1. No category

Dipeptidyl Peptidase I and Granzyme A Are
Coordinately Expressed During CD8 + T Cell
Development and Differentiation
This information is current as
of February 6, 2015.
References
Subscriptions
Email Alerts
J Immunol 1998; 160:5880-5885; ;
http://www.jimmunol.org/content/160/12/5880
This article cites 33 articles, 25 of which you can access for free at:
http://www.jimmunol.org/content/160/12/5880.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscriptions
Submit copyright permission requests at:
http://www.aai.org/ji/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/cgi/alerts/etoc
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
9650 Rockville Pike, Bethesda, MD 20814-3994.
Copyright © 1998 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
Permissions
Christopher L. Mabee, Michael J. McGuire and Dwain L. Thiele
Dipeptidyl Peptidase I and Granzyme A Are Coordinately
Expressed During CD81 T Cell Development and
Differentiation1
Christopher L. Mabee, Michael J. McGuire,2 and Dwain L. Thiele3
D
ipeptidyl peptidase I (DPPI),4 formerly known as cathepsin C, is a cysteine protease that is capable of removing dipeptides from the amino-terminus of various
peptides and protein substrates (1– 6). This enzymatic activity is
expressed at higher levels in cytotoxic lymphocytes and myeloid
cells than in lymphocytes without cytotoxic potential or cells of
non-bone marrow origin (7–9). Within cytotoxic lymphocytes and
myeloid cells, DPPI colocalizes within specialized granules with
proteases from the families of structurally related granule serine
proteases expressed in these cells (10). The results of a variety of
studies indicate that DPPI plays a requisite role in the posttranslational processing and activation of these granule serine proteases
by the removal of an activation dipeptide (10 –13). Moreover, inhibiting DPPI activity during CD81 T cell responses to alloantigens
Liver Unit, Department of Internal Medicine, The University of Texas Southwestern
Medical Center at Dallas, Dallas, TX 75235
Received for publication December 22, 1997. Accepted for publication February
19, 1998.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by a National Research Service Award from the National
Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of
Health, 5 K32 DK09608-02, by the American Liver Foundation Amgen Postdoctoral
Research Fellowship awarded to C.L.M., and by Research Grant R01 AI-24639 from
the National Institutes of Health.
2
Present address: Ryburn Cardiology Center, The University of Texas Southwestern
Medical Center at Dallas, Dallas, TX 75235-8573.
3
Address correspondence and reprint requests to Dr. Dwain L. Thiele, Liver Unit,
Department of Internal Medicine, The University of Texas Southwestern Medical
Center at Dallas, Dallas, TX 75235-9151. E-mail address: [email protected]
4
Abbreviations used in this paper: DPPI, dipeptidyl peptidase I; BLT, N-a-benzyloxycarbonyl-L-lysine thiobenzyl ester; alloAg, alloantigen; G3PDH, glyceraldehyde3-phosphate dehydrogenase.
Copyright © 1998 by The American Association of Immunologists
(alloAgs) impairs both the activation of granzyme serine protease activity and the generation of cytotoxic effector function (14 –17).
During thymocyte development and differentiation, a number of
genes encoding putative CTL effector molecules are expressed (18,
19). Granzyme A mRNA expression has been noted in both immature thymocytes devoid of CD4 and CD8 epitopes and in more
differentiated CD81CD42 thymocytes (18, 19). A multiphasic induction of granzyme genes during T cell ontogeny has been previously proposed (20, 21). While the expression of granzyme A
and granzyme B mRNA has been noted during thymocyte differentiation, high levels of these enzymatic activities are expressed
late in the course of CD81 T cell responses to immune stimuli, and
granzyme expression has been used as a marker of differentiated
CTL effector cells (22). In contrast, the expression of high levels
of DPPI has been noted in both CTL precursor and effector cells
(9, 10). In a recent study assessing DPPI mRNA levels during the
in vitro activation of lymphokine-activated killer function, increased DPPI gene expression was noted following IL-2 stimulation of human PBLs, suggesting that, similar to granzyme A and
granzyme B expression, DPPI may be up-regulated in response to
stimuli that elicit cytotoxic lymphocyte responses (23). However,
other investigators have noted no significant differences in the levels of DPPI mRNA expressed in freshly isolated mouse splenocytes vs in vitro-activated murine lymphokine-activated killer cells
or alloAg-activated splenocytes (24). Neither of these previous
studies examined DPPI gene expression in purified populations of
lymphocytes. Thus, the degree to which DPPI gene expression is
regulated in CD81 CTLs following various immune stimuli remains unclear. In addition, the stage at which DPPI expression is
up-regulated in CTLs during T cell ontogeny is unknown. Our
studies examine the expression of DPPI mRNA and enzymatic
activity during the maturation and activation of CD81 T cells.
These data indicate that DPPI gene expression varies significantly
0022-1767/98/$02.00
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
Dipeptidyl peptidase I (DPPI) is a granule protease that plays a requisite role in processing the proenzyme form of the CTL
granule serine proteases (granzymes). This study assesses DPPI mRNA and enzyme expression during T lymphocyte ontogeny and
CTL differentiation. The most immature CD32CD42CD82 thymocytes were found to express >40-fold higher levels of DPPI
mRNA, although levels of DPPI enzymatic activity in CD32CD42CD82 thymocytes were only modestly higher than those seen for
CD41CD81 or CD41CD82 thymocytes. More mature CD81CD42 thymocytes and CD81 splenocytes expressed significantly
higher levels of DPPI mRNA and enzymatic activity than CD41CD81 or CD41CD82 thymocytes. Granzyme A mRNA expression
was observed in DPPI expressing CD32CD42CD82 and CD81CD42 thymocytes and was also observed in CD81CD42 splenocytes; however, expression was not observed in CD41CD81 or CD41CD82 thymocytes. Both DPPI mRNA and granzyme A
mRNA expression in CD81 T cells decreased to very low or undetectable levels during the first 48 h after allostimulation in MLCs.
However, peak levels of both DPPI and granzyme A expression were observed later in the course of CD81 T cell responses to
alloantigen, with DPPI mRNA expression peaking on either day 3 or day 4 and granzyme A expression peaking at the end of a
5-day MLR. These data indicate that DPPI is expressed at all stages of T cell ontogeny and differentiation in which granzyme A
mRNA is detected; consequently, DPPI appears to be available for the processing and activation of granzyme A during both CD81
T cell development and differentiation. The Journal of Immunology, 1998, 160: 5880 –5885.
The Journal of Immunology
during the course of lymphocyte ontogeny and CD81 T cell differentiation. Moreover, the patterns of DPPI expression observed
in the course of these studies suggest that DPPI expression is regulated in a manner that results in the availability of high levels of
DPPI in T cells synthesizing the preprogranzymes that are reportedly the physiologic substrates of this granule protease.
Materials and Methods
Cell lines
CTLL-2 cells were obtained from the American Type Culture Collection,
(Manassas, VA) and were cultured in RPMI 1640 medium (BioWhittaker,
Walkersville, MD) supplemented with 10% FBS (Life Technologies,
Gaithersburg, MD), 1 mM sodium pyruvate, 5 3 1025 M 2-ME, 5 mM
HEPES (Sigma, St. Louis, MO), 0.3 mg/ml L-glutamine, 200 U/ml penicillin G, and 10 mg/ml gentamicin. These cultures were supplemented with
25 U/ml of rIL-2 twice per week.
Mice
Monoclonal Ab
Anti-CD4 (GK 1.5) (25), anti-CD8 (YTS.169.4) (26), anti-NK (3A4) (27),
anti-I-Ab,d,q (MS/114.15-2) (28), and anti-I-Ab (25–5–16S) (29) were prepared as culture supernatants of hybridoma cells or were staphylococcal
protein A-purified from hybridoma culture supernatants as previously described (30). FITC-conjugated anti-CD3 (145-2CII) was purchased from
PharMingen (San Diego, CA).
Cell purification and isolation
Thymectomies were performed on C57BL/6J mice by careful dissection,
and organs were thoroughly rinsed twice with HBSS (Life Technologies)
before dispersion into single-cell suspensions. Spleens were minced and
filtered through nylon mesh. Viable thymocyte and splenocyte populations
were separated by Hypaque 1083 (Sigma) density gradient centrifugation
for 30 min at 1500 revolutions per min after suspension in RPMI 1640
medium supplemented with 0.3% FBS, 25 mM HEPES, 100 mM 2-ME,
200 U/ml penicillin G, and 10 mg/ml gentamicin. Thymocyte or T cell
subsets were purified and isolated using magnetic cell sorting with a VarioMACS cell sorter (Miltenyi Biotec, Auburn, CA) (31). Briefly, cells were
suspended in PBS buffer supplemented with 5 mM EDTA and 1% FBS and
incubated for 15 min at 4°C with Ab-coated microbeads. Positive and
negative selection columns were used where appropriate, and cell populations were washed with PBS following separation and isolation as directed
by the manufacturer. Upon a subsequent flow cytometric analysis of
splenocytes and single-positive thymocytes following enrichment with the
magnetic-activated cell sorter magnetic bead isolation system, .95% purity of selected cell populations was routinely observed.
CD32CD42CD82 thymocytes
Thymocytes were incubated with FITC anti-CD3, anti-NK (3A4), and antiI-Ab (MS 114.15-2 and 25–5–16S) Abs for 30 min at 4°C. Following
washing, the cells were incubated with goat anti-mouse Ig, anti-FITC, antiCD4 (L3T4), and anti-CD8 (Ly-2) microbeads as previously described, and
the CD32CD42CD82 thymocytes were collected as the unbound fraction
using a negative selection column.
CD41CD81 thymocytes
Thymocytes were incubated with fluoresceinated anti-CD8 (Life Technologies) and biotinylated anti-CD4 (Life Technologies) for 30 min at 4°C.
Cells were washed and incubated with avidin-phycoerythrin (Life Technologies) for 30 min on ice before washing, and the selection of cells
positively stained with both anti-CD8 and anti-CD4 by FACS using a
FACStar (Becton Dickinson, Mountain View, CA) as previously described
(16). Upon subsequent flow cytometric analysis, .95% purity of positively
selected cell populations was routinely observed.
CD41CD82 and CD81CD42 thymocytes
Thymocytes were incubated with anti-CD4 (L3T4) or anti-CD8 (Ly-2)
microbeads. The unbound fraction following selection with anti-CD4 mi-
crobeads was then incubated with anti-CD8 (Ly-2) microbeads and positively selected as CD42CD81 cells. The unbound thymocytes following
initial selection with anti-CD8 microbeads were then incubated with antiCD4 (L3T4) microbeads and positively selected as CD41CD82 cells.
Isolation of CD81 C57BL/6J splenocytes
Splenocytes were incubated with anti-CD8 (Ly-2) microbeads, and positively selected CD81 T cells were isolated.
Generation of in vitro-activated CD81 B6 anti-H-2d-specific
CTLs
CD81 CTLs were activated in MLCs containing both 40 3 106 C57BL/6J
(H-2b) responder spleen cells and 10 3 106 irradiated (1500 cGy) T celldepleted DBA/2J (H-2d) stimulator spleen cells in 20 ml of culture medium. Before irradiation, the DBA/2J cells were separated from other cellular elements by Hypaque 1083 (Sigma) density centrifugation. The cells
were also depleted of T cells by incubation with HO 13.4 anti-Thy-1 Ab
(32) (1:30 dilution) for 30 min on ice and subsequent treatment with rabbit
complement (1:6 dilution) for 50 min at 37°C. The cells were passed
through 30-mM nylon filters and irradiated with 1500 cGy. Each culture
was suspended in 20 ml of complete media. AlloAg-activated cells were
harvested on days 1 through 5 and positively enriched for CD81 CTLs
using anti-CD8 (Ly-2) microbeads (Miltenyi Biotec).
Protein, DPPI, and N-a-benzyloxycarbonyl-L-lysine thiobenzyl
ester (BLT) esterase (granzyme A) enzymatic activity assays
The protein concentration was assessed by the bicinchoninic acid method
using BSA as the standard as previously described (10). Assay reagents
were purchased from Pierce (Rockford, IL). DPPI activity was assayed by
hydrolysis of glycylphenylalanyl-b-naphthylamide (Sigma) as previously
described. BLT esterase activity was assayed by hydrolysis of BLT (Calbiochem-Behring, La Jolla, CA) as previously described (10, 33). The results are given as the mean 6 SE of the mean for triplicate determinations.
Generation of DPPI, granzyme A, and glyceraldehyde-3phosphate dehydrogenase (G3PDH) probes for semiquantitative
PCR
Those primers (M41) (59-CACAACTTTGTGAAGGCCATCAAT-39) and
(B34) (59-TCATCAGTTCCTCTGCGG-39) that had been used previously
to amplify a 830-base pair (bp) product of mouse DPPI cDNA (33) were
used to establish an RT-PCR assay for DPPI mRNA expression. These
primers are complementary to sequences in the 4th and 7th exon of the
mouse DPPI gene (24); consequently, the primers yield distinctive m.w.
products when used to amplify genomic DNA. Oligonucleotides were obtained from Integrated DNA Technologies (Coralville, IA). A 177-nucleotide bp internal probe was obtained from the previously cloned mouse
DPPI cDNA (34) by digestion with BamHI and EcoRI (Life Technologies)
and gel purification. The sequence of granzyme A mRNA was analyzed,
and a 59 primer from the N terminus (59-CACGGTTGTTCCTCACTCAA
GACC) and a 39 primer from the C terminus (59-TCGGCGATCTCCA
CACTTCTCTCCACC) were synthesized (Integrated DNA Technologies).
cDNA encoding a portion of mouse granzyme A was obtained by RT-PCR
using CTLL-2 RNA as a template and cloned in the PCR 3.1 vector. The
cloned cDNA was verified as mouse granzyme A by sequence analysis. A
372-nucleotide bp internal probe was obtained by digestion with AvaII and
BglII (Life Technologies) and gel purification. The cloned murine G3PDH
sequence was analyzed, and a 59 primer from the N terminus (59-ACCA
CAGTCCATGCCATCACTGC) and a 39 primer from the C terminus (59CCACCACCCTGTTGCTGTAGCC) were synthesized (Integrated DNA
Technologies). cDNA encoding a 450-nucleotide bp segment of mouse
G3PDH was obtained by RT-PCR using CTLL-2 RNA as a template and
cloned in the PCR 3.1 vector as described above. The cloned cDNA was
verified by sequencing and used as a probe following gel purification as
previously described (34).
Semiquantitative RT-PCR
Cell populations (1.0 3 106) were individually pelleted and treated for 15
min at 15 to 30°C with TRIzol reagent (Life Technologies). Total RNA
was isolated per the manufacturer’s recommendations. The isolated RNA
was solubilized in 30 ml of RNase-free sterile water at 70°C for 10 min.
First strand cDNA was synthesized by RT reaction with 1 mg of starting
RNA in a 22 ml reaction volume. Following denaturing and annealing with
1 ml of oligo(dT) (Life Technologies) (0.5 mg/ml), the reaction was equilibrated and incubated at 45°C for 1 h with 1 ml of Superscript (Life Technologies) RT (200 U/ml). Specimens were immediately removed from the
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
We obtained 5- to 8-wk-old C57BL/6J and DBA/2J from The Jackson
Laboratory (Bar Harbor, ME). All animal research protocols used in this
project were reviewed and approved by the University of Texas Southwestern Medical Center at Dallas Institutional Animal Care and Use Committee (Dallas, TX). Animals were 10 to 12 wk old at the time of use.
5881
5882
DIPEPTIDYL PEPTIDASE I EXPRESSION DURING T CELL ONTOGENY
thermal controller and put on ice. A total of 1 U of RNase H (Sigma) was
added to each specimen; specimens were subsequently incubated at 37°C
for 30 min. In triplicate reactions, first-strand cDNA derived from 0.25 mg
RNA served as the template for the amplification of DPPI, granzyme A,
and G3PDH. Each reaction was amplified in a final volume of 50 ml containing 1.5 U Taq polymerase, 13 PCR buffer, 2.5 mM MgCl2, and 0.25
mM deoxynucleoside triphosphate. Mineral oil was placed over the samples to serve as a vapor barrier. The amplification sequence consisted of
denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and elongation
at 72°C for 1 min for 27 cycles. The initial denaturation and annealing steps
were conducted in the absence of Taq polymerase and deoxynucleoside
triphosphate, which were added during the first incubation at 72°C. On the
28th cycle, the elongation step at 72°C was extended to 5 min. The PCR
products were immediately blotted by a Nytran max-strength membrane
using a Minifold II (72-well) slot-blot system (Schleicher & Schuell,
Keene, NH). The nucleic acid was fixed to the membrane in a vacuum oven
(15–20 pounds per square inch) for 1 h at 82°C. Membranes were pretreated with 25 ml Express Hyb hybridization solution (Amersham, Arlington Heights, IL) for 1 h at 65°C in a rocker-incubator. A total of 25 ng
of previously isolated template DPPI probe was denatured at 100°C for 5
min and diluted to a volume of 45 ml sterile water on ice. The probe was
synthesized in the presence of 50 mCi of [a-32P]deoxyCTP by incubating
at 37°C for 10 min with the Rediprime random primer labeling system
(Amersham). The reaction was stopped by adding 5 ml of 0.2 m EDTA.
The radiolabeled probe was denatured at 100°C for 5 min and immediately
added to the hybridization buffer to obtain a final concentration of 1 ng/ml
and was incubated at 65°C for 1 h with gentle rocking. The membranes
were removed from the hybridization solution and washed with two lowstringency washes for 10 min with 23 SSC plus 0.1% SDS at room temperature and with two high stringency washes for 10 min with 13 SSC plus
0.1% SDS at 65°C. Quantitative b emission was assessed using the Ambis
computer-controlled multiwire proportional counter (Ambis, San Diego,
CA) and Ambis core software (version 4.0) on a Dell 486 computer (Austin, TX) using 720-min counting periods and a 1.6 3 3.2-mm detection
plate. The membranes were subsequently stripped of the radioactive probe
by two incubations in 95°C water baths for 10 min. The procedure was
repeated with probes for granzyme A and G3PDH.
In preliminary experiments, varying quantities of RNA (range: 0.1–1.0
mg) from both CTLL-2 cells, a cell line expressing high levels of DPPI
mRNA, and mouse brain, a tissue expressing very low levels of DPPI (33),
were reverse transcribed and amplified for varying numbers of cycles
(range: 25–35 cycles) before transfer to nylon membranes and hybridization with [a32P]-labeled DPPI or G3PDH probes. We found that cDNA
that had been generated from 0.25 mg of total RNA isolated from either
CTLL-2 or mouse brain amplified through 28 cycles yielded detectable but
submaximal levels of DPPI and G3PDH PCR products (Fig. 1A, additional
data not shown). Following the determination of the range of PCR cycles
through which DPPI and G3PDH DNA accumulated exponentially, additional studies were performed in which PCR products were resolved by
electrophoresis in 0.8% agarose gels (Fig. 1A) and transferred to Nytran
membranes by capillary action. Hybridization with DPPI- and G3PDHspecific probes demonstrated that .80% of the radioactivity was bound to
full-length dsPCR products (Fig. 1B). Further studies showed similar specificity for the granzyme A probe. The quantities of probes bound by PCR
amplicons were assessed using the Ambis as previously described (Fig.
1C). In subsequent studies, the quantities of RT-PCR-amplified DPPI and
granzyme A products were normalized to quantities of RT-PCR-amplified
G3PDH mRNA. A single RNA isolate from CTLL-2 cells was reverse
transcribed; this cDNA was included in each assay to control for interexperimental variability in the specific activity of the [a-32P]-labeled probes
that were bound by the RT-PCR products of each mRNA examined.
Results
DPPI and granzyme A mRNA expression in thymocytes and
splenocytes
The expression of DPPI and granzyme A mRNA was assessed in
various subsets of thymocytes and splenocytes as described in Figure 2. Both DPPI mRNA and granzyme A mRNA expression were
detected in CD32CD42CD82 thymocytes, while the expression of
neither DPPI mRNA nor granzyme A mRNA was detected in
CD41CD81 thymocytes. CD81 thymocytes were found to express
higher levels of both DPPI mRNA and granzyme A mRNA than
CD41 thymocytes. Although the expression of granzyme A
mRNA was modestly reduced in CD81 spleen cells, this cell population continued to express detectable levels of granzyme A
mRNA as well as high levels of DPPI mRNA.
DPPI enzymatic activity in thymocytes
Whole cell lysates from each thymocyte and spleen cell population
were assayed for DPPI activity. As described in Figure 3,
CD32CD42CD82 thymocytes were found to express DPPI enzymatic activity at a level that was about threefold less than that
detected in peripheral CD81 splenocytes. Progressively lower levels of DPPI activity were detected in CD41CD81 thymocytes and
CD41CD82 thymocytes. CD81CD42 thymocytes were found to
express higher levels of DPPI than CD41CD82 thymocytes, with
even higher levels of DPPI expressed in CD81 splenocytes.
DPPI and granzyme A expression in alloAg-activated CD81
cells
In vitro alloAg-activated CD81 CTLs were generated in a 5-day
MLC. Cells were harvested daily for 5 days, and highly purified
CD81 CTLs were selected as described in Materials and Methods
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
FIGURE 1. Semiquantitative RT-PCR assays of DPPI mRNA. A, 0.25 mg of RNA from CTLL-2 and mouse brain were reverse transcribed, and cDNA
was amplified with DPPI- and G3PDH-specific primers by PCR for 28 cycles. DPPI primers produced a 830-bp product (lanes 1 and 2), and G3PDH
primers produced a 450-bp product (lanes 5 and 6). Lane 4 displays the electrophoretic patterns of a 100-bp ladder (Life Technologies) marker DNA
including prominent 600-bp, 1500-bp, and 2000-bp bands. B, the 0.8% agarose gel from A was transferred to a Nytran membrane by capillary action, the
DNA was fixed to the membrane in a vacuum oven, and DPPI- and G3PDH-specific [a-32P]deoxyCTP radiolabeled probes were used to quantitatively
assess mRNA expression using the Ambis computer-controlled b emission counter. C shows quantitatively the number of cpm/mm2 detected by the Ambis
counter during a 12-h scan.
The Journal of Immunology
5883
FIGURE 2. Expression of mRNA in thymocytes and spleen cells. Highly purified CD32CD42CD82 (DN Thy), CD41CD81 (DP Thy), CD41CD82
(CD41 Thy), and CD81CD42 (CD81 Thy) thymocytes as well as CD41 or CD81 spleen cells were isolated and assessed by RT-PCR for DPPI, granzyme
A, and G3PDH mRNA. The results represent the means 6 SEM of values obtained from three independent experiments.
of the family of granule serine proteases or granzymes expressed
in activated CTLs. The present findings indicate that the expression of high levels of DPPI antecedes or is concomitant with that
Discussion
DPPI is a lysosomal cysteine protease previously noted to play a
role in the posttranslational processing and activation of members
FIGURE 3. Expression of DPPI enzymatic activity in thymocytes and
spleen cells. Highly purified thymocyte and spleen cell populations as described in Figure 2 were lysed and assessed for hydrolysis of the DPPI
substrate glycylphenylalanyl-b-naphthylamide. DPPI-specific activity is
expressed as units of activity per mg protein (U/mg) with 1 U 5 1 nmol
bNA released per minute. The results represent the means 6 SEM of
values obtained from three independent experiments.
FIGURE 4. DPPI and granzyme A mRNA expression following alloAg
stimulation. B6(H-2b) spleen cells were cultured with irradiated, T celldepleted DBA/2(H-2d) stimulator cells in a 5-day MLC. At the indicated
time points, CD81 T cells were isolated and assayed for DPPI, granzyme
A, and G3PDH mRNA expression; two representative experiments are
presented.
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
and assayed for DPPI and granzyme A mRNA expression (Fig. 4)
and enzymatic activity (Fig. 5). In contrast to the readily detectable
levels of DPPI and granzyme A mRNA noted in freshly isolated
CD81 spleen cells before allostimulation, the levels of both types
of mRNA were greatly reduced or undetectable after 1 to 2 days in
MLCs. In contrast to granzyme A mRNA expression, which reappeared on day 3 of MLC and continued to increase through day
5 of activation, DPPI mRNA levels were up-regulated earlier and
peaked by day 3 or day 4 of culture as noted in the two representative experiments outlined in Figure 4.
As described in Figure 5, in vitro-activated CD81 CTLs displayed a reduction in DPPI enzymatic activity on day 2 of the
MLC, with a subsequent up-regulation of DPPI enzymatic activity
by day 3 that continued throughout the remainder of the 5-day
MLC. In contrast, BLT esterase activity, a measure of trypsin-like
protease activity that is mediated largely, although not exclusively,
by granzyme A in CD81 T cells (35), decreased following initial
stimulation, returned to preactivation levels at day 3, and then
continued to increase to much higher levels by day 5 of the MLC.
5884
DIPEPTIDYL PEPTIDASE I EXPRESSION DURING T CELL ONTOGENY
FIGURE 5. Expression of DPPI and BLT esterase activities following in vitro alloAg stimulation. CD81 B6 spleen T cells were activated in MLCs as
described in Figure 4 and then assessed for DPPI and BLT activity. These data correspond to experiment 1 only.
occurring in CD81CD42 thymocytes with no apparent gene transcription during intermediate phases of thymocyte differentiation.
Following intrathymic selection and differentiation, single-positive lymphocytes emerge from the thymus and migrate to peripheral lymphoid organs, in which mature CD81 T cells continue to
express both DPPI mRNA and enzymatic activity. In agreement
with previously reported studies (10) in which we detected immunoreactive and enzymatically active granzyme A in CD81 spleen
T cells, modest but readily detectable levels of granzyme A expression were detected in the freshly isolated spleen CD81 T cell
populations examined in the present studies. It remains unclear
whether this low level of granzyme A expression is present only in
a subset(s) of CD81 T cells, such as cells that have recently emigrated from the thymus or T cells recently stimulated by Ag.
However, the results of previously published studies using dipeptide ester substrates of DPPI to identify cells expressing high levels
of this enzyme suggest that the majority of human peripheral blood
and mouse spleen CD81 T cells continue to express high levels of
DPPI enzyme activity (15, 16).
In contrast to the similarities between the patterns of DPPI and
granzyme A expression in thymocytes and spleen T cells, granzyme B mRNA is reportedly expressed equally in CD41CD82 and
CD81CD42 thymocytes (19) but not in splenic CD81 T cells. In
additional studies (data not shown) using granzyme B-specific
PCR primers and RT-PCR mRNA assay conditions similar to
those that detect granzyme A and DPPI mRNA in CD81 spleen T
cells, we were unable to detect granzyme B mRNA in CD81
spleen T cells.
When spleen T cells were stimulated with alloAg, it was observed the levels of both granzyme A and DPPI mRNA in CD81
cells declined to very low or undetectable levels during the first 1
to 2 days of the 5-day MLC. Following an initial reduction in
expression during the first 2 days of culture, DPPI mRNA expression in CD81 T cells was induced over the next 24 to 48 h; peak
levels of DPPI mRNA expression in CD81 T cells were observed
during day 3 or day 4 of activation. In contrast, granzyme A
mRNA expression was highest at the end of the 5-day MLC.
These findings regarding the expression of DPPI during alloAginduced activation of CD81 T cells are in contrast to recent reports
which suggest that DPPI mRNA is constitutively expressed in both
resting and in vitro-activated mouse spleen cells (24). The discrepancies may be secondary to the use of highly purified CD81 T cells
in the present studies, while previous attempts to follow DPPI
mRNA levels during the activation of mouse spleen T cells assessed mRNA levels in whole spleen cell populations and thus
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
of granzyme A not only during the activation of CTLs but also
during the earlier stages of T lymphocyte ontogeny.
When thymocyte subsets were examined for DPPI mRNA expression and enzymatic activity, DPPI mRNA expression was
found to be significantly higher in immature CD32CD42CD82
thymocytes and more differentiated CD81CD42 thymocytes than
in intermediate stage CD41CD81 thymocytes or in the corresponding CD41CD82 population of more differentiated, singlepositive thymocytes. Of interest, even though CD32CD42CD82
thymocytes expressed very high levels of DPPI mRNA, these cells
were found to express similar or only slightly greater amounts of
DPPI enzymatic activity than other thymocyte subsets expressing
little or no DPPI mRNA. In addition, while DPPI mRNA levels
appear to fall to very low or undetectable levels in CD41CD81
and CD41CD82 thymocytes, low levels of DPPI enzymatic activity remain detectable in these cells. The disparate expression of
DPPI mRNA and enzymatic activity in these thymocyte populations likely relates to differences in mRNA and protein half-life or
to other posttranscriptional regulatory mechanisms.
The present findings suggest that DPPI gene expression is activated before or immediately after the migration of T cell precursors to the thymus. The concomitant expression of both DPPI and
granzyme A (our observations and Refs. 18 and 19) as well as
granzyme B (18, 19) at this early stage of T cell development
suggests that enzymatically active forms of granzyme A and B
could theoretically be produced in these cells. However, we have
not found detectable levels of BLT esterase activity in lysates of
double-negative thymocytes in additional studies (data not shown).
These findings are in agreement with the observation by Ebnet et
al. (19) that BLT esterase activity was not able to be detected by
histochemical techniques in CD42CD82 thymocytes. The absence
of detectable levels of granzyme A-like enzymatic activity in these
cells may be related to the relatively low levels of enzymatically
active DPPI that appear to accumulate in these cells before the
down-regulation of DPPI mRNA during subsequent thymic differentiation steps. Prior studies have noted that granzyme processing
and activation only proceed efficiently in cells expressing relatively high levels of DPPI enzymatic activity (11). The present
findings also indicate that while DPPI expression is reduced during
positive and negative selection processes in the thymus, DPPI expression is up-regulated again following the acquisition of the
CD81CD42 phenotype before CD81 T cells egress to the periphery. Granzyme A expression in the thymus follows a pattern similar to that of DPPI, with the highest level of mRNA and enzymatically active protein (additional data not shown) expression
The Journal of Immunology
References
1. Izumiya, N., and J. S. Fruton. 1956. Specificity of cathepsin C. J. Biol. Chem.
218:59.
2. Voynick, I. M., and J. S. Fruton. 1968. The specificity of dipeptidyl transferase.
Biochemistry. 7:40.
3. McDonald, J. K., B. B. Zeitman, T. J. Reilly, and S. Ellis. 1969. New observations of the substrate specificity of cathepsin C (dipeptidyl aminopeptidase I).
J. Biol. Chem. 244:2693.
4. McDonald, J. K., B. B. Zeitman, and S. Ellis. 1972. Detection of a lysosomal
carboxypeptidase and a lysosomal dipeptidase in highly purified dipeptidyl aminopeptidase I (cathepsin C) and the elimination of their activities from preparations used to sequence peptides. Biochem. Biophys. Res. Commun. 46:62.
5. Coffey, J. W., and C. de Duve. 1968. Digestive activity of lysosomes. J. Biol.
Chem. 243:3255.
6. Katunuma, N., and E. Kominami. 1989. Intracellular Proteolysis: Mechanisms
and Regulations. Japan Scientific Press, Tokyo.
7. Thiele, D. L., and P. E. Lipsky. 1990. Mechanisms of L-leucyl-L–leucine methyl
ester-mediated killing of cytotoxic lymphocytes: dependence on a lysosomal thiol
protease, dipeptidyl peptidase-I, that is enriched in these cells. Proc. Natl. Acad.
Sci. USA 87:83.
8. Thiele, D. L., and P. E. Lipsky. 1990. The action of leucyl-leucine methyl ester
on cytotoxic lymphocytes requires uptake by a novel dipeptide-specific facilitated
transport system and dipeptidyl peptidase I-mediated conversion to membranolytic products. J. Exp. Med. 172:183.
9. McGuire, M. J., P. E. Lipsky, and D. L. Thiele. 1992. Purification and characterization of dipeptidyl peptidase I from human spleen. Arch. Biochem. Biophys.
295:280.
10. Brown, G. R., M. J. McGuire, and D. L. Thiele. 1993. Dipeptidyl peptidase-I is
enriched in granules of in vitro- and in vivo-activated CTLs. J. Immunol. 150:
4733.
11. Smyth, M. J., M. J. McGuire, and K. Y. Thia. 1995. Expression of recombinant
human granzyme B: a processing and activation role for dipeptidyl peptidase I.
J. Immunol 154:6299.
12. Caputo, A., R. S. Garner, U. Winkler, D. Hudig, and R. C. Bleackley. 1993.
Activation of recombinant murine cytotoxic cell proteinase-1 requires deletion of
an amino-terminal dipeptide. J. Biol. Chem. 268:17672.
13. Dikov, M. M., E. B. Springman, S. Yeaola, and W. E. Serafin. 1994. Processing
of procarboxypeptidase A and other zymogens in murine mast cells. J. Biol.
Chem. 269:25897.
14. McGuire, M. J., P. E. Lipsky, and D. L. Thiele. 1993. Generation of active
myeloid and lymphoid granule serine proteases requires processing by the granule thiol protease dipeptidyl peptidase I. J. Biol. Chem. 268:2458.
15. Thiele, D. L., and P. E. Lipsky. 1986. The immunosuppressive activity of Lleucyl-L-leucine methyl ester: selective ablation of cytotoxic lymphocytes and
monocytes. J. Immunol. 136:1038.
16. Thiele, D. L., M. R. Charley, J. A. Calomeni, and P. E. Lipsky. 1987. Lethal
graft-vs-host disease across major histocompatibility barriers: requirement for
leucyl-leucine methyl ester-sensitive cytotoxic T cells. J. Immunol. 138:51.
17. Thiele, D. L., S. E. Bryde, and P. E. Lipsky. 1988. Lethal graft-vs-host disease
induced by a class II MHC antigen only disparity is not mediated by cytotoxic T
cells. J. Immunol. 141:3377.
18. Held, W., H. R. MacDonald, and C. Mueller. 1990. Expression of genes encoding
cytotoxic cell-associated serine proteases in thymocytes. Int. Immunol. 2:57.
19. Ebnet, K., C. N. Levelt, T. T. Tran, K. Eichmann, and M. M. Simon. 1995.
Transcription of granzyme A and B genes is differentially regulated during lymphoid ontogeny. J. Exp. Med. 181:755.
20. Zuniga-Pflucker, J. D., H. L. Schwartz, and M. J. Lenardo. 1993. Gene transcription in differentiating immature T cell receptorneg thymocytes resembles antigenactivated mature T cells. J. Exp. Med. 178:1139.
21. Montgomery, R. A., and M. J. Dallman. 1991. Analysis of cytokine gene expression during fetal thymic ontogeny using the polymerase chain reaction. J. Immunol. 147:554.
22. Prendergast, J. A., C. D. Helgason, and R. C. Bleackley. 1992. Quantitative
polymerase chain reaction analysis of cytotoxic cell proteinase gene transcripts in
T cells. J. Biol. Chem. 267:5090.
23. Rao, N. V., G. V. Rao, and J. R. Hoidal. 1997. Human dipeptidyl-peptidase-I.
J. Biol. Chem. 272:10260.
24. Pham, C. T. N., R. J. Armstrong, D. B. Zimonjic, N. C. Popescu, D. G. Payan,
and T. J. Ley. 1997. Molecular cloning, chromosomal localization, and expression of murine dipeptidyl peptidase I. J. Biol. Chem. 272:10695.
25. Dialynas, D. P., D. B. Wilde, P. Marrack, A. Pierres, K. A. Wall, W. Havran, G.
Otten, M. R. Loken, M. Pierres, J. Kappler, and F. W. Fitch. 1983. Characterization of the murine antigenic determinant, designated L3T4a, recognized by
monoclonal antibody GK1.5: expression of L3T4a by functional T cell clones
appears to correlate primarily with class II MHC antigen-reactivity. Immunol.
Rev. 74:29.
26. Cobbold, S. P., A. Jayasuriya, A. Nash, T. D. Prospero, and H. Waldmann. 1984.
Therapy with monoclonal antibodies by elimination of T-cell subsets in vivo.
Nature 312:548.
27. Sentman, C. L., J. Hackett, Jr., V. Kumar, and M. Bennett. 1989. Identification of
a subset of murine natural killer cells that mediates rejection of HH-1d but not
Hh-1b bone marrow grafts. J. Exp. Med. 170:191.
28. Garni-Wagner, B. S., P. L. Witte, M. M. Tutt, W. A. Kuziel, P. W. Tucker,
M. Bennet, and V. Kumar. 1990. Natural killer cells in the thymus: studies in
mice with severe combined immune deficiency. J. Immunol. 144:796.
29. Ozato, K., and D. H. Sachs. 1981. Monoclonal antibodies to mouse MHC antigens: hybridoma antibodies reacting to antigens of the H-2b haplotype reveal
genetic control of isotype expression. J. Immunol. 126:317.
30. Leo, O., M. Foo, D. H. Sachs, L. E. Samuelson, and J. A. Bluestone. 1987.
Identification of a monoclonal antibody specific for a murine T3 polypeptide.
Proc. Natl. Acad. Sci. USA 84:1374.
31. Miltenyi, S., W. Muller, W. Weichel, and A. Radbruch. 1990. High gradient
magnetic cell separation with MACS. Cytometry 11:231.
32. Suzuki, R., S. Suzuki, N. Ebina, and K. Kumagai. 1985. Suppression of alloimmune cytotoxic T lymphocyte (CTL) generation by depletion of NK cells and
restoration by interferon and/or interleukin 2. J. Immunol. 134:2139.
33. Green, G. D. J., and E. Shaw. 1979. Thiolbenzyl benzyloxycarbonyl-L-lysinate,
substrate for a sensitive colorimetric assay for trypsin-like enzymes. Anal. Biochem. 93:223.
34. McGuire, M. J., P. E. Lipsky, and D. L. Thiele. 1997. Cloning and characterization of the cDNA encoding mouse dipeptidyl peptidase I (cathepsin C). Biochim.
Biophys. Acta 1351:267.
35. Ebnet, K., M. Hausmann, F. Lehmann-Grube, A. Mullbacher, M. Kopf,
M. Lamers, and M. M. Simon. 1995. Granzyme A-deficient mice retain potent
cell-mediated cytotoxicity. EMBO J. 144230.
Downloaded from http://www.jimmunol.org/ by guest on February 6, 2015
could not distinguish the expression by CD81 T cells from DPPI
mRNA expressed by macrophages, NK cells, or other spleen cell
populations. The present findings are in agreement with prior reports that human lymphocyte DPPI mRNA expression is significantly up-regulated following in vitro activation (23).
The observation that DPPI mRNA expression and levels of enzymatic activity peak earlier in the course of CTL activation than
does granzyme A expression is consistent with the proposed requisite role that DPPI appears to play in posttranslational processing
and the activation of granzymes. Thus, DPPI is expressed immediately before and during periods of peak granzyme A expression
during both lymphoid ontogeny and again during the Ag-specific
activation of CTLs. These data are consistent with other observations suggesting that a critical level of DPPI enzymatic activity is
required for the production of active granzyme B in transfected
COS cells (11). Therefore, the observed temporal sequence of
DPPI and granzyme A expression during alloAg stimulation is
teleologically appropriate. These findings suggest that the expression of high levels of DPPI is part of a multigene activation sequence leading to the expression of high levels of granule proteases in CTLs at selected stages of T cell ontogeny and T cell
immune responses.
5885