Emily Buckhouse Nitrogenous Bases Nucleosides  Base linked to a 2-deoxy-D-ribose at 1’ carbon Nucleotides • Nucleosides with a phosphate at 5’ carbon Phosphodiester Bond  DNA Polymerase Determining the Sequence of DNA  Methods: 1. Chain termination or dideoxy method  F. Sanger 2. Shotgun sequence method 3. 2nd generation sequence methods  Pyrosequencing Dideoxy (Sanger) Method  4 Steps: 1. Denaturation 2. Primer attachment and extension of bases 3. Termination 4. Gel electrophoresis Overview: Dideoxy (Sanger) Method 2 3 1 4 Gel electrophoresis 5 Dideoxy (Sanger) Method • ddNTP- 2’,3’dideoxynucleotide • No 3’ hydroxyl • Terminates chain when incorporated • Add enough so each ddNTP is randomly and completely incorporated at each base Dideoxy Method • Run four separate reactions each with different ddNTPs • Run on a gel in four separate lanes • Read the gel from the bottom up Automated Version of the Dideoxy Method So What’s Wrong With It? The dideoxy method is good only for 500-750bp reactions  Expensive  Takes a while  The human genome is about 3 billion bp  Human Genome Project Began in 1990  Why?   Human evolution  Nature versus nurture  Causes of disease Shotgun Sequencing   Used to sequence whole genomes Steps:  DNA is broken up randomly into smaller fragments  Dideoxy method produces reads  Look for overlap of reads Strand Sequence AGCATGCTGCAGTCATGCT------First Shotgun Sequence -------------------TAGGCTA AGCATG-------------------Second Shotgun Sequence ------CTGCAGTCATGCTTAGGCTA AGCATGCTGCAGTCATGCTTAGGCTA Reconstruction 2nd Generation: Pyrosequencing Sequencing by synthesis  Advantages:   Accurate  Parallel processing  Easily automated  Eliminates the need for labeled primers and nucleotides  No need for gel electrophoresis Pyrosequencing  Basic idea:  Visible light is generated and is proportional to the number of incorporated nucleotides  1pmol DNA = 6*1011 ATP = 6*109 photons at 560nm DNA Polymerase I from E.coli. pyrophospate From fireflies, oxidizes luciferin and generates light Pyrosequencing  1st Method  Solid Phase ○ Immobilized DNA ○ 3 enzymes ○ Wash step to remove nucleotides after each addition Pyrosequencing  2nd Method  Liquid Phase ○ 3 enzymes + apyrase (nucleotide degradation enzyme)  Eliminates need for washing step • In the well of a microtiter plate: • primed DNA template • 4 enzymes • Nucleotides are added stepwise • Nucleotide-degrading enzyme degrade previous nucleotides Pyrosequencing Method: Pyrosequencing Results: Pyrosequencing Disadvantages Smaller sequences  Nonlinear light response after more than 5-6 identical nucleotides  Summary DNA sequencing is a common procedure  Dideoxy method   Chain termination method  Best for small DNA segments  Whole genome shotgun sequencing  Sequence human genome  Fragments larger DNA strand to manageable chunks  Pyrosequencing  Sequence by synthesis  Accurate and fast References Applied Biosystems Automated DNA Sequence Chemistry Guide. (2000) Garrett & Grisham. (2007) Biochemistry. Thomson and Brooks/Cole. 3rd ed. Pgs 337340. Maxam, A. & Gilbert, W. (1977) A new method for sequencing DNA. Proc. Natl. Acad. Sci. 74, 560-564. Ronaghi, M. (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res. 11, 3-11. Sanger, F., Nicklen, S., & Coulson, A.R. (1977) DNA Sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. 94, 5463-5467. Shendure, J. & Ji, H. (2008) Next-generation DNA Sequencing. Nature Biotech. 26, 1135-1145 Venter, C, et al. (2001) The sequence of the human genome. Science. 291, 1304.