Suggestions for Sample Delivery (NGS)
BGI-TS-03-12-01-001
Rev. A0
June 2013
Genome Sequencing Platform ·BGI Tech Solutions Co.Ltd.
Contents
1. Objective ............................................................................................................................................. 1
2. Applications ........................................................................................................................................ 1
3. Responsibility ...................................................................................................................................... 1
3.1 Duties of BGI Project Coordinator .....................................................................................................1
3.2 Duties of Sample Recipients ..............................................................................................................1
4. Definition ............................................................................................................................................ 1
4.1 Test methods.......................................................................................................................................1
4.2 Test items ...........................................................................................................................................2
4.3 Specification of Test Result................................................................................................................2
5. Workflow ............................................................................................................................................ 2
5.1 Requirements for Sample Quality ......................................................................................................2
5.1.1 Requirements for DNA Samples .....................................................................................................2
5.1.2 Requirements for DNA Tissue Sample and Blood Sample Transporting .......................................8
5.1.3 Requirements for RNA Sample .................................................................................................... 11
5.1.4 Requirements for RNA Tissue Sample and Blood Sample Transporting .................................... 18
5.1.5 Requirements for COs’ Building a Library and Transferring a Sample on Their Own ............... 24
5.1.6 Requirements for Protein Sample ................................................................................................. 26
5.1.7 Requirements for Protein Tissue Sample and Blood Sample Transporting ................................. 27
5.2 Requirements for Sample Shipment: ............................................................................................... 29
5.2.1 Sample Packing ............................................................................................................................ 29
5.2.2 Sample Identification ................................................................................................................... 30
5.2.3 Sample Transportation Requirements .......................................................................................... 31
5.2.4 Sample Transport and Receiving.................................................................................................. 31
6. Relevant Documents ......................................................................................................................... 33
7. Relevant Records............................................................................................................................... 33
8. Reference........................................................................................................................................... 33
9. The Sample Information Sheet (Template) ....................................................................................... 33
10. Appendix ......................................................................................................................................... 33
Appendix A Revision Record.............................................................................................................. 34
I
Suggestions for Sample Delivery(NGS)
Page: 1/34
File NO.: BGI-TS-03-12-01-001
Drafted by: Tan Xuemei
Date of Drafting: 2013.06.03
Audited by: Chen Li、Wu Zongze、
Hu Ni、Hu Zhenfei
Date of auditing : 2013.06.05
Approved by: Wang Bo
Version NO.:A0
Date of approval: 2013.06.06
Distribution NO.:
1. Objective
To provide the criteria and related requirements for samples from Collaborators, and make sure that
the sample collaborators (hereinafter are called “COs”) submits can produce high quality data in the
standard production experiment and effectively safeguard their samples.
2. Applications
The Suggestions are applicable to COs’ samples and their transporting.
3. Responsibility
3.1 Duties of BGI Project Coordinator
3.1.1 To communicate with COs about the sample submission;
3.1.2 To give instructions to COs on how to fill in the sample information sheet;
3.2 Duties of Sample Recipients
3.2.1 Make the first test of the sample after receiving it;
3.2.2 To check up the sample information sheet with the samples received;
4. Definition
4.1 Test methods
Qubit®: Invitrogen Qubit® Fluorometer, or use Invitrogen Qubit® Fluorometer for DNA/RNA
Quality Control.
NanoDropTM: Thermo Fisher NanoDropTM ND-1000/ND-8000, or use Thermo Fisher NanoDropTM
ND-1000/ND-8000 for DNA/RNA Quality Control.
Agilent 2100: Agilent 2100 Bioanalyzer, or use Agilent 2100 Bioanalyzer for DNA/RNA Quality
Control.
Caliper LabChip GX: Caliper LabChip GX, or use Caliper LabChip GX for DNA/RNA Quality
Control.
AGE: Agarose Gel Electrophoresis.
Q-PCR: Real-Time quantitative PCR. BGI use ABI StepOnePlus Real-Time PCR System for Q-
1
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 2/34
PCR Quality Control.
4.2 Test items
v: Volume.
m: Total Mass.
c: Concentration.
M: Molar Concentration.
size: Fragment size.
RIN: RNA Integrity Number.
28 S/18 S：The ratio of 28 S to 18 S, which reflects the integrity of Eukaryotes RNA.
23 S/16 S：The ratio of 23 S to 16 S, which reflects the integrity of Prokaryotes RNA.
OD260/280：The ratio of OD260 to OD280, which reflects the purity of DNA/RNA.
OD260/230：The ratio of OD260 to OD230, which reflects the purity of DNA/RNA.
4.3 Specification of Test Result
Level A: Refers to the sample quality which not only meets the requirements for libraries
construction and sequencing, but also with enough sample amounts for libraries constructing twice
or more.
Level B: Refers to the sample quality which meets the requirements for libraries construction
and sequencing, and with the sample amount for libraries constructing only once.
Level C: Refers to the sample quality which doesn't completely meet the requirements for libraries
construction and sequencing, but can try libraries constructing with risk, and the sequencing
quality can not be guaranteed.
Level D: Refers to the sample quality which totally doesn't meet the requirements for libraries
construction and sequencing, and we suggest not use such samples for libraries constructing.
5. Workflow
5.1 Requirements for Sample Quality
5.1.1 Requirements for DNA Samples
COs need to provide analysis results of the DNA sample using one or several of the following
2
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 3/34
methods: Qubit®, NanoDropTM, AGE and Agilent 2100. For large inserted sized DNA library, the
samples should be based on Qubit® or AGE quantification. NanoDropTM quantification is not
recommended.
5.1.1.1 Quantity standard of DNA Samples
Samples classified as level A are qualified and sufficient for library construction for more than
twice, while those of level B are sufficient for library construction for once. Sample preparation
following the standard of level A is recommended for guaranteeing a normal progress of the project.
If samples fail to meet the standard even of level B, and for some reason, no more samples could be
obtained, please contact BGI Project Coordinator and Project management before sample shipment
for consulting.
Form 1: Requirements of HiSeq-DNA samples
Library Types
≤800 bp Insert
Sample Types
Quantitative
Methods in
BGI
Sample with
Single
Band/Apparent
Main Band in
Electrophoresis
(genome,
plasmid, PCR
product, etc.)
Qubit®, AGE
Sample for
Meta-genomics
Sequencing
Qubit®, AGE
Samples With
Smear in
Electrophoresis
(fragmented
samples, PCR
product, etc.):do
not need to be
fragmented
Samples With
Smear in
Electrophoresis
(fragmented
samples, PCR
product, etc.):
need to be
fragmented
Quantitative result
Conclusion
Qubit®
AGE
m≥5μg
Level A
c≥25 ng/μL
No degradation
or partially
degradation
2.5 μg≤m<5 μg
Level B
m≥4 μg
c≥30 ng/μL
2 μg≤m<4 μg
m≥3 μg
Qubit®, AGE
c≥30 ng/μL
1.5 μg≤m<3 μg
m≥4 μg
Qubit®, AGE
c≥30 ng/μL
2 μg≤m≤4 μg
3
No degradation
or partially
degradation
Level A
COs should
confirm that
BGI only
provide the test
results
Level A
COs should
confirm that
BGI only
provide the test
results
Level A
Level B
Level B
Level B
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
16 S rDNA
V3/V6 PCR Free
2 K Insert
16 S rDNA
V3/V6 PCR
product
Qubit®, AGE
Genomic DNA
Qubit®, AGE
Version NO.:A0
m≥2 μg
c≥20 ng/μL
1 μg≤m<2 μg
c≥10 ng/μL
m≥40 μg
20 μg≤m<40 μg
c≥133 ng/μL
m≥40 μg
5-6 K Insert
Genomic DNA
®
c≥133 ng/μL
Qubit , AGE
20 μg≤m<40 μg
m≥60 μg
10 K Insert
Genomic DNA
®
c≥133 ng/μL
Qubit , AGE
30 μg≤m<60 μg
m≥120 μg
20/40 K Insert
Genomic DNA
®
c≥133 ng/μL
Qubit , AGE
60 μg≤m<120 μg
m≥2 μg
RAD-Seq
Genomic DNA
Qubit®, AGE
c≥25 ng/μL
1 μg≤m<2 μg
m≥20 μg
Genomic DNA
Qubit®, AGE
c≥30 ng/μL
10 μg≤m<20 μg
PCR Free
ChIP-Seq
MeDIP/Bisufite
m≥6 μg
PCR product
with Single
Band
Qubit , AGE
ChIP-Seq DNA
samples
Qubit®, Agilent
2100
Genomic DNA
Qubit®, AGE
®
c≥30 ng/μL
3 μg≤m≤6 μg
m≥20 ng
10 ng≤m<20 ng
m≥10 μg
5 μg≤m<10 μg
c≥50 ng/μL
m≥6 μg
RRBS
Genomic DNA
®
c≥50 ng/μL
Qubit , AGE
3 μg≤m<6 μg
EXON Agilent,
Nimblegen EZ
m≥5μg
Genomic DNA
®
c≥37.5 ng/μL
Qubit , AGE
2.5μg≤m<5 μg
4
Page: 4/34
No degradation
and genome
DNA
contamination,
Fragment size
accurately
No degradation
or partially
degradation
Level A
Level B
Level A
Level B
No degradation
or partially
degradation
Level A
No degradation
or partially
degradation
Level A
No degradation
or partially
degradation
Level A
No degradation
or partially
degradation, No
RNA
contamination
No degradation
or partially
degradation
COs should
confirm that
BGI only
provide the test
results
Main Peak in
100 bp-500 bp
（Agilent
2100）
No degradation
or partially
degradation
No degradation
or partially
degradation, No
protein
contamination
No degradation
or partially
degradation
Level B
Level B
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Genotyping
Fosmid/BAC
m≥1 μg
Qubit®, AGE,
NanoDropTM
Genomic DNA
c≥50 ng/μL
0.5 μg≤m<1 μg
Qubit®, AGE
（Sampling
inspection）
Plasmid DNA
Page: 5/34
Version NO.:A0
m≥1.5 μg
0.75 μg≤m<1.5
μg
c≥15 ng/μL
No degradation
or partially
degradation
Level A
No degradation
or partially
degradation
Level A
Level B
Level B
Form 2: Requirements of 454 GS FLX+ DNA samples
Library Types
Rapid DNA
library
(1-2 k Insert)
Samp
le
Type
Quantitative
Methods in
BGI
Geno
mic
DNA
Qubit®,
AGE
Quantitative result
®
m≥2 μg
1 μg≤m<2 μg
16S rDNA
Amplicon library(for soil,
water and excrement from
mamals)
AGE
NanoDropTM
c≥25
ng/μL
No degradation
or partially
degradation
OD260:OD280≥1.8
OD260:OD230≥1.8
c≥20
ng/μL
No degradation
or partially
degradation
Qubit
m≥400 ng
Geno
mic
DNA
Level A
Level B
Level A
®
Qubit ,
AGE
Conclusio
n
200 ng≤m<400 ng
OD260:OD280≥1.8
OD260:OD230≥1.8
Level B
Note: According to the experimental conditions, BGI would possibly dilute the original
sample before detection if the sample volume is too small (less than 15 μL). If the sample is
not preserved in the 1.5 mL EP tube, BGI would change tube firstly.
5.1.1.2 Insufficient Samples, Degradation and Other Potential Risks and Suggestions to Confront
Them
a) Insufficient Sample Quantity: It may lead to 1) Failure in library construction; 2) Insufficient
library for sequencing; 3) Contain the potential risks of poor randomness; 4) Insufficient data
output or uneven coverage; 5) ChIP samples possible adapter contamination rate is on the high
side.
b) Quantitation using Qubit® is more accurate than using NanoDropTM and hence is used in calculating sample quantity.
c) If COs intend to construct library with samples of insufficient amount or degraded samples,
COs shall take responsibility for it or take the risk of being involved in this matter.
d) Degraded Sample (especially genomic DNA): It may lead to uneven coverage, poor randomness and high duplication, etc.
5
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 6/34
e) PCR product: The OD260/280 ratio between 1.8 and 2.0 is preferably. For the PCR samples
with single band and it’s fragment length is between 100 bp and 200 bp, we can sequence
through all base without interrupting; For samples whose length is between 200 bp and 500 bp,
interrupting fragments are needed for sequencing through, and it may affect assembly result because these samples are difficult to interrupt, and have risk of bad randomness; For samples
longer than 500 bp, interrupting is needed, and the library is constructed according to genome
samples strategy.
f)
Samples for Metagenomics Sequencing: No specific requirement for OD, preferably OD between 1.8 and 2.0. Slight contamination by protein or RNA (AGE testing) is acceptable.
g) Fosmid/BAC DNA Samples: The samples are recommended to use 96 well plates for transportation. Every cloning’s concentration, total quantity and volume should maintain the same. Pure
water, TE Buffer is recommended for dissolving DNA samples. Total mass as 0.75 μg are available for library construction for once. The sample’s minimum concentration should be no less
than 15 ng/µl and no degradation or partially degradation. Protein and RNA contamination need
to be eliminated. For Fosmid/BAC samples, BGI will not carry out sample detection or Sampling observation because of the large amount of samples. Therefore COs should provide AGE
and quantitative concentration results, and BGI will construct libraries based on them.
5.1.1.3 Samples for ChIP-Seq:
a) Main bands of the fragmented DNA in electrophoresis should be preferably in the range of 100500 bp, mainly peak within 200-300 bp, with the optimal length 250 bp or so. To get DNA
ChIP design primer for Q-PCR test and quantitative, please provide testing site and test report,
with positive and negative control.
b) Please indicate the size of DNA fragments clearly，including the range and position of the
main band.
c) We suggest to validate the reliability of ChIP experiment by choosing a reasonable positive
DNA binding region for Q-PCR experiment after ChIP enrichment, but this method is not suitable for the ChIP experiment that without positive control sequence.
d) There is a difference between Gel result after supersonic treatment and real fragment size,
which may affect library results. In ChIP experiment, although the fragment ranges of
supersonic results is from 100 bp to 500 bp, the differences still exist after antibody enrichment,
in very occasionally, it is longer than 500 bp or shorter than 100 bp which will cause library
6
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 7/34
unqualified. So, for some samples, we failed to construct libraries although the total mass
passes our test.
e) ChIP sample contains other species DNA contamination; it may lead to sequencing data quality
is bad. ChIP in the experimental process, and will exist exogenous species of DNA evidence
contamination samples in very accidental circumstances, and this only in sequencing finish,
carries on the analysis comparison will be found. So suggest COs in the ChIP experiment, the
experimental process in strict control, so as to reduce the risk.
f)
ChIP sample contains significant protein or the concentration of the ions too high or other
impurities contamination may make the 2100 peak figure anomaly detection, and influence
enzyme reaction in the process of construct library, resulting in the failure of construction
libraries.
5.1.1.4 Library with Inserted DNA Fragment Longer Than 5 kb
If construct 5-10 K insert library, COs should running the sample using AGE (0.6% gel, choosing λHind III digest marker or other ladder with bands of 20 kb or above, and electrophoresis at 80-120
V for 40-150 minutes), the longest genomic DNA band should be longer than 23 kb. If construct 2040 K insert library the pulse-field electrophoresis is suggested to using, and DNA main band should
be longer than 40 kb.
5.1.1.5 Samples for RAD-Seq
a) The final data distribution of sample for RAD-Seq results with sample quantitative accuracy of
a great relationship. In the mean time, polysaccharide or protein can also affect the restriction
enzyme digestion, to result in poor data distribution.
b) Please as far as possible to provide the same batch of genomic DNA samples, lest because of
different batch extraction effect to different effect of enzyme digestion.
c) Be sure to use RNase enzyme treatment genome DNA samples (especially plant samples), so as
not to affect quantitative accuracy of sample.
d) Level C sample for RAD-Seq can use to construction non-target reads library, but contains the
potential risks of poor data.
5.1.1.6 Samples for 16 S rDNA V3/V6 PCR Free
This kind of sample need to do genome and V3/V6 area of PCR product QC, only two kinds of
testing are qualified we will constructed PCR free library.
7
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Page: 8/34
Version NO.:A0
5.1.1.7 Please purify samples, avoiding contamination by polycarbonate, protein and exonclease.
Please clearly state the nature of the solvent used in the sample in Sample Information Form in
shipment.
5.1.2 Requirements for DNA Tissue Sample and Blood Sample Transporting
Declaration: For any pathogenicity or infectious sample (tissue, blood, bacterium etc), clear
risk sign must be attached on the sample tubes or bags.
5.1.2.1 Requirements for Total Quantity Demanded
Form 3: Requirements of Total Amount of DNA Tissue Samples
DNA
Insert
≤800 bp
DNA
Insert
2-5 kb
DNA
Insert
5-10 kb
DNA
Insert
≥20 kb
MeDIP /
Bisulfite
Exon
Genotyping
≥1 g
≥2 g
≥3 g
3-5 g
1-2 g
≥1 g
≥1 g
Net Weight of
Fresh Plants tissue
≥2 g
≥4g
≥8 g
≥16 g
4g
≥4g
≥2 g
The Number of
Fresh Culture cells
≥8×106
≥5×107
≥5×107
≥9×106
≥8×106
≥4×106
Whole Blood
≥1 mL
≥5 mL
≥10 mL
20-50 mL
≥5 mL
≥2 mL
≥1 mL
Meta
≥2 g
N/A
N/A
N/A
N/A
N/A
N/A
≥1 g
≥2 g
≥3 g
3-5 g
N/A
N/A
N/A
≥5 mL
≥25 mL
≥50 mL
N/A
N/A
N/A
N/A
Sequencing Type
Net Weight of
Fresh Animals
tissue
Thallus
（Net Weight）
Bacterium Fluid
（Logarithmic
Phase）
≥9×106
Note: DNA production varies greatly with different types of sample. E.g. the whole blood sample of
human and mammal of which erythrocyte lacks a nucleus, and we can get low DNA production, so
a bigger sample volume is demanded. In contrast, for bird or fish blood, in which erythrocyte has
nucleus, more DNA can be yielded, so a less sample volume is demanded. As for muscle tissues
containing abundant muscle fibers and lipid, complex plants containing high amylase and
polyphenol, a bigger sample volume is demanded because of their limited DNA yield. We can get
20-30 μg DNA from 50 mg liver tissue which has an active metabolism, so the sample volume can
be reduced appropriately.
8
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 9/34
5.1.2.2 Microorganism Samples
a) Bacterium Fluid: Take single colonies into suitable volume liquid medium (50-100 mL) in the
appropriate temperature training for the night, OD600 0.6-0.8 is advisable (Logarithmic Phase); and
then transfer to 50 mL centrifugal tube, with parafilm film sealed. Transport it with a large volume
of dry ice and to ensure that there is still sufficient dry ice when we get the samples.
b) Thallus: Collect the bacterium fluid in centrifuge tubes by centrifugation, seal tubes with
parafilm, and put them into 50 mL centrifuge tubes. Transport them with a large volume of dry ice
and to ensure that there is still sufficient dry ice when we get the samples.
c) Culture dish: Seal the dish with parafilm, and put it into seal bags. Transport it with a large
volume of dry ice.
5.1.2.3 ChIP-Seq Cell Samples
For ChIP-Seq cell samples: 5107 cells are required for one sample preparation (for human or
mouse cell line, 1107 cells can try to IP). Total cell number for multiple preparations = number of
sample preparation × 5107. COs should also offer a small amount of sample (1/10 of total samples)
individually repacked in a tube for us to do early experiment. Special category tissues must submit a
consultation in advance extraction.
5.1.2.3.1 Cross-linking Chromatin Immunoprecipitation
a) Prepare the 1% formaldehyde with PBS (pH=7.0);
b) Collect the cells in 15 mL centrifuge tubes by centrifugation, Crosslink by adding 1%
formaldehyde and rocked for 10 min at 37 oC;
c) Stop the cross-linking by adding glycine to a final concentration of 125 mM. Continue to rock at
room temp for 5 min;
d) Wash the cell two times with ice-cold 1×PBS. Then add into 1×PBS (1 mL) plus protease
inhibitors and transfer to 1.5 mL EP tube and collected by centrifugation, quickly freeze them in
liquid nitrogen, then transport them with a large volume of dry ice and to ensure that there is
still sufficient dry ice when we get the samples.
5.1.2.3.2 Native Chromatin Immunoprecipitation
a) Collect the cells in 15 mL centrifuge tubes by centrifugation;
b) Wash the cell two times with ice-cold 1×PBS;
9
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 10/34
c) Cell pellets are resuspended in 1×PBS (1 mL) plus protease inhibitors and transfer to 1.5 mL EP
tube and collected by centrifugation, quickly freeze them in liquid nitrogen, and then transport
them with a large volume of dry ice and to ensure that there is still sufficient dry ice when we
get the samples.
5.1.2.4 Requirements for Tissue Sampling
1) Plant Tissue
Please use 70% alcohol to rinse out dust and mud on the surface of materials obtained in the field or
countryside, then blot up the water, quickly freeze them in liquid nitrogen, and put them into
precooled 50 mL centrifuge tubes or seal bags. Then transport them with a large volume of dry ice
and to ensure that there is still sufficient dry ice when we get the samples.
2) Animal Tissue
Tissues drawn from living bodies should be rinsed with 0.9％ normal saline to remove blood dirt
and contaminants, then eliminate connective tissue and adipose tissue as well as other tissues that
are not needed for research. Then the tissues are divided into small pieces of about 50 mg, and put
into 1.5 mL or 2.0 mL EP tubes, quickly frozen in liquid nitrogen. Then put EP tubes into precooked
50 mL centrifuge tubes or seal bags. Transport it with a large volume of dry ice and to ensure that
there is still sufficient dry ice when we get the samples.
3) Blood
The sample is required to be a whole blood one, and anticoagulant needs to be added in the sample.
Suggest to use the EDTA anticoagulation tube collection (Please do not use heparin anticoagulation).
The sample needs to be transported with a large volume of dry ice after having been frozen and to
ensure that there is still sufficient dry ice when we get the samples.
4) Culture cells
a) Remove cell culture medium after culturing or disposal of adherent cells or suspension cells;
b) Wash with PBS buffer quickly, to remove the PBS buffer. Adherent cells can be removed with a
cell scraper.
c) Transfer collected cells to a 1.5 mL EP tube, quickly freeze them with liquid nitrogen, and then
transport them with the dry ice.
5.1.2.5 Cautions
1) It is necessary to distinguish normal or abnormal tissue accurately. If possible, it is recommended
10
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Page: 11/34
Version NO.:A0
to decide which part is sampled according to a frozen section report.
2) It is suggested that the disposal and incision of tissue sample should be carried out on ice for
DNA experimental sample preparations. It will lead to DNA degradation if it takes too much time.
3) Pathological or normal samples collected during clinic operation should be preserved in liquid
nitrogen right away after incision, if they could not be treated immediately when they are obtained
from an operating room.
5.1.3 Requirements for RNA Sample
5.1.3.1 Please provide analysis results of the RNA sample using one or several of the following
methods: Qubit®, NanoDropTM, AGE and Agilent 2100.
5.1.3.2 Please purify samples, avoiding contamination by polycarbonate, protein and exonclease.
Please clearly state the nature of the solvent used in the sample in the Sample Information Form in
shipment.
5.1.3.3 Requirements for Concentration, Purity, and Total Amount of RNA Samples
a) When we test sample integrity by Agilent 2100, we will consider comprehensively the species,
distribution of basic line, 5 S peak etc. as well as the following parameter table.
b) Based on Agilent 2100 results, we get concentration and total amount information, Based on
NanoDropTM results, we get OD value for sample purity.
c) Samples classified as level A are qualified and sufficient for library construction for more than
twice, while those of level B are sufficient for library construction for once. Sample preparation
following the standard of level A is recommended for guaranteeing a normal progress of the
project. If samples fail to meet the standard even of level B, and for some reason, no more
samples could be obtained, please contact BGI Project Coordinator and Project management
before sample shipment for consulting.
Form 4: Requirements of HiSeq-RNA samples
Library Types
Sample
Types
Quantitative
Methods in
BGI
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
Quantitative result
Agilent/AGE
m≥40 μg
RNA-Seq
(Transcriptome)
Total RNA of
Human, Rat
Agilent 2100
TM
20 μg≤m<40 μg
m≥10 μg
11
NanoDrop
c≥250 ng/μL
RIN≥6.5
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
c≥65 ng/μL
RIN≥7.0
The baseline is
smooth and 5 S
N/A
Conclusio
n
Level A
Level B
Level A
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
and Mice
Version NO.:A0
28 S/18 S≥1.0
5 μg≤m<10 μg
Agilent 2100
c≥150 ng/μL
10 μg≤m<20 μg
m≥20 μg
Total RNA of
other Animals
Total RNA of
Prokaryotes
RNA-Seq
(Quantification)
TruSeq
(Transcriptome)
Agilent 2100
10 μg≤m<20 μg
Agilent 2100,
NanoDropTM
ds cDNA
(Prokaryotes,
Eukaryotes)
Not including
PCR product,
fragmented
samples
NanoDropTM,
AGE, Qubit®
mRNA
purified with
oligo(dT) or
RNA depleted
of rRNA
Agilent 2100
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
Total RNA of
Human, Rat
and Mice
Agilent 2100
Total RNA of
Insect
Agilent 2100
Total RNA of
other Animals
Agilent 2100
mRNA
purified with
oligo(dT) or
RNA depleted
of rRNA
Agilent 2100
Total RNA of
Agilent 2100,
NanoDropTM
peak is normal.
Level B
m≥20 μg
Total RNA of
Insect
Page: 12/34
m≥10 μg
5 μg≤m<10 μg
The baseline is
smooth and 5 S
peak is normal.
Level A
N/A
Level B
Level A
c≥150 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥65 ng/μL
RIN≥7.0
23 S/16 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
Level B
m≥2 μg
Level A
Level B
Level A
c≥15 ng/μL
Mainly
fragment>1 K
1.8≤OD260/280
≤2.2
1 μg≤m<2 μg
Level B
c≥20 ng/μL
rRNA<10%
Mainly
fragment>1 K
N/A
c≥200 ng/μL
RIN≥6.5
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
c≥80 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥200 ng/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥200 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
m≥0.1 μg
c≥15 ng/μL
rRNA<10%
Mainly
fragment>1 K
N/A
Level C
m≥2 μg
c≥20 ng/μL
The baseline is
smooth and 5 S
OD260/280≥1.8
OD260/230≥1.8
Level A
m≥0.2 μg
m≥10 μg
5 μg≤m<10 μg
m≥4 μg
2 μg≤m<4 μg
m≥10 μg
5 μg≤m<10 μg
m≥10 μg
5 μg≤m<10 μg
12
Level C
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Plant, Fungi
Total RNA of
Human, Rat
and Mice
1 μg≤m<2 μg
m≥400 ng
Agilent 2100
200 ng≤m<400
ng
RIN≥6.5
28 S/18 S≥1.0
peak is normal.
c≥5 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
c≥20 ng/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥20 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥300 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
c≥10ng/μl
RIN≥6.5
28S/18S≥1.0
The baseline is
smooth and 5 S
peak is normal
c≥10ng/μl
The baseline is
smooth and 5 S
peak is normal.
m≥2 μg
Total RNA of
Insect
Agilent 2100
Total RNA of
other Animals
Agilent 2100
1 μg≤m<2 μg
m≥2 μg
1 μg≤m<2 μg
m≥10 μg
LncRNA-Seq
Low-input
(200ng) Eukarya
RNA
(Quantification)
Total RNA of
Mammals
Agilent 2100
5 μg≤m<10 μg
Total RNA of
Plant, Fungi
Agilent
2100、
NanoDrop
Total RNA of
Insect
Agilent 2100
m≥0.4μg
0.2μg≤m<0.4μg
m≥0.4μg
0.2μg≤m＜0.4μg
Agilent 2100
Total RNA of
Plant
Agilent 2100
Level A
N/A
Level B
Level A
Level B
Level A
Level B
Level A
N/A
Level B
OD260/280≥1.8
OD260/230≥1.8
Level A
Level B
N/A
Level A
N/A
Level B
Level A
c≥10ng/μl
RIN≥7.0
28S/18S≥1.0
The baseline is
smooth and 5 S
peak is normal
c≥200ng/ul
RIN≥7.5
28s/18s≥1.3
The baseline is
smooth and 5 S
peak is normal.
c≥200 ng/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
The baseline is
smooth and 5 S
peak is normal.
N/A
10 μg≤m<20 μg
c≥200 ng/μL
RIN≥8.0
28 S/18 S≥1.5
m≥50 ng
c≥1 ng/μL
N/A
N/A
0.2μg≤m＜0.4μg
m≥20ug
10ug≤m<20ug
m≥20 μg
Total RNA of
Insect
Level B
N/A
m≥0.4μg
Total RNA of
other Animals
Page: 13/34
Version NO.:A0
Agilent 2100
10 μg≤m<20 μg
N/A
Level B
N/A
Level A
N/A
Level B
Level A
Level B
Small RNA
m≥20 μg
Total RNA of
other
Eukaryotes
Agilent 2100
Serum/Plasma
RNA/ RNA
Immunoprecipitation
Agilent 2100
pico
13
Level A
Level B
Level C
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Degradome
sequencing
Small RNA
（<200 nt）
Agilent 2100
Total RNA of
Animals
Agilent 2100
Total RNA of
Insect
Agilent 2100
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
poly(A)mRNA
Agilent 2100
Total RNA of
Animals
Agilent 2100
Total RNA of
Insect
Agilent 2100
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
poly(A)mRNA
Agilent 2100
m≥1 μg
m≥200μg
100μg≤m≤200μg
c≥20 ng/μL
N/A
N/A
c≥1 μg/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥1 μg/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥1 μg/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
c≥200 ng/μL
rRNA<10%
Mainly
fragment>1 K
N/A
c≥80 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥80 ng/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥80 ng/μL
RIN≥6.5
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
c≥20 ng/μL
rRNA<10%
Mainly
fragment>1 K
N/A
m≥200μg
100μg≤m≤200μg
m≥200μg
100μg≤m≤200μg
m≥2 μg
m≥8 μg
4 μg≤m<8 μg
m≥8 μg
4 μg≤m<8 μg
DGE
Page: 14/34
Version NO.:A0
m≥8 μg
4 μg≤m<8 μg
m≥0.1 μg
Level C
Level A
Level B
Level A
Level B
Level A
Level B
Level C
Level A
Level B
Level A
Level B
Level A
Level B
Level C
Form 5: Requirements of 454 GS FLX+ RNA samples
Library Types
RNA-Seq
(Transcriptome)
Sample
Types
Quantitative
Methods in
BGI
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
Total RNA of
Rat, Human
Agilent 2100
Total RNA of
Insect
Agilent 2100
Total RNA of
other Animals
Agilent 2100
Quantitative result
NanoDropTM
Agilent/AGE
m≥100 μg
50 μg≤m<100 μg
m≥40 μg
20 μg≤m<40 μg
c≥400 ng/μl
RIN≥6.5
28 S/18 S≥1.0
The baseline
is smooth and
5 S peak is
normal.
OD260/280≥1.8
OD260/230≥1.8
c≥200 ng/μl
RIN≥7.0
28 S/18 S≥1.0
The baseline
is smooth and
5 S peak is
normal.
N/A
c≥400 ng/μl
The baseline
is smooth and
5 S peak is
normal.
OD260/280≥1.8
OD260/230≥1.8
The baseline
is smooth and
OD260/280≥1.8
OD260/230≥1.8
m≥100 μg
50 μg≤m<100 μg
m≥40 μg
c≥200 ng/μl
14
Conclusion
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
mRNA
purified with
oligo(dT) or
Agilent 2100
pico
Page: 15/34
Version NO.:A0
20 μg≤m<40 μg
RIN≥7.0
28 S/18 S≥1.0
5 S peak is
normal.
m≥0.2 μg
c≥20 ng/μl
rRNA<10%
Main
fragment>1 K
RNA depleted
of rRNA
Level B
N/A
Level C
Note: RNA-Seq for 454 GS FLX+ platforms is currently under R&D progress. The
requirement may be higher or lower than the table above in project implementation.
Note: According to the experimental conditions, BGI would possibly dilute the original
sample before detection if the sample volume is too small (less than 15 μL). If the sample is
not preserved in the 1.5 mL EP tube, BGI would change tube firstly.
Form 6: Requirements of Ion Proton RNA samples
Library Types
RNA-Seq
(Quantification)
Sample
Types
Quantitative
Methods in
BGI
Total RNA of
Plant, Fungi
Agilent 2100,
NanoDropTM
Total RNA of
Human, Rat
and Mice
Agilent 2100
Total RNA of
Insect
Agilent 2100
Total RNA of
other Animals
Agilent 2100
mRNA
purified with
oligo(dT) or
RNA depleted
of rRNA
Agilent 2100
Quantitative result
NanoDropTM
Agilent/AGE
m≥10 μg
5 μg≤m<10 μg
m≥4 μg
2 μg≤m<4 μg
c≥200 ng/μL
RIN≥6.5
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
OD260/280≥1.8
OD260/230≥1.8
c≥80 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥200 ng/μL
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥200 ng/μL
RIN≥7.0
28 S/18 S≥1.0
The baseline is
smooth and 5 S
peak is normal.
N/A
c≥15 ng/μL
rRNA<10%
Mainly
fragment>1 K
N/A
m≥10 μg
5 μg≤m<10 μg
m≥10 μg
5 μg≤m<10 μg
m≥0.1 μg
Conclusio
n
Level A
Level B
Level A
Level B
Level A
Level B
Level A
Level B
Level C
Note: If samples fail to meet the standard even of level B, and for some reason, no more samples
could be obtained, please contact BGI Project Coordinator and Project management before sample
shipment for consulting.
5.1.3.4 Possible Emerging Risks and Suggestions in Case of Deficient or Degradable Samples
a) Deficient or too Low Quantity of RNA: It may lead to library construction failure, too low
library production to sequence or insufficient sequencing data quantity; and it may affect data
15
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 16/34
randomness and cause bias.
b) Sample Degradation: It may lead to library construction failure; may lead to high proportion
of duplication and poor randomness of RNA-Seq data; may lead to high proportion of rRNA
contamination in small RNA sequencing, affect the effective data ratio and lead to abnormal
distribution of library fragment length. May lead to inaccurate gene expression quantitation in
DGE.
c) Small RNA Serum/Plasma RNA: Sample concentration is too low to detect accurate sample
concentration, purity and integrality. The risk of library construction is very high, may leading
to failure; there may be high adaptor contamination proportion and cause low alignment rate to
reference genome.
d) Low content of small RNA: For some samples, total RNA can reach sample requirement, but
the content of small RNA is much lower than that in normal samples (e.g. Cultivated cells)
because of sample specificity, which may lead to library construction failure
e) Small RNA (<200 nt) Samples: We only recycle Small RNA below 200 nt. We cannot estimate
the integrity of RNA and the ratio of degradation of rRNA/tRNA in samples. rRNA
contamination rate could be too high in library to obtain effective data.
f)
Contamination by Protein or Insoluble Impurity: It may affect normal electrophoretic
separation, result in incorrectness of cutting gel, and affect library quality. It also may affect the
efficiency of mRNA isolation using magnetic bead and reverse transcription and then leads to
library construction failure. Even library is carried out sequencing; it may lead to poor
randomness of RNA-Seq library, high proportion of duplication and inaccurate gene expression
quantitation (common in plant sample containing much saccharides and phenols).
g) The 260/280 and 260/230 absorbance ratio <1.8：It may lead to library construction failure,
library production too low to sequence or insufficient sequencing data quantity; and it may
affect randomicity and cause bias. The closer to the standard the smaller risk, conversely the
bigger.
h) Remove the Remains of rRNA in Samples: The remains may lead to too high ratio of rRNA
in sequencing data.
i)
cDNA, mRNA Samples: Integrity of RNA is hard to test, Sequencing Quality cannot be
guaranteed.
j)
5 S peak on the high side will affect the quantitative veracity and conduce to the downstream
16
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 17/34
inaccuracy and the poor data.
k) Samples infected by virus: It may have high ratio of virus sequence in the library, and may
lead to low quantity sequencing result.
l)
Not receiving viral RNA: The viral RNA has certain infectious, BGI receive only the viral
cDNA sample.
If COs insist on constructing library with samples that are deficient or in too low quantity or
degraded ones, COs shall take responsibility for it or take the risk of being involved in this matter.
5.1.3.5 The Below Samples Belong to Level C, and We Can Try to Construct These Samples
a) The RIN value is slightly under standard, but basic line is smooth.
b) The RIN value reaches standard, but basic line is slightly rise.
c) The 28 S/18 S or 23 S/16 S value is slightly under standard, but basic line is smooth.
d) The 28 S/18 S or 23 S/16 S value reaches standard, but basic line is slightly rise.
e) Basic line is smooth and the RIN value reaches standard, but the 5 S peak is a little high.
f)
The quality is qualified, but total amount below Level B.
5.1.3.6 Agilent 2100 with RNA Integrality
17
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Page: 18/34
Version NO.:A0
5.1.4 Requirements for RNA Tissue Sample and Blood Sample Transporting
Declaration: For any pathogenicity or infectious sample (tissue, blood, bacterium etc), clear
risk sign must be attached on the sample tubes or bags.
5.1.4.1 Total Quantity Demanded
Form 7: Requirements of Total Amount of RNA Tissue Samples
Small RNA
RNA-Seq
（Transcriptome）
Digital
Gene
Expression
RNA-Seq
（Quantification）
Net Weight of Fresh
Animal Tissue
≥300mg
≥300mg
≥200mg
≥200mg
Net Weight of Fresh
Plant Tissue
≥500mg
≥1g
≥300mg
≥300mg
The Number of Fresh
Culture Cells
≥4×106
≥4×106
≥2×106
≥2×106
Serum
up to 5 mL
N/A
N/A
N/A
Whole Blood
up to 5 mL
up to 5 mL
up to 3 mL
up to 3 mL
Thallus
Up to 50 mL
fresh microbial
culture
medium or one
90 mm culture
dish
Up to 50 mL fresh
microbial culture
medium or two 90
mm culture dishes
Up to 50
mL fresh
microbial
culture
medium or
one 90 mm
culture dish
Up to 50 mL fresh
microbial culture
medium or one 90
mm culture dish
Amount/Sequencing
Type
18
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 19/34
Note: RNA production varies greatly with different types of sample. E.g. the whole blood
sample of human and mammal of which erythrocyte lacks a nucleus, and we can get low RNA
production, so a bigger sample volume is demanded. In contrast, for bird or fish blood, in
which erythrocyte has nucleus, more RNA can be yielded, so a less sample volume is
demanded. Muscle tissue contains abundant muscle fibers and lipid, the complex plant
contains high amylase and polyphenol, so a bigger sample volume is demanded because of
their low RNA yield. We can get 20-30 μg RNA from 50 mg liver tissue which has an active
metabolism, so the sample amount can be reduced appropriately.
5.1.4.2 Requirements for Tissue Sampling
The routine method for tissues treatment is liquid nitrogen flash freezing：
a) Prepare sufficient liquid nitrogen and 50 mL or 15 mL centrifuge tubes, and filled the tube with
liquid nitrogen (Notice: puncture the tube lid first, or the liquid nitrogen may expand rapidly
and explodes ).
b) Tissues taken from living bodies should be rinsed quickly and frozen in the centrifuge tubes
from step (1), and then can be stored at -80 °C after freezing in liquid nitrogen(Notice: do not
put the sample into the centrifuge tube first and then fill with liquid nitrogen ).
c) If the tissues could not be collected in a centrifuge tube, it should still be frozen in liquid nitrogen, and another suitable vessel can be used to preserve it. Before storage at -80 °C, the vessel
with tissues should be frozen in liquid nitrogen also.
d) Transport it with a large volume of dry ice and to ensure that there is still sufficient dry ice
when we get the samples.
5.1.4.2.1 Plant Tissue
Please use DEPC-H2O to rinse out dust and mud on the surface of materials obtained in the field or
countryside, then blot up water and cut the sample into small plots of about 100 mg, then put the
plots into 1.5 mL or 2.0 mL RNase-free EP tubes, and add tissue preservation reagents like
RNAlater (reagent of ABI company’s is strongly recommended Please follow the instructions strictly.) In order to let RNAlater permeate into the tissue, some plants’ natural barrier, which could prevent from evaporation of water like waxy skin of leaf tissue, needs to be broken through, so as to
allow RNAlater access into the tissue. Seal the tubes with parafilm after it is quickly frozen with
liquid nitrogen, and then put the EP tubes into 50 mL centrifuge tubes or small plastic bags with
good tightness. Then transport it with a large volume of dry ice and to ensure that there is still suffi-
19
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 20/34
cient dry ice when we get the samples.
5.1.4.2.2 Animal Tissue
Tissues drawn from living bodies should be rinsed with 0.9％ normal RNase-free saline immediately to remove blood dirt and contaminants, and then eliminate connective tissue and adipose tissue as
well as other tissues that are not needed for research. Then put the plots into 1.5 mL or 2.0 mL EP
tubes of RNase-free, add tissue preservation reagents such as RNAlater. Then put the EP tubes into
50 mL centrifuge tubes or small plastic bags with good tightness. Then transport it in a large volume
of dry ice and to ensure that there is still sufficient dry ice when we get the samples.
Please freeze the samples following above specific details; the tips for trace samples are listed as
follows: Firstly, immersing trace samples in liquid nitrogen. Secondly, to grinding the tissues
powdered under the protection of liquid nitrogen and adding a sufficient amount of lysate for
cracking reaction, 15 mg/mL Trizol is recommended. Finally, the normal-temperate lysis above 5
min and transport it by enough dry ice.
5.1.4.2.3 Tumor Tissue
It is necessary to distinguish normal from abnormal tissue accurately. If possible, it is recommended
to collect samples according to the report on frozen section. Freeze immediately ex vivo tissue with
liquid nitrogen. Then put the plots into 1.5 mL or 2.0 mL EP tubes of RNase-free, add tissue preservation reagents like RNAlater. And put the EP tubes into 50 mL centrifuge tubes or small plastic
bags with good tightness. Then transport it in a large volume of dry ice and to ensure that there is
still sufficient dry ice when we get the samples.
5.1.4.2.4 Microorganism Samples
a) Thallus: If you need liquid culture of microorganisms, pick monoclonal in 50 mL liquid medium,
usually at 37 oC culture overnight. If the OD600 is between 0.6-0.8, it indicates that the strong
growth of bacteria in logarithmic growth phase. Collect the bacterium fluid in centrifuge tubes by
centrifugation, add tissue preservation reagents such as RNAlater, seal tubes with parafilm, and put
them into 50 mL centrifuge tubes. Transport them with a large volume of dry ice and to ensure that
there is still sufficient dry ice when we get the samples.
b) Culture dish: Plate cultivation of microorganisms, flat way to send samples. Seal the dish with
parafilm, and put it into seal bags. Transport it with a large volume of dry ice.
5.1.4.3 Operation Process of Cell and Blood Sampling
5.1.4.3.1 Adherent Cells
20
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 21/34
a) Remove cell culture fluid after culturing or disposal of adherent cells；
b) Add Trizol reagent in the proportion of 1 mL Trizol reagent every 10 cm2 culture space；
c) Beat upon with 1 mL pipettor repeatedly to make sure all the surface of culture bottles culturing
cells could contact the regent, so that the cells could be digested sufficiently;
d) Transfer the cells into the RNase-free tube and beat upon repeatedly with disposable syringe
until there are not any visible conglobate cell blocks. The whole liquor should be clear and not
melicera;
e) Preserve in dry ice or refrigerator at -80 oC.
5.1.4.3.2 Suspension Cells
a) The cells collected by centrifugation after culturing or disposal and remove the cell culture medium.
b) Rinse preserved cells quickly with PBS buffer, and then centrifugalize to remove PBS buffer.
c) Add Trizol reagent in the proportion of 1mL Trizol reagent every 1×106 cells, and beat upon
repeatedly with disposable syringe until there are not any visible conglobate cell blocks. The
whole liquor should be clear and not melicera.
d) Preserve in dry ice or -80 oC refrigerator.
5.1.4.3.3 Blood
a) Add an equal volume of PBS (1×) in fresh whole blood with anticoagulant and mix it sufficiently.
b) Slowly transfer it into another centrifuge tube with lymphocyte separating solution in order to
keep it above the lymphocyte separating solution (that is to say, do not mix these two types of
liquid and keep clear interface), then centrifugalize with 3000 g for 30 minutes.
c) Transfer the leucocytes layer with pipettor carefully, and then rinse it with PBS (1×) and centrifugalize to retain the leukocyte, and remove the supernatant.
d) Add Trizol reagent with the amount of 20 times volume of leukocyte and beat upon repeatedly
with disposable syringe until there are not any visible conglobate cell blocks. The whole liquor
should be clear and not melicera.
e) Preserve in dry ice or refrigerator at -80 oC.
If not able to do lymphocyte separation, please follow the requirements for blood sample
21
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 22/34
preparation as below:
Under normal temperature conditions, collect 500 µl fresh whole blood to RNAprotect ® Animal
Blood Tubes (500 µl), Total quantity demanded of whole blood must 2 mL for birds、5 mL for
other animals, close the lid immediately, inverted gently for 8-10 times, and deliver it with a large
volume of dry ice. Send 5 mL or more samples.
5.1.4.3.4 Serum
Normally it takes 1 hour to separate serum from the blood clotting.
Even if using heating
centrifugal, which may cause the hemolysis; it also needs half an hour. The blood coagulant agent is
added to fresh blood to speed up the serum generation, and shorten the period of collecting serum.
The serum should immediately be kept in the -80 oC refrigerator after collected. To ensure the
success rate of serum extraction, at least of 5 mL of serum is needed, which should be quick-frozen
with liquid nitrogen and transported with dry ice. The production of microRNA may differ because
of different sources of serum, and they need special treatment.
5.1.4.3.5 Cautions
a) It is suggested that the disposal and incision of tissue sample should be carried out on ice for
RNA experimental sample preparations. Disposal for a long time will lead to degradation.
b) Pathological or normal samples collected during clinic operation should be preserved in liquid
nitrogen immediately, if they could not be treated right away.
5.1.4.4 The Existing Extraction Risks and Suggestion for Insufficient Tissue Amount or Freezethaw Tissue
Tissue extraction may be affected by upstream and downstream treatment of the tissue, so
there is higher risk and it is hard to guarantee the quantity. COs should backup the tissue
before they send it.
a) Insufficient Tissue：Low production of RNA, could not reach library construction initial
amount may lead to library construction failure, especially plant leaves, fruit, root tuber and
rhizoma that contain high concentration of polysaccharide and polyphenol and other unknown
composition. In this case, it is more difficult to extract tissue so there should be enough
amounts.
b) Repeated Freeze-thaw Tissue：Degradation proportion of RNA is above 80% and it is impossible to extract RNA and the quantity cannot meet library construction requirement. We do not
22
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 23/34
suggest COs to send this kind of tissue. COs should make sure the tissue is not repeated freezethaw before they send, especially RNase active tissues from animal liver, spleen, kidney, heart,
fat, brain or tumor.
c) Long-term Preserved Tissue：For the tissue samples from specimens preserved for over one
year, risk of RNA extract would increase. Due to low quantity samples are not suggested to
send. These kinds of specimens include animal/plant tissue, various thallus and algae.
d) Tissues：Animal/Plant tissue, i.e. plant old root, plant fruit tissue, animal liver, adipose, brain
tissue, since they have active RNase, after tissues separate with main body, make sure to soak
them into liquid nitrogen to froze quickly and storage in refrigerator at -80 oC. Or slice them into 2-3 thick pads under liquid nitrogen and then immersed to RNAlater protect reagent. If tissue
would not be treated in 1 minute after separating, the RNase would degrade RNA in a significant speed. Accordingly it would hard to maintain the RNA quantity.
e) Blood Serums：Serum contain up to hundreds of components, i.e. Complex protein, polysaccharide, and most of them are unknown, which will increase the risk of extract. Therefore, we
recommend sending serum samples above 5 mL.
f)
Whole Blood Sample：To ensure the extraction success rate, Please COs cooperate with us to
complete the lymphocyte separation, sending samples with Trizol lysis buffer or RNAlater protection reagent. If lymphocytes separation conditions are not allowed, please collect all fresh
blood about 60 µl, putting into RNAprotect® Animal Blood Tubes（100 µl）（QIAGEN
Ltd.）. If all three methods above are hardly to do so, please COs extract by your own. If COs
insist on sending samples, COs shall take responsibility for it or take the risk of being involved in this matter.
g) Trace Tissue：Animal tissue < 200 mg, Plant tissue < 300mg, Cell numbers < 105, Serum
quantity < 5 mL, Pure blood volume < 2 mL (Birds), Pure blood volume < 3mL (other fauna).
It is mainly for the more precious and scarce samples. In consideration of samples are special
and precious, these kinds of samples are not accepting RNA extraction work, please COs extract by your own. If COs insist on sending samples, COs shall take responsibility for it or
take the risk of being involved in this matter.
h) Complex Samples：Polysaccharide polyphenol unusually high amounts of old root plants,
mature rice, highland barley, strawberry fruit, pine, algae, cotton, fungi, and component extremely complex tumor tissue. In consideration of either these kinds of samples’ extraction are
not mature or to avoid influencing the COs’ research progress by sending samples from and to,
23
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 24/34
BGI is not accepting RNA extraction work, please COs extract by your own. If COs insist on
sending samples, COs shall take responsibility for it or take the risk of being involved in
this matter.
i)
Special Samples：FFPE sample, LCM sample, urine, milk, gastric fluid, saliva, intestinal microorganisms. In consideration of much less of experience of extraction of such samples, BGI
is not accepting RNA extraction, please COs extract by your own. If COs insist on sending
samples, COs shall take responsibility for it or take the risk of being involved in this matter.
j)
Virus organization: Plague, anthrax, bird flu, foot-and-mouth disease, these highly infectious
virus need in P3 laboratory operation. The present experimental conditions are not allowed to
operate such sample. So it does not receive some kind of sample extraction and detection.
5.1.5 Requirements for COs’ Building a Library and Transferring a Sample on Their Own
5.1.5.1 Please provide analysis results measured by using one or several methods of Qubit®,
NanoDropTM, Gel Electrophoresis, Caliper LabChip GX and Agilent 2100. Agilent 2100 and Caliper LabChip GX is strongly recommended，in order to get a perfect repeatable result with the detections of BGI. Agilent DNA 1000 kit (for Agilent 2100) and HT DNA 1K LabChip (for Caliper
LabChip GX) is recommended.
5.1.5.2 Suggested Sample Concentration of Agilent 2100/Caliper LabChip GX Testing
Form 8: Requirements of HiSeq Library Samples
Library Category
Concentration(nM)
Total Quantity
Demanded(×10-3 pmol)
Transcriptome Library
≥3.5
≥82.25
Expression Library
≥1.3
≥30.55
Small RNA Library
≥1.5
≥35.25
ChIP Library
≥2.8
≥65.80
Exome Capture Library
≥4.0
≥94.00
DNA Short Fragment Library(0-499 bp)
≥4.3
≥101.05
DNA Long Fragment Library(500-800 bp)
≥4.3
≥101.05
DNA Large Fragment Library(≥800bp)
≥3.7
≥86.95
Methylation Library
≥3.4
≥79.90
24
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Page: 25/34
Version NO.:A0
Note: According to the experimental conditions, BGI would possibly dilute the original
sample before detection if the sample volume is too small (less than 15 μL). If the sample is
not preserved in the 1.5 mL EP tube, BGI would change tube firstly. The above concentration
is the minimum requirement of library construction, i.e., for only one round of sequencing. The
final result is based on our qPCR result. Refer to Illumina qPCR Quantification Protocol Guide.
a) If standard Illumina kit is used, please indicate the type and the log number of the kit. If another
kit is used, the COs should provide information on methodology, kit use and its brand, the sequences of the adaptor and PCR primers, and the expected fragment size of the libraries. If the
sample is indexed, please indicate the position and the sequence of the index. Please specify if
the library is partially constructed.
b) Library has to be purified to remove primer dimer contamination. Primers dimer would greatly
affect the quality of sequencing.
c) If the sample is a PCR product or has special sequence inserted, please indicate it in the Information Sheet, otherwise the quality of sequencing data will be greatly affected.
d) Components of the solvent must be clearly indicated.
e) The insert fragment size of the library must be less than 600 bp; otherwise the quality of
sequencing will be greatly affected.
f)
Sequencing primers provided by COs can be in powder or solution. For powder, its minimum
quantity should be > 1OD. For solution, the concentration of the solution should be at least
100μM, with the minimum volume described as follows (Form 9).
Form 9: Requirements of Sequencing Primers
Sequencing Primer
Volume
Read 1 primer
3μl/lane+6μl
Index primer
45μl/flowcell+45μl
Read 2 primer
45μl/flowcell+45μl
Form 10: Requirements of 454 GS FLX+ Library Samples
Library Type
Concentration
(108 molecule/μL)
Volume
(μL)
25
Quantity(1010
molecule)
Small fragment
Contamination
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Page: 26/34
Version NO.:A0
Rapid DNA library
≥2.0
≥50
≥1.0
Rapid cDNA library
≥2.0
≥50
≥1.0
Fragment less than
650 bp≤10%
Fragment less than
500 bp≤10%
Form 11: Requirements of 454 GS FLX+ Amplicon Library Samples
Library Type
Concentration
(ng/μL)
Volume(μL)
Quantity(ng)
Amplicon Library
≥5
≥10
≥50
Note: Libraries for 454 GS FLX sequencing should be amplified using primer set Lib-A (Forward:
CGTATCGCCTCCCTCGCGCCATCAG; Reverse: CTATGCGCCTTGCCAGCCCGCTCAG) or
Lib-L
(Forward:
CCATCTCATCCCTGCGTGTCTCCGACTCAG;
Reverse:
CCTATCCCCTGTGTGCCTTGGCAGTCTCAG), other amplicon would be recognized as DNA
sample other than library.
5.1.6 Requirements for Protein Sample
5.1.6.1 Please provide analysis results of the protein samples using one or several of the following
methods: BCA, Bradford.
5.1.6.2 In order to perform samples handling rapidly and easily, please provide buffer composition
of protein samples and their concentration, such as thiourea, SDS or strong ionic salt. Please
provide concentration of salt if the samples are peptides.
5.1.6.3 Protein samples requirements for protein, peptides, gel spots and gel bands can follow the
table of requirements of protein samples below.
5.1.6.4 BGI needs to alkylate protein samples as well as acetone precipitation and buffer alteration
in order to remove the impurities that may affect mass spectrometry. The final concentration is
based on this measurement.
Form 12: Requirements of Protein samples
Sample type
Service type
Proteome profiling
Quantitative proteomics
Protein
≥500µg,
Concentratio
n ≥1mg/ml
Peptide
The amount of
protein before
digesting is no
less than 50ug
26
Gel spot or
gel band
___
___
Remark
It is better to
remove high
abundance
proteins first
before sending
extracted
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
___
Targeted proteomics
Phosphoproteo
me profiling
No
fraction
≥4mg
Fraction
≥10mg
>30ug
Target
protein
purification>
80%
Single phosphoprotein
identification
Gel band for protein
identification
Page: 27/34
Version NO.:A0
≥30µg,
Concentratio
n ≥1 µg / µl
___
___
proteins of
blood samples
___
More than 5
gel bands
≥50fmol/μl,
volume≥10μl;
sale content:
volatile inorganic
salt <20mM,
stable inorganic
salt <5mM;
Protein band
stained with
coomassie
blue or silver
could be seen
with eye
Gel spot for protein
identification
≥50pmol;
Salt content:
volatile
inorganic
salt<20mM,
stable
inorganic salt
<5mM;
≥50fmol/μl,
volume≥10μl;
Salt content:
volatile inorganic
salt <20mM,
stable inorganic
salt <5mM;
≥1.5mm3;
Spot
stained with
coomassie
blue or silver
could be seen
with eye
Protein molecular weight
detection
Purified
protein
solution or
powder, the
purity of the
sample under
test > 90%
___
___
If silver
staining
method is used,
please be sure
not to fix the
gel with
glutaraldehyde
5.1.7 Requirements for Protein Tissue Sample and Blood Sample Transporting
Declaration: For any pathogenicity or infectious sample (tissue, blood, bacterium etc), clear
risk sign must be attached on the sample tubes or bags.
5.1.7.1 Total quantity demanded
Form 13: Requirements of Total Amount of Tissue samples
Sample type
Amount of sample
27
Remark
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Fresh animal tissue (wet
weight)
Fresh plant tissue (wet
weight)
Microorganism
Cell
Blood
Body fluid (saliva,
cerebrospinal fluid etc.)
Urine
Version NO.:A0
needed
≥100mg
Page: 28/34
For tissue with high impurity or low protein
such as root of plant, phloem, the amount of
sample required is 5g
≥2g
≥2g
≥5×106 cells
Serum,
plasma≥500µl；
Blood ≥5ml
It is not recommend sending whole blood in
that the cell in blood will broke during thawing
process and protein in cell will interfere with
the final result
≥5ml
≥50ml
Centrifuge at 1000g, 5min before sending your
sample to BGI, discard the precipitant
Note: If the samples are applied for phosphoproteomic profiling, clients should increase the
amount of sample. If the sample has special characteristics, such as easily oxidized, thick
capsule and so on, please inform us!
5.1.7.2 Requirements for Tissue Sampling
1) Plant Tissue
Please use 70% alcohol to rinse out dust and mud on the surface of materials obtained in the field or
countryside, then blot up the water, quickly freeze them in liquid nitrogen, and put them into
precooled 50 mL centrifuge tubes or seal bags. Then transport them with a large volume of dry ice
and to ensure that there is still sufficient dry ice when we get the samples.
2) Animal Tissue
Tissues drawn from living bodies should be rinsed with 0.9％ normal saline to remove blood dirt
and contaminants, then eliminate connective tissue and adipose tissue as well as other tissues that
are not needed for research. Then the tissues are divided into small pieces of about 50 mg, and put
into 1.5 mL or 2.0 mL EP tubes, quickly frozen in liquid nitrogen. Then put EP tubes into precooked
50 mL centrifuge tubes or seal bags. Transport it with a large volume of dry ice and to ensure that
there is still sufficient dry ice when we get the samples.
3) Blood
It is NOT recommended to send whole blood samples, it is suggested to separate the plasma or
serum according to the research. The sample needs to be transported with a large volume of dry ice
after having been frozen and to ensure that there is still sufficient dry ice when we get the samples.
4) Culture cells
28
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 29/34
a) Remove cell culture medium after culturing or disposal of adherent cells or suspension cells;
b) Wash the cells 3～5 times with PBS buffer, to remove the PBS buffer. Adherent cells can be
removed with a cell scraper.
c) Transfer collected cells to a 1.5 mL EP tube, quickly freeze them with liquid nitrogen, and then
transport them with the dry ice.
.5.2 Requirements for Sample Shipment:
5.2.1 Sample Packing
5.2.1.1 For DNA /RNA/Protein samples, 1.5 mL Eppendorf tube is recommended (0.2 mL thin wall
PCR tube / 8-strip tube is easy to break). To protect the tube from being crushed by the squeezing
during sample shipment, which may result in sample damage, the Eppendorf tube is preferably
placed in a 50 mL centrifuge tube or other strutting. Clean wipe or absorbent paper can be used for
fixation. (Please do not add any liquid nitrogen or other hazardous materials into the 50 mL
tube and other props)
（Figure 1: Put Some Cotton in the 50 mL Tube or Use Capsule to Fix the Tube）
5.2.1.2 For tissue samples, 1.5 mL Eppendorf tube or 2 mL screw cap tube is recommended.
5.2.1.3 Please use parafilm membrane to seal the tube in transfer. Samples are not recommended to
be dissolved in organic solvents like absolute ethanol or isopropanol because it may lead to leakage
or even cross contamination. If it is necessary to transfer samples dissolved in organic solvents,
please seal the nozzle of tube with at least 5 circles with parafilm membrane and screw cap tube is
recommended.
29
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 30/34
（Figure 2: Seal the Tubes with Sealing Membrane）
5.2.1.4 For blood samples, it can be transferred with a 5 to 10 mL anticoagulative tube. Please fix
the anticoagulative tube in foam and space out each other to avoid collision. The plastic
anticoagulative tube is suggested to using.
5.2.1.5 In the case of samples in large amount (more than 15 samples), please adopt a frozen storage
box to protect the sample from damage.
5.2.2 Sample Identification
5.2.2.1 Do not mark a name and other information directly on the tube wall or lid with an oil pen. It
is better to write the information on a label with an oil pen and stick the label to the tube wall with
scotch tape wrapping the tube for one circle (by preventing the sample name from being dissolved
by organic solvents and preventing the label from falling off, to avoid a failure of sample
application) .
（Figure 3: Write a Label and Wrap it to the Tube Wall with Film）
5.2.2.2 Please attach a standard sample information sheet (both electronic and text versions)
30
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 31/34
provided by our institute when mailing samples. Please make sure that the sample name and the
quantity demanded in the sample information sheet are the same with that accompanied with the
mailing samples.
5.2.3 Sample Transportation Requirements
5.2.3.1 DNA sample that is precipitated by ethanol can be transferred in normal temperature.
Otherwise, transfer it in dry ice within 72 hours or ice bags within 24 hours.
5.2.3.2 RNA /Protein/ tissue samples should be transferred in dry ice within 72 hours no matter
what kind of solvent they are dissolved in.
5.2.3.3 Blood plasma should be preserved in dry ice and to ensure that there is sufficient dry ice left
when the sample arrives at the destination, and it should be stored in a refrigerator at -80 oC in time.
The sample must not be placed at room temperature. If Whole blood transferred in biological ice
bags, should be within 12 hours.
5.2.3.4 The quantity of dry ice and ice bags varies with season, length of travel time and thickness
of foam box. (Try to use massive dry ice for it is slow to volatile and better for keeping temperature.
If possible, leave some cotton in the foam box above and underside to seclude heat during mailing. )
5kg/day of dry ice is enough.
5.2.3.5 After BGI receiving samples, DNA or Library stored at -20 oC refrigerator, RNA /Protein
tissue stored at -80 oC refrigerator. The special conditions for sample storage, COs please describe
the correct storage temperature in the information sheet. Antibodies, Primers, and Probes sent along
with the samples also need to specify the corresponding information of stored temperature.
5.2.4 Sample Transport and Receiving
a) If the samples are sent directly by COs, Project Coordinator shall be responsible for contacting
COs about receiving matters, instructing COs to fill in sample information sheet correctly and
at the same time sending email to the person in charge of receiving the sample.
Notes: For contact details, see at the appendix.
b) Please be reminded that all samples have to send to the following address: 2/F, 16th Dai Fu
Street, Tai Po Industrial Estate, Tai Po, Hong Kong. Please do not send the shipments to other
address (such as airport), which may cause loss of shipment/ delayed delivery.
After the samples have been picked up, please send the name of courier, tracking no. and
sample information sheet to our HK colleague April Wong ([email protected])
31
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 32/34
immediately. With the information, BGI will help to track for the shipping status
and facilitate the importation progress.
c) To send the DNA samples to Hong Kong, an official and signed declaration letter will be
needed for Hong Kong Custom. In the letter, please give a general description of samples (e.g.
source/ usage/ quantity) and clarify the samples are neither hazardous, infectious, HIV positive,
dangerous, toxic nor radioactive. Appendix will be a sample letter for your reference. Please
attach the declaration letter onto the shipment when sending out, and the samples should have
no problems with Custom clearance.
Form 14: Declaration Letter
Declaration Letter Sample
(Letterhead of the company)
(Date)
To whom it may concern,
This is to certify that the shipment contains (Quantity and type of sample. e.g. 10 DNA samples) that
is for Research Purpose Only. The samples are derived from (source of sample e.g. human). They are
(prepared in laboratory/ purchased from commercial company). All the materials are not hazardous,
not infectious, not HIV positive, not dangerous not toxic and not radioactive. The materials will be
destroyed by autoclave after experiments. No import license is required for this shipment.
I hereby agree to send the about materials to BGI Tech Solutions (HongKong)Co., Ltd for research
purpose. Thank you for your attention.
Yours faithfully,
(Signature)
(Name)
(Title)
d) To send the Tissue/ Blood samples to Hong Kong (the samples must be non-infectious), an
import license will be required. Please help to prepare the following information and send
to: [email protected] for application:
i. Name of Samples
ii. Quantity of Samples (e.g. 5 μg each, 5 samples in total)
32
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 33/34
iii. Courier going to use
iv. Expected Importation Date
v. Declaration Letter (sample letter attached: Declaration letter tissue sample)
vi. Method of packaging
And also send the Tissue/ Blood samples to Hong Kong, an official and signed declaration
letter will be needed for Hong Kong Custom too.
6. Relevant Documents
None
7. Relevant Records
None
8. Reference
None
9. The Sample Information Sheet (Template)
Click here：http://www.bgisample.com/
10. Appendix
Appendix A Revision Record
33
Suggestions for Sample Delivery(NGS)
File NO.: BGI-TS-03-12-01-001
Version NO.:A0
Page: 34/34
Appendix A Revision Record
No
Date
Revision Contents
34
Revised
People
Accreditation
People