Mice containing the jellyfish gene for green fluorescent protein (GFP) Figure 19.1
Mice containing the jellyfish gene for green fluorescent protein (GFP) Figure 19.1 DNA isolation, PCR, agarose and polyacrylamide gel electrophoresis and sequencing Molecular Techniques in vivo : (La&n: within the living) whole living organism ex vivo : (La&n: out of the living) means that which takes place outside an organism in vitro : (La&n: in glass) cells or biological molecules studied outside their normal biological context, "test tube experiments" in situ : "on site” or "in posi&on”. It means "locally", "on site", "on the premises" or "in place" to describe an event where it takes place, and is used in many different contexts. in silico : performed on computer or via computer simula&on RNA TAC C GTTAGTTCAC GATT A U G G C AA U C AA G U G C U AA AT G G C AAT C AA G T G C TAA START STOP GTTTATTGCATTCTTCTGTGAAAAGAAGCTGTTCACAGAATGATTCTGAAGAACCAACTT TGTCCTTAACTAGCTCTTTTGGGACAATTCTGAGGAAATGTTCTAGAAATGAAACATGTT CTAATAATACAGTAATCTCTCAGGATCTTGATTATAAAGAAGCAAAATGTAATAAGGAAA AACTACAGTTATTTATTACCCCAGAAGCTGATTCTCTGTCATGCCTGCAGGAAGGACAGT GTGAAAATGATCCAAAAAGCAAAAAAGTTTCAGATATAAAAGAAGAGGTCTTGGCTGCAG CATGTCACCCAGTACAACATTCAAAAGTGGAATACAGTGATACTGACTTTCAATCCCAGA AAAGTCTTTTATATGATCATGAAAATGCCAGCACTCTTATTTTAACTCCTACTTCCAAGG ATGTTCTGTCAAACCTAGTCATGATTTCTAGAGGCAAAGAATCATACAAAATGTCAGACA AGCTCAAAGGTAACAATTATGAATCTGATGTTGAATTAACCAAAAATATTCCCATGGAAA AGAATCAAGATGTATGTGCTTTAAATGAAAATTATAAAAACGTTGAGCTGTTGCCACCTG AAAAATACATGAGAGTAGCATCACCTTCAAGAAAGGTACAATTCAACCAAAACACAAATC TAAGAGTAATCCAAAAAAATCAAGAAGAAACTACTTCAATTTCAAAAATAACTGTCAATC CAGACTCTGAAGAACTTTTCTCAGACAATGAGAATAATTTTGTCTTCCAAGTAGCTAATG AAAGGAATAATCTTGCTTTAGGAAATACTAAGGAACTTCATGAAACAGACTTGACTTGTG TAAACGAACCCATTTTCAAGAACTCTACCATGGTTTTATATGGAGACACAGGTGATAAAC AAGCAACCCAAGTGTCAATTAAAAAAGATTTGGTTTATGTTCTTGCAGAGGAGAACAAAA ATAGTGTAAAGCAGCATATAAAAATGACTCTAGGTCAAGATTTAAAATCGGACATCTCCT TGAATATAGATAAAATACCAGAAAAAAATAATGATTACATGAACAAATGGGCAGGACTCT TAGGTCCAATTTCAAATCACAGTTTTGGAGGTAGCTTCAGAACAGCTTCAAATAAGGAAA TCAAGCTCTCTGAACATAACATTAAGAAGAGCAAAATGTTCTTCAAAGATATTGAAGAAC AATATCCTACTAGTTTAGCTTGTGTTGAAATTGTAAATACCTTGGCATTAGATAATCAAA AGAAACTGAGCAAGCCTCAGTCAATTAATACTGTATCTGCACATTTACAGAGTAGTGTAG TTGTTTCTGATTGTAAAAATAGTCATATAACCCCTCAGATGTTATTTTCCAAGCAGGATT TTAATTCAAACCATAATTTAACACCTAGCCAAAAGGCAGAAATTACAGAACTTTCTACTA TATTAGAAGAATCAGGAAGTCAGTTTGAATTTACTCAGTTTAGAAAACCAAGCTACATAT TGCAGAAGAGTACATTTGAAGTGCCTGAAAACCAGATGACTATCTTAAAGACCACTTCTG AGGAATGCAGAGATGCTGATCTTCATGTCATAATGAATGCCCCATCGATTGGTCAGGTAG ACAGCAGCAAGCAATTTGAAGGTACAGTTGAAATTAAACGGAAGTTTGCTGGCCTGTTGA AAAATGACTGTAACAAAAGTGCTTCTGGTTATTTAACAGATGAAAATGAAGTGGGGTTTA GGGGCTTTTATTCTGCTCATGGCACAAAACTGAATGTTTCTACTGAAGCTCTGCAAAAAG CTGTGAAACTGTTTAGTGATATTGAGAATATTAGTGAGGAAACTTCTGCAGAGGTACATC CAATAAGTTTATCTTCAAGTAAATGTCATGATTCTGTTGTTTCAATGTTTAAGATAGAAA ATCATAATGATAAAACTGTAAGTGAAAAAAATAATAAATGCCAACTGATATTACAAAATA ATATTGAAATGACTACTGGCACTTTTGTTGAAGAAATTACTGAAAATTACAAGAGAAATA CTGAAAATGAAGATAACAAATATACTGCTGCCAGTAGAAATTCTCATAACTTAGAATTTG ATGGCAGTGATTCAAGTAAAAATGATACTGTTTGTATTCATAAAGATGAAACGGACTTGC TATTTACTGATCAGCACAACATATGTCTTAAATTATCTGGCCAGTTTATGAAGGAGGGAA ACACTCAGATTAAAGAAGATTTGTCAGATTTAACTTTTTTGGAAGTTGCGAAAGCTCAAG 1 ISOLATION OF DNA DNA Isolation - Various sources - Cells - Tissue - Organ - Leaf - Various methods - For prokaryotic cells - For plants - For bacteria - For yeast High Molecular Weight Genomic DNA Isolation Typical Procedure 1 Cell Lysis – 0.5% SDS + proteinase K (55oC several hours) 2 Phenol ExtracIon – gentle rocking several hours Phenol Extraction • mix sample with equal volume of sat. phenol soln • retain aqueous phase • optional chloroform/isoamyl alcohol extraction(s) ← aqueous phase (nucleic acids) ← phenolic phase (proteins) ORGANIC PHASE SEPARATION High MW Genomic DNA Isolation Typical Procedure 1 Cell Lysis EtOH Precipitation • 2-2.5 volumes EtOH, -20oC – 0.5% SDS + proteinase K (55oC • high salt, pH 5-5.5 several hours) • centrifuge or ‘spool’ out 2 Phenol ExtracIon – gentle rocking several hours 3 Ethanol/ salt PrecipitaIon 4 RNAse followed by proteinase K 5 Repeat Phenol ExtracIon and EtOH ppt PLASMID DNA Natural Bacterial Transforma&on/ conjuga&on S. Pneumoniae ‘transforming’ DNA is a plasmid Also possible to experimentally ‘transform’ plasmid vectors into bacteria -‐ see later PLASMID DNA ISOLATION Alkaline lysis denaturaIon/ renaturaIon protocol Bacteria lysed in SDS + strong NaOH buffer Protein denatura&on (SDS) Single stranded plasmid DNA Single stranded genomic DNA DENATURATION Aqueous (double stranded plasmid DNA) Centrifuga&on Potassium acetate Small mul&-‐copy plasmid DNA quickly re-‐anneals in solu&on SEDIMENTATION Pellet (proteins and genomic DNA) Large single copy genomic DNA fails to re-‐anneal and forms precipitate with proteins pH NEUTRALISATION PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) 1. Phenol/ CHCl3 extrac&on & Ethanol/ Salt precipita&on or 2. Solid phase/ silica extrac&on ‘miniprep’ Pellet (proteins and genomic DNA) In presence of alkaline chaotropic salts, denatured plasmid DNA binds to silica beads in the column Wash buffers used to remove impuri&es & DNA eluted (and re-‐natured in H2O) Centrifuga&on steps Quick relaIvely pure double stranded plasmid DNA PLASMID DNA ISOLATION Aqueous (double stranded plasmid DNA) or 3. Anion exchange column-‐based chromatography Pellet (proteins and genomic DNA) Altering the pH and ionic condi&ons removes impuri&es leading to high [salt] elu&on and EtOH or isopropanol precipita&on Extremley pure double stranded plasmid DNA Isolation of RNA Special Considerations Guanidinium thiocyanate • RNAse inhibitors! • extraction in guanidine salts • phenol extractions at pH 5-6 • (pH 8 for DNA) • selective precipitation of high MW forms (rRNA, mRNA) with LiCl • oligo-dT column for mRNA’s • treatment with RNase-free DNase Using UV spectroscopy to analyze DNA/ RNA Absorbance • Nucleic acids absorbs UV light with a major peak at 260nm (λmax) 260 Beer-‐Lambert equaIon A = εcl Wave Length (λ) • Absorbance exIncIon coefficients (ε) vary depending on the nucleic acid structure A260 Isolated nucleo&des ss RNA/ DNA ε = 25 ds DNA ε = 20 • A260 / A280 raIo indicates sample purity • DetecIon Pure RNA = 2.0 • QuanItaIon Pure DNA = 1.8 • Assessment of purity Amplifying DNA Polymerase chain reaction (PCR) - Works on DNA molecules outside of cells - Replicates sequence millions of times Recombinant DNA technology - Amplifies DNA within cells often using sequences from other organisms PCR Consists of a repetition of three basic steps: 1. Denaturation: Heat is used to separate the two strands of target DNA 2. Annealing: Two short DNA primers bind to the DNA at a lower temperature 3. Extension: The enzyme Taq1 DNA polymerase adds bases to the primers All this is done in a thermal cycler Copies of DNA accumulate exponentially Figure 8-45a Molecular Biology of the Cell (© Garland Science 2008) Figure 8-45b Molecular Biology of the Cell (© Garland Science 2008) Figure 8-46 Molecular Biology of the Cell (© Garland Science 2008) PCR Figure 19.2 Table 19.1! Polymerase Chain Reac&on (PCR) A mechanism to exponen&ally amplify a specific DNA fragment in a test tube, using the principles of specific DNA base-‐pairing and DNA replica&on and employing these in repeated cycles THERMAL CYCLING • DNA containing fragment to be amplified (e.g. genomic DNA or cDNA) • Two oligonucleo&de primers (ss) specific to DNA sequence of desired fragment* • Purified DNA polymerase (Klenow frag.) • deoxyribonucleo&de triphosphates (dNTPs) • Buffer solu&on (with required Mg2+ and K+ ca&ons) ~94oC -‐ Denatura&on step ~60oC -‐ Primer annealing step 37oC -‐ Extension step x25-‐35 REPEATED THERMAL CYCLING -‐ ini&ates new rounds of DNA replica&on that can use the products of the previous round as template, thus exponen&ally amplifying the target DNA fragment * The oligonucleo;de primer sequences must be complementary to DNA sequence flanking the fragment to be amplified and match with DNA sequence from the opposing strands of that fragment -‐ see next slide MOLECULAR BIOLOGY – PCR 5’ 3’ dsDNA FRAGMENT TO BE AMPLIFIED 3’ 5’ 5’ DENATURATION 94°C EXTENSION -‐ 37oC (Klenow) 3’ DNApol primer primer ANNEALING ~60oC DNApol 3’ 5’ DENATURATION 5’ 3’ DENATURATION 3’ 5’ DENATURATION With each repeated THERMAL CYCLE (denatura&on, annealing & extension) the amount of target dsDNA doubles PCR’s DNApol problem ! Primi&ve PCR machine (3 water baths) 94oC 60oC 37oC DNApol (Klenow fragment) is killed by the heat THERMAL CYCLING INITIAL DENATURATION DENATURATION e.g. x30 ANNEALING EXTENSION TERMINAL EXTENSION Expensive Klenow had to be added auer every thermal cycle ! Yellowstone Na&onal Park Thermal Springs Isola&on of thermophillic bacteria: Thermophillus aqua;cus (50-‐80oC) Has an extremly heat stable (t1/2 >40 mins at 95oC) DNA polymerase Taq polymerase ideally suited to PCR! The Klenow fragment is a large protein fragment produced when DNA polymerase I from E. coli is enzyma;cally cleaved by the protease sub;lisin. MOLECULAR BIOLOGY – PCR Thermostable DNA polymerases and PCR The isola&on of Taq polymerase permiwed the automa&on of PCR thermal cycling as fresh DNApol did not need to be added auer every cycle ! HOWEVER: Taq polymerase lacks a proofreading ac&vity (3‘-‐5‘ exonuclease) and high error rate DNA polymerase error rate (misincorporated nucleo&de) Klenow 1: 50 000 Taq polymerase 1: 9 000 Pfu polymerase 1: 1 300 000 ! ! ! Stratgene inc. isolated a DNA polmerase from the hyperthermophilic archae (primi&ve bacteria) Pyrococcus furiosus found in the marine sediment associated with ocean thermal vents Pfu polymerase is extremely heat stable (Pyrococcus furiosus op&mum growth temperature is 100oC) Crucially Pfu polymerase has proof-‐reading ac&vity and has the lowest error rate of any known thermostable polymerase Pfu polymerase is IDEALLY suited for PCR applica&ons where high fidelity amplifica&on of DNA is required (although more expensive than Taq polymerase) A typical PCR protocol Template DNA, sequence specific sense and an&sense oligonucleo&de primers, thermo-‐stable DNApol (e.g. Taq or Pfu), dNTPs & PCR buffer ‘Inven&on’ of PCR KARY B. MULLIS Journal of Molecular Biology Volume 56, Issue 2 , 14 March 1971, Pages 341-361 Studies on polynucleo&des XCVI. Repair replica&on of short synthe&c DNA's as catalyzed by DNA polymerases K. Kleppe‡, E. Ohtsuka§, R. Kleppe‡, I. Molineux|| and H. G. Khorana|| Ins&tute for Enzyme Research of the University of Wisconsin, Madison, Wisc. 53706, U.S.A. Received 20 July 1970. Cetus Corpora&on 1983 PCR discovery 1985 published, patent pending 1987 patented 1993 Nobel prize Dr. Kjell Kleppe H.G. Khorana Mullins would have been ‘aware’ of the work of Kleppe and Khorana. Although their method did not amplify DNA it is generally accepted their research was a ‘primer’ for PCRs discovery Experimental uses of PCR Introduc&on of specific and useful DNA sequences Sequence specific (i.e. complementary) DNA oligonucleo&de primer with non-‐complementary yet useful 3’ sequence PCR Incorpora&on of useful DNA sequence into PCR product EPITOPE TAG Genera&on of restric&on enzyme sites for cloning Addi&on of extra protein coding DNA sequence for a ‘tag’ that can be used experimentally to detect or purify a protein Experimental uses of PCR Introduc&on of specific muta&ons within recombinant DNA ‘directed mutagenesis’ Mutagenic primer T 5‘ TGCTGTGATGT GCTGATGCTGAATGC 3‘ 3‘ CGCACGACACTACATCGACTACGACTTACGACGCTACAAGTTCATGAC 5‘ R T T L H R L R L T T L Q V H D Q Protein coding DNA sequence (cDNA) Experimental uses of PCR Detec&ng SNPs by PCR GCTGTGATGTAGCTGATGCTGAATG 3’TCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAA’5 SNP-‐specific primer amplifica&on GCTGTGATGTAGCTGATGCTGAATGCTGCGATGTT 3’TCGATCGCACGACACTACATCGACTACGACTTACGACGCTACAA’5 SNP Detec&on of SNPs is important for: • diagnosing certain gene&c diseases arising from ‘point muta&on’ e.g. sickle cell anaemia (Hb gene E6V) • iden&fying linkage traits e.g. SNPs in the Apolipoprotein E are associated with increased risk of Alzheimer’s diseas Inverse PCR DNA digested with restric&on enzyme not cu~ng in known region A method to amplify a par&cular DNA region (e.g. containing a gene) with only par&al sequence informa&on N.B. relies on being able to cut DNA with ‘restric&on’ enzymes that only cut at specific DNA sequences -‐ see lecture 8 Generated compa&ble ends are ligated into a circle DNA re-‐linearised by diges&on with a restric&on enzyme recognising a site within the know sequence PREVIOUSLY UNKNOWN DNA SEQUENCE CAN BE DETERMINED BY SEQUENCING FROM KNOWN FLANKS Unknown DNA can know be PCR amplified using primers specific to the known sequence Unknown DNA can know be PCR amplified using primers specific to the known sequence at each end DNA SEQUENCE WILL REVEAL WHERE UNKNOWN FRAGMENTS WHERE ORIGINALLY LIGATED (i.e. LEFT AND RIGHT) MICROSATELLITE SEQUENCES Sequence repeats: (A)n (CA)n (CAG)n (CAGT)n Variable Number of Tandem Repeats (VNTR) a 5’ 3’ 3’ 5’ b 5’ 3’ 3’ 5’ AFLP – amplified fragment length polymorphism DNA fingerprin&ng Experimental uses of PCR Reverse Transcrip&on PCR (RTPCR) mRNA 5’ CCGAGTAGCTAGGAACTGATGAATGTCGATCGCACGACACTACATCGACTACGACTTAAGACGCTACAATCGATCGCACGACACTACATCGA CTACGACTTACGACGCTACAATTGAGGTCGATGA...CCCCATGAGGGTGTGACCCGACATGACATGACATTGAGGCACAAATCAATGTAGA AAAAAAAAAAAAAAAAAAAAAAAAA 3’ TTTTTTTTTTT Reverse transcrip&on cDNA 5’ TTTTTTTTTTTTTTTTTTTTTTTTTCTACATTGATTTGTGCCTCAATGTCATGTCATGTCGGGTCACACCCTCATGGGG. . . ! ! TCATCGACCTCAATTGTAGCGTCGTAAGTCGTAGTCGATGTAGTGTCGTGCGATCGATTGTAGCGTCTTAAGTCGTAGTCGATGTAGTGTCG! ! TGCGATCGACATTCATCAGTTCCTAGCTACTCGG!3’ Normal PCR Presence of DNA product reveals presence of mRNA in the original sample However, more quan&ta&ve rather than qualita&ve results maybe required Real-‐&me PCR (Quan&ta&ve PCR or Q-‐PCR) product General PCR kine&cs 1. 2. Plateau due to exhaus&on of reagents Measurements of abundance must be taken in the exponen&al phase of the PCR PCR cycles If the number of PCR cycles used were not in the exponen&al phase, one could mistake samples 1. and 2. of being of equal concentra&on Con&nuous measurement of product synthesis would be preferable i.e measurements in ‘real ;me’ DNA ISOLATION AMPLIFICATION 4 How to visualize DNA? GEL ELECTROPHORESIS NUCLEIC ACID HYBRIDIZATION size dis&nc&on sequence dis&nc&on GEL ELECTROPHORESIS fragmented DNA + -‐ -‐ -‐ agarose! D-galactose 3,6-anhydro L-galactose n Ethidium Bromide SYBR® Safe on blue light Genomic DNA on gel: 23 kb 9,5 kb Plasmid DNA on gel: NUCLEIC ACID HYBRIDIZATION labeled probe Fluorescence In Situ Hybridiza&on (FISH) Metaphase spread chromosomes on a slide Probe labeling by incorporaIon of modified (d)NTPs radioac&ve labeling AUTORADIOGRAPHY 32P Streptavidin Y BioIn-‐11-‐dUTP an&-‐DIG an&body (DIG) Fluorophores conjuga&on Enzymes alkaline phosphatase horseradish peroxidase chemiluminiscence DIG DIG DIG DIG DIG HRP Y Y Y Y Y substrate light HRP substrate light substrate DIG DIG DIG HRP light HRP substrate substrate DIG HRP light light DNA denatura&on Melting (denaturation) temperature depends on these major factors: - GC content (and therefore AT content) - sequence length - gaps in the annealed strands - salt concentration - pH - organic solvents (DMSO, formamide...) GC rich AT rich GC rich Temp Temp CHROMOSOME PAINTING – MULTI COLOR FISH Translocated chromsome segment Par&cularly useful when diagnosing chromsomal abnormali&es in certain forms of cancer (region specific barcoding on leu and whole chromsosome paints on right) DNA SEQUENCING (i.e. determining the order of the four possible deoxynucleo&des in one of the DNA strands and by inference the order on the other strand) DNA sequencing is the process of determining the precise order of nucleo&des within a DNA molecule. It includes any method or technology that is used to determine the order of the four bases—adenine, guanine, cytosine, and thymine—in a strand of DNA. The advent of rapid DNA sequencing methods has greatly accelerated biological and medical research and discovery. Dideoxynucleo&de trisphosphate chain terminator/ Sanger DNA sequencing DNA backbone comprises phosphodiester bonds between the 5’ and 3’ carbon atoms of the deoxyribose moie&es of consecu&ve deoxynucleo&des Addi&on of an addi&onal deoxynucleo&de to a growing DNA strand, during DNA synthesis, requires a free 3’-‐OH group However, incorpora&on of a chemically modified dideoxynucleo&de (ddNTP), lacking a 3’-‐OH group, would prevent addi&onal polymerisa&on and hence TERMINATE DNA synthesis Sanger realised such ‘chain termination’ could be exploited to reveal the sequence of a specific/ target DNA molecule, but how? Figure 8-50a Molecular Biology of the Cell (© Garland Science 2008) Dideoxynucleo&de trisphosphate chain terminator/ Sanger DNA sequencing DNApol ddGTP is radioac&vely labelled 5’-CTGGGATACTGTACTAGC-3’! 3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’! 5’-CTGGGATACTGTACTAGC! ACTTAACCTTTG! 3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’! 5’-CTGGGATACTGTACTAGC! ACTTAACCTTTGATCG! 3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’! dGTP ddGTP dTTP dATP dCTP ACTTAACCTTTGATCGATCTAG! 5’-CTGGGATACTGTACTAGC! 3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’! ACTTAACCTTTGATCGATCTAGCCG! 5’-CTGGGATACTGTACTAGC! 3’-GGACCCTATGACATGATCGATGAATTGGAAACTAGCTAGATCGGCACGAG-5’! Target DNA, oligonucleo&de primer & DNApol Genera&on of a series of differently sized fragments synthesised from the target DNA molecule that all end with radio-‐labelled dideoxy-‐G (specified by C in the target DNA) Repeat reac&on using the three other radio-‐labelled ddNTPS G A T dGTP dGTP dGTP dGTP dTTP dTTP dTTP dTTP ddGTP dATP dCTP Target DNA, oligonucleo&de primer & DNApol ddATP dATP dCTP Target DNA, oligonucleo&de primer & DNApol ddTTP dATP dCTP Target DNA, oligonucleo&de primer & DNApol C ddCTP dATP dCTP Target DNA, oligonucleo&de primer & DNApol Now have a complete popula&on of varying length DNA fragments (at one base-‐pair resolu&on), derived from target DNA, that end with one of four radio-‐labelled dideoxynucleo&des G A T C -‐ ACTTAACCTTTGATCGATCTAGCCG! ACTTAACCTTTGATCGATCTAGCC! ACTTAACCTTTGATCGATCTAGC! ACTTAACCTTTGATCGATCTAG! ACTTAACCTTTGATCGATCTA! + ACTTAACCTTTGATCGATCT! ACTTAACCTTTGATCGATC! ACTTAACCTTTGATCGAT! ACTTAACCTTTGATCGA! ACTTAACCTTTGATCG! ACTTAACCTTTGATC! ACTTAACCTTTGAT! Read off DNA sequence from bowom to top ACTTAACCTTTGA! ACTTAACCTTTG! (5’-‐3’ on newly synthesised strand). Reverse ACTTAACCTTT! complement for the other strand ACTTAACCTT! ACTTAACCT! ACTTAACC! ACTTAAC! ACTTAA! ACTTA! ACTT! ACT! AC! A! polyacrylamide DNA sequencing gel autoradiography film Figure 8-50b Molecular Biology of the Cell (© Garland Science 2008) Figure 8-50c Molecular Biology of the Cell (© Garland Science 2008) Figure 8-51 Molecular Biology of the Cell (© Garland Science 2008) Automa&on of the Sanger DNA sequencing method using fluorescently labelled ddNTPs Each ddNTP varient is conjugated to a specific fluorescent group (ddGTP, ddCTP, ddATP and ddTTP) allowing the 4 reac&ons to be pooled in one tube and the electrophoresed in the same lane The specific fluorescence signature of each band informs which nucleo&de is at that posi&on in the target DNA Process can be highly automated using ‘capillary tube electrophoresis’ coupled to automa&c fluorescence detectors (~1Kb max) Automa&c DNA sequence analyzers Principle of automated DNA sequencing detector capillary electrophore&c tubing 1990 Human Genome Project (HGP) Complete sequencing of the whole human genome within 15 years Whole Genome Shotgun DNA Sequencing Human genome (blood donors) Isola&on of genomic DNA Cloning of the genomic DNA fragments (i.e. to build a genomic DNA library; consis&ng of BACs -‐ 200Kb) Mapping BACs to known sequence markers (i.e. identify from what part of the genome does the BAC come from)? Whole Genome Shotgun DNA Sequencing Mapped BACs (i.e. in correct order on chromosome) Fragmenta&on of BAC clones and BAC sub-‐clone libraries (typically cloned into bacteriophage; ~2Kb) Sanger-‐based sequencing of the sub-‐clones (from either end) Sequence alignment of overlapping sequences from various subclones to recons&tute the en&re BAC DNA sequence Whole Genome Shotgun DNA Sequencing Repeated itera&ons of sub-‐clone sequencing (to give sequence depth i.e. confidence) and BAC recons&tu&on, for all the BACS covering the en&re genome. Publica&on of a drau sequence in 2000 and a complete sequence in 2003 ! Human genome rich in repe&&ve sequences: ??? AAAAAAAAAAAAAAAAAAAAAAAA GTCCTGCATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAGCTTGGCTCACATAGT J. Craig Venter Francis Collins President William J. Clinton Now many hundreds of different species’ genomes have been shotgun sequenced The poli&cs of sequencing the human genome !!! Founded as an interna&onal publicly funded consor&um effort to sequence all the bases of the human genome with 15 years at a cost of $3 billion Aimed to provide free and open access to all the data as a resource for research biologists During the 1990’s a number of groups had placed patents on genes that they had cloned, se~ng a commercial precedent/ incen&ve to whole genome sequencing Polyacrylamide gel electrophoresis (PAGE), describes a technique widely used in biochemistry, forensics, gene&cs, molecular biology and biotechnology to separate biological macromolecules, usually proteins or nucleic acids, according to their electrophore&c mobility. Mobility is a func&on of the length, conforma&on and charge of the molecule. Figure 8-18a Molecular Biology of the Cell (© Garland Science 2008) Figure 8-18b Molecular Biology of the Cell (© Garland Science 2008)
© Copyright 2025