Document 446543
MoBiTec GmbH Lotzestr. 22a 37083 Göttingen phone +49 551 707220 fax +49 551 7072222 http://www.mobitec.com Vector Information Sheet p427-TEF The plasmid p427-TEF is a yeast - E. coli shuttle vector that is used to express cDNAs from the strong TEF promoter. Xba I (676) TEF1 Spe I (682) BamH I (688) Xma I (694) EcoR I (706) EcoRV (714) HindIII (718) Sal I (733) Xho I (739) AmpR CYC1term p427TEF 6701bp HindIII (1734) HindIII (2279) 2micron KanMX Xba I (3781) Multiple cloning site Spe I BamH I Sma I EcoR I EcoR V Sal I Xho I tctagaactagtggatcccccgggctgcaggaattcgatatcaagcttatcgataccgtcgacctcgag Vector features TEFp CYC1t KAN TEF1 promoter (nt 272-675) S. cerevisiae CYC1 terminator (nt 739-1000) Kanamycine resistance gene (aminoglycoside phosphotransferase), allows selection in yeast using 200 mg/ml G418 (nt 12975-1972) 2micron Origin of replication derived from the endogenous yeast 2m circle. Allows propagation of plasmids in yeast at high copy numbers (10-50 copies/cell, nt 3172-4539) AmpR Ampicillin resistance gene (nt 4895-5755) The complete sequence of this vector can be downloaded from http://www.mobitec.com.
© Copyright 2024