1. No category

From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
1994 84: 3205-3211
Molecular mapping of the Cromer blood group Cra and Tca epitopes
of decay accelerating factor: toward the use of recombinant antigens
in immunohematology
MJ Telen, N Rao, M Udani, ES Thompson, RM Kaufman and DM Lublin
Updated information and services can be found at:
http://www.bloodjournal.org/content/84/9/3205.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
Molecular Mapping of the Cromer Blood Group Cr" and Tc" Epitopes of
Decay Accelerating Factor: Toward the Use of Recombinant
Antigens in Immunohematology
By Marilyn J. Telen, Neeraja Rao, Manisha Udani, E. Scott Thompson, Richard M. Kaufman, and Douglas M. Lublin
Cromer blood groupantigensresideon the complement
regulatory protein decayacceleratingfactor(DAF,CD55).
This glycosyl-phosphatidylinositol-anchored glycoprotein is
widely dim-buted, especially among cell types in contact
with plasma. Numerous Cromer blood group antigens
have
been defined using alloantibodies induced by transfusion or
pregnancy. However,few pairs ofantithetical antigens have
been described in this system, presumably because of the
rarity of the low-frequency alleles. Analysis of polymerase
chain reaction-amplified genomic DNA showed that the
Pro substitution in short
Cr(a-) phenotype has a Ala'=
consensus repeat 4 (SCR4)of DAF, and the Tc(a-b+) phenotype has a Arg" --t Leu substitution in SCRl of DAF. The
locations ofCr' and Tc' epitopes were confirmed by analysis
of Chinese hamster ovary cell transfectants expressing a
Cr(a-) allele-specifictransfectantandachimeric
protein
containing only SCRl ofDAF, respectively. Overall, these
studies further show the usefulness of an approach based
on recombinant proteins in mapping blood group antigen
epitopes and identifyingblood group antibodies.
6 1994 by The American Society of Hematology.
T
The aim of this study was to determine the genetic and
biochemical bases of the Cr(a-) and Tc(a-) phenotypes and
to map the C f and Tc" epitopes using recombinant proteins.
-+
HE CROMER BLOOD GROUP system comprises at
least 10 individual antigens.' Of these, most are highfrequency antigens identified when a rare individual lacking
the antigen produced an antibody after exposure to blood
products expressing that antigen; only three low-incidence
antigens have been identified by human sera. The antigens of
the Cromer blood group system reside on decay accelerating
factor (DAF, CD%), a glycosyl-phosphatidylinositol-anchored protein with complement regulatory activity.' The
high-frequency D$ antigen was the first Cromer antigen to
be deciphered at the molecular level, and the Dr(a-) phenotype is caused by a single amino acid substitution, Ser'65
Leu, in
The C f and Tc" antigens are the two highincidence Cromer antigens to which alloantibodies are most
frequently identified, but they have not been previously characterized at the molecular level. Unlike the Dr(a-) phenotype, the Cr(a-) and Tc(a-) phenotypes have not been associated with weakened expression of other Cromer antigens.
The Cr(a-) phenotype was the first described and remains
the most common polymorphism in this blood group sysThe Cr(a-) phenotype occurs in less than 1 in 1,000
individuals, and in the United States, nearly all Cr(a-) individuals are African-Americans. Although rare, human antiC f has been associated with significantly accelerated destruction of transfused red blood cells (RBCs).' Its possible
role in hemolytic disease of the newborn is unclear; no case
of hemolytic disease of the newborn has been reported to
have been caused by anti-Cf', and one of the propositi included in this study delivered several children without complication. No antibody to the product of the Cr(a-) DAF
allele has been described.
The Tc(a-) phenotype is also rare. First recognized after
the identification of two women who made anti-Tc" after
pregnancy,6 the Tca antigen occurs in greater than 99% of
all populations studied. In African-Americans, absence of
Tc" is associated with expression of the Tcb allele, whereas
in whites, the Tc(a-) phenotype is associated with expression of Tc". The incidence of the Tcballele in African-Amencans is *5%.' Little documentation of the clinical significance of anti-Tc" exists; although in vitro these antibodies
give a positive mononuclear phagocyte assay,' hemolytic
transfusion reactions and hemolytic disease of the newborn
caused by anti-Tc" have not been described. Likewise, antiTcb and anti-Tc" are of unclear clinical importance.
Blood, Vol 84, No 9 (November l),
1994: pp 3205-3211
MATERIALS AND METHODS
Blood cells and sera. Blood from Cr(a-), Tc(a-b+) and normal
Cr(a+) Tc(a+) donors was collected using tripotassium EDTA as
anticoagulant. Erythrocytes (E) were then stored in acid citrate dextrose at 4°C for up to 1week and were washed inphosphate-buffered
saline (PBS, pH 7.4) before use.
Samples of whole blood collected from three unrelated Cr(a-)
donors were kindly contributed by John Judd (University of Michigan, Ann Arbor) and by Rebecca Bullock (American Red CrossCarolinas Region, Durham, NC). Samples from the Tc(a-b+) donor
were provided by M. Yacor and M. Reid (New York Blood Center,
New York, NY), and anti-Tc"was provided by John Moulds (Gamma
Biologicals, Houston, TX). Additional antisera and Cromer-variant
RBCs from the Duke University Immunohematology Laboratory (an
AABB-certified reference laboratory) were also used for confirmation of cell phenotype and antibody specificity. Cell typings and
antibody identification were performed using standard agglutination
testing.
The following murine monoclonal antibodies (MoAbs) were used:
M75 and M160 antimembrane cofactor protein (MCP)*; 1H4, 15B10,
BRIC 230, and 3.3-136 anti-DAF?." Polyclonal anti-DAF was also
used in some experiments?
DNA isolation and analysis. To isolate leukocyte DNA, samples
From the Department of Medicine, Division of Hematology/Oncology, Duke University Medical Center, Durham, NC; and the Departments of Pathology and Medicine, Division of Laboratory Medicine, Washington University, St Louis, MO.
Submitted February 28, 1994; accepted June 29, 1994.
Supported by Grants No. HW3572, HZ44042 (to M.J.T.), and
A115322 (to D.M.L) fromthe National Institutes of Health (NIH),
and a grant from the National Blood Foundation (to D.M.L.). M.J.T.
is the recipient of Research Career Development Award No.
HLO2233 lfrom NIH).
Address reprint requests to Marilyn J. Telen, MD, Box 3387, Duke
University Medical Center, Durham, NC 27710.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
"advettisement" in accordance with 18 U.S.C.section 1734 solely to
indicate this fact.
6 I994 by The American Society of Hematology.
0006-4971/94/8409-W.00/0
3205
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
TELEN ET AL
3206
Table 1. Oligonucleotide Primers Used for Amplification
of DAF Exons
Exon
SCRl
SCRZ
SCR3A
SCRBB
SCR4
SIT-A
SIT-B, Sn-C
Hydrophobic
Primer Pair*
T
(anneal)
5"CCTTCAGTTCTGCmTGTCTCCC
5"CTATCAATTACTAGTCACTCCAAAGG
5"GGGTTAlTAGGGTCCAGATAA
5"GAGTTCTAGCATGAATGAAGGMGGG
5"CAAACAGCClTATATCACTC 1,200
5'-AACAATCTCACmAAG
5"AGAlTGATGTACCAGGTGGC
1,200
5"GAGTACTCAGCCTCACAATCTGAG
5"GCATCTmGTTGGTAATGCTG
5"CAACCCACATATAGACCGAGGG
5'-ACAGAGCAAGCAATGGC
5"ATlTGGGGlTGTTFCATGAA
5"CAGTGACTAATGGTCTC
2,100
5"GGAATATGGATTGTATAT
5"CCl"TGGCCAACCCCAAATTAACTG
5'-ACATTCCTAACACATClT
Product
Size
(bp)
45°C
300
55°C
300
45°C
55°C
55°C
350
55°C
800
45°C
45°C
400
For eachprimer pair, the topprimer is in the coding direction, and the bottom
primer is inthe noncoding direction.
of anticoagulated whole blood were centrifuged and the buffy coat
aspirated into a second tube. After several washes in PBS, cells were
lysed in 10 mmollL TRIS-HCl (pH 8.0), 0.1 m o m EDTA, 0.5%
sodium dodecyl sulfate (SDS) with 100 p@mLproteinase K (overnight at 42") and extracted with phenol. DNA was then precipitated
from the aqueous phase with ethanol and stored in water.
Analysis of the coding exons of DAF was performed as previously
described,' using the primers listed in Table 1. Briefly, each exon was
amplified by polymerase chain reaction (PCR) using Taq polymerase
(Perkin Elmer-Cetus, Emeryville, CA). PCR reaction conditions
were as follows: denaturation at 94°C for 2 minutes followed by 35
cycles of denaturation at 94°C for 1 minute, annealing at the temperature indicated in Table 1 for 1 minute, and extension at 72°C for 1
minute for products 4300 bp and 3 minutes for products >SO0 bp.
The resultant product was subcloned into a plasmid vector (pUC19
or pBluescript KS+) and transformed into DHScu. Double-stranded
sequencing was performed using Sequenase (US Biochemical,
Cleveland, OH) according to manufacturer's recommendations, using either M13 universal primers or primers used during PCR amplification. In each case, at least two independent clones from each of
two separate PCR amplifications were sequenced to confirm any
variation from wild type.
Construction and expression of wild-type and variant DAF.
DAFMCP chimeric cDNA was made byPCR." The nucleotides
encoding the 5' untranslated region, signal peptide, and SCRl of
DAF were amplified from 1 ng of DAF cDNA plasmid," and the
fragment encoding SCR2 through the 3'-untranslated region of MCP
was amplified from MCP cDNA plasmid.13 These two fragments
were ligated together in reading-frame in the vector pBluescript KS+,
and the construct was confirmed by DNA ~equencing.'~
This DAF/
MCP chimera comprised amino acids -34 to +61 of DAF (numbered
such that amino acid + 1 is the amino terminus of the mature protein)
joined to amino acids 63 to 350 of MCP.
The DAFMCP chimeric cDNA was subcloned into the pBSRaEN
mammalian expression vector" and transfected into Chinese hamster
ovary (CHO) cells byuseof the reagent Lipofectamine (GIBCO,
Grand Island, NY). Specifically, 10 pg ofthe pBSRaEN vector
containing the DAFMCP chimeric cDNA was mixed with 70 pg
Lipofectamine in 3 mL Optimem (GIBCO) and then added to a
subconfluent 10-cm plate of CH0 cells. After 4 hours incubation at
37T, 10 mL of complete medium containing fetal calf serum was
added and the incubation continued. Approximately 24 hours later,
2-aminopurine (Sigma Chemical CO, St Louis, MO) was added to
a final concentration of 10 mmol/L to increase expression of the
transfected cDNA.'~After a further overnight incubation, the cells
were solubilized for Western blotting.
CH0 transfectant cell lines expressing a series of DAF deletion
mutants, from which individual DAF domains have been removed,
have been previously described? In addition, site-directed mutation
of wild-type DAF to duplicate the nucleotide polymorphism found
in the Cr(a-) donors' DNA was performed as previously described,'
and mutated DAF was then transfected into CH0 cells, also as
described. Cells transfected with vector only were used as a negative
control in various experiments.
Quantitation of DAF by radioimmunoassay. To ascertain the
level of expression of DAF by Cr(a-) and Tc(a-) RBCs, antibody
3.3-136 wasused, along with other previously described MoAbs
and P3 X 631Ag8 myeloma ascitic fluid as positive and negative
control^.^' Briefly, RBCs collected and stored as described above
were washed in PBS and resuspended at 4 X 10x/mL(as determined
by an ELT8 automated cell counter, Ortho Diagnostics, Raritan, NJ).
After cells were incubated with saturating amounts of antibody and
washed, saturating amounts of 1251-labeledF(ab')* sheep antibody to
mouse IgG (Amersham, Arlington Heights, E)were added to detect
binding of first antibody. Cell-bound and unbound label were separated by centrifugation through phthalate oils, and bound label was
counted in a gamma counter.
Western blor analysis. RBC ghosts were prepared, solubilized
under nonreducing conditions, and proteins separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose as previously described." Lysates of stably transfected cell
lines were made by adding 0.5 to 0.75 mL PBS, 1% Nonidet-P40
(Sigma), 0.2% phenylmethylsulfonyl fluoride (PMSF) to a 25-cm'
tissue-culture flask containing a 75% to 100% confluentcell growth,
previouslywashed several times withPBS. The lysate wasthen
transferred to a microcentrifuge tube, centrifuged to pellet unsolubilized nuclear material, and stored at -80°C. Lysates weremixed
with2x SDS gel loading buffer, andrun on similar gels. Immunoblotting with human antibodies was accomplished by first partially
purifying the antibody by adsorption and elution onto RBCs as described." Most immunoblots were developed using an alkaline phosphatase-anti-IgG conjugate and the BCIPNBT chromogenic subAlternatively, Western blots were
strate (Promega, Madison, W)."
developed using the ECL chemiluminescent system (Amersham).
Dot blot analysis. Ten-microliter lysate aliquots were applied to
nitrocellulose and allowed to bind for 2 hours at 22°C. The membrane was then washed in TRIS-buffered saline and 0.05% Tween
20 (TBST) and blocked in TBST and 10% milk powder for at
least 30 minutes at 22°C or overnight at 4°C. Membranes were then
incubated with dilutions of human anti-CP, human anti-Tc",or rabbit
anti-DAF sera made in TBST for at least 1 hour, washed in TBST,
and then incubated with theappropriate alkaline phosphatase-linked
anti-IgG. Detection of antibody binding was accomplished using a
chromogenic substrate as described above for Western blots.
RESULTS
Expression of DAF by Cr(a-) and Tc(a-b+) erythroa vacytes. When tested by erythrocyte agglutination with
riety of Cromerand anti-DAF antibodies, the Dr(a-)
and
Inab phenotypes demonstrate reduced or absent
DAF expression of DAF, respectively. This is confirmed by radioimmun~assay?,~
The Cr(a-) and Tc(a-) phenotypes exhibit normal erythrocyte agglutination when tested with other Cromer
blood group antibodies. We used radioimmunoassayquanto
titate DAF expression on these cells. Erythrocytes from two
Cr(a-) donorsandone
Tc(a-b+) donorweretestedby
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
CPANDTc"
EPITOPES OFDAF
3207
radioimmunoassay using MoAb 3.3-136, as well as other
MoAbs. Binding of MoAb 3.3-136 to Cr(a-) and Tc(a-b+)
E was not different from that of Cr(a+)Tc(a+) control cells
(Table 2). In some experiments, other anti-DAF MoAbs reacted more strongly with Tc(a-b+) RBCs than with normal
RBCs (data not shown). Thus, this limited sample suggests
that there is no significant decrease in DAF expression in
the Cr(a-) and Tc(a-b+) phenotypes, unlike that seen in
Dr(a-) individuals.'
Analysis of Cr(a-) and Tc(a-b+) RBCs by Western blotting (Fig I ) also showed thatthe migration of DAF expressed
by Cr(a-) and Tc(a-b+) RBCs was comparable with wildtype DAF in SDS-PAGE, confirming that there was likely
to be only a minor alteration of the DAF molecule in the
Cr(a-) and Tc(a-b+) phenotypes.
Mapping ofthe CY epifope. To map the location of the
Cr' epitope on the DAF molecule, human anti-Cr' was tested
for reactivity with C H 0 transfectants expressing various deleted forms of DAF. In both dot blots (Fig 2) and Western
blots (data not shown), anti-Cl" reacted with all transfectants
except those missing the DNA encoding SCR4 and those
expressing vector DNA only.
We then analyzed all exons encoding SCRs 1 through 4
using genomic DNA from one Cr(a-) individual. In the
initial studies of the five exons encoding SCR domains, a
single point mutation was found. This mutation was a G +
C change in the 15th nucleotide of the exon encoding SCR4
(Fig 3); this change encodes an Ala'y3 + Pro substitution.
Analysis of this exon in the DNA from two other Cr(a-)
donors also showed this single point mutation. No other
polymorphisms were identified in the DAF gene of any of
the Cr(a-) donors.
To confirm the molecular basis of the Cr(a-) phenotype,
we created a DAF mutant cDNA with this single nucleotide
substitution and expressed it in C H 0 cells. When anti-Cr'
from several donors was tested against this Cr(a-)-type allele-specific transfectant and a previously reported Dr(a-)
allele-specific tranfectant in dot blots (Fig 4) and Western
blots (data not shown), anticl" failed to react withthe
Cr(a-) allele-specific transfectant, whereas other anti-DAF
antibodies reacted strongly with the Cr(a-) transfectant (data
Table 2. Expression of DAF by Cr(a-) and Tc(a-b+) RBCs
Phenotype
Experiment no 1
Cr(a-) 1
Cr(a-) 2
Cr(a+) l
Cr(a+) 2
Cr(a+ ) 3
Cr(a+) 4
Experiment no 2
Tc(a-b+)
Tc(a+) 1
Tc(a+) 2
Tc(a+) 3
Tc(a+) 4
Tc(a+) 5
Specific Cpm Bound Using MoAb
3.3-136 Anti-DAF
2,514
2,175
2,022
2,451
3,008
2,364
A
kD
antid
NHS
anti-DAF
NHS
antiDAF
46 69
30
-
2 1 -4NI
Clfa-)
lnab
antiTca
B
kD
97
69
-
30
-
Fig 1. Western blot analysis of Crla-1 and Tcla-b+) erythrocyte
membranes. The antibody used t o identify immunoreactive protein
is indicatedabove each panel, while theRBC phenotype ofcells used
t o prepare membrane proteins is shown beloweach lane. In A, neither Cda-) nor lnab ICromer-null) erythrocyte membrane proteins
contained DAF reactive with human anti-Cr'. Normal human serum
(NHS) was nonreactive with human erythrocytemembrane proteins.
However, monoclonal anti-DAF reacted with normal (NI) Cr(a+) as
well as Crla-) 70-kD DAF and showed that both are equally well
expressed and migrate similarly in SDS-PAGE. Similarly, in B, antiTc" failed t o react with Tcla-) erythrocyte membrane proteins, but
identified DAF in normal membranes; however, monoclonal anti-DAF
reacted strongly with normalTc(a+) as well as Tc(a-b+) DAF, both
of which show similarapparent molecular weights of 70 kD.
not shown). Thus, these results confirm that the single G
C mutation in the exon encoding SCR4 was responsible for
the Cr(a-) phenotype.
Mapping o f f h e Tc" epifope. Two examples of anti-Tc"
were similarly tested by dot blot and Western blot
for reactivity with transfected C H 0 cell lysates containing wild-type
DAF or DAF deletion mutants. However, both antisera failed
+
4,221
4.876
5,019
4.742
4.278
4,646
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
TELEN ET AL
3208
Cr
DAP
V00
-ticr.
-3
(a-)
(a-)
-4
DI
RBC
antiera
Fig 2. Dot blot of transfectants expressing deletion mutant DAF
cDNAs. RBCs of CH0cells transfected with vector only (Vec), normal
DAF EDNA (DAF), or DAF cDNA constructs containing deletions of
individual SCRs (-1, -2, etc) or the serinelthreonine-rich region (-SIT)
were used t o prepare detergent extracts were then testedreactivfor
ity with human anti-Cr'. Anti-Cr' reacted with all extracts except
those containing CH0 cells transfected with vector only or with a
construct lacking thesequence encoding SCR4, suggesting that the
C? epitope is containedin SCR4.
to react with DAF proteins missing SCRl (data not shown).
Thus. we proceeded to PCR amplify, subclone, and sequence
the exon encoding SCR I . This work led to identification of
:I single point mutation in the exon encoding SCRI; a single
G -t T change at position 55 in the exon encoding SCRl
leads to an ArgIX Leu substitution (Fig 5). In addition,
this mutation leads to creation of a new restriction enzyme
recognition site for Stu I (AGGCCT).
To confirm that the single nucleotide change identified in
SCRl of DAF of the Tc(a-b+) phenotype corresponds to
the TcVTc" epitope, we constructed a chimera that contains
-+
mom1
T
Q
C
Cr(a-)
A
T
Q
C
~
Fig 4. Reactivity of anti-Cr' with allele-specific transfectants. Human antiCr' was reacted with detergent extracts ofRBCs and CH0
cells transfected with vector only (Vec), normal DAF cDNA (DAF),
cDNA constructs from whichsequence encoding SCR3 or SCR4 had
been deleted (-3,
-41, or cDNA constructs containing the
G -C change
in SCR4 found in Cr(a-) individuals or the C
T polymorphism of
SCR3 found in Dr(a-) individuals. Anti-Cr' reacted with all cells expressing DAF or DAF variants except those either missing SCR4 or
containing theG C mutation in SCR4 found in Cr(a- j individuals.
-
-
only DAF SCR 1 appended to a different membrane protein.
The specific construct consisted of MCP lacking only the
amino-terminal SCRl domain, whichwas replaced by the
SCRl domain of DAF. This chimeric protein was transiently
expressed in C H 0 cells, and lysates were analyzed by SDSPAGE and Western blot. To confirm that this protein was a
DAFIMCP chimera, the Western blot was probedwith
MoAbs to MCP and D A F as expected, the chimeric protein
reacted with antibodies to MCP and to DAF SCRI, but not
to DAF SCR3 (Fig 6, lanes 1 through 3). Probing of the
chimeric protein blot with a human anti-Tc" eluate or a control normal human serum eluate showed that the chimeric
protein contains the Tc" epitope (Fig 6, lanes 4 and 5 ) . thus
confirming that this epitope is located in SCRl of DAF.
Tc(a+)
ATGC
/H
i\
C
A
T
T
T
T
T
T
G
T
T
ns
C
A
C
C
:/
"
A
A
E\
A
;-". m
I
Fig 3. Nucleotide polymorphism of Cr(a-) DAF gene. Partial sequence analysis of DAF SCR4 from a normal Cr(a+) and a Cr(a-)
individual is shown. Sequence analysis of SCR4 in three unrelated
Cr(a-) propositi showed
a single nucleotideG +C base-pair substitution. This mutation leads t o a proline-for-alanine substitution.
Tc(a-)
ATGC
G
A
A
A
A
C
C
A
T
T*
C
C
G
G
A
T
G
C
C
G
G
A
A
A
A
G
G
G
G
Fig 5. Partial sequence of SCRl of Tc(a-b+l individual. Partial
sequences of SCRl from a normal Tc(a+) individual and a Tc(a-b+)
individual are shown, showing a single point mutation comprising
a
G
T substitution (T*) in the exon encoding SCR1. This mutation
leads t o an arg leu substitutionin the mature protein.
-
-
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
CP AND Tc" EPITOPES
OF
3209
DAF
105-
I
2
3
4
5
Fig 6. Western blot ofDAF/MCP chimeric protein. A chimeric protein consistingof SCRl of DAF appended t o MCP (see Materials and
Methods for details of construct) was expressed transiently in CH0
cells. A cell lysate was separated by SDS-PAGE and transferred t o
nitrocellulose. Lanes containing identicallysates of transfected CH0
cells were probedwith theantibodies indicatedabove each lane and
developed with a chemiluminescence technique. Antibodies: lane 1,
mixture of M75and M160 murine monoclonalanti-MCP; lane 2, mixture of 15810 and BRIC230 murine monoclonalanti-DAF (specific for
SCRl); lane 3, 1H4 murine monoclonal anti-DAF (specific for SCRB);
lane 4, human anti-Tc' (eluted from antigen-positive RBCsl; lane 5,
normal humanserum, similarly eluted. Human anti-Tc" was reactive
with the chimeric protein containing only the first SCR of DAF and
was not reactive withMCP (data not shown).
DISCUSSION
The C? and Tc" antigens, like other Cromer antigens,
reside on DAF, a glycosyl-phosphatidylinositol-linked complement regulatory protein.' DAF (Fig 7) contains four consensus repeat regions at its N-terminus.I2Each SCR domain
contains two internal disulfide bonds that presumably influence the conformation of the molecule. Between these repeat
domains and the anchor lies a serine/threonine-rich domain
that is highly 0-glycosylated.
This study has identified the genetic and biochemical basis
for the Cr(a-) and Tc(a-b+) phenotypes, in which an altered form of DAF is expressed. Unlike the Dr(a-) phenotype, in which expression ofan altered DAF molecule is
associated with reduced DAF expression, the mutations responsible for the Cr(a-) and Tc(a-b+) phenotypes appear
to produce no diminution of membrane surface DAF. Nevertheless, in each case, the molecule is sufficiently altered that
Cr(a-) and Tc(a-b+) individuals produce antibody to the
wild-type DAF molecule when exposed via transfusions or
fetal/maternal hemorrhage.
All antibodies in the Cromer system have similar characteristics in that they fail to react with RBCs pretreated with
reducing reagents or with chymotrypsin, whereas all antibodies react with trypsin-treated cells.' The localization of the
C? and Tc" epitopes to SCR domains (Fig 7) is consistent
with existence of disulfide bonds in these regions and the
known trypsin insensitivity of DAF function, which resides
in SCRs 2 through 4.' Although the mutation responsible for
the Cr(a-) phenotype is close to the SCR3-SCR4 junction, it
is clear from the deletion mutation studies that only SCR4
is necessary for expression of the C? antigen.
The combination of a consistent single base-pair substitution in three unrelated Cr(a-) individuals, along with evidence that DNA with a similar mutation produced by sitedirected mutagenesis encodes Cr(a-) DAF in transfected
cells, provides a firm identification of the genetic and biochemical basis of this phenotype.
Our studies using a single example of the Tc(a-b+) phenotype indicate that the Tc" epitope resides within SCRI.
This conclusion is most firmly supported by results with the
DAFNCP chimeric protein, which expressed only the SCRl
domain of DAF and likewise expressed the Tc" antigen. Lack
of reactivity of two anti-Tc' sera onlywith transfectants
expressing DAF cDNA fromwhich SCRI-encoding sequence had been deleted also supports this conclusion. The
SCRl location of Tc" is likewise supported by the finding
of a single pointmutation in thatregion in an individual
with the Tc(a-b+) phenotype. However, the unavailability
DAF (Cromer)
r
Consensus
Repeats
I 0
-
Dr(a-): Serls5
l ?
Cr(a-): Ala193-
0-Glycosylation
Region
Leu
Pro
CHO-O- -0-CH0
CHO-O- -0-CH0
-0-CH0
-0-CH0
r
I
L
Fig 7. Mutations responsible for rare Cromer blood group phenotypes are shown. The DAF protein contains four SCRs, a heavily 0glycosylated region, and a glycosyl-phosphatidylinositol anchor. All
the mutations thus far found
to be thebases of rare Cromer blood
group phenotypesoccur in the SCRs.
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
3210
TELEN ET AL
of other individuals with this phenotype has not allowed
confirmation of a similar mutation in unrelated Tc(a-b+)
individuals.
Thus far, the D f , Tc&, and Cr" epitopes reside in the SCR
domains of DAF, and variant phenotypes all result from
a single base-pair substitution (Fig 7). A single base-pair
substitution that creates a stop codon in SCRl has been
found in the original propositus of the Inab Cromer-null
phenotype.lgWhen blood-group antigen polymorphisms are
reviewed overall, it is clear that several, but byno means
all of them, arise from single amino acid substitutions in the
parent peptide. However, veryfew molecules other than
DAF have been studied in this detail. The M and N antigens
of glycophorin A correspond to paired polymorphisms of
amino acids l and 5 (sed and gly', M; leu' and gIu5, N).*'
However, recent work suggests that individual antisera may
be relatively more dependent on the presence of a single
amino acid and may require presence of neighboring oligosaccharides as we11.z',22However, the S and S antigens of
glycophorin B result from a single amino acid substitution
(metz9v th?')?' and the rare Webb phenotype of glycophorin
C also results from a point mutation, although the resultant
single amino acid substitution results in loss of an N-linked
oligosa~charide.~~-*~
Nevertheless, it is clear that the immune
system is capable of extremely fine discrimination. In the
cases of the Cr(a-) and Tc(a-b+) phenotypes, no change
in N-linked or 0-linked glycosylation would be anticipated
from the amino acid substitutions found.
Identification of unusual antibodies such as anti-Cr"or
anti-Tc" have traditionally relied on the availability of appropriate nonreactive, phenotypically characterized RBCs as reagents. However, many hospital-based blood banks and
transfusion services do not have such rare reagents available.
Thus, patients with such antibodies may face considerable
delay before transfusion, evenwhen the rare blood type
would be available for transfusion (usually from a centralized depository of phenotypically rare blood). Thus, one
advantage of identifying the molecular basis for blood-group
antigens is the prospect of using genetically engineered reagents to identify antibodies with unusual specificities."
Nonhuman cells expressing recombinant blood-group antigen-bearing proteins could also be useful in complex cases
where many alloantibodies are present; in such cases, expression of limited numbers of antigens would be helpful in
determining the individual antigen specificities present. In
the case of the Cromer blood group, testing of an alloantiserum versus the C H 0 transfectant expressing human DAF
would give anunequivocal answer to whether any antibodies
to high-frequency Cromer antigens are present, regardless
of the presence of additional antibodies such as Rh. The
ability to use both allele-specific transfectants and transfectants containing cDNA with deleted domains or chimeric
cDNA constructs in assays using human blood group antisera
and solubilized cell preparations bodes well for efforts to
create non-RBC-dependent methods of analyzing bloodgroup antisera.
ACKNOWLEDGMENT
The authors gratefully acknowledge the technical assistance of
Nicole Anderson and Julie Lapp.
REFERENCES
l. Storry JR: Serology and genetics of the Cromer blood group
system, in Moulds JM, Laird-Fryer B (eds): Blood Groups: Chido/
Rodgers, KnopslMcCoyNork and Cromer. Bethesda, MD, American Association of Blood Banks, 1992, p 31
2. Telen MJ, Hall SE, Green AM, Moulds JJ, Rosse WF: Identification of human blood group antigens on decay-accelerating factor
(DAF) and an erythrocyte phenotype negative for DAF. J Exp Med
167:1993, 1987
3. Lublin DM, Thompson ES, Green AM, Levene C, Telen MJ:
Dr(a-) polymorphism of decay accelerating factor: Biochemical,
functional and molecular characterization and production of allelespecific transfectants. J Clin Invest 87:1945. 1991
4. McCormick EE, Francis BJ, Gelb AB: A new antibody apparently defining an allele of Go": 18th Annual Meeting Program, American Association of Blood Banks, Chicago, IL, 1965, p 59
5. Stroup M, McCreary J: CP, another high frequency blood
group factor. Transfusion 15:522, 1975 (abstr)
6. Laird-Fryer B, Dukes C, Walker EM Jr, Glassman A, Moulds
JJ: Tc": A new high incidence blood group factor. Transfusion
20:631, 1980 (abstr)
7. Lacey PA, Block UT, Laird-Fryer BJ, Moulds JJ, Bryant LR,
Giandelone JA, Linnemeyer DR: Anti-Tcb, an antibody that defines
a red cell antigen antithetical to Tc". Transfusion 25:373, 1985
8. Seya T, Hara T, Matsumoto M, Akedo H: Quantitative analysis
of membrane cofactor protein (MCP) of complement. High expression of MCP of human leukemia cell lines, which is regulated during
cell differentiation. J Immunol 145:238, 1990
9. Coyne KE, Hall SE, Thompson ES, Arce MA, Kinoshita T,
Fujita T, Anstee DA, Rosse WF, Lublin DM: Mapping of epitopes,
glycosylation sites, and complement regulatory domains in human
decay accelerating factor. J Immunol 149:2906, 1992
10. Bobolis KA, Moulds JJ, Telen MJ: Isolation of the JMH
antigen on a novel phosphatidylinositol-linked humanmembrane
protein. Blood 79:1574, 1992
1 1. Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higushi R, Horn
GT, Mullis KB, Erlich HA: Primer-directed enzymatic amplification
ofDNAwith a thermostable DNA polymerase. Science 239:487,
1988
12.Medof ME, Lublin DM, Holers VM, Ayers DJ, Getty RR,
Leykam JF, Atkinson JP, Tykocinski ML: Cloning and characterization ofcDNAs encoding the complete sequence of decay accelerating
factor of human complement. h o c NatlAcadSci USA 84:2007.
1987
13. Lublin DM, Liszewski MK, Post TW, Arce MA, Le Beau
MM, Rebentisch MB, Lemons RS, Seya T, Atkinson JP: Molecular
cloning and chromosomal localization of human membrane cofactor
potein (MCP). Evidence for inclusion in the multigene family of
complement-regulatory proteins. J Exp Med 168:181, 1988
14. Tabor S, Richardson CC: DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc Natl Acad Sci USA
844767, 1987
15. Shenoy-Scaria AM, Kwong J, Fujita T, Olszowy MW, Shaw
AS, Lublin DM: Signal transduction through decay-accelerating factor. Interaction of glycosyl-phosphatidylinositol anchor and protein
tyrosine kinases ~ 5 6 ' 'and
~ ~69"".J Immunol 149:3535, 1992
16. Kaufman RJ, Muflha P: Translational control mediated by
eucaryotic initiation factor-2 is restricted to specific mRNAs i n
transfected cells. Molecular Cell Biology 7:1568, 1987
17. Chow FL, Telen MJ, Rosse WF: The acetylcholinesterase
defect in paroxysmal nocturnal hemoglobinuria: Evidence that the
enzyme is absent from the cell membrane. Blood 66:940, 1985
From www.bloodjournal.org by guest on November 7, 2014. For personal use only.
Cr" AND Tc" EPITOPES OF DAF
18. Telen MJ, Paker TJ, Haynes B F Human erythrocyte antigens
11. The In(Lu) gene regulates expression of an antigen on an 80kilodalton protein of human erythrocytes. Blood 64599, 1984
19. Lublin DM, Mallinson G, Poole J, Reid M E , Thompson ES,
Ferdman BR, Telen MJ, Anstee DJ, and Tanner MJA. Molecular
basis of reduced or absent expression of decay accelerating factor
in Cromer blood group phenotypes. Blood 84:1276, 1994
20. Dahr W, Uhlenbruck G, Janssen E, Allen FW: Different Nterminal amino acids in the M,N glycoprotein from MM and NN
erythrocytes. Hum Genet 35:335, 1977
21. Blackall DP, Ugorski M, Pahlsson P, Spitalnik SL: Determination of the fine specificity of antigen-antibody interactions using
mutants of recombinant glycophorin A. Transfusion 32:24S, 1992
(abstr, suppl)
22. Judd WJ, Issitt PD, Pavone BG, Anderson J, Aminoff D:
Antibodies that define NANA-independent MN-system antigens.
Transfusion 19:12, 1979
23. Dahr W, Beyreuther K, Steinbach H, Gielen W, Kruger J:
321 1
Structure of the Ss blood group antigens. 11. A methionine/threonine
polymorphism within the N-terminal sequence of Ss glycoprotein.
Hoppe Seyler Z Physiol Chem 3612395, 1980
24. Reid ME, Shaw MA, Rowe G, Anstee DJ, Tanner MJA:
Abnormal minor human erythrocyte membrane sialoglycoprotein p
in association with the rare blood-group antigen Webb (Wb). Biochem J 232:289, 1985
25. Telen MJ, Le Van Kim C, Guizzo ML, Cartron J-P, Colin
Y: Erythrocyte Webb-type glycophorin C variant lacks N-glycosylation due to an asparagine to serine substitution. Am J Hemato1375 1,
1991
26. Chang S, Meid ME, Conboy J, Kan W, Mohandas N: Molecular characterization of erythrocyte glycophorin C variants. Blood
77:644, 1991
27. Telen MJ: New and evolving techniques for antigen and antibody identification, in Nance ST, (ed): Alloimmunity: 1993 and
Beyond. Bethesda, MD, American Association of Blood Banks,
1993, p 117