1. No category

From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
1995 86: 3754-3762
Retroviral-mediated gene transfer in human bone marrow cells
growth in continuous perfusion culture vessels
PG Eipers, JC Krauss, BO Palsson, SG Emerson, RF 3rd Todd and MF Clarke
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/10/3754.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
Retroviral-Mediated Gene Transfer in Human Bone Marrow Cells Grown in
Continuous Perfusion Culture Vessels
By Peter G. Eipers, John C. Krauss, Bernhard 0.Palsson, Stephen G. Emerson, Robert F. Todd 111,
and Michael F. Clarke
Hematopoietic stem cell gene therapy holds the promise of
being able to treat a variety of inherited and acquired diseases of the hematopoietic stem cell. However, to date, genetic modification of the human hematopoietic stem cell
has been relatively inefficient. Here, we report the results of
using a bioreactor system to expand hematopoietic cells
after a brief retrovirus infection using a high titer, replication
defective virus encoding for murine 0 1 8 . The retrovirus
transduced culture continued to produce genetically modified hematopoietic progenitors for up to 6 weeks, the dura-
tion of the culture period. Up to one-third of the long-term
culture initiating cell (LTC-IC) are genetically modified by the
culture conditions. Murine CD18 can be expressed on the
cell surface ofup to 20% of the maturecells generated by the
culture system, suggestingthat clinically significant levels of
gene transfer may be occurring. These results demonstrate
the feasibility of usingcontinuous perfusion bioreactors as a
method of efficiently modifying human hematopoietic stem
cells.
0 1995 b y The American Society of Hematology.
M
OLECULAR BIOLOGY has opened the way for the
(LTC-IC) threefold to sevenfold in 14 days and colony-forming
introduction ofnew genetic material into human
unit granulocyte macrophages (CFU-GMs) 8- to 21-foldin the
cells.'-3Gene therapy using hematopoietic stem cells as the
same period. This represents a significant improvement over
therapeutic target cell population holds great promise to draearlier culture techniques.
matically improve treatment of both hereditary and acquired
The best studied and most efficient method totransfer new
diseases that involve blood cells. For example, hereditary
genetic material into hematopoietic cells uses replicationhemoglobinopathies such as the thalessemias or sickle cell
deficient murine retroviruses. Use of these vectors in conjunction with a culture system that drives the cycling of
anemia could be corrected by the introduction of a gene
that expresses large amounts of fetal hemoglobin. Acquired
hematopoietic stem cells should increase the long-term sucdisorders, such as acquired immunodeficiency syndrome
cess of retroviral based treatment of human disease. We have
(AIDS), could potentially be treated by genetically engichosen leukocyte adhesion deficiency (LAD) as a model
system for retroviral mediated gene transfer into human heneering resistance to human immunodeficiency virus (HIV)
matopoietic cells.'' LAD is a rare autosomal recessive disorinto the hematopoietic stem cell.
Previously, we have shown that successful human long-term der caused by a defective CD18 gene. I4 The defective expression of CD18 leads to the decreased expression of a family
bonemarrowculture(LTBMC)dependson
a combination
of three heterodimeric proteins: CD 11a/CD 18 (LFA-l),
of culture conditions, including rapid media exchange, media
CDllb/CD18 (Mol), and CDllc/CD18 (p150,95). Patients
supplemented with hematopoietic growth factors (HGFs), and
with LAD suffer a range of functional defects, and often
development
of
a suitable micr~environment."~ Optimal
succumb in childhood to recurrent bacterial infection^.'^
growth conditions are achieved by the development
of an adherBone marrow transplantation has proven curative, demonent stromal cell layer, which provides anchorage sites and memstrating that correction of the defect in hematopoietic stem
brane bound and soluble growth factors." Supplementing mecells is adequate to fully treat the disease.16 We (the authors)
dia with a combination of several HGFs produces synergistic
activities that affect stromal, progenitor, and stem cells.'
' Rapid and other investigators have recently demonstrated that
transduction with a CD18-encoding retrovirus can restore
media exchange provides a relatively constant level of HGFs,
the expression of functional LFA-1 to lymphoblasts derived
as well as maintaining constant serum turnover, bothof which
from a patient with
Further, LAD clinical severity
more closely mimic the in vivo milieu. These factors are comis linked to the level of CD18 expression, suggesting that
bined effectively in a recently reported culture system using
even low levels of CD18 expression may produce substantial
continuous
perfusion
of
closed
cell
culture
chambers.'*
clinical improvement."
LTBMCmaynow
expandlong-termculture-initiatingcells
Here we demonstrate the transfer and expression of a
gene encoding murine CD18 in normal human bone marrow
From the Department of Internal Medicine and the Department
mononuclear cells grown in continuous perfusion LTBMC.
of Chemical Engineering, University of Michigan, Ann Arbor, MI.
Gene transfer was achieved with a simple 2-day infection
Submitted September 27, 1994; accepted July 13, 1995.
using a high titer cell-free viral supernatant of resting, unSupported by National Institutes of Health grants to M.F.C. and
fractionated bone marrow mononuclear cells. A significant
Grant No. HLD27640 to J.C.K.
number of CFU-GM colonies as well as LTC-IC were transP.G.E. and J.C.K. contributed equally to this work.
Address reprint requests to Michael F. Clarke, MD, Department
duced with retrovirus, suggesting gene transfer to primitive
of Internal Medicine, University of Michigan, Room C570, MSRB
hematopoietic cells. In addition, we demonstrated expression
11, I150 West Medical Center Dr, Ann Arbor, MI 48109-0668.
of murine CD18 in the transduced cultures at levels that if
The publication costsof this article were defrayedin part by page obtained in vivo, could be clinically significant.
charge payment. This article must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
0006-4971/95/86IO-0032$3.00/0
3754
MATERIALS AND METHODS
Generation of a high titer recombinant retrovirus encoding for
murine CD18. The plasmid 17.4,19 which encodes for murine
Blood, Vol86, No 10 (November 15). 1995 pp 3754-3762
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
RETROVIRUSGENETRANSFER
3755
INHUMAN MARROW
H
1 kb
Vlrus Dllutlon
8
1:1
130
1:lW
1:lOoo
M18-28
I
Cell number
t
Fiuorercance
(log rente)
Fig 1. Characterization of the murine D18 encoding retroviruses. (A) Schematic of the retrovirus vector encoding for murine CDl8; K-KPN
1 restrictionslte, SD-splice donor, SA-splice accept, LTR-retroviral long terminal repoat,
M-l&murine CD18 cDNA. IBl Indirect lmmunofluorescent. of c d surface murine CD18 expression aftar a single exposure to Mmr M18-28 or 15-2 virus supematents. Histograms depict cells
stained with a control antibody (shadedl ora test antlbody funshadedl after transductionwith the indicated dilutionsof virus supernatant.
nonadherent cells were serially isolatedto eliminate virus producing
CD18 was cut with Xho I, and B m H I linkers were attached using
cells. Approximately 1 week after retrovirus transduction of U937
standard subcloning procedures.m The resulting 2,495-bp fragment
cells, they were analyzedby flow cytometry (see below) for murine
was cloned into the B m H I site of phlFG?' to yield the plasmid
CD18 expression. Flow cytomeaic analysis showed that less than
pM18. Both amphotropic and ecotropic retrovirus producer
cell lines
were generated by cotransfecting the plasmid pM18 and pSV2Neo
1% of the U937cells expressed murine CD18. Transduced cells were
into 9, cells or into
cells bycalcium/phosphateprecipitation."
FACS sorted twice for murine CD18 expression, and the resulting
Clones were screened for their ability to express murine CD18 on
population U-M18-2 was used in subsequent experiments. Analysis
the cell surfaceof a CD1la cell line?' The highest titer amphotropic by Southern blotof U-M182 cells demonstrated approximately one
clone (M18-IP28) was used to transduce U937 cells. The highest
copy of unrearranged provirus per cell (datanot shown).
titer ecotropic clone was selected (M18-E13), and was used to cross- U937 imrnunoprecipifarion. Cellsurfaceiodinationandimmuinfect Q'crip cells five times to amplify retrovirus titer. The murine
noprecipitationwasperformedessentially
as described.=Briefly,
CD18 transduced !Pdp cells were subcloned, and individual virus
exponentially growing cells were iodinated by the lactoperoxidase
producingcellswereisolated.Thehighesttiterclone(15-2)
was
method, solid phase immunoprecipitated with either an antihuman
used to transduce bone marrow cells. A clone of the cross-infected
CDlla antibody (TS1/22),24 an antimurine CD18 antibody(M18):'
producer cells (15-2) produced retrovirus of approximately 1 to 2
a control antibody for the antihuman CD1la antibody, or a control
log higher titer than the conventional producer cell line (Fig
1B).
antibody for the antimurine CD18 antibody (all obtained from the
While an accurate limiting dilution titer is not possible with these
American Type Culture Collection [Camden, NJ] and used as neat
viral vectors because theydo not contain a selectable marker, com- tissue culture supernatants), and were electrophoresed through
an
parison with similar vectors with a selectable marker would indicate 8% nonreducingpolyacrylamidegel,andwerethensubjectedto
that M18-IP28 had an approximate titer of IO6 CFWmL, and 15-2
autoradiography.
had an approximate titer of lo7 CFU/mL. All retrovirus producing
Flow cytometry. Flowcytometrywasperformed
as described
clones were free of replication competent retrovirus as determined
either without or with a 72-hour incubation4p
in phorbol 12-myrisby a proviral rescue with 3T3 amplification assay.=
tate 13-acetate (PMA) and representative histograms aredepi~ted.~'
U937 transduction Exponentially growingU937 cells were coCells were subjected to indirect immunofluorescence with the folcultured with the amphotropic retrovirus M18-IP28 for 2 days and
lowing antibodies:TSlll8 (murine antihuman CD18)," TS1/22 (mu-
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
EIPERS ET AL
3756
M-CD18
H-CD18
cell number
Immunofluorescence
(log scale)
Fig 2. Murine CD18 can be expressed on thecell surface of human myeloidcell lines. Depicted are histograms of indirect immunofluorescence
of untransduced cells (U937) or transduced and sorted cells (U-M18-21 either without or with a 72-hour incubation in PMA. Test antibody (antimurine CD18-Ml8, antihuman CD18-H-CD18, or antihuman C D l l a - H C D l l a ) is the solid line, control antibody is the dotted line. The specific
fluorescence above control (linear scale) is shown in the upper right handcorner.
rine antihuman CD1 la), MIX (rat antimurine CDIX), and species
and isotype matched control antibodies,all obtained from the American Type Culture Collection andused as neat tissue culture supernatants. Murine antihuman CD1 I C was obtained from AMAC (clone
IOC; Immunotech, Westhrook, ME). The mean linear fluorescence
channel (after subtraction of the species and isotype matched control
antibody fluorescence) was determined.
Primary hone marrow cells. Humanhone marrow cellswere
obtained from the iliac crest of normal consenting donors under a
protocolapproved by the University of MichiganHumanInstitutional Review Board. Bone marrow mononuclear cells were separated by density gradient centrifugation on Ficoll-Paque (density =
1.077 g/rnL; Pharmacia, Piscataway, NJ). Cells were collected from
the interface and washed three times
in Iscove's modified Dulbecco's
medium(IMDM;GIBCO,Gaithersburg,MD).Cellswere
then
counted and divided for appropriate infection conditions.
Cell culture. Eight culture vessels were each inoculated with 5
X IO' primary human stromal cells, and cultured for
24 hours. For
each culture vessel, 6 X 10' human mononuclear hone marrow cells
were infected on day 1 by suspension in a cell-free viral supernatant
mixed 1 : 1 with normal Dexter media. The cells were incubated at
37°C for 4 hours, and then washed and resuspended in normal Dexter
media. The culture vessels were then inoculated with the retrovirally
infected cells and allowed to settle 24 hours. On the second day,
culture media was rapidly changed by perfusion with
the l : ] virus
supernatant:Dextermedium
(10 mL130 minutes),followed by a
static incubation of 4 hours. The virus
was then flushed from the
cells by another rapid perfusion with normal Dexter medium. Subsequently, media was stored at 4°C and warmed to 37°C immediately
before perfusion at a rate of 2.5 mL/day. Upon harvest, cells were
aspirated from the culture chamber with a syringe.
The chamber was
washed three times with Hank's Balanced Salt Solution (HBSS) and
the washes were pooled with the nonadherent cells. The adherent
stromal layer was removed in a similar manner after an incubation
of ten minutes with 0.25% trypsin/EDTA solution. Cells were subjected to progenitor and LTC-IC analysis as previously described."
Conventional static culture (non-bioreactor) was carried out as previously d e ~ c r i b e d . ~
PCR proviral detection. ConditionsforthePCRamplification
of proviral DNA sequences in isolated methylcellulose colonies were
optimized, based on a previously reported protocol?6
The marked
colonies were individually aspirated using a Gilman P200 pipetter
andaclippedpipettetip.Thecolonyandapproximately
50 pL
surrounding it wasplaced in 500pL phosphatebufferedsaline
(PBS),invertedgentlyseveraltimes,andspunin
an Eppendorf
centrifuge at 6,000 rpm for 15 minutes. The invisible cell pellet was
then resuspended in 25 pL of a PCR buffer with nonionic detergents
and Proteinase K (50 mmol/L KCI, 10 m m o l n Tris-HC1 (pH 8.3)
2.5 m m o l n MgCII, 0. l mg/mL gelatin, 0.45% NP40,0.45% Tween
20, Proteinase K to 0.6 Fg/pL). Cells were incubated at
50°C for
60minutes.Proteinase K wastheninactivated
by 15 minutes of
incubation at 95°C. This lysate could then be placed directly into a
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
MARROWRETROVIRUS
HUMAN
GENE TRANSFER IN
3757
00
6
& x E
.I, g 2
0
z o o
4
H-CD11a
H-CD18
M-CD18
0
0
- 205
- 117
- 80
-49.5
-
Fig 3. Murine CD18 is in close proximityto human CD18 in transduced cells. U-M18-2 cells were iodinated by the lactoperoxidase
method, solid phase immunoprecipitated with either an antihuman
CDlla antibody (anti-H-CDlla), an antimurine CD18 antibody (antiM-CD181, a control antibody fortheantihuman CDlla antibody (CONHI or a control antibody for the antimurine CD18 antibody (CON")
and run on a 8.0% nonreducing polyacrylamide gel. Molecular weight
markers in kilodakon are shown to the right.
conventional PCR cocktail. Amplification cycle consisted of94°C
for 1 minute and 72°C for 2 minutes and 10 seconds for a total of
30 cycles. First Round-primer one:
5' ACCCCACCTGTAGGT'ITGGCAAGCTAGCTTAA;primertwo: 5' GTCTCCCGATCCproduct.
Second
CGGACGAGCCCCCAAATGAAA; 61 1 bp
5' CAGGGCCAAGAACAGATGGAACAGround-primerone:
CTGAATATG;
primer
two:
5' AGCAGAAGCGCGCGAACAGAAGCGAGAAGCGAA; 238 bp product. Two successive rounds
of PCR allows detection of viral genome in
colonies of as few as
50 cells. PCR products from the second roundof amplification were
separated and photographed on
a 2% agaroseTBE gel, using4x1741
Hoe111 size markers. For the purpose
of identifying thePCR product
by Southern
blothybridization,
a largeroligodeoxynucleotide
primer, located between the two second round primers was synthesized with the sequence5' GCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACT. Southern blot confirmationof PCR products was carried out as previously described."
RESULTS
ciently transduced 100% of cells after a single exposure to
retrovirus (Fig IB). A higher titer retroviruscellline was
generated by cross-infecting the QC",, packaging cell linewith
ecotropic murine C l 8 encoding retrovirus. A clone of the
cross-infected producer
cells
(15-2) produced
retrovirus
of
approximately 1 to 2 log higher
titer
than conventional
the
producer cell line (Fig IB). All viruses were free of replication competentvirusasdetermined
by aprovirusrescue
method (data not shown). This high titer producer cell line
was used with subsequent experiments transducing normal
human bone marrow.
To confirm that murine CD18 could be expressed on the
cell surface of myeloid cells, the macrophage-like cell line
U937wastransduced
with the amphotropic murineCD18
encoding retrovirus. Asthe initialtransductionefficiency
was less than 1 % (data not shown),murine CD18' cells
were isolated by 2sequential FACSsortstogeneratethe
cell line U-MI8-2 (Fig 2). Murine CD18 is efficiently expressed on the cell surface of these myeloid cells. Murine
CD18expressionincreasesafter
incubation with the phorbol
ester PMA, concomitant with an increase in the endogenous
p2 integrin expression (Fig 2). These results suggest that the
murineCD18encodingvectorcan
efficientlyfunction in
both resting and differentiated myeloid cells.
The p2 integrins require heterodimer formation to be efficiently expressed on the cell
surface.'' Cell surfaceiodinated
transduced cells (U-M18-2) were subjected to immunoprecipitation with antibodies directed at either murine CD18 or
human CD1l a (Fig 3). Immunoprecipitation ofmurine CD18
fromthetransducedcellsconfirms
thatmurine CD18 is
physically associated with human CD1 l a on the surface of
the U937 cells.Precipitation with an antibodydirected at
human CD11a co-precipitated bothmurine CD18 and human
CD18. These results provide supportive evidence heterofor
dimer formation between murine CD18 and human CD1 l a
in human myeloid cell lines. Thisextends theresultsof
others demonstrating heterodimerformation between murine
CD18 and human CD1 l a in transfected fibroblasts and somatic cell hybrid^.^'.^'
Based on previous experiments using continuous perfu-
Table 1. Retrovirus Transduced Hematopoietic Cells Grown in
Bioreactors ConsistentlyProduce Provirus Positive
Progenitors for 6 Weeks
Provirus Positive
CFU-GM
Time
(weeks)
0
1
2
4
6
Cell Number,
Cumulative, x 10.'
(fold increase)'
3.0
5.1 (1.7)
CFU-GM,
cumulative
(fold increase)
18,600
40,100 (2.2)
90,915 (4.9)
119,580 (6.4)
141,680 (7.6)
No. Positive1
No. Assessed
14114
13/13
Percent
100
100
57
90
50
A recombinant retrovirus vector encoding murine CD18
8112
11.2 (3.7)
was generated (Fig 1A). This vector transcribes predomi9110
28.1 (9.3)
6/12
nantly from the retrovirus long
terminal repeat. The inclusion
35.8 (11.9)
of the endogenous envelope splice-accept sequences allow
Cell number is the average of two bioreactors harvested at the
for the generation
of genomic provirus derived RNA suitable indicated time points. Bioreactors run for more than 2 weeks were
for theefficient translation ofmurine CD18. An amphotropic
depopulated at 21 days by the removal of 75% of the nonadherent
producer cell line produced by transfection (M18-28) efficells.
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
EIPERS ET AL
3758
A
238 bp
Day 14
Day 7
1 2 3 4
5 6 7 0 M
9 10111213
+
-
1 2 3 4
1011
1213
14
+-
+
Day 28
1 2 3 4 5 6 7 8 M
238 bp
B
5 6 7 8 9 M
9 10+ -+%
Day 42
0
0
321
5
6
7 8
9
M10
1112+%
-
+
I
+
m C D I8
4
+238 bp
hCD18
NA
AD
C
M D 18
hCD18
d
"
NA
AD
. " - "
sion culture of hematopoietic cells, we postulated that rapid
media exchange would stimulate hematopoietic cell replication and allow successful transduction with retroviral vectors. In order to investigate the ability of the murine CD18encoding virus to infect early hematopoietic cells grown in
rapidly perfused LTBMC, fresh normal human bone marrow
mononuclear cells were inoculated into continuous perfusion
culture chambers and the cultures were transduced with the
Fig 4. Proviral sequences are detected in CFU-GM
colonies throughout the long-term culture of human
bonemarrow cells. Genomic DNA was prepared
from isolatedCFU-GM colonies and subjected t o two
rounds ofPCR amplification with nested sets of primers. Presence of proviral DNA gives rise t o an expected PCR product 238 bp inlength. CFU-GM colonies were examined at days 7, 14, 28. and 42 of
culture. (A) At each timepoint, a majority ofcolonies
examined exhibited theexpected PCR product, in adto
dition
nonspecific products
of
various sizes. M
denotes molecular size marker, @X174-Hindlll.(B, C)
Protein expression at 28 and 42 days. NA denotes
nonadherent cell fraction, AD the adherent cell fraction. Control antibody is depicted by the dotted
line,
while humanor mouse CD18 is depicted by a heavy,
In a replicate experiment, PCR products
solid line. (D)
were subjected t o Southern blotanalysis. When PCR
products fromgenomic DNA of infected cells are hybridized to a radiolabeled probe from an internal
fragment of the viral vector, autoradiography specifically detects a signal from the 238-bp fragment,
and not from negative control lanes or molecular
murine CD18 encoding retrovirus 15-2 as described in Materials and Methods. Media was perfused through the chamber
at 2.5 m u 2 4 hours, providing for a 50% volume exchange
every 24 hours.Both the total cell number, and the total
number of CFU-GM continuously increased for the entire
6-week period (Table 1). Similar to untransduced cultures,
the maximum CFU-GM and overall cell number expansion
occurred during the first 2 weeks of the long-term culture,
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
GENE
RETROVIRUS
IN HUMAN MARROW
3759
+
Fig 4.
although continuous production of both CFU-GM was noted
for the entire 6 weeks.
Analysis of DNA from isolated progenitor colonies demonstrated efficient gene transfer at all time points tested (Table l and Fig 4). PCR detection of proviral DNA revealed
that provirus was present in a majority of CFU-GM colonies
throughout the 6-week duration of the experiment. At the
first analysis 1 week after infection, nearly all of the progenitor cell colonies contained proviral sequences. Continued
analysis showedthat the proportion of positive colonies
never dropped below half of the colonies examined at any
time point (Table 1 and Fig 4). Southern blot analysis with
a viral-derived oligonucleotide probe internal to the PCR
primers confirmed the identity of the PCR fragment (Fig
4D). As a control against the possibility that lysed cells could
introduce free genomic DNA throughout the methylcellulose, resulting in false positives, cell-free areas of the progenitor cultures were also assayed by PCR, and were uniformly
negative (data not shown).
To compare these data with that of a conventional
LTBMC, we also cultured human marrow cells in conventional culture dishes as previously described.' Cells were
harvested from these cultures at 2 and 4 weeks of culture,
and used in our CFU-GM assay. CFU-GM colonies derived
from cells harvested at 14 days of culture were uniformly
provirus negative when assayed by our PCR assay (Fig 5 ) .
Colonies from cells harvested at day 28 of culture were
similarly negative (data not shown).
The presence of proviral DNA in CFU-GM colonies from
day 42 of bioreactor culture led us to test how effectively
earlier hematopoietic progenitor cells were infected with the
retrovirus. LTC-IC represent cells hierarchically less mature
than committed progenitors. Therefore, in a separate experiment, we examined CFU-GM derived colonies produced by
7-week LTC-IC culture as described previously.'2 We reasoned that cycling of stem cells early in the culture would
238 bp
ICont'd)
allow integration of provirus in cells measured in our LTCIC assay. Using the same PCR assay as was used for CFUGM provirus detection, we found that 33% (4 of 12) LTCIC derived methylcellulose colonies from different cultures
in our limiting dilution assay contained provirus (Fig 6).
This suggests that at least a portion of the earliest cells in
the new culture are cycling, whichis in agreement with
earlier work describing the expansion of these cells using
this culture method.'*
Murine CD18 was efficiently expressed in a proportion
of the transduced cells in culture. Flow cytometric analysis
of both the nonadherent fraction as well as the adherent
fraction of cells demonstrated expression of murine CD18
on the cell surface at both 4 weeks and 6 weeks (Fig 4B,
C). The reduced murine CD18 expression in the adherent
fraction may be due to the trypsinization required to harvest
these cells. Murine CD18 fluorescence persisted at roughly
steady levels throughout the 6-week duration of the experiment.
DISCUSSION
We have shown that a high titer retrovirus may be used
as a vector for efficient gene transfer into human hematopoietic cells grown in continuous perfusion LTBMC, and primary hematopoietic cells canefficiently express murine
CD18 on their cell surface. Immunoprecipitation of surface
labeled cells suggests that murine CD1 8 is being expressed
as a heterodimer with humanCD1 la. In addition, the retrovirus vector can upregulate murine CD 18 protein expression
after in vitro differentiation, suggesting that this vector can
efficiently express protein in both early and mature hematopoietic cells. Genetic modification of 33% of LTC-IC suggests that a portion of the most immature cells are being
transduced. The ability to expand and genetically modify
normal hematopoietic cells may make it feasible to perform
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
3760
EIPERS ET AL
I23456789101112
+
a "competition transplant" with genetically modified bone
marrow without significant myeloablation.
Hematopoietic stem cell gene transfer in animal systems
has met with varied success. A number of investigators have
achieved the long-term expression of transgenes in virtually
all mice transplanted with genetically modified bone marrow.2y-3'Reproducible transduction of the hematopoietic
stem cell of mice has relied on the treatment of marrow
donor mice with a cytotoxic agent such as 5-fluorouracil,
the prestimulation of the donor marrow in vitro with a combination of early acting growth factors such as kit ligand (stem
cell factor), interleukin 3 (IL-3), and IL-6, and the use of
ecotropic murine retrovirus as the gene transfer substrates.
Attempts to genetically modify the hematopoietic stem cells
of mice with amphotropic retrovirus have generally resulted
in overall lower gene transfer rates.32
Genetic modification of the hematopoietic stem cell of
larger animals, such as dogs and non-human primates has
been less efficient. Even with a high-titer virus, and using
repeated retrovirus transduction, fewer than 5% of hematopoietic progenitor cells can be reliably transduced.33.3sSimilar work by others in primate stem cell gene transfer model
has demonstrated roughly equivalent levels of gene transfer,
with genetic modification occurring in atbest 5% of the
repopulating hematopoietic stem
In some instances
persistence of the transgene has been observed for periods
up to 1 year suggesting true stem cell genetic modification,
albeit at relatively low rates. These results suggest that sub-
-
+
Fig 6. Proviral sequences can
be detected in LTC-ICcolonies.
CulturesofLTC-ICcells
were
prepared and individual colonies
were subjected to thesame PCR
asassay
the CFU-GM colonies.
Lanes 1,2,4, and 7 show the expected 238 bp product from LTCICcolonies containing proviral
DNA. (+l A positive control using previously infected cells; (-1
a negative control using
uninfected cells. H20is a control reaction containing no template.
+
+
stantial improved gene transfer protocols need to be devised
to obtain higher rates of gene transfer into large animals and
humans.
Recently, several investigators have achieved relatively
high rates of genetic modification of hematopoietic progenitors. Efficient genetic modification of up to 100% of CFUGM has been obtained by transducing hematopoietic progenitors isolated from patients receiving human growth factor
(HGF) isolated from patients during recovery from highdose chemotherapy.3xIn patients primed only with in vivo
HGF, transduction of isolated CD34 cells in the presence of
HGF resulted in 17% to 50% of the CFU-GMbeing genetically modified.39Genetic modification of 63% of the CFUGM was obtained by Moore et al, using resting marrow and
allogeneic stromal cell feeder laye~s.~"
Interestingly, in these
experiments the transduction efficiency in the presence of
bone marrow stromal cells was not appreciably enhanced by
the supplementation with additional growth factors during
the retrovirus transduction.
Hughes et al have reported the ability to transduce up to
60%of colony-forming cells (CFCs) and up to 40% of LTCIC using a high titer neomycin encoding virus to transduce
bone marrow collected during steady-state hematopoiesis:'
We have achieved virtually identical gene transfer rates, and
in addition have demonstrated the cell surface expression of
the transgene in a proportion of the transduced bone marrow
cells. Although infection of cells that give rise to progenitor
cells after 6 weeks of culture may reflect infection of the
+
\%9b(C36109
,
~..
238 bp
Fig 5. CFU-GM coloniesfrom
cells grown in conventional
static cultures are not efficiently
infected by ourretrovirus. The
15-2 supernatant was used to infect cells grown in conventional
tissue culture plasticware, with
a daily 5046 medium exchange.
CFU-GM coloniesderived from
cells harvested at day 14 of culture were subjected to PCR analysis. No colonies were PCR positive. Lane 1, MW marker;2-11,
colony samples; 12,
positivecontrol.
Q \ %
Q
X
#+%
* 238 bp
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
RETROVIRUSGENETRANSFER
IN HUMAN MARROW
stem cell, human trials using these gene transfer techniques
are needed to confirm transfer into stem cells rather than
committed progenitor cells. (This level of CD18 expression,
if obtainable in vivo in hematopoietic cells, may be of a level
that could partially ameliorate the phenotype of leukocyte
adhesion deficiency. Further experiments will be necessary
to determine whether we can complement the defect in bone
marrow derived from patients with LAD.)
Continuously perfused culture vessels should continue to
provide a useful model for gene therapy in the hematopoietic
system for several reasons. This culture method appears to
improve the efficiency of retroviral gene transfer when compared with conventional static cultures. A high serum turnover rate provides conditions analogous to in vivo bone marrow. Perfusion with HGF supplemented media can induce
rapid cell cycling of both the hematopoietic and stromal
elements, increasing the efficiency of retroviral gene transfer.
A stromal bed can be established before marrow culture,
thereby providing an optimal microenvironment for retroviral infection. It has been shown that extracellular matrix
molecules improve the efficiency of retroviral gene transfer
in hematopoietic cells.42 Culture in perfusion vessels has
provided an important method for the efficient transduction
of hematopoietic progenitors, while maintaining a significant
expansion of myeloid progenitor cells.
The ability to achieve engraftment of normal marrow in
mice hypertransfused with hematopoietic stem cells raises
the possibility that a similar phenomena may occur in hum a n ~ : ~If hematopoietic stem cells could be sufficiently expanded ex vivo, then presumably administration of a large
number of ex vivo expanded and genetically modified hematopoietic cells could lead to the engraftment of a proportion
of the genetically modified cells. Further improvements in
both the transduction frequency and the ability to expand
hematopoietic cells will be necessary before this hypothesis
can be tested in the clinical setting.
REFERENCES
1.MulliganRC:Thebasicscienceofgenetherapy.Science
260926, 1993
2. Krauss JC: Hematopoietic stem cell gene replacement therapy.
Bio Biophys Acta 1114:193, 1992
3. Einerhand “ P W , Valerio D: Gene transfer into hematopoietic cells: Prospects
for human gene therapy. Curr Top Micro Immuno1 177:217, 1992
4. Schwartz R, Palsson B, Emerson S: Rapid medium perfusion
rate increases the productivity and longevity
of human bone marrow
cultures. Proc Natl Acad Sci USA 88:6760, 1991
5. Dexter T, Allen T, Lajtha L Conditions controlling the proliferation of haemopoietic stem cells in vitro. J Cell Physiol 91:335,
1977
6. Testa N, DexterT Long term production oferythroid precursor
cells (BFU) in bone marrow cultures. Differentiation 9:103, 1977
7. Moore M, Sheridan A, Allen T, Dexter T Prolonged hematopoiesis in primate bone marrow culture system: Characteristics of
stem cell production and hematopoietic microenvironment. Blood
54:775, 1979
8. Gamer S , Kaplan H Long-term culturesof human bone marrow cells. Roc Natl Acad Sci USA 77:4756, 1980
S : In vitro myelopoiesis is
9. Schwartz R, Palsson B, Emerson
3761
stimulated by rapid exchange and supplementation with hematopoietic growth factors. Blood 78:3155, 1991
10. Coulombel L, Vuillet G, Tchernia
M:Linkage-andstagespecific adhesion of human hematopoietic cells to extracellularmatrices from marrow fibroblasts. Blood 71:329, 1988
11. Coutinho L, Will A, Radford R, Schiro R, Testa N, Dexter
T Effectsofrecombinanthuman
granulocyte colony stimulating
factor (G-CSF), human granulocyte-macrophage CSF, and gibbon
interleukin-3 on hematopoiesis inhumanlong-termbonemarrow
cultures. Blood 75:2118, 1990
12. Koller M, Emerson S , PalssonB:Large-scaleexpansionof
human stem and progenitor cells from bone marrow mononuclear
cells in continuous perfusion cultures. Blood 82:378, 1993
13.AndersonD,SpringerTA:Leukocyteadhesiondeficiency:
An inherited defect in the
Mac- 1, LFA-1, and p150,95 glycoproteins.
Ann Rev Med 38:175, 1987
14.KishimotoTK,HollanderN,Roberts
TM, AndersonDC,
Springer TA: Heterogeneous mutations in thep subunit common to
LFA-1, Mac-l, and p150,95 glycoproteins cause leukocyte adhesion
deficiency. Cell 50:193, 1987
15. Anderson D, SchmalsteigF, Finegold M, Hughes B, Rothlein
R, Miller L, Kohl S , Tosi M, Jacobs R, Waldrop T, Goldman A,
Shearer T, Springer T: The severe and moderate phenotypes
of heritable Mac-l, LFA-1deficiency:Theirquantitativedefinitionand
relation to leukocyte dysfunction and clinical features. J Infect Dis
152668, 1985
16. Le Deist F, BlancheS , Keable H, Gaud C, Pham H, DescampLatscha B, Wahn V, Griscelli C, Fischer A: Successful HLA nonidentical bone marrow transplantation in three patients with the leukocyte adhesion deficiency. Blood 74:512, 1989
17. Wilson J, Ping A, Krauss JC, Mayo-Bond L, Rogers C, Anderson D, Todd W.Correction of CD18-deficient lymphocytes by
retrovirus-mediated gene transfer. Science 248:1413, 1990
18. Hibbs M, Wardlaw A, StackerS , Anderson D,Lee A, Roberts
T, Springer T:Transfectionof cells from patients with leukocyte
adhesion deficiency with an integrinp subunit (CD18) restores lymphocytefunction-associated antigen-l expressionandfunction. J
Clin Invest 85:674, 1990
19. Wilson RW, O’Brien WE, Beaudet AL: Nucleotide sequence
ofthecDNA from the mouse leukocyte adhesion protein CD18.
Nucleic Acids Res 17:5397, 1989
20. Sambmk J, Fritsch FP, Maniatis T Molecular Cloning, A
Laboratory Manual. Cold Spring Harbor, New York, 1989
21.Dhawan 3, Pan LC, Paulath GK, Travis MA, Loncto AM,
Blau HM: Systemic deliveryof human growth hormone by injection
of genetically engineered myoblasts. Science 2541509, 1992
22. Danos 0, Mulligan RC: Safe and efficient generation of recombinant retroviruses with amphotropic and ecotropic host ranges.
Roc Natl Acad Sci USA 856460, 1988
23. Krauss JC, Bond LM, Todd RF, Wilson JM: Expression of
retroviral transduced human CD18 in murine cells:
An in vitro model
of gene therapy for leukocyte adhesion deficiency.
Hum Gene Ther
2:221,1991
24.Sanchez-MadridF,Krensky
AM, WareCF,Robbins
E,
Strominger JL, Burakoff SJ, Springer TA: Three distinct antigens
1,
associated with human T-lymphocyte-mediated cytolysis: LFALFA-2 and LFA-3. Proc Natl Acad Sci USA 79:7489, 1982
25. Springer T, Galfre G, Secher D, Milstein C: Monoclonal xenogeneic antibodies to murine cell surface antigens: Identification
of novel leukocyte differentiation antigens. Eur J Immunol 8:539,
1978
26. Higuchi R Amplifications. Perkin-Elmer News Lett2:1,1989
27. Marlin SD, Morton CC, Anderson DC, Springer TA: LFA1immunodeficiencydisease:Definition ofthegeneticdefectand
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
3762
chromosomal mapping of a and subunits of the lymphocyte function-associated antigen 1 (LFA-l) by complementation in hybrid
cells. J Exp Med 164:855, 1986
28. Kaufmann Y, Tseng E, Springer TA: Cloning of the murine
lymphocyte function-associated molecule-l a-subunit and its expression in cos cells. J Immunol 147:369, 1991
29. Luskey BD, Rosenblatt M, Zsebo K, Williams DA: Stem cell
factor, interleulun-3, and interleukin-6 promote retroviral-mediated
gene transfer into murine hematopoietic stem cells. Blood 80:396,
1992
30. Correll PH, Colilla S, Dave HPG, Karlsson S : High levels
of human glucoceribrosidase activity in macrophages of long-term
reconstituted mice after retroviral infection of hematopoietic stem
cell. Blood 80:331, 1992
3 1. Szilvassy S , Fraser C, Eaves C, Lansdorp P, Humphries R:
Retrovirus-mediated gene transfer to purified hemopoietic stem cells
with long-term lympho-myelopoietic repopulating ability. Proc Natl
Acad Sci USA 86:8798, 1989
32. van Beusechem VW, Kukler A, Einerhand MPW, Bakx TA,
van der Eb AJ, van Bekkum DW, Valerio D: Expression of human
adenosine deaminase in mice transplanted with hemopoietic stem
cells infected with amphotropic retroviruses. J Exp Med 172:729,
1990
33. Carter RF, Abrams-Ogg ACG, Dick JE, Kruth SA, Valli VE,
Kamel-Reid S , Dube ID: Autologous transplantation of canine longterm marrow culture cells genetically marked by retroviral vectors.
Blood 79:356, 1992
34. Schuening FG, Kawahara K, Miller AD, To R, Goehle S ,
Stewart D, Mullally K, Fisher L, Graham TC, Appelbaum FR, Hackman R, Osbome WRA, Stobe R: Retrovirus-mediated gene transduction into long-term repopulating marrow cells of dogs. Blood
78:2568, 1991
35. Stead RB, Kwok W, Storb R, Miller AD: Canine model
for gene therapy: Inefficient gene expression in dogs reconstituted
EIPERS ET AL
with autologous marrow infected with retrovirus vectors. Blood
71:742, 1988
36. van Beusechem VW, Kuler A, Heidt PJ, Valerio D: Longterm expression of human adenosine deaminase in rhesus monkeys
transplanted with retrovirus-infected bone marrow cells. Proc Natl
Acad Sci USA 89:7640, 1992
37. Bodine DM, Moritz T, Donahue RE, LuskeyBD, Kessler
SW, Martin DIK, Orkin SH, Nienhuis AW, Williams DA: Longterm in vivo expression of a murine adenosine deaminase gene in
rhesus monkey hematopoietic cells of multiple lineages after retroviral mediated gene transfer into CD34+ bone marrow cells. Blood
82: 1975, 1993
38. Brengni M, Magni M, Siena S, DiNicola M, Bonadonna G,
Gianni A: Human peripheral blood hematopoietic progenitors are
optimal targets of retroviral-mediated gene transfer. Blood 80: 1418,
1992
39. Cassel A, Cottler-Fox M, Doren S , Dunbar C: Retroviralmediated gene transfer into CD3Cenriched human peripheral blood
stem cells. Exp Hematol 21:585, 1993
40. Moore KA, Deisseroth AB, Reading CL, Williams DE, Belmont JW: Stromal support enhances cell-free retroviral vector transduction ofhumanbonemarrow
long-term culture-initiating cells.
Blood 79:1393, 1992
41. Hughes PFD, Thacker JD, Hogge D, Sutherland W ,Thomas
TE, Lansdorp PM, Eaves CJ, Humphries RK: Retroviral gene transfer to primitive normal and leukemic hematopoietic cells using clinically applicable procedures. J Clin Invest 89:1817, 1992
42. Moritz T, Patel VP, Williams DA: Bone marrow extracellular
matrix molecules improve gene transfer into human hematopoietic
cells via retroviral vectors. J Clin Invest 93:1451, 1994
43. Stewart FM, Crittenden RB, Lowry PA, Pearson-White S ,
Quessenbeny PJ: Long-term engraftment of normal and post-5-fluorouracil murine marrow into normal nonmyeloablated mice. Blood
81:2566, 1993