1. No category

From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
Type I1 Interleukin-1 Receptor Is Not Expressed in Cultured Endothelial Cells
and Is Not Involved in Endothelial Cell Activation
By Francesco Colotta, Marina Sironi, Aldo BorrB, Teresa Pollicino, Sergio Bernasconi,
Diana Boraschi. and Albert0 Mantovani
Interleukin-1 (IL-1) profoundly affects a number of functions
of endothelial cells (EC). It was previously shown that EC
express the type I 80-Kd 11-1 receptor (IL-I RI). In this study
we define the expression and functional significance of the
type I I IL-1R (IL-1RII) in EC. Human umbilical vein EC did
not express appreciable levels of IL-I RI1 mRNA as assessed
by Northern analysis or reverse transcription and polymerase chain reaction. Exposureto various cytokines (including
IL-4, which augments IL-1 RI1 in neutrophils)failed to induce
IL-I RI1 mRNA. The binding of radiolabeled IL-18 to EC was
blocked by antitype I (M4) but not by antitype II (M22)
monoclonal antibodies (MoAbs). MoAbs directed against
the IL-1 R I ( M I and M4) inhibited the induction of IL-6 and
adhesion molecules in EC by IL-1, whereas an anti-IL-I RI1
(M22) was inactive. The human IL-I receptor antagonist
(IL-I ra) preferentially interacts witli IL-1 RI versus IL-1 RI1
in the mouse. IL-1 ra inhibited the response of mouse endothelial cells to IL-I . We conclude that EC selectively express the IL-1R I and that this is involved in the response of
this cell type to IL-I .
0 1993 by The American Society of Hematology.
I
medium (DMEM) and El99 medium (10X concentrated) were from
Biochrom KG, Berlin, Germany; penicillin and streptomycin for
clinical use (Farmitalia, Milan, Italy); aseptically collected fetal calf
serum (FCS) (Hyclone Lab, Logan, UT). All reagents contained less
than 0.125 endotoxin units (EU)/mL of endotoxin as checked by the
Limulus Amebocyte Lysate assay (Microbiological Associates,
Walkersville, MD).
Cells. Human EC were obtained from umbilical veins and cultured as described in detail in previous reports.” We used routinely
confluent cells at second to fifth passage maintained in El99 medium
with 20% FCS, supplemented with EC growth supplement (ECGS,
50 pg/mL; Collaborative Research Inc, Lexington, MA) and heparin
(100 pg/mL; Sigma Chemical CO, St Louis, MO). The mouse endothelioma cell line tEND.l was originally obtained through the
courtesy of Dr E.F. Wagner (IMP, Wien, Austria). The cells were
maintained in DMEM 10% FCS. The properties of this cell line,
including cytokine production and expression of adhesion molecules,
were recently described.26A human sarcoma cell line (838712) was
cultured in DMEM supplemented with 10%FCS. Human circulating
polymorphonuclear cells (PMN) were used as control cells expressing
high levels of IL-I receptor type 11. PMN were purified from buffy
coats of blood donations (courtesy of Centro Trasfusionale, Ospedale
Sacco, Milano, Italy) by a one-step discontinuous Percoll (Pharmacia,
Uppsala, Sweden) gradient as described in detail el~ewhere.~’
Cytokines and antibodies. Recombinant human IL-10 (specific
activity IOs U/mg protein) was obtained from Dr P. Lomedico, Hoffmann-La Roche, Nutley, NJ. Human recombinant IL-4 was from
Immunex, Seattle, WA. Lipopolysacchride (LPS) (from Escherichia
coli 055:BS) was purchased from Difco (Detroit, MI). Human re-
NTERLEUKIN- 1 (IL- 1) polypeptides are pleiotropic cytokines that affect various organs and tissues.’ Vascular
cells are one important target for IL-l.2-4IL-I and the functionally related mediator tumor necrosis factor (TNF) regulate endothelial cell (EC) functions essentially related to inflammation and thrombosis! IL- 1 induces procoagulant
a ~ t i v i t y platelet-activating
,~
factor,6 and plasminogen activator inhibitor,’ and inhibits the thrombomodulin-protein
C anticoagulation pathway? these alterations tend to favor
thrombosis. On exposure to IL- 1, EC produce vasodilatory
mediators (NO and PG12,9,10) and chemoattractant cytokines,”-13 and express adhesion molecule^'^^'^: these EC
products regulate leukocyte extravasation at sites of inflammation.
Two distinct IL- 1 receptors, differentially expressed in cells
of different lineages, have been identified. The type I 80-Kd
receptor is expressed mainly in T cells and fibroblasts,’6‘20
whereas the type I1 (68 Kd) is present as the predominant
IL- 1 binding molecule in B cells2’and neutrophils,22although
the differential expression of the two molecules is not absoThe significance of the two IL- 1 receptors in the action
and regulation of IL- 1 remains unclear. We recently reported
that human and mouse EC express the type I 80-Kd receptorF4At that time, the IL-1 R type I1 had not been molecularly
identified, and thus, the possibility that EC might coexpress
the IL- 1RI1 could not be discounted.
The cloning of the type IIRZ3allowed us to complete our
study by examining type IIR expression in EC by Northern
analysis and polymerase chain reaction (PCR). We found
that human umbilical vein EC do not express detectable levels
of IL- 1RI1 mRNA. Moreover, anti-IL- 1RI monoclonal antibodies (MoAbs) but not anti-type I1 inhibited both IL-I
binding to EC and IL- I-induced cytokine and adhesion molecule expression in EC. Finally, using the human IL-l receptor antagonist (IL- Ira), which in the mouse preferentially
interacts with the type I R,25we found inhibition of the response of mouse endothelial cells to IL- I.
MATERIALS AND METHODS
Cell culture media and reagents. The following reagents were
used for culture of cells, adhesion, and cytokine assays: pyrogen-free
saline for clinical use (S.A.L.F., Bergamo, Italy); pyrogen-free distilled
water (S.A.L.F.); phosphate-buffered saline (PBS) was from Gibco,
Paisley, Scotland; medium RPMI 1640, Dulbecco’s modified Eagle’s
Blood, Vol81, No 5 (March 1). 1993:pp 1347-1351
+
From Centro Daniela e Catullo Borgomainerio,Istituto di Ricerche
Farmacologiche “MarioNegri, Milano; and the Department of Biotechnology, DompP S.p.A., L ilquila, Italy.
Submitted July 24, 1992; accepted October 27, 1992.
Supported by ConsiglioNazionale delle Ricerche,jinalized projects
BTBS and ACRO, and by Istituto Superiore di Sanitd (AIDS project).
The contribution of the Associazione Italiana per la Ricerca SUI Cancro
(AIRC) is gratefully acknowledged.
Address reprint requests to Francesco Colotta, MD, Istituto di Ricerche Farmacologiche “MarioNegri,” Via Eritrea. 62-2015 7 Milano,
Italy.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section I734 solely to
indicate this fact.
0 1993 by The American Society of Hematology.
”
0006-4971/93/8105-0017$3.00/0
1347
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
1348
combinant IL-I receptor antagonist (IL-Ira) was a gift of Dr D. Tracey
(Upjohn, Kalamazoo, MI).
MoAb anti-ICAM- I , clone LB2 (IgG2b), was from Dr N. Hogg,
ICRF, London, GB; MoAb anti-VCAM-I, clone 4B9 (IgGl), from
Dr J. Harlan, University of Washington, Seattle, WA. M4 is a rat
antihuman type I IL-IR IgG2b, as well as MI antibody, whereas
M22 (also a rat IgG2b) is an antihuman type I1 IL-IR antibody.
These antibodies were a gift of Dr J.E. Sims, Immunex, Seattle, WA.
Measurement ofIL-6. IL-6 was measured as hybridoma growth
factor (HGF) activity on the 7TDl cell line obtained through the
courtesy of Dr J. Van Snick, as described.28Briefly, 2 X IO3 cells in
200 pL (four replicates per dilution) were cultured for 72 hours with
different dilutions of the culture supematants to be tested or with
control medium. The number of cells was assessed by the MTT colorimetric test as described.28We confirmed that cells did not respond
to IL- I , IL-5, granulocyte-macrophage colony-stimulating factor
(GM-CSF), and TNF or LPS. HGF activity resulting in half maximal
stimulation of target cell growth was arbitrarily defined as one unit.
The reference standard used in these experiments was human recombinant IL-6.
Cytofluorimetricanalysis. Phenotyping of EC was performed by
indirect immunofluorescence. Briefly, cells were exposed to MoAb
(5 pg/mL in saline, 2% human serum) specific for different adhesion
structures for 30 minutes at 4"C, washed, and incubated with fluoresceinated affinity-purified sheep anti-mouse IgG F(ab)2 (Techno
Genetics, Turin, Italy) for 30 minutes at 4°C. The cells were washed
and fixed with PBS containing I % paraformaldehyde. Fluorescence
was measured on a Becton Dickinson FACStar Plus (Becton Dickinson, Mountain View, CA) apparatus.
Binding ofradiolabeled IL-I@. Confluent EC in 9-cm diameter
plastic Petri dishes (approximately lo6 cells) (Falcon) were washed
three times with ice-cold binding buffer (PBS with 0. I% bovine serum
albumin and 0.02% sodium azide, Sigma). Then 200 pmol/L 1251ILI @ (180 pCi/pg, Nen, Boston, MA) was added in 0.5 mL binding
buffer, with or without a 200 molar excess of cold IL-I@or I O pg/
mL MoAbs M4 or M22. After I-hour incubation at room temperature, cells were rinsed three times with ice-cold binding buffer and
solubilized in I mL 0.5% Triton-25 mmol/L HEPES (Sigma). The
cell-associated radioactivity was determined by couting a lysate volume corrected among experimental groups on the basis of the protein
content as determined by a commercial assay (BioRad, Richmond,
CA). Each experimental group was in duplicate and data are reported
as specific binding (cpm)/500 pg protein.
Northern blot. Northern blot analysis was performed according
to standard procedure^.^^ Total RNA was isolated by guanidine isothiocyanate method.30 Eight to I O pg total RNA were analyzed by
electrophoresis through 1% agarose formaldehyde gels in the presence
of ethidium bromide (Sigma), followed by Northern blot transfer to
Gene Screen Plus membranes (New England Nuclear, Boston, MA).
Plasmid pHu75.750 contains a 750-bp fragment of human type I1
IL-1 receptor, and plasmid G41Int contains a 477-bp fragment of
the human type I IL-1 receptor. Inserts were labeled with random
priming and w3'P dCTP (5,000 Ci/mmol/L Amersham, Buckinghamshire, UK). Membranes were pretreated and hybridized in 50%
formamide (Merck, Darmstadt, Germany) with 10%dextran sulfate
(Sigma) and washed twice with 2X SSC ( 1 X SSC: 0. I5 mol/L sodium
chloride, 0.015 sodium citrate) then twice with 2X SSC plus 1% sodium dodecyl sulfate (SDS) (Merck) at 60°C for 30 minutes and
finally twice with 0.1 X SSC at room temperature for 30 minutes.
The membranes were exposed for 12 to 24 hours at -80°C with
intensifying screens. RNA loading and transfer to membranes were
checked by examination of filters under UV light.
Reverse transcription (RTJ-PCR. Oligonucleotides were synthesized with the phosphoramidite method using a Beckman 200A syn-
COLOTTA ET AL
thesizer (Beckman, Palo Alto, CA). Oligos were precipitated three to
four times with absolute ethanol and then resuspended in water. One
microgram total RNA (2 pL) was reverse transcribed by adding 17
pL ofa master mix with reverse transcriptase buffer (5 mmol/L MgCI2,
50 mmol/L KCI and 10 mmol/L Tris HCI, pH 8.3), 2.5 pmol/L
random hexamers, 1 mmol/L each dNTP, 1 U/pL RNase inhibitor,
and 2.5 U/pL MMLV reverse transcriptase (Perkin Elmer Cetus,
Norwalk, CT). Samples were incubated for I O minutes at 25°C and
then at 42°C for 45 minutes. Then each sample was amplified in 2
mmol/L MgClz. 50 mmol/L KCI, I O mmol/L TrisHC1, 0.2 mmol/
L each dNTP, 2.5 U/lOO pL Taq DNA Polymerase (Perkin Elmer
Cetus), and 5 ng/mL of each specific primer. Primers were as follows:
IL- I receptor type I1 forward, SGTGAGCCCAGCTAATGAGACAT;
IL- 1 receptor type I1 backward, SGGAATCCCTGTACCAAAGCACT;
@-actin forward, S'CCTTCCTGGGCATGGAGTCCTGX @-actin
backward, 5'CCAGCAATGATCTTGATCTTCY. Amplification was
performed in an automated thermal cycler (Perkin Elmer Cetus) at
95°C for 1.5 minutes, 55°C for I .5 minutes, and 72°C for 1.5 minutes,
30 cycles. To measure the efficiency of the extraction of RNA and
of reverse transcription, 2 pL of the same reverse transcriptase reaction
were amplified with P-actin-specific primers as an internal control.
PCR products were run in an agarose gel, blotted onto nitrocellulose
filters, and then hybridized with the appropriate plasmid probes labeled with
I PI dCTP as detailed above and using standard Southern blot technique^.^^
Statistical analysis. Statistical significance was established by
Student's t-test as indicated. Results presented are representative of
four to five experiments performed, unless otherwise specified.
RESULTS
In a first series of experiments we examined the expression
of IL- 1R by Northern analysis. As shown in Fig 1A, i n agreement with o u r previous data, EC expressed appreciablelevels
of IL- 1RI mRNA. In contrast, no hybridization was observed
when an IL- 1RI1 probe was used. Under the same conditions,
IL- I RI1 mRNA was easily detectable in P M N used as positive
control in these experiments. To investigate whether E C express IL-IRII m R N A at levels lower than those detectable
by northern analysis, RT-PCR followed by Southern analysis
was used. As shown in Fig lB, also under these conditions,
EC gave no detectable type I1 m R N A transcripts that were
easily observed in PMN. P-actin was evident in the same E C
cDNA reaction used for analysis.
Expression of the IL-1 receptors can be modulated by cytokines or hormones. Hence, we examined whether IL- 1RI1
transcripts were inducible in E C on exposure to cytokines.
As shown in Fig 2, exposure t o IL- I , LPS, and IL-4 failed to
induce appreciable levels of IL-I RI1 expression. It is of interest
that one of these mediators, IL-4, active on E C pr~liferation,~'
upregulates expression of IL-IRII in P M N under the same
conditions (Fig I). T h e results presented in Figs 1 and 2 are
representative of 12 E C preparations examined for IL- 1RI1
expression with negative results.
In a n effort to explore whether expression of extremely
low levels of IL-IRII, escaping detection by Northern and
RT-PCR, were indeed involved in E C activation by IL-I,
specific MoAbs were used. As shown in Fig 3, M 4 MoAb
(anti-type I IL- 1R) but not M22 (anti-type I1 IL- 1R) effectively
inhibited binding of radioiodinated IL- Ip to EC. M22 blocked
binding of IL-IP t o IL-IR type I1 expressing P M N (not
shown). Moreover, as shown in Table 1, the M 4 a n d M I
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
IL-1 RECEPTORS IN ENDOTHELIAL CELLS
1349
A
-
B
IL-1 R 11
,
P-ACTIN
<
Y-I
w
0
4
I
0
0
U
E 5
IL-1 R I
-
IL-1 R I1
-
Fig 1. Expression of IL-1 receptor type I and type II in human EC. (A) Total RNA (8 pg for each lane) from the cell types indicated in the
Fig has been blotted and hybridized to 11-1 receptor type I and type II probes. IL-4-PMN were treated with 10 ng/mL for 6 hours. The
apparently low levels of expression of IL-1 receptor type Iin EC and sarcoma cells are solely caused by the very short time of exposure (6
hours) required to avoid overexposureof the autoradiographic film by the intense signal from PMN. Longer exposuretimes failed to evidentiate
any 11-1 R type II mRNA in EC. The lower part of the figure shows the ethidium bromide staining of blotted RNAs onto the membrane. (B)
RT-PCR analysis of IL-1 receptor type II expression. One microgram total RNA from each cell population was reverse transcribed as detailed
in Materials and Methods. One half of the reaction was amplified with IL-1R type II oligonucleotides, whereas the remaining half was
amplified with &actin sequences. The amplification reactions were run in ethidium bromide-stained agarose gel (upper part) with DNA
molecular weight markers (MW). The portion of the gel containing the amplified fragments of IL-1R type II has been subjected to Southern
analysis with an IL-1 R type I1specific probe (lower part).
anti-lL-l RI MoAb effectively inhibited the induction of IL6 production by IL-l:M4 and M 1 ( I O pg/mL) completely
inhibited induction by low concentrations (0.05 ng/mL) of
IL-I, whereas they caused only a partial block of a 0.5 to 5
ng/mL concentration of IL-I: for instance, at an IL-I concentration of 0.5 ng/mL, IL-6 levels were 35 k 5, 388 ? 25.
and 158 ? 84 U/mL for control. IL-1 and IL-l
MI (P<
.01). A similar inhibition by anti-IL-IRI MoAbs was observed
when the expression of ICAM-I was measured these antibodies completely blocked induction at an IL-1 concentration
of0.05 ng/mL, but had partial effects at higher cytokine concentrations (not shown). Under the same conditions, M22
(anti-IL-1 RII), which inhibits binding to the IL-l RII, had
no significant effect on EC activation by IL-1. The fact that
anti-IL- I RI MoAb M4 and M 1 did not completely inhibit
the action of high doses of IL-l (0.5 to 5 ng/mL) may be
caused by the high Kd value of the cytokine-receptor interaction and the need for extremely low levels of receptor oc-
+
cupancy to trigger responses. The alternative o r complementary explanation of a third type of IL-IR, though unlikely,
cannot be formally excluded on the basis of these data.
It has recently been shown that in mouse but not human
cells human IL-Ira binds efficiently to the type I but not to
the type I1 IL-IR.” As shown in Table I , IL-Ira inhibited
the IL-l induction of IL-6 production in a mouse endothelioma line.
DISCUSSION
The results reported here confirm and extend previous
analysis of the IL- I R expressed in vascular EC. Taking advantage of the recent cloning of the IL-l RII,Z3 we have examined a large series ( I2 samples) of human umbilical vein
EC preparations for IL-l RI1 expression with negative results.
Consistently with these observations, MoAbs M4 and MI
(anti-IL-l RI) inhibited the induction of IL-6 and adhesion
molecules by IL-I. In contrast, an MoAb that blocks binding
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
COLOTTA ET AL
1350
z
2
U
E
P
EC
11-1 R I1
PACTIN
-
Fig 2. RT-PCR analysis of 11-1R type II expression
in untreated and activated EC. RNA from each cell
populationhas been reversetranscribedand analyzed
for IL-1R type II and @-actinexpression as detailed
in Fig 1. Treatment of EC with IL-1 (10 U/mL) and
IL-4 (10 ng/mL) was for 2 to 4 hours; the sample of
EC treated with LPS (100 ng/mL) was incubated for
4 hours. M W denotes molecular weight marker.
-
of IL-l to the type I1 receptor had no effect. Finally, human
IL-Ira, a ligand for the type I but not for the type I1 IL-IR
in mouse cells,25completely inhibited activation by IL-l of
a mouse endothelioma of thymic origin. Collectively. these
observations strongly suggest that EC selectively express the
type I IL- I R, which accounts for activation of this cell type
by 1L-I.
Is the lack of IL-l RI1 expression in EC of any biological
significance? It has recently been reported that the IL- I RI1
can be released in biological fluids, where it retains ligandbinding activity.32 As such. it may represent a negative regulator of the IL-l action, along with IL-Ira. It is of interest
that EC express neither IL-lraJ3 nor IL-IRII (this study) in
appreciable levels. EC would therefore lack two mechanisms
of IL- I downregulation. which would instead be centered on
inflammatory phagocytes.
Table 1. Inhibition of the IL-1 Activation of EC by Anti-IL-1 R
MoAbs and IL-lra
T
11-6 Production With
EC
Inhibitor
Medium
IL- 1
Human
-
11 2 1.7
2 3 + 15
25 2 4
35 5
NT
1926
<10
104 2 24
20 4'
253 2 150
126 26
51 523'
368 72
<lo-
~~
M4 (IL-1RI)
M22 (IL-1RII)
M1 (IL-lRI)
Murine
-
IL-1ra
Medium
Irrel.
M22
M4
Treatment
Fig 3. Binding of '2s[1]IL-1~
to EC treated with anti-IL-1 R antibodies. Confluent EC (approximately 10" cells) were incubatedwith
200 pmol/L radiolabeled IL-1B in the presence or absence of a 200
molar excess of cold IL-10 or 10 rg/mL anti-type I (M4). anti-type
II (M22) MoAbs or an irrelevant rat MoAb of the same class for 1
hour at room temperature. Cell-associatedligand was determined
as described in Materials and Methods. Bars represent the mean,
with the range of values, from samples tested in duplicate.
+
+
+
+
Human EC were exposed to MoAb (10 pg/mL) for 30 minutes at 4°C.
then IL-lp was added and the culture continued for 24 hours. In experiments with mouse cells (t end-1 endothelioma), IL-1ra (200 ng/mL) was
added together with IL-lp at the initiation of the culture, and the supernatant was collected 24 hours later. IL-1 concentrations ranging from
0.05 to 5 pg/mL were used: results presented refer to 0.05 pg/mL (human
EC) and 1 ng/mL (murineEC). Results are mean SD (4 replicates/group)
of IL-6 U/mL.
Abbreviation: NT, not tested, but in preliminary experiments M1 alone
had no effect on IL-6 production.
P < .01 v control.
+
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
IL-I RECEPTORS IN ENDOTHELIAL CELLS
1351
REFERENCES
18. Sims JE, Acres RB, Grubin CE, McMahan CJ, Wignall JM,
March CJ, Dower SK: Cloning the interleukin-I receptor from human
T cells. Proc Natl Acad Sci USA 869946, 1989
19. Chin J, Cameron PM, Rupp E, Schmidt JA: Identification of
a high affinity receptor formative human interleukin I fl and interleukin la on normal human lung fibroblasts. J Exp Med 16S:70, 1987
20. Kupper TS, Lee F, Birchall N, Clark S, Dower S Interleukin1 binds to specific receptors on human keratinocytes and induces
granulocyte macrophage colony-stimulating factor mRNA and protein. J Clin Invest 82:1787, 1988
21. Matsushima K, Akahoshi T, Yamada M, Furutani Y, Oppenheim JJ: Properties of a specific interleukin-1 (IL-I) receptor on
human Epstein Barr virus-transformed B lymphocytes: Identity of
the receptor for IL-1-a and IL-1-p. J Immunol 136:4496, 1986
22. Rhyne JA, Mizel SB, Taylor RG, Chedid M, McCall CE:
Characterization of the human interleukin 1 receptor on human
polymorphonuclear leukocytes. Clin Immunol Immunopathol 48:
354, 1988
23. McMahan CJ, Slack JL, Mosley B, Cosman D, Lupton SD,
Brunton LL, Grubin CE, Wignall JM, Jenkins NA, Brannan CI,
Copeland NG, Huebner K, Croce CM, Cannizzaro LA, Benjamin
D, Dower SK, Spriggs MK, Sims JE: A novel IL- 1 receptor, cloned
from B cells by mammalian expression, is expressed in many cell
types. EMBO J 10:2821, 1991
24. Boraschi D, Rambaldi A, Sica A, Ghiara P, Colotta F, Wang
JM, de Rossi M, Zoia C, Remuzzi G, Bussolino F, Scapigliati G,
Stoppacciaro A, Ruco L, Tagliabue A, Mantovani A: Endothelial
cells express the interleukin- 1 receptor type I. Blood 78:1262, I99 1
25. Dripps DJ, Verderber E, Ng RK, Thompson RC, Eisenberg
S P Interleukin-] receptor antagonist binds to the type I1 interleukinI receptor on B cells and neutrophils. J Biol Chem 266:2031 I, 199 I
26. Bussolino F, De Rossi M, Sica A, Colotta F, Wang JM, Bocchietto E, Martin-Padura I, Bosia A, Dejana E, Mantovani A: Murine
endothelioma cell lines transformed by polyoma middle T oncogene
as target for and producers of cytokines. J Immunol 147:2122, 1991
27. Bertani A, Polentarutti N, Sica A, Rambaldi A, Mantovani
A, Colotta F: Expression of c-jun protooncogene in human myelomonocytic cells. Blood 74: I8 1 1, 1989
28. Sironi M, Breviario F, Proserpio P, Biondi A, Vecchi A, Van
Damme J, Dejana E, Mantovani A: IL-1 stimulates IL-6 production
in endothelial cells. J Immunol 142549, 1989
29. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning. A
Laboratory Manual. Cold Spring Harbor, NY, Cold Spring Harbor
Laboratory, 1989
30. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ: Isolation of biologically active ribonucleic acid from sources enriched
in ribonuclease. Biochemistry 185294, 1979
3 1 . Toi M, Hams AL, Bicknell R Interleukin-4 is a potent mitogen
for capillary endothelium. Biochem Biophys Res Commun 174:1287,
1991
32. Gin JG, Newton RC, Horuk R: Identification of soluble interleukin- 1 binding protein in cell-free supernatants. J Biol Chem
265:17416, 1990
33. Bertini R, Sironi M, Martin-Padura I, Colotta F, Rambaldi
S, Bemasconi S, Ghezzi P, Haskill SJ, Liu D, Mantovani A: Inhibitory
effect of recombinant intracellular interleukin- 1 receptor antagonist
on endothelial cell activation. Cytokine 4:44, 1992
I. Dinarello CA: Interleukin-] and its biologically related cyto-
kines. Adv Immunol 44: 153, 1989
2. Mantovani A, Dejana E: Cytokines as communication signals
between leukocytes and endothelial cells. Immunol Today 10:370,
1989
3. Pober JS: Cytokine-mediated activation of vascular endothelium. Physiology and pathology. Am J Pathol 133:426, 1988
4. Mantovani A, Bussolino F, Dejana E Cytokine regulation of
endothelial cell function. FASEB J 6:2591, 1992
5. Bevilacqua MP, Pober JS, Majeau GR, Cotran RS, Gimbrone
MA Jr: Interleukin-1 (IL-I) induces biosynthesis and cell surface
expression of procoagulant activity in human vascular endothelial
cells. J Exp Med 160:618, 1984
6. Bussolino F, Breviario F, Tetta C, Aglietta M, Mantovani A,
Dejana E: Interleukin- 1 stimulates platelet-activating factor production in cultured human endothelial cells. J Clin Invest 77:2027, 1986
7. Schleef RS, Bevilacqua MP, Sawdey M, Gimbrone MA Jr, Loskutoff DJ: Cytokine activation of vascular endothelium. Effects on
tissue-type plasminogen activator and type 1 plasminogen activator
inhibitor. J Biol Chem 2635797, 1988
8. Nawroth PP, Handley CT, Esmon C, Stern DM: Interleukin1 induced endothelial cell procoagulant while suppressing cell-surface
anticoagulant activity. Proc Natl Acad Sci USA 83:3460, 1986
9. Rossi V, Breviario F, Ghezzi P, Dejana E, Mantovani A: Prostacyclin synthesis induced in vascular cells by interleukin-I. Science
229: 174, 1985
10. Gross SS, Jaffe EA, Levi R, Kilbourn RG: Cytokine-activated
endothelial cells express an isotype of nitric oxide synthase which is
tetrahydrobiopterin-dependent.Biochem Biophys Res Commun 178:
823, 1991
1 1 . Sica A, Wang JM, Colotta F, Dejana E, Mantovani A, Oppenheim JJ, Larsen CG, Zachariae COC, Matsushima K: Monocyte
chemotactic and activating factor gene expression induced in endothelial cells by IL-1 and tumor necrosis factor. J Immunol 144:
3034, 1990
12. Sica A, Matsushima K, Van Damme J, Wang JM, Polentarutti
N, Dejana E, Colotta F, Mantovani A: IL-I transcriptionally activates
the neutrophil chemotactic factor/IL-8 gene in endothelial cells. Immunology 69548, 1990
13. Rollins BJ, Yoshimura T, Leonard EJ, Pober JS: Cytokineactivated human endothelial cells synthesize and secrete a monocyte
chemoattractant, MCP-l/JE. Am J Pathol 136:1229, 1990
14. Dustin ML, Springer TA: Lymphocyte function associated
antigen- 1 (LFA-I) interaction with intercellular adhesion molecule1 (ICAM-1) is one of at least three mechanisms for lymphocyte adhesion to cultured endothelial cells. J Cell Biol 107:321, 1988
15. Bevilacqua MP, Stengelin S, Gimbrone MA Jr, Seed B Endothelial leukocyte adhesion molecule 1: An inducible receptor for
neutrophils related to complement regulatory proteins and lectins.
Science 243:1160, 1989
16. Sims JE, March CJ, Cosman D, Widmer MB, MacDonald
HR, McMahan CJ, Grubin CE, Wignall JM, Jackson JL, Call SM,
Friend D, Alpert AR, Gillis S, Urdal DL, Dower S K cDNA expression
cloning of the IL-1 receptor, a member of the immunoglobulin superfamily. Science 241585, 1988
17. Chua AO, Gubler U: Sequence of the cDNA for the human
fibroblast type interleukin-I receptor. Nucleic Acids Res 17:10114,
1989
From www.bloodjournal.org by guest on December 22, 2014. For personal use only.
1993 81: 1347-1351
Type II interleukin-1 receptor is not expressed in cultured endothelial
cells and is not involved in endothelial cell activation
F Colotta, M Sironi, A Borre, T Pollicino, S Bernasconi, D Boraschi and A Mantovani
Updated information and services can be found at:
http://www.bloodjournal.org/content/81/5/1347.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.