relatives (P22F34 and
P16F34) of 78 and 85 years of age, with the mutation, both
had severe progressive cerebellar ataxia but denied ever
having had attacks of migraine. The ataxia in this family was
slowly progressive from 8 to 10 years of age and associated
with cerebellar atrophy, present on MR scans in three
individuals and CT scans in one patient (only 5 of these
patients had previously been scanned). P53F34 was 24 years
old and had exclusively had attacks of episodic tension type
headache, never attacks of migraine.
Family 6002 had a T666M mutation [threonine (T, ACG)
to methionine (M, ATG)] in the CACNA1A gene. The
T666M missense mutation has been described before
(Ophoff et al., 1996; Ducros et al., 1999, 2001; Friend et al.,
1999; Takahashi et al., 2002; Terwindt et al., 2002; Wada
et al., 2002; Kors et al., 2003; Jen et al., 2004). Five patients
with FHM from family 6002 were included in the study.
Sequence analysis shows that four family members with
FHM and three family members without FHM (P18F2,
P16F2, P20F2, P13F2, P12F2, P24F2, and P23F2) have the
mutation. Sequencing was unsuccessful for one family
member with FHM and one family member without FHM
(P25F2 and P16F2), but haplotype analysis with available
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Fig. 1 Genome-wide linkage of 31 Danish FHM families. Results are shown for both non-parametric linkage (LOD-N) (black line)
and a dominant parametric model allowing for heterogeneity (HLOD-D) (red line). LOD scores are shown on the vertical axis and the
cM position of genetic markers relative to the p end of the chromosome on the horizontal axis. The span of the vertical LOD score
axis is 2 U for all chromosomes except chromosome 19 where it is 5.
Genetics of familial hemiplegic migraine
Brain (2006)
Page 5 of 11
Clinical characteristics
Fig. 3 The location of FHM mutations in the (A) CACNA1A
and (B) ATP1A2 gene.
genotype data indicates that both should have the mutation
since they share the haplotype that correlates to the
mutation (Fig. 4). The T666M mutation was not identified
in any of the 92 controls analysed.
Among the five patients with FHM, one patient also had
permanent ataxia. Four family members had the T666M
mutation but did not express the FHM phenotype (P12F2,
P23F2, P24F2 and P25F2). P12F2 was 56 years of age and did
not fulfil the diagnostic criteria for FHM (ICHD-1), however,
in childhood she had had a single attack where she became
weak in both arms and legs, which was not followed by
headache (described by her parents), furthermore she had
attacks of migraine without aura (MO) but not MA. P23F2 was
25 years of age and did not suffer from headache disorders.
P24F2 was 30 years of age and had had attacks of MO. P16F2
was 19 years of age but did not suffer from headache disorders.
Family 6044 had a C1369Y mutation [cysteine (C, TGT)
to tyrosine (Y, TAT)] in the CACNA1A gene. The C1369Y
mutation is a missense mutation that has not been described
previously. Four patients with FHM were included in the
study. Sequencing shows that 3 of 4 affected family members
have the mutation. The C1369Y mutation is in a conserved
amino acid residue. The C1369Y mutation was not identified
in any of the 460 controls analysed.
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Fig. 2 Pedigrees of FHM families with mutations in the CACNA1A or ATP1A2 genes. In the text persons are referred to by
running numbers for each family (example; person 1 in family 6002 is referred to as P1F2). The clinical phenotype status is indicated
by the symbols, with FHM denoting familial hemiplegic migraine, MA migraine with aura, MO migraine without aura, ETTH episodic tension
type headache, MD migrainous disorder and CTTH chronic tension type headache. FHM mutation allele is indicated with m in each family
and + for wild type allele. This is shown for all persons that were screened by sequence analysis, except for P16F2 and P25F2 (+/m*) who
have the mutation according to haplotype analysis (see also Fig. 4).
6034
6034
6034
6034
6034
6034
6034
6034
6034
6034
6034
6002
6002
6002
6002
6002
6044
6044
6044
6044
6007
6007
6007
6005
6005
6005
6005
6005
6005
6005
6016
6016
6016
P52F34
P47F34
P44F34
P56F34
P30F34
P47F34
P34F34
P49F34
P41F34
P39F34
P37F34
P4F2
P13F2
P21F2
P18F2
P16F2
P12F44
P9F44
P14F44
P13F44
P4F7
P8F7
P7F7
P10F5
P30F5
P32F5
P29F5
P21F5
P19F5
P24F5
P20F16
P7F16
P12F16
24/7
52/44
48/13
25/5
50/12
26/7
59/15
34/6
51/17
47/15
47/35
77/16
47/7
23/3
42/4
38/12
55/5
44/7
22/20
14/9
38/7
10/8
12/7
62/45
26/22
27/25
52/35
48/30
50/10
53/16
13/10
37/8
47/?
Age/age
at onset
(years)
10–49
10–49
>100
>100
>100
10–49
50–100
10–49
>100
2–4
10–49
>100
10–49
>100
50–100
10–49
>100
>100
2–4
2–4
>100
2–4
10–49
50–100
2–4
10–49
5–9
50–100
50–100
50–100
2–4
10–49
1
Lifetime number
of FHM attacks
Duration of
hemiplegia
(min)
60
30
1200
120
40
600
20
180
60
720
240
360
30
30
1200
30
60
1440
1440
10
45
1200
60
45
20
1200
120
1600
1200
60
660
180
Hemiplegia in
arm/leg +/
+/+
+/+
+/+
+/+
+/+
+/
+/+
+/+
+/
+/+
+/+
+/+
+/+
+/+
+/+
+/+
+/+
+/+
+/
+/+
+/+
+/+
+/+
+/+
+/
+/+
+/
+/+
+/+
+/
+/
+/
4h-1d
4h-1d
4h-1d
1-3d
4h-1d
1-3d
4h-1d
4h-1d
4h-1d
1-3d
3-7d
1-3d
1-3d
4h-1d
4h-1d
4h-1d
1-3 d
30m-4h
1-3 d
4h-1d
1-3 d
4h-1d
1-3d
?
4h-1d
4h-1d
?
3-7da
4h-1d
4h-1d
1-3d
4h-1d
Duration of
FHM attack
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
/*
+
+
/*
+
+
+
+
+
+
Headache
accompanying
hemiplegic
attacks +/
+/+/+/+
+/+/+/+
+/+/+/+
+/+/+/+
+/+/+/+
+///+
+/+/+/+
+//+/+
+/+/+/+
+/+//+
+/+/+/+
/+/+/+
+/+/+/
+/+/+/+
+/+/+/+
//+/+
+/+/+/+
+/+/+/+
+/+/+/
//+/+
+/+/+/+
+/+//
+/+/+/+
///
+/+//+
+//+/+
///
+/+/+/+
+/+/+/+
+//+/+
+/+/+/+
+/+/+/+
Accompanying
symptoms nausea/
vomiting/photo/
phonophobia +/
Cerebellar
ataxia
+p
+p
+p
+
+p
+p
+p
+p
+p
+p
+p
+
+
+
+
+
(+)
+
+
+
+
+
+
FHM triggered
by minor head
trauma
+
+
+
+
+
/
+/+
+/+
+/+
/+
/
/
/
+/
/
/
/
/
/
/
/+
+/+
/
+/+
+/
/
/
/+
/
/
+/+
+/
+/+
/+
+/
/+
+/
/
Co-occurring
attacks of
MA/MO +/
Brain (2006)
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
+ = symptom present; = symptom not present; ? = unable to recall; d = day; h = hours; m = minutes; +p = persistent cerebellar ataxia; + ataxia = paroxystic cerebellar ataxia.
*Hemiplegic attacks never associated with headache.
Family
Person
Table 1 Clinical characteristics of FHM-affected carriers of mutations in the CACNA1A and ATP1A2 genes
Page 6 of 11
L. L. Thomsen et al.
Genetics of familial hemiplegic migraine
Brain (2006)
Page 7 of 11
Clinical characteristics
Clinical characteristics
One person, 14 years of age (P13F44), expressed the FHM
phenotype, had attacks of MA and tension type headache
(TTH), but did not have the mutation. This is supported by
the absence of a shared FHM1 locus haplotype for P13F44
with other family members with the C1369Y mutation, and
is therefore a likely FHM phenocopy. One person 74 years
of age (P5F44) had the mutation, had attacks of MA but
did not express the FHM phenotype.
Family 6007 had a V138A mutation [valine (V, GTC)
to alanine (A, GCC)] in the ATP1A2 gene. The V138A
mutation is a missense mutation which has not been
described previously. Three patients with FHM were
included in the study. The sequencing data reveal that five
family members are heterozygous for this mutation,
including all three FHM patients. Valine to alanine is a
minor change in amino acid properties; however, this
residue is conserved in the protein. The V138A
mutation was not identified in any of the 460 controls
analysed.
Two family members (P5F7 and P2F7) had the mutation
but did not express the FHM phenotype and had never had
attacks of any type of migraine.
Family 6005 had a R202Q mutation [arginine (R, CGG)
to glutamine (Q, CAG)] in the ATP1A2 gene. The R202Q
mutation is a novel missense mutation not described
previously, and is seen in all seven FHM patients in this
study. Four of the unaffected family members also have the
mutation (P14F5, P34F5, P33F5 and P35F5). The R202Q
mutation changed a conserved amino acid residue. The
R202Q mutation was not identified in any of the 460
controls analysed.
Clinical characteristics
Patient P14F5 was 71 years of age and had exclusively had attacks of MA. Patients P34F5 and P33F5 are
22 and 33 years of age, respectively, and have only
experienced attacks of MA at the time of our interview.
Two patients with FHM had never had headache,
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Fig. 4 Haplotype analysis with available genotype data in Family 6002 with a T666M mutation in the CACNA1A gene. The affection
status is as indicated by symbols and affected haplotype as a ribbon with the letter K. The allelic state and the name of corresponding
markers are also shown. Persons with sequencing data support for the T666M mutation are indicated by arrows. Unaffected members of
the family, P24F2, P12F2 and P25F2, also carry this haplotype. In the text persons are referred to by running numbers for each family
(example; person 1 in family 6002 is referred to as P1F2)
Page 8 of 11
Brain (2006)
L. L. Thomsen et al.
but exclusively aura symptoms, in relation to their FHM
attacks.
Family 6016 had a R763C mutation [arginine (R, CGC) to
cysteine (C, TGC)] in the ATP1A2 gene. The R763C
mutation is a novel missense mutation not described
previously. Three patients with FHM were included in the
study. The sequencing data indicate that four family
members have the R763C mutation, including all but one
FHM-affected. Patient P12F16 has FHM but does not have
the mutation. The R763C mutation was not identified in any
of the 460 controls analysed.
Clinical characteristics
Two relatives (P9F16 and P11F16) have the mutation.
P9F16 suffered from attacks of MO and MA but did
not fulfil the ICHD-1 criteria for FHM, because she had
only experienced one attack of hemiplegic migraine. P11F16
had exclusive attacks of TTH and never attacks of migraine.
Linkage analysis excluding families with
identified FHM mutations
Additionally we did a genomewide linkage analysis excluding
the 6 FHM families with known or new mutations. The
results are shown in Fig. 5. The linkage to the FHM1 locus
on chromosome 19 decreases to linkage background level.
No major linkage signal is observed. Linkage with LOD
scores of 1 or greater is observed on chromosome 3p, 10p,
10q, 14q and Xp.
Discussion
FHM is a rare disorder affecting 0.005% of the Danish
population (Lykke Thomsen et al., 2002). A systematic
nationwide search is the best way to collect a sample of
families with FHM, which represents the whole spectrum of
the disease in the population. This study is the first of a
population-based sample of families with FHM. All patients
were diagnosed according to generally accepted international
classification criteria (ICHD-1). All patients fulfilled the
diagnostic criteria and all patients had a physical and
neurological examination which ruled out other possible
causes of hemiplegic attacks. Overall, the clinical characteristics of our FHM families did not differ from FHM families
described previously (Thomsen et al., 2002).
Genomewide linkage on the Danish FHM families
revealed a linkage to the known FHM1 locus on chromosome 19, a minor linkage to the FHM2 locus on
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Fig. 5 Genomewide linkage of the FHM cohort with the 6 identified FHM mutation families excluded. Results are shown for both
non-parametric linkage (LOD-N) (black line) and dominant parametric model allowing for heterogeneity (HLOD-D) (red line). LOD
scores are shown on the vertical axis and the cM position of genetic markers relative to the p end of the chromosome on the horizontal axis.
Genetics of familial hemiplegic migraine
Brain (2006)
Page 9 of 11
Table 2 Number of FHM cases and FHM families with or without mutation in the CACNA1A, ATP1A2 and SCN1A genes
FHM cases in
each family
FHM families
2
3
4
5
6
7
11
17 (18)
12
6
4
1
2
1
FHM families with
mutation in CACNA1A
FHM families
with new mutation
in ATP1A2
FHM families
with mutation
in SCN1A
Mutation
2
V138A, R763C
C1369Y
T666M
1
R202Q
R583Q
1
1
1
Methodological considerations regarding
the new mutations
Families with two previously described CACNA1A mutations were identified, the R583Q mutation as found in FHM
family 6034 and the T666M mutation in FHM family 6002.
The R583Q mutation co-segregated with the disease
phenotype; however, the mutation was also identified in
three relatives not expressing the FHM phenotype. Two of
these relatives were older women with severe cerebellar
ataxia but without migraine. One relative was 24 years of age
and did not express either the FHM phenotype or cerebellar
ataxia. This FHM family supports the clinical spectrum
described previously in families with the R583Q mutation in
the CACNA1A gene, where some family members express
HM, others cerebellar ataxia and others both HM and
cerebellar ataxia (Alonso et al., 2003).
17
10
5
3
1
1
0
The T666M mutation was identified by sequencing or
haplotype analysis in all five FHM-affected family members
and additionally in four unaffected family members. The
family member with only one FHM attack (P12F2) does not
fulfil the criteria for FHM; however, she could have FHM
with reduced penetrance. Supporting this, both her children
(age 25 and 30) had the mutation without expressing the
FHM phenotype. The fourth family member with the
mutation but without FHM was only 19 years of age, which
makes it impossible to say if this is due to incomplete
penetrance or young age.
We identified a novel mutation, C1369Y, in the CACNA1A
gene encoding the Cav2.1 calcium channel pore-forming
subunit. The subunit of the calcium channel contains four
repeated domains, each encompassing six transmembrane
segments. The mutation co-segregates with the disease in
three of four patients with FHM. Person P13F44 most likely
represents a phenocopy. Person P5F44 may be an instance
of reduced penetrance. The mutation was absent in the
460 controls. Even though the C1369Y mutation is in a
conserved residue, the absence of this mutation in one
affected family member makes us only claim that this is a
possible FHM mutation.
Furthermore we identified three novel missense mutations, V138A, R202Q, R763C, in the ATP1A2 gene encoding
the Na+, K+-ATPase 2 subunit in three Danish families
with FHM. The Na+, K+-ATPase 2 subunit consists of a
N-terminal part containing four membrane spanning
domains (M1-4) followed by a large intracellular loop and
a C-terminal region with six membrane spanning domains
(M5-10). All three mutations are located in a well-conserved
region.
The V138A mutation in Family 6007 was identified in five
individuals. The mutation followed the FHM phenotype in
all three FHM-affected persons; however, it was also
identified in two unaffected family members. Two other
unaffected relatives did not have the mutation. The
mutation was absent from 460 controls and changes a
conserved residue. The V138A mutation therefore very likely
is an FHM mutation with variable penetrance. However, no
FHM mutations have previously been described in this
region of the ATPase protein.
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
chromosome 1 and no linkage to the FHM3 locus on
chromosome 2 (Fig. 1). The linkage data for individual
families indicated that family 6002 and 6034 contribute
to the FHM1 locus and family 6005 to the FHM2 locus.
We have also screened the Danish FHM families by sequence
analysis for FHM mutations in the CACNA1A (FHM1) and
the ATP1A2 (FHM2) genes and by SNP assay for the recently
identified Q1489K mutation in the SCN1 gene (FHM3).
Three mutations were identified in each of CACNA1A and
ATP1A2 genes but none in the SCN1 gene. Of the FHM
families with identified mutations, three correspond to the
families with notable single-family linkage at either the
FHM1 or the FHM2 loci (families 6002, 6034 and 6005,
Fig. 2). When families with FHM mutations in either the
CACNA1A or the ATP1A2 genes are excluded the linkage on
chromosome 19 disappears (Fig. 5), and no other suggestive
locus is observed that would correspond to the remaining
FHM family material. In general the FHM families described
here are small and the FHM families that score with
mutations at either the FHM1 or FHM2 locus tend to be
larger than the remaining families (Table 2). The large
number of small families in the remaining FHM family
cohort makes it unlikely that novel FHM loci can be detected
by linkage analysis.
FHM families
without mutations
in the CACNA1A,
ATP1A2 and
SCN1A genes
Page 10 of 11
Brain (2006)
Our results compared with previous
studies
In this study we identified two previously described
CACNA1A mutations (T666M, R583Q), one new CACNA1A
mutation and three new ATP1A2 mutations causing FHM.
Previous functional studies show a dysfunction in the ion
transport in the involved ion channels, a dysfunction that
decreases the threshold for cortical spreading depression—
the likely underlying mechanism for migraine aura
(Leao, 1986; Goadsby, 2004). Functional studies of the
new mutations in the CACNA1A and ATP1A2 genes need to
be done in addition to further confirmation of these
mutations in other FHM families.
The CACNA1A and ATP1A2 mutations in FHM have
previously been reported in large highly selected families
showing an autosomal dominant inheritance. Interestingly,
in this study, CACNA1A and ATP1A2 mutations were
identified in the large multi-generational families (6–15 FHM
patients per family) in our population-based sample of FHM
families whereas mutations in the known FHM genes were
not found in the somewhat smaller FHM families (2–8 FHM
patients per family) (Thomsen et al., 2002). Whether the
symptoms are weaker in smaller families, the penetrance
lower or inheritance more complex is not clear.
The FHM penetrance in the Danish families reported
here is 67% for CACNA1A gene mutations and 63% for
the ATP1A2 gene mutations. This is somewhat lower than
the 80–90% penetrance published for the CACNA1A gene
(Ducros et al., 1995) or the 81% penetrance for the ATP1A2
gene (Riant et al., 2005).
Surprisingly, this study showed that only 14% of FHM
families had mutations in the CACNA1A or ATP1A2 gene.
One explanation could be that a population-based sample of
families with FHM from Denmark differs genetically from a
population-based sample of families with FHM from other
populations. Another explanation could be that previous
studies are biased towards large families with many affected
persons and clear Mendelian segregation of FHM. Thus, it is
likely that there exist other FHM genes with causative
variants with lower penetrance than the variants in the
already known FHM genes.
In our survey of the Danish population we have also
identified 105 SHM cases (Lykke Thomsen et al., 2002). 103
SHM patients have been screened for mutations in the
known FHM genes. None of the identified mutations
corresponds to the FHM mutations described here.
After removing families with known mutations our
genome-wide scan shows linkage exceeding 1 at several
locations and the linkage peaks on chromosome 10p and
14q overlap linkages published previously (Soragna et al.,
2003; Lea et al., 2005) and may therefore harbour
unidentified FHM genes.
In conclusion, FHM in the general population is most
often caused by mutations in other genes than the
CACNA1A, ATP1A2 and SCN1A genes. This study also
raises questions regarding whether all FHM is actually
dominantly inherited. The existence of many small families
in a population-based sample of families with FHM
indicates either low penetrance of a dominant gene or
complex inheritance while recessive inheritance seems
unlikely from the pedigrees.
Acknowledgements
We thank the patients with FHM and their unaffected
relatives who agreed to participate. We also thank our
colleagues for their excellent collaboration. The work was
supported by deCODE genetics and grants from the Cool
sorption Foundation of 1988, the Foundation for Research
in Neurology, the Danish Headache Society, The A.P. Møller
Foundation for advancement of medical science, the
Novo Nordisk Foundation, the IMK-Almene Foundation,
The Glaxo Wellcome Research Prize and Ms Else Torp
Foundation.
References
Alonso I, Barros J, Tuna A, Coelho J, Sequeiros J, Silveira I, et al. Phenotypes
of spinocerebellar ataxia type 6 and familial hemiplegic migraine caused by
a unique CACNA1A missense mutation in patients from a large family.
Arch Neurol 2003; 60: 610–4.
Battistini S, Stenirri S, Piatti M, Gelfi C, Righetti PG, Rocchi R, et al. A new
CACNA1A gene mutation in acetazolamide-responsive familial hemiplegic
migraine and ataxia. Neurology 1999; 53: 38–43.
Beauvais K, Cave-Riant F, De Barace C, Tardieu M, Tournier-Lasserve E,
Furby A. New CACNA1A gene mutation in a case of familial hemiplegic
migraine with status epilepticus. Eur Neurol 2004; 52: 58–61.
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
The R202Q mutation in Family 6005 followed the FHM
phenotype in all seven FHM-affected family members. A total
of 32 unaffected relatives were screened of whom four had
the mutation. Because of a variable age of onset of FHM, it is
still too early to tell whether family members P34F5, P33F5
and P14F5 represent truly non-penetrant individuals or may
show the FHM phenotype later in life. The R202Q mutation
was absent from the 460 control individuals. The R202Q
mutation is therefore very clearly an FHM mutation.
The R763C mutation in Family 6016 followed the FHM
phenotype in 4 FHM-affected individuals except in one
individual (P12F16) who did not have the mutation but
had FHM from other causes that are not linked to this
mutation. A total of 17 unaffected family members were
screened for the mutation and two of these individuals
(P11F16 and P9F16) had the mutation. A child of P20F16
had the mutation, supporting that P20F16 represents
reduced penetrance. The fact that P9F16 had had one attack
of FHM previously supports that P9F16 represents reduced
penetrance. The R763C mutation was not identified in the
460 controls. However, even though the R763C mutation
changes a highly conserved amino acid residue it is possible
that this is not truly the causative FHM mutation in this
family, since one FHM family member did not have the
mutation. Alternatively this family member could represent
a phenocopy.
L. L. Thomsen et al.
Genetics of familial hemiplegic migraine
Page 11 of 11
Kors EE, Haan J, Giffin NJ, Pazdera L, Schnittger C, Lennox GG, et al.
Expanding the phenotypic spectrum of the CACNA1A gene T666M
mutation: a description of 5 families with familial hemiplegic migraine.
Arch Neurol 2003; 60: 684–8.
Kors EE, Melberg A, Vanmolkot KR, Kumlien E, Haan J, Raininko R, et al.
Childhood epilepsy, familial hemiplegic migraine, cerebellar ataxia, and a
new CACNA1A mutation. Neurology 2004; 63: 1136–7.
Lea RA, Nyholt DR, Curtain RP, Ovcaric M, Sciascia R, Bellis C, et al. A
genome-wide scan provides evidence for loci influencing a severe heritable
form of common migraine. Neurogenetics 2005; 6: 67–72.
Leao AA. Spreading depression. Funct Neurol 1986; 1: 363–6.
Lykke Thomsen L, Kirchmann Eriksen M, Faerch Romer S, Andersen I,
Ostergaard E, Keiding N, et al. An epidemiological survey of hemiplegic
migraine. Cephalalgia 2002; 22: 361–75.
Ophoff RA, Terwindt GM, Vergouwe MN, van Eijk R, Oefner PJ,
Hoffman SM, et al. Familial hemiplegic migraine and episodic ataxia
type-2 are caused by mutations in the Ca2+ channel gene CACNL1A4. Cell
1996; 87: 543–52.
Riant F, De Fusco M, Aridon P, Ducros A, Ploton C, Marchelli F, et al.
ATP1A2 mutations in 11 families with familial hemiplegic migraine. Hum
Mutat 2005; 26: 281.
Rozen S, Skaletsky H. Primer3 on the WWW for general users and for
biologist programmers. Methods Mol Biol 2000; 132: 365–86.
Russell M, Rasmussen B, Thorvaldsen P, Olesen J. Prevalence and sex-ratio of
the subtypes of migraine. Int J Epidemiol 1995; 24: 612–8.
Soragna D, Vettori A, Carraro G, Marchioni E, Vazza G, Bellini S, et al. A locus
for migraine without aura maps on chromosome 14q21.2–q22.3. Am J
Hum Genet 2003; 72: 161–7.
Spadaro M, Ursu S, Lehmann-Horn F, Liana V, Giovanni A, Paola G, et al. A
G301R Na+/K+ -ATPase mutation causes familial hemiplegic migraine
type 2 with cerebellar signs. Neurogenetics 2004; 5: 177–85.
Takahashi T, Igarashi S, Kimura T, Hozumi I, Kawachi I, Onodera O, et al.
Japanese cases of familial hemiplegic migraine with cerebellar ataxia
carrying a T666M mutation in the CACNA1A gene. J Neurol Neurosurg
Psychiatry 2002; 72: 676–7.
Terwindt G, Kors E, Haan J, Vermeulen F, Van den Maagdenberg A, Frants R,
et al. Mutation analysis of the CACNA1A calcium channel subunit gene in
27 patients with sporadic hemiplegic migraine. Arch Neurol 2002;
59: 1016–8.
Thomsen LL, Eriksen MK, Roemer SF, Andersen I, Olesen J, Russell MB. A
population-based study of familial hemiplegic migraine suggests revised
diagnostic criteria. Brain 2002; 125: 1379–91.
Vanmolkot K, Kors EE, Hottenga JJ, Terwindt GM, Haan J, Hoefnagels WA,
et al. Novel mutations in the Na+, K+-ATPase pump gene ATP1A2
associated with familial hemiplegic migraine and benign familial infantile
convulsions. Ann Neurol 2003; 54: 360–6.
Wada T, Kobayashi N, Takahashi Y, Aoki T, Watanabe T, Saitoh S. Wide
clinical variability in a family with a CACNA1A T666m mutation:
hemiplegic migraine, coma, and progressive ataxia. Pediatr Neurol 2002;
26: 47–50.
Downloaded from http://brain.oxfordjournals.org/ by guest on October 6, 2014
Bjornsson A, Gudmundsson G, Gudfinnsson E, Hrafnsdottir M,
Benedikz J, Skuladottir S, et al. Localization of a gene for
migraine without aura to chromosome 4q21. Am J Hum Genet 2003;
73: 986–93.
De Fusco M, Marconi R, Silvestri L, Atorino L, Rampoldi L, Morgante L, et al.
Haploinsufficiency of ATP1A2 encoding the Na+/K+ pump alpha2 subunit
associated with familial hemiplegic migraine type 2. Nat Genet 2003;
33: 192–6.
Dichgans M, Freilinger T, Eckstein E, Babini E, Lorenz-Depiereux B, Biskup S,
et al. Mutation in the neuronal voltage-gated sodium channel SCN1A in
familial hemiplegic migraine. Lancet 2005; 366: 371–7.
Ducros A, Joutel A, Labauge P, Pages M, Bousser MG, Tournier-Lasserve E.
Monozygotic twins discordant for familial hemiplegic migraine. Neurology
1995; 45: 1222.
Ducros A, Denier C, Joutel A, Vahedi K, Michel A, Darcel F, et al. Recurrence
of the T666M calcium channel CACNA1A gene mutation in familial
hemiplegic migraine with progressive cerebellar ataxia. Am J Hum Genet
1999; 64: 89–98.
Ducros A, Denier C, Joutel A, Cecillon M, Lescoat C, Vahedi K, et al.
The clinical spectrum of familial hemiplegic migraine associated with
mutations in a neuronal calcium channel. N Engl J Med 2001; 345:
17–24.
Fossdal R, Jonasson F, Kristjansdottir GT, Kong A, Stefansson H, Gosh S, et al.
A novel TEAD1 mutation is the causative allele in Sveinsson’s chorioretinal
atrophy (helicoid peripapillary chorioretinal degeneration). Hum Mol
Genet 2004; 13: 975–81.
Friend KL, Crimmins D, Phan TG, Sue CM, Colley A, Fung VS, et al.
Detection of a novel missense mutation and second recurrent mutation in
the CACNA1A gene in individuals with EA-2 and FHM. Hum Genet 1999;
105: 261–5.
Goadsby PJ. Migraine aura: a knockin mouse with a knockout message.
Neuron 2004; 41: 679–80.
Gordon D, Abajian C, Green P. Consed: a graphical tool for sequence
finishing. Genome Res 1998; 8: 195–202.
Gudbjartsson D, Thorvaldsson T, Kong A, Gunnarsson G, Ingolfsdottir A.
Allegro version 2. Nat Genet 2005; 37: 1015–16.
Headache Classification Committee of the International Headache Society
(1988), Classification and diagnostic criteria for headache disorders, cranial
neuralgias and facial pain. Cephalalgia 1988; 8: 1–96.
Jen J, Kim GW, Baloh RW. Clinical spectrum of episodic ataxia type 2.
Neurology 2004; 62: 17–22.
Jurkat-Rott K, Freilinger T, Dreier JP, Herzog J, Gobel H, Petzold GC, et al.
Variability of familial hemiplegic migraine with novel A1A2 Na+/K+ATPase variants. Neurology 2004; 62: 1857–61.
Kirchmann M, Thomsen LL, Olesen J. The CACNA1A and ATP1A2 genes are
not involved in dominantly inherited migraine with aura. Am J Med Genet
B Neuropsychiatr Genet 2006; 141: 250–6.
Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA,
Richardsson B, et al. A high-resolution recombination map of the
human genome. Nat Genet 2002; 31: 241–7.
Brain (2006)