1. No category

From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
1996 87: 2962-2967
Characterization of the gene encoding the human LW blood group
protein in LW+ and LW- phenotypes
P Hermand, PY Le Pennec, P Rouger, JP Cartron and P Bailly
Updated information and services can be found at:
http://www.bloodjournal.org/content/87/7/2962.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
Characterization of the Gene Encoding the Human LW Blood Group Protein
in LW+ and LW- Phenotypes
ByP. Herrnand, P.Y.Le Pennec, P. Rouger, J.-P. Cartron, and P. Bailly
The LW blood group is carried by a 42-kD glycoprotein that
belongs to the family of intercellular adhesion molecules.
The L Wgene is organized into threeexons spanning an Hindlll fragment of approximately 2.65 kb. The exonlintron architecture correlates to thestructural domains of the protein
and resembles that of other lg superfamily members except
that the signal peptide and the first Ig-like domain are encoded by thefirst exon. The 5'UT region (nucleotides -289
to +S) includes potential binding sites for various transcription factors (Ets, CACC, SP1, GATA-1, AP2) and exhibited a
significant transcriptional activity after transfection in the
erythroleukemic K562 cells. No obvious abnormality of the
LW gene, including the5'UT region, has been detected
by sequencing polymerase chain reaction-amplified genomic DNA fromRhD+ or RhD- donors and from an Rh..,, variant that lacks the Rh and LW proteins on red blood cells.
However, a deletion of 10 bp in exon 1 of the LW gene was
identified in the genome of an LW (a- b-) individual (Big)
deficient for LW antigens but carrying a normal Rh phenotype. The IO-bp deletion generates a premature stop codon
and encodes a truncated protein without transmembrane
and cytoplasmic domain. No detectable abnormality of the
LW gene or transcript could be detected in another LW(ab-) individual (Nic), suggesting the heterogeneity of these
phenotypes.
0 1996 by The American Society of Hematology.
T
phenotype and why Rh,,,,cells also lack LW antigens. As
a preliminary step toward understanding theroleandthe
expression mechanism of LW antigens, we have isolated and
characterized the LW gene from individuals with different
LW and Rh phenotypes.
HE BLOOD GROUP LW (Lansteiner-Wiener) is phenotypically related to the RH system."3There are more
LW antigens on RhD+ than on RhD- erythrocytes, but these
antigens are strongly expressed on cord redblood cells
(RBCs) regardless of their RhD phenotypes. In addition, Rhdeficient REKs (Rhnul,)also lack LW antigens. However,
rare individuals lacking LW antigens have been found
among RhD+ individuals. On the basis of these relationships,
it has been speculated that Rh might be the precursor of LW,4
but comparative analysis by two-dimensional iodopeptide
mapping5 showed that Rh and LW are not related and that
there isno precursor relationship between these antigens.
Recently, molecular cloning6 indicated that the LW cDNA
encoded a mature membrane protein of 241 amino acids
(calculated molecular mass 26.5 kD) with a single transmembrane domain whose sequence and structure are similar to
the intercellular adhesion molecules (ICAMs), which are the
counter-receptors for the lymphocyte function-related antigen LFA-1. This was further demonstrated by showing that
the LW antigen binds to CDlUCD18 leukocyte integrin~.~
These findings provided the definitive proof that Rh and
LW are unrelated because there was no sequence homology
between these two proteins and, in addition, both structural
genes are located on different chromosomes (19pl3 and
lp36, respectively).""
Sequence analysis of the LW protein predicted the presence of four N-glycans and it is detected on Western blot as
a 42-kD component.'"" It is known also that the LWa/LWb
polymorphism is carried by a single base-pair exchange that
resulted in a Gln70Arg sub~titution.'~
Despite these findings,
it is still unclear how LW expression is affected by the Rh
From INSERM U76, Institut National de la Transfusion Sanguine,
Paris, France.
Submitted August 15, 1995; accepted November 7, 1995.
Address reprint requests to J.-P.Cartron,PhD, INSERM U76,
Institut National de la Transfusion Sanguine, 6, rue Alexandre Cabanel, 75015 Paris, France.
The publication costsof this article were defrayedin part by page
chargepayment. This article must therefore be hereby marked
"advertisement" in accordance with I8 U.S.C. section 1734 solely to
indicate this fact.
0 1996 by The American Society of Hematology.
0006-4971/96/8707-06$3.00/0
2962
MATERIALS ANDMETHODS
Reagents and bloodsamples. Restriction endonucleases, modifying enzymes, and pUC vectors came from New England Biolabs
(Hitchin, Hertfordshire, UK). The Thermus aquaticus polymerase
(Taq polymerase) was from Perkin Elmer Cetus (Norwalk, CT), the
Sequenase kit was from the US Biochemical Corp (Cleveland, OH)
and radiolabeled nucleotides were purchased from Amersham
(Bucks, UK). Blood samples from common LW and Rh phenotypes
came from the Institut National de la Transfusion Sanguine (Paris,
of the amorph type (D.A.A.) was from
France). Samples of
Dr C. Perez-Perez (Linares, Spain) and the LW(a- h-) blood sample
(Big) was kindly provided by Kathy Burnie (Hematology University
Hospital, Ontario, Canada). The second LW(a- b-) sample (Nic)
was discovered recently in a 92-year-old male patient who developed
a potent anti-LWAhantibody.
Isolation of h u m n LW gene. Approximately 2.5 X IOh phages
from a human genomic library (Clontech Laboratories, Inc, Pal0
Alto, CA) were plated and hybridized under standard procedures
with a "P-labeled full-length LW cDNA probe using a random
primed DNA labeling Kit (Boehringer-Mannheim, Mannheim. Germany). One positive clone was isolated and analyzed.
LW promoter-chloramphenicolaceiyltrunsferasr (CAT) assavs.
The SP-A primer (nucleotides [nt] -289 to -268) and AS-A primer
(nt 12 to +9) (see Fig 2) were used to polymerase chain reaction
(PCR)-amplify the 5' flanking region of the LW gene from a LW(a+
b-) sample. The PCR product was controlled by sequencing and
inserted into the promoterless plasmid pBLCAT3'' to generate the
LW(-289, +9)-CAT construct. The pBLCAT2 plasmid, containing
the ubiquitous promoter of the Herpes simplex thymidine kinase
gene" and the promoterless plasmid pBLCAT3 were used as positive
and negative controls, respectively. In each experiment 10 pg of
recombinant CAT construct was cotransfected with 2 pg of the RSVLuc plasmid, carrying the firefly luciferase gene in front of the RSV
promoter, into K562 and HeLa cells using electroporation (BioRad Gene Pulser, Hercules, CA) and cationic liposomes ( 1 mg/
mL) according to the guidelines of the manufacturer (GIBCO-BRL,
Gaithersburg, MD), respectively. For CAT assays, protein amounts
in individual extracts 48 hours after transfection were normalized to
luciferase activity and used as described by Gorman et al." Experiments were performed twice with two independent plasmid prepara-
Rh..,
~
Blood, Vol 87, No 7 (April l ) , 1996: pp 2962-2967
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
HUMAN LW BLOOD GROUP PROTEIN
c
(
2963
0.5 Kb
18 Kb hLW
Fig 1. Restriction map and organization of the human LW gene.
The organization of the LW gene was determined by analyzing the
phage genomic clone shown at the bottom of the diagram (18-kb,
XLW). The position of the exons El, E2, E3 is indicated by the filled
boxes relative to the restriction sites Sal I (SIand Hindlll (H).
lions. After thin-layersilica gel chromatography and autoradiography
the spots were excised and counted.
PCR crnlplificcrtion of pwomic sequences c111el LW rmnscripts.
The LW genewasPCR-amplified from genomicDNAs (200 ng)
prepared from LW' (RhD' or RhD-) andLW- (RhD' or Rh,,,,,,)
donors, using primers SP-B (S'-CCGGCCCTGGCTCTCTGGCGC3'. nt -39 to -19) and AS-B(S'-GCGTCAGCCACCATGTATGGCC-3'. nt + I I84 to + 1 163). Each cycle consisted of I minute
of denaturation at 94°C. I minute annealing at 60°C. and 2.5 minutes
extension at 72°C. After 30 cycles, the 1.2-kb amplified product was
ligated in pUC vector and sequenced. For reverse transcriptase(RT)PCR analysis of the LW transcripts. total RNAs from whole-blood
samples were extracted by the acid-phenol-guanidiummethod" and
werereversetranscribedusing the first-strand cDNA synthesis kit
(Pharmacia. Uppsala. Sweden). TheLW fragment (0.8 kb) amplified
hetween primers SP-D (S'-ATGGGGTCTCTGTTCCCTCTGTCG3'. nt + l 0 to +33) andAS-D(5'-TTACGCCTGGGACTTCATAGCTAG-3'. nt + I IO2 to 1079)was detected on Southern blot with
the LW cDNA probe.
Wc,.slc,nl hlot ut~crI~.si.s.RBCmemhraneproteinsfrom
donors
of known phenotypes were prepared. separated by sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and analyzedbyimmunoblotting
with rabbit polyclonalantibodiesraised
against synthetic peptides of the NHz-terminal regions of the LW"
and Rh proteins (MPC-X). as previously described.lx
RESULTS
Cl~armteri~atiorl
ofthehwncrrt LW gene. Southern blot
analysis of human genomic DNAs digested
withdifferent
restriction endonucleasesand probed with the LW-cDNA
showed a single-band pattern." suggesting that the LW gene
was present a s a simple copy in the human genome. The
LWgene wasfinally isolated from a EMBL3 genomic library
and was fully characterized by restriction mapping (Fig 1)
and sequence analysis (Fig 2). The coding sequences of the
LW gene reside in the 2.65-kb Hindlll fragment and consisted of three exons separatedby two short stretches of I29
and 147 bp of interveningsequences.Exon 1 encodesthe
S' untranslated sequence (9 bp), the signal peptide and the
first Ig-like domain. Exon 2 encodes the second [g-like domain and the exon 3 encodes the transmembrane domain,
the cytoplasmic tail and the 3' untranslated region. All splice
junctions occur after the first nucleotide of an amino acid
codon (type 1 ) and were found to contain the S' donor 'gt'
and 3' acceptor k g ' consensus sequences. The transcription
initiationsite. determined by S'-Amplifinder RACE-PCR
(Clontech, Palo Alto. CA) (not shown) usinghuman erythroblasts poly(A)' RNAs was found
located 9 nt upstream of
the ATG initiating codon (Fig 2).
Iderltification of cotz.setl.sus rnotifs,fi)rpotenticrl lhding of
tmnscription,fnct[)r.s. Four hundred four nt upstream of the
transcriptioninitiation sitehave been sequenced and analyzed to identify putative cis-acting regulatory sequence (Fig
2). There was no typical TATA box in this region, but an
inverted CAAT box (ATTG) waspresent at nt -292. Several
potential binding sites for transcription factors were identified in the reverse orientation such as an AP-2 motif (G/CG/
CG/CNT/GGGG),'" a GATA-I motif (CiTTATC T/A)."'
and the Etsmotif (A/GC T/ATCCT/GC/G)" at nt -22, -S I ,
and -97, respectively. A reverse CACC motif" that could
bind a CACC or an SP-I factor was located at nt -86. In
addition, a SP-Ibindingsite(G/TG/AGGCGITG/AG/AG/
T)" was also identified at nt -72. All these motifs are consensus except the Ets element, which differs by the S' first
nucleotide.
CAT activit? of the 5' flanking seqltence o f the LW gene.
The ability of the LW gene region upstream of the first exon
to support transcription was tested with the bacterial CAT
gene in transient expressionassays. Accordingly. a PCR
fragment (nt -289 to +9) amplified between SP-A and ASA primers (see Fig 2) was cloned at the S' side of the CAT
gene in the plasmid pBLCAT3.As negative and positive
controls,
the
promoterless
pBLCAT3
plasmid and
the
of
pBLCAT2 plasmid containing the ubiquitous promoter
the Herpes simplex thymidine kinase gene were
used. respectively. After 48 hours, the LW (-289, +9)-CAT construct
showed 225% of CAT activity in erythroleukemic cell line
K562compared withthepositive
control(Fig 3). In the
nonhematopoietic cell line Hela, the same construct showed
results indicated
only S6% of activity (data no shown). These
that the -289 LW gene region, upstream of the first exon,
is self-sufficient for transcription in erythroid cells.
Analysis o f the LW gene ,from indivic1ucd.s with diferent
LW and Rh .status. The S' flanking region and the LW gene
were PCR-amplified between two sets of primer (SP-A. ASA and SP-B, AS-B, respectively) from donors with the LW'
andLW-phenotypesandsequenced.
All LW' genomes
from RhD'and RhD-donorsexhibitedthesameLW
sequence, including in the S' UT region. The Rh,,,,,,individual
(DAA) who lacks LW and Rh antigens also carried an LW
gene with a nucleotide sequence identical to that of LW'
individuals. Differences
were
observed
when
the
two
LW(a- b-) individuals (Big and Nic),typed as RhD', were
examined.Samplefrom
Big exhibited a IO-bp deletion
(ACCTGCGCAG) in the first exon of the LW' allele (see
Fig 1 ). which could be easily detected by PCR amplification
between SP-C and AS-C primers (Fig 4A). Because only a
140-bp amplified fragment was amplified from Big instead
of the IS0-bp fragment seen with the LW' and Rh.,,,, (DAA)
donors, it is obvious that the two LW' allelesof Big are
affected by the deletion. The IO-bp deletion generated a
premature stop codon at the begining of the exon 2 (see Fig
2) and theresulting mRNA is translated into a truncated
proteinwithout
transmembraneandcytoplasmic
domain.
However, in the second LW(a- b-) sample (Nic). therewas
no deletion and no other abnormality of the two LW' alleles
could be found. In all cases examined (LW', LW-, Rh,,,,,),
normal LW mRNA was detected following RT-PCR ampli-
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
2964
HERMAND ET AL
-
-404
SP-A
I
-317 CtCCCaCttCCtCccccaagaaaacattgtgggttgatggccataccctgaggttctggtccaaatcggactttctatgaccttctg
-
-230 ggtctctagtgaaaactaaagactcctctccagaaaaaaacatttggtttctaatgaggcctggaatcttattcttgacctggggag
CACC
SP 1
Lta
-143 Cggaatccctttttgcagtactcccgggccctctgttggggcctccccttcctctccagggtggagtcgagffagffcggggctgcggg
GATA
-1
AS-A
AP 2
-56
CTTTTTGCC'ATG GGG TCT CTG
CCtCCtfatCtCtagagCCggCCCtggCtCtCtg~CPCpO~~CC~ttagtCCggg
+l
met gly mer leu phe
25
CCTCTG
pro leu
RRR RRt
......
......
382
R
AAA ACACGCTGGGCC
gly lys thr arg trp ala
gtgagggacaggggctcggtcccggctggggtgaggggagggggctggaagaggtgg
c
thr aer arg ile thr ala tyr 1
461
**R
...... TGCCTCGTGACCTGCGCAGGA
...... cya leu Val thr cy8 ala
gggaagggtagtttgacagtcgctctatagggagcgcccgcggacctcactcagaggctcccccttgcctta
CCGCCCCAC
B pro pro his
W4
545 AGCGTGATT
aer Val Ile
872
959
1494
...
...
...... CTGATGCTCG
m
TTC
...... leu met
gtgaggcacccctgtaaccctggggactaggagga
leu a
agggggcagagagagttatgaccccgagagggcgcacagaccaagcgtgagctccacgcgggtcgacagacctccctgtgttccgtt
......
...... CAG TAA...........
GCG
......
...... gln ala atop
I
GAATCAATAAAGGCTTCCTTAACCAGC ctctgtcctgtgacctaagggt.....
CT
AGC
cctaattctcgccttctgctcccag TGG
la trp aer
l
Fig 2. Nucleotide sequence of the LW gene. Nucleotide sequence of individual exons are shown in uppercase letters and flanking intron
sequences in lowercase letters. Exon sequences areboxed and protein translation under each codonis given. Full exon sequences are given
in ref 6. Nucleotide positions (left side) arerelative to the transcription initiation and not to the translation initiation site as in ref 6. In the 5'flanking region, potential binding sites for Ets, CACC, SP-1, GATA-l, and AP-2 factors are shown in boldface characters. The 10-bpdeletion
(nt 355 to 364)in exon 1 of the LW(a- b-) sample Big is indicated by asterisks (*l and the premature stop codon generated is shown at the
by double horizontal lines.
beginning of exon 2. The inverted CAAT box andthe polyadenylationconsensus sequence AATAAA are underlined
TheSP-A and AS-A primers used for PCR amplification of the promoter region (see Materials and Methods) are indicated, The genomic
sequence has beensubmitted to the EMBL under the accession number X93093.
fication and Southern blot analysis (Fig 4B). However, Westem blot analysis (Fig 4C) confirmed that the LW protein
was present only in the LW(a+ b-) sample with a common
Rh phenotype, but was absent from the LW- donors (Big,
Nic, and R h , , I I DAA). As expected, the Rh protein was undetectable only in the I U I n u I I variant (Fig 4C).
DISCUSSION
The LW gene is a small gene organized into three exons
that spans approximately 2.65 kb of DNA. There is a good
correlation between the exodintron organization of the LW
gene and the LW protein structure; the first exon encodes
for the signal peptide and the first Ig-like domain which are
normally encoded by separate exons in the Ig superfamily;
exon 2 encodes the second Ig-like domain and exon 3 the
transmembrane and cytoplasmic domains. All exons are separated by type 1 intron, like the members of the Ig superfamand this may be important for gene duplication within
the gene family; for instance, LW, ICAM-I, and ICAM-3
genes that colocalized on chromosome 19p1314~25~26
may have
evolved from a common ancestral gene. Interestingly, the
present findings indicate that the 147-nt insertion found in
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
PROTEINHUMAN LW BLOOD GROUP
2965
in close proximity of the GATA-I motif in the LW gene, as
found in regulatory regions of erythroid and megakaryocytic
However, although the LW gene is expressed in
erythroid tissues, there is presently no indication for megakaryocytic expression.
Sequence comparison of the LW gene from RhD'and
RhD- individuals showed no difference in the region examined (nt -289 to + I , 184), offering no explanation for the
higher level of LW expression in D' than D- phenotypes.''
Further studies should clarify if transcription/translation efficiency or mRNA stability are important factors, although
another explanation might be that the RhD polypeptides facilitate LW transport to the cell surface, like glycophorin A
K562
A
1
I
Exon 1
*.*******.l
SP-c
-
403
l
AS-C
+ 0.8 kb
Q'
5
225
LW
+
+ 42 kDa
Rh
+
4 30 kDa
100
CAT activity (VO)
Fig 3. Transient expression of the CAT gene directed by constructs containing the 5' flanking region of the LW gene. K562 and
Hela cells were transfectedwith the
recombinant Dlasmids LW(-289.
+SICAT. PBLCAT~andwiththepromoterlessplasmidPBLCAT~
as
Fig 4. Genomic
amplification, RT-PCR tranxripts, and protein
negative controls. CAT assays were performed 48 hours later, and
analysis of LW+ and LW- donors. (A) PCR detection of the 10-bp
the products were
separated by thin-layer chromatography and autodeletion in the genomicDNA from theLWla- b-) donor Big. Primers
radiographed overnight. The CAT activity is given
as a percentage of
SP-C (5'-CTCCGCACCCCGCTGCGGC&AGGC-3', nt +250 t o +273) and
the pBLCAT2-transfected cells.
AS-C (5'-GGCGGTGAlTCCGGAGGTGGCCCAGCG-3', nt +399 t o
+373) were used in 50-pL reaction mixtures containing 200 ng of
leukocyte DNA (denaturation 1 minute at 94°C. annealing 40 seconds
at 60"C, and extension 30 seconds at 72°C). After 30 cycles, the PCR
the LW cDNA clone IV previously identified6 resulted from
products were resolved on 12% polyacrylamide gel and visualized
the unsplicing of intron 2.
under UV light after staining with ethidium bromide. A 140-bp inExamination of the sequence immediately upstream of the
stead of a 150-bp expected fragment was amplified from Big. (B)
transcription initiation site showed an inverted CAAT box
Autoradiogram of the Southernanalysis of cDNA reverse-transcribed
at position -292 (normally expected at position -70 to -80)
from LW RNAs by RT-PCR and detected with the LW cDNA probe.
(C) lmmunostaining of RBC membrane LW and Rh proteins using
but failed to reveal a TATA box. Instead, an inverted consenrabbit antibodies directed
against the Rh protein (MPC8,1:4.0001 and
sus sequence for the binding of the GATA-l transcription
the N terminus of the LW protein ~1:1,0001. Bound antibodies were
factor was identified close to the transcription start site at
detected by an alkaline phosphatase-conjugated substrate kit
position -51, as described in several erythroid genes2' In
(BioRad). Arrows on the right side indicate the size of Rh and LW
addition, binding sites for SP-I, CACC, and Ets are present
proteins.
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
2966
HERMAND ETAL
or glycophorin B enhance the cell-surface expression of the
anion transporter band 330or theRh-associated glycoprotein
Rt150,~’respectively.
The LW gene status wasnext examined in rareindividuals
of the LW(a- b-) phenotype that lack LW antigens and LW
protein expression on RBCs. Some of these donors express
normal Rh antigens but others also lack Rh and Rh-associated antigens and proteins and belong to the group of Rh,,,,
individuals.” First, we found that our Rh,,,, donor (DAA)
of the amorphic type had no detectable LW gene sequence
abnormality (no deletion, mutation, or splice sitealteration).
In addition, the LW transcript was indistinguishable from
that of LW+ controls. Together with previous RH gene studies,33 these findings support the view that LW and Rh proteins, as well as other Rh-associated membraneproteins,
form a noncovalent complex in the cell membrane that is
not transported efficiently to the cell surface when Rh proteins are lacking.” At which level and how this complex
assembles in the cell ispresently unknown. Next, we examined two unrelated LW(a- b-) individuals
(Big and Nic)
that had a normal phenotypic expression of Rh antigens, as
seen by LW and Rh typing and Western blot analysis (Fig
4). In addition, these cells exhibited anormal phenotypic
expression of the Rh50 glycoprotein and CD47 (our unpublishedresults,January
1995), which are majormembrane
proteins present in the Rh membrane complex.” We found
Big to be homozygous fora 10-bp deleted LW‘ allele encoding a truncatedproteinwithout
transmembraneandcytoplasmic domains. Most likely, this truncated protein is either
secreted or rapidly degraded, thus explaining the absenceof
the LW protein in the RBC membrane (Fig 4). In contrast.
there was no detectable alteration in the LW gene and its
transcript from the second LW(a- b-) sample (Nic). Because no family study of this patient was available, it cannot
be formerly excluded that the loss of LW antigens and antiLW productionistransient,
as alreadydescribedin
some
cases of pregnancies or immunologic disorders.’ However,
this is unlikely because Nic suffers no such syndrome and
was hospitalized for the removal of a hernia. Therefore, the
reason for the absence of LW protein in this patient remains
obscure and suggests that the LW(a- b-) condition is heterogeneous.
In summary, we have clarified the LW gene structure in
individuals that exhibit the LW+ and LW- phenotypes, but
major questions concerning the modulation of LW expression and the biosynthesis of the Rh membrane complex”
remain unresolved. In addition, future studies should better
delineate whether thestructural similarity of LW with intercellular adhesion molecules play any significantbiologic
role.
ACKNOWLEDGMENT
WethankKathy Bumie (Hematology University Hospital, Ontario, Canada) for the gift of the LW(a- b-) blood sample (Big)
and Dr C. Perez (Linares, Spain) for the Rh.,,, blood sample (DAA).
We thank also Martine Huet and Nicole Lucien (Institut National
de la Transfusion Sanguine, Paris, France) for technical assistance.
REFERENCES
1. Race RR, Sanger R: Blood Groups in Man (ed 6). London,
UK, Blackwell, 1975, p 228
2. Giles CM: The LW blood group: A review. Immunol Commun
9:225. 1980
3. Storry JR: The LW blood group system. Immunohematology
837, 1992
4. Race RR: Modem concepts of the blood group systems. Ann
NY AcadSci 127:884, 1965
5 . Bloy C, Hermand P, Chtrif-Zahar B, Sonneborn HH, Cartron
JP: Comparative analysis by two-dimensional iodopeptide mapping
of the RhD protein and LW glycoprotein. Blood 75:2245, 1990
6. Bailly P, Hermand P, Callebaut I, Sonneborn HH, Khamlichi
S, Mornon JP, Cartron JP: TheLWblood
group glycoprotein is
homologous to intercellular adhesion molecules. Proc Natl Acad Sci
USA 91:5306, 1994
7. Bailly P, Tontti E, Hermand P, Cartron JP, Gahmberg C: The
red cell LW bloodgroup protein is an intercellular adhesion molecule
(ICAM-4) whichbindsto CDlUCD18 leukocyte intergins. Eur J
Immunol 25:3316, 1995
8. Sistonen P: Linkage of the LW blood group locus withthe
complement C3 and Lutheran blood group loci. Ann Hum Genet
48:239, 1984
9. Marsh WL, Chaganti RSK, Gardner FG,Mayer K, Nowell
PC, German J: Mapping human chromosomes: Evidence supporting
assignment of Rhesus to the short arm of chromosome n” I . Science
184:966, 1974
IO. Chkrif-Zahar B, Mattei MC, Le Van Kim C, Bailly P, Cartron
JP, Colin Y: Localization of the human Rh blood group gene structure to chromosome lp34.3-lp36.1 region by i n siru hybridization.
Hum Genet 86:398, 1991
1 I . Moore S: Identificationof red cell membrane components associJP, Rouger
ated with Rhesusblood group antigen expression, in Cartron
P, Salmon C (eds): Red Cell Membrane Glycoconjugates and Related
Genetic Markers. Paris, France, Librairie Arnette, 1983, p 97
12. Mallinson G, Martin PG. Anstee D, Tanner MJA, Merry AH,
Tills D, Sonneborn HH: Identification andpartial characterization
of the human erythrocyte membrane component(s) that express the
antigens of the LW blood group system. Biochem J 234:649, 1986
13. Bloy C, Blanchard D, Hermand P, Kordowicz M, Sonneborn
HH, Cartron JP: Properties of the blood group LW glycoprotein and
preliminary comparison with Rh proteins. Mol Immunol26:1013,
1989
14. Hermand P, Gane P, Mattei MG, Sistonen P, Cartron JP.
Bailly P: Molecular basis and expression of the LW”/LWhblood
group polymorphism. Blood 86: 1590. 1995
15. Luckow B, Gunther S: CAT constructions with multiple
unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res 15:5490, 1987
16. Gorman CM, Moffat LF, Howard BH: Recombinant genomes
which express chloramphenicol acetyltransferase in mammalian
cells. Mol Cell Biol 2:1044, 1982
17. Lozano EM, Grau 0, Romanowski V: Isolation of RNA from
whole blood for reliable use in RT-PCR amplification. Trends Genet
9:296, 1993
18. Hermand P, Mouro I, Huet M, Bloy C, Suyama K, Goldstein
J. Cartron JP, Bailly P: Immunochemical characterization ofRh
proteins with antibodies raised against synthetic peptides. Blood
82:668, 1993
19. Faisst S, Meyer S: Compilation of vertebrate encoded transcription factors. Nucleic Acids Res 20:3, 1992
20. Evans T, Reitman M, Felsenfeld G: An erythrocyte-specific
DNA-binding factor recognizes a regulatory sequence common to
all chicken globin genes. Proc Natl Acad Sci USA 85:5976, 1988
21. Wasylyk B, Wasylyk C, Flores P, Begue A, LePrince D,
Stehelin D: The c-ets proto-oncogenes encode transcription factors
that co-operate with c-Fos and c-Jun for transcriptional activation.
Nature 346:191, 1990
From www.bloodjournal.org by guest on October 15, 2014. For personal use only.
HUMAN LW BLOOD GROUPPROTEIN
22. Xiao JH, Davidson I, Macchi M, Rosales R, Vigneron M,
Staub A, Chambon P: I n vitro binding of several cell-specific and
ubiquitous nuclear proteins to the GT-1 motif of the SV40 enhancer.
Genes Dev 1:794, 1987
23. Kadonaga JT, Jones KA, Tjian R: Promoter-specific activation of RNA polymerase I1 transcription by SP1. Trends Biochem
Sci 11:20, 1986
24. William A F : The immunoglobulin superfamily takes shape.
Nature 308:12, 1984
25. Ropers HH, Pericak-Vance MA: Report of the committee on
the genetic constitution of chromosome 19. Cytogenet Cell Genet
58:751, 1991
26. Bossy D, Mattei MG, Simmons DL: The human intercellular
adhesion molecule 3 (ICA"3) gene is located in the 19~13.2-p13.3
region, close to the ICA"1 gene. Genomics 23:712, 1994
27. Orkin SH: GATA-binding transcription factors in hematopoietic cells. Blood 80575, 1992
2967
28. Raich N, Romeo PH: Erythroid regulatory elements. Stem
Cells 11:95, 1993
29. Mignotte V, Lemarchandel V, Romeo PH:GATA et Ets:
deux familles de determinants majeurs de la differenciation htmatopoibtique. HCmatologie 1: 19, 1995
30. Groves JD, Tanner MJA: Glycophorin A facilitates the expression of human band 3-mediated transport in Xenopus oocytes.
J Biol Chem 267:22163, 1992
31. Ridgwell K, Eyers SAC, Mawby WJ, Anstee DJ, Tanner
MJA: Studies on the glycoprotein associated with Rh (Rhesus) blood
group antigen expression in the human red blood cell membrane. J
Biol Chem 269:6410, 1994
32. Cartron JP: Defining the Rh blood group antigens. Biochemistry and molecular genetics. Blood Rev 8:199, 1994
33. Cherif-Zahar B, Raynal V, Le Van Kim C, D'Ambrosio AM,
Bailly P, Cartron JP, Colin Y: Structure and expression of the RH
locus in the Rh-deficiency syndrome. Blood 82:656, 1993