1. travel
2. tourist destinations
3. africa

African Journal of
Biotechnology
Volume 14 Number 9, 3 March, 2015
ISSN 1684-5315
ABOUT AJB
The African Journal of Biotechnology (AJB) (ISSN 1684-5315) is published weekly (one volume per year) by
Academic Journals.
African Journal of Biotechnology (AJB), a new broad-based journal, is an open access journal that was founded
on two key tenets: To publish the most exciting research in all areas of applied biochemistry, industrial
microbiology, molecular biology, genomics and proteomics, food and agricultural technologies, and metabolic
engineering. Secondly, to provide the most rapid turn-around time possible for reviewing and publishing, and to
disseminate the articles freely for teaching and reference purposes. All articles published in AJB are peerreviewed.
Submission of Manuscript
Please read the Instructions for Authors before submitting your manuscript. The manuscript files should be given
the last name of the first author
Click here to Submit manuscripts online
If you have any difficulty using the online submission system, kindly submit via this email
[email protected].
With questions or concerns, please contact the Editorial Office at [email protected].
Editor-In-Chief
Associate Editors
George Nkem Ude, Ph.D
Plant Breeder & Molecular Biologist
Department of Natural Sciences
Crawford Building, Rm 003A
Bowie State University
14000 Jericho Park Road
Bowie, MD 20715, USA
Prof. Dr. AE Aboulata
Plant Path. Res. Inst., ARC, POBox 12619, Giza, Egypt
30 D, El-Karama St., Alf Maskan, P.O. Box 1567,
Ain Shams, Cairo,
Egypt
Editor
N. John Tonukari, Ph.D
Department of Biochemistry
Delta State University
PMB 1
Abraka, Nigeria
Dr. S.K Das
Department of Applied Chemistry
and Biotechnology, University of Fukui,
Japan
Prof. Okoh, A. I.
Applied and Environmental Microbiology Research
Group (AEMREG),
Department of Biochemistry and Microbiology,
University of Fort Hare.
P/Bag X1314 Alice 5700,
South Africa
Dr. Ismail TURKOGLU
Department of Biology Education,
Education Faculty, Fırat University,
Elazığ,
Turkey
Prof T.K.Raja, PhD FRSC (UK)
Department of Biotechnology
PSG COLLEGE OF TECHNOLOGY (Autonomous)
(Affiliated to Anna University)
Coimbatore-641004, Tamilnadu,
INDIA.
Dr. George Edward Mamati
Horticulture Department,
Jomo Kenyatta University of Agriculture
and Technology,
P. O. Box 62000-00200,
Nairobi, Kenya.
Dr. Gitonga
Kenya Agricultural Research Institute,
National Horticultural Research Center,
P.O Box 220,
Thika, Kenya.
Editorial Board
Prof. Sagadevan G. Mundree
Department of Molecular and Cell Biology
University of Cape Town
Private Bag Rondebosch 7701
South Africa
Dr. Martin Fregene
Centro Internacional de Agricultura Tropical (CIAT)
Km 17 Cali-Palmira Recta
AA6713, Cali, Colombia
Prof. O. A. Ogunseitan
Laboratory for Molecular Ecology
Department of Environmental Analysis and Design
University of California,
Irvine, CA 92697-7070. USA
Dr. Ibrahima Ndoye
UCAD, Faculte des Sciences et Techniques
Departement de Biologie Vegetale
BP 5005, Dakar, Senegal.
Laboratoire Commun de Microbiologie
IRD/ISRA/UCAD
BP 1386, Dakar
Dr. Bamidele A. Iwalokun
Biochemistry Department
Lagos State University
P.M.B. 1087. Apapa – Lagos, Nigeria
Dr. Jacob Hodeba Mignouna
Associate Professor, Biotechnology
Virginia State University
Agricultural Research Station Box 9061
Petersburg, VA 23806, USA
Dr. Bright Ogheneovo Agindotan
Plant, Soil and Entomological Sciences Dept
University of Idaho, Moscow
ID 83843, USA
Dr. A.P. Njukeng
Département de Biologie Végétale
Faculté des Sciences
B.P. 67 Dschang
Université de Dschang
Rep. du CAMEROUN
Dr. E. Olatunde Farombi
Drug Metabolism and Toxicology Unit
Department of Biochemistry
University of Ibadan, Ibadan, Nigeria
Dr. Stephen Bakiamoh
Michigan Biotechnology Institute International
3900 Collins Road
Lansing, MI 48909, USA
Dr. N. A. Amusa
Institute of Agricultural Research and Training
Obafemi Awolowo University
Moor Plantation, P.M.B 5029, Ibadan, Nigeria
Dr. Desouky Abd-El-Haleem
Environmental Biotechnology Department &
Bioprocess Development Department,
Genetic Engineering and Biotechnology Research
Institute (GEBRI),
Mubarak City for Scientific Research and Technology
Applications,
New Burg-Elarab City, Alexandria, Egypt.
Dr. Simeon Oloni Kotchoni
Department of Plant Molecular Biology
Institute of Botany, Kirschallee 1,
University of Bonn, D-53115 Germany.
Dr. Eriola Betiku
German Research Centre for Biotechnology,
Biochemical Engineering Division,
Mascheroder Weg 1, D-38124,
Braunschweig, Germany
Dr. Daniel Masiga
International Centre of Insect Physiology and
Ecology,
Nairobi,
Kenya
Dr. Essam A. Zaki
Genetic Engineering and Biotechnology Research
Institute, GEBRI,
Research Area,
Borg El Arab, Post Code 21934, Alexandria
Egypt
Dr. Alfred Dixon
International Institute of Tropical Agriculture (IITA)
PMB 5320, Ibadan
Oyo State, Nigeria
Dr. Sankale Shompole
Dept. of Microbiology, Molecular Biology and
Biochemisty,
University of Idaho, Moscow,
ID 83844, USA.
Dr. Mathew M. Abang
Germplasm Program
International Center for Agricultural Research in the
Dry Areas
(ICARDA)
P.O. Box 5466, Aleppo, SYRIA.
Dr. Solomon Olawale Odemuyiwa
Pulmonary Research Group
Department of Medicine
550 Heritage Medical Research Centre
University of Alberta
Edmonton
Canada T6G 2S2
Prof. Anna-Maria Botha-Oberholster
Plant Molecular Genetics
Department of Genetics
Forestry and Agricultural Biotechnology Institute
Faculty of Agricultural and Natural Sciences
University of Pretoria
ZA-0002 Pretoria, South Africa
Dr. O. U. Ezeronye
Department of Biological Science
Michael Okpara University of Agriculture
Umudike, Abia State, Nigeria.
Dr. Joseph Hounhouigan
Maître de Conférence
Sciences et technologies des aliments
Faculté des Sciences Agronomiques
Université d'Abomey-Calavi
01 BP 526 Cotonou
République du Bénin
Prof. Christine Rey
Dept. of Molecular and Cell Biology,
University of the Witwatersand,
Private Bag 3, WITS 2050, Johannesburg, South
Africa
Dr. Kamel Ahmed Abd-Elsalam
Molecular Markers Lab. (MML)
Plant Pathology Research Institute (PPathRI)
Agricultural Research Center, 9-Gamma St., Orman,
12619,
Giza, Egypt
Dr. Jones Lemchi
International Institute of Tropical Agriculture (IITA)
Onne, Nigeria
Prof. Greg Blatch
Head of Biochemistry & Senior Wellcome Trust
Fellow
Department of Biochemistry, Microbiology &
Biotechnology
Rhodes University
Grahamstown 6140
South Africa
Dr. Beatrice Kilel
P.O Box 1413
Manassas, VA 20108
USA
Dr. Jackie Hughes
Research-for-Development
International Institute of Tropical Agriculture (IITA)
Ibadan, Nigeria
Dr. Robert L. Brown
Southern Regional Research Center,
U.S. Department of Agriculture,
Agricultural Research Service,
New Orleans, LA 70179.
Dr. Deborah Rayfield
Physiology and Anatomy
Bowie State University
Department of Natural Sciences
Crawford Building, Room 003C
Bowie MD 20715,USA
Dr. Marlene Shehata
University of Ottawa Heart Institute
Genetics of Cardiovascular Diseases
40 Ruskin Street
K1Y-4W7, Ottawa, ON, CANADA
Dr. Hany Sayed Hafez
The American University in Cairo,
Egypt
Dr. Clement O. Adebooye
Department of Plant Science
Obafemi Awolowo University, Ile-Ife
Nigeria
Dr. Ali Demir Sezer
Marmara Üniversitesi Eczacilik Fakültesi,
Tibbiye cad. No: 49, 34668, Haydarpasa, Istanbul,
Turkey
Dr. Ali Gazanchain
P.O. Box: 91735-1148, Mashhad,
Iran.
Dr. Anant B. Patel
Centre for Cellular and Molecular Biology
Uppal Road, Hyderabad 500007
India
Dr. Yee-Joo TAN
Department of Microbiology
Yong Loo Lin School of Medicine,
National University Health System (NUHS),
National University of Singapore
MD4, 5 Science Drive 2,
Singapore 117597
Singapore
Prof. Hidetaka Hori
Laboratories of Food and Life Science,
Graduate School of Science and Technology,
Niigata University.
Niigata 950-2181,
Japan
Prof. Thomas R. DeGregori
University of Houston,
Texas 77204 5019,
USA
Dr. Wolfgang Ernst Bernhard Jelkmann
Medical Faculty, University of Lübeck,
Germany
Prof. Arne Elofsson
Department of Biophysics and Biochemistry
Bioinformatics at Stockholm University,
Sweden
Dr. Moktar Hamdi
Department of Biochemical Engineering,
Laboratory of Ecology and Microbial Technology
National Institute of Applied Sciences and
Technology.
BP: 676. 1080,
Tunisia
Prof. Bahram Goliaei
Departments of Biophysics and Bioinformatics
Laboratory of Biophysics and Molecular Biology
University of Tehran, Institute of Biochemistry
and Biophysics
Iran
Dr. Salvador Ventura
Department de Bioquímica i Biologia Molecular
Institut de Biotecnologia i de Biomedicina
Universitat Autònoma de Barcelona
Bellaterra-08193
Spain
Dr. Nora Babudri
Dipartimento di Biologia cellulare e ambientale
Università di Perugia
Via Pascoli
Italy
Dr. Claudio A. Hetz
Faculty of Medicine, University of Chile
Independencia 1027
Santiago, Chile
Dr. S. Adesola Ajayi
Seed Science Laboratory
Department of Plant Science
Faculty of Agriculture
Obafemi Awolowo University
Ile-Ife 220005, Nigeria
Prof. Felix Dapare Dakora
Research Development and Technology Promotion
Cape Peninsula University of Technology,
Room 2.8 Admin. Bldg. Keizersgracht, P.O. 652,
Cape Town 8000,
South Africa
Dr. Geremew Bultosa
Department of Food Science and Post harvest
Technology
Haramaya University
Personal Box 22, Haramaya University Campus
Dire Dawa,
Ethiopia
Dr. José Eduardo Garcia
Londrina State University
Brazil
Prof. Nirbhay Kumar
Malaria Research Institute
Department of Molecular Microbiology and
Immunology
Johns Hopkins Bloomberg School of Public Health
E5144, 615 N. Wolfe Street
Baltimore, MD 21205
Prof. M. A. Awal
Department of Anatomy and Histplogy,
Bangladesh Agricultural University,
Mymensingh-2202,
Bangladesh
Prof. Christian Zwieb
Department of Molecular Biology
University of Texas Health Science Center at Tyler
11937 US Highway 271
Tyler, Texas 75708-3154
USA
Prof. Danilo López-Hernández
Instituto de Zoología Tropical, Facultad de
Ciencias,
Universidad Central de Venezuela.
Institute of Research for the Development (IRD),
Montpellier,
France
Prof. Donald Arthur Cowan
Department of Biotechnology,
University of the Western Cape Bellville 7535
Cape Town,
South Africa
Dr. Ekhaise Osaro Frederick
University Of Benin, Faculty of Life Science
Department of Microbiology
P. M. B. 1154, Benin City, Edo State,
Nigeria.
Dr. Luísa Maria de Sousa Mesquita Pereira
IPATIMUP R. Dr. Roberto Frias, s/n 4200-465 Porto
Portugal
Dr. Min Lin
Animal Diseases Research Institute
Canadian Food Inspection Agency
Ottawa, Ontario,
Canada K2H 8P9
Prof. Nobuyoshi Shimizu
Department of Molecular Biology,
Center for Genomic Medicine
Keio University School of Medicine,
35 Shinanomachi, Shinjuku-ku
Tokyo 160-8582,
Japan
Dr. Adewunmi Babatunde Idowu
Department of Biological Sciences
University of Agriculture Abia
Abia State,
Nigeria
Dr. Yifan Dai
Associate Director of Research
Revivicor Inc.
100 Technology Drive, Suite 414
Pittsburgh, PA 15219
USA
Dr. Zhongming Zhao
Department of Psychiatry, PO Box 980126,
Virginia Commonwealth University School of
Medicine,
Richmond, VA 23298-0126,
USA
Prof. Giuseppe Novelli
Human Genetics,
Department of Biopathology,
Tor Vergata University, Rome,
Italy
Dr. Moji Mohammadi
402-28 Upper Canada Drive
Toronto, ON, M2P 1R9 (416) 512-7795
Canada
Prof. Jean-Marc Sabatier
Directeur de Recherche Laboratoire ERT-62
Ingénierie des Peptides à Visée Thérapeutique,
Université de la Méditerranée-Ambrilia
Biopharma inc.,
Faculté de Médecine Nord, Bd Pierre Dramard,
13916,
Marseille cédex 20.
France
Dr. Fabian Hoti
PneumoCarr Project
Department of Vaccines
National Public Health Institute
Finland
Prof. Irina-Draga Caruntu
Department of Histology
Gr. T. Popa University of Medicine and Pharmacy
16, Universitatii Street, Iasi,
Romania
Dr. Dieudonné Nwaga
Soil Microbiology Laboratory,
Biotechnology Center. PO Box 812,
Plant Biology Department,
University of Yaoundé I, Yaoundé,
Cameroon
Dr. Gerardo Armando Aguado-Santacruz
Biotechnology CINVESTAV-Unidad Irapuato
Departamento Biotecnología
Km 9.6 Libramiento norte Carretera IrapuatoLeón Irapuato,
Guanajuato 36500
Mexico
Dr. Abdolkaim H. Chehregani
Department of Biology
Faculty of Science
Bu-Ali Sina University
Hamedan,
Iran
Dr. Abir Adel Saad
Molecular oncology
Department of Biotechnology
Institute of graduate Studies and Research
Alexandria University,
Egypt
Dr. Azizul Baten
Department of Statistics
Shah Jalal University of Science and Technology
Sylhet-3114,
Bangladesh
Dr. Bayden R. Wood
Australian Synchrotron Program
Research Fellow and Monash Synchrotron
Research Fellow Centre for Biospectroscopy
School of Chemistry Monash University Wellington
Rd. Clayton,
3800 Victoria,
Australia
Dr. G. Reza Balali
Molecular Mycology and Plant Pthology
Department of Biology
University of Isfahan
Isfahan
Iran
Dr. Beatrice Kilel
P.O Box 1413
Manassas, VA 20108
USA
Prof. H. Sunny Sun
Institute of Molecular Medicine
National Cheng Kung University Medical College
1 University road Tainan 70101,
Taiwan
Prof. Ima Nirwana Soelaiman
Department of Pharmacology
Faculty of Medicine
Universiti Kebangsaan Malaysia
Jalan Raja Muda Abdul Aziz
50300 Kuala Lumpur,
Malaysia
Prof. Tunde Ogunsanwo
Faculty of Science,
Olabisi Onabanjo University,
Ago-Iwoye.
Nigeria
Dr. Evans C. Egwim
Federal Polytechnic,
Bida Science Laboratory Technology Department,
PMB 55, Bida, Niger State,
Nigeria
Prof. George N. Goulielmos
Medical School,
University of Crete
Voutes, 715 00 Heraklion, Crete,
Greece
Dr. Uttam Krishna
Cadila Pharmaceuticals limited ,
India 1389, Tarsad Road,
Dholka, Dist: Ahmedabad, Gujarat,
India
Prof. Mohamed Attia El-Tayeb Ibrahim
Botany Department, Faculty of Science at Qena,
South Valley University, Qena 83523,
Egypt
Dr. Nelson K. Ojijo Olang’o
Department of Food Science & Technology,
JKUAT P. O. Box 62000, 00200, Nairobi,
Kenya
Dr. Pablo Marco Veras Peixoto
University of New York NYU College of Dentistry
345 E. 24th Street, New York, NY 10010
USA
Prof. T E Cloete
University of Pretoria Department of
Microbiology and Plant Pathology,
University of Pretoria,
Pretoria,
South Africa
Prof. Djamel Saidi
Laboratoire de Physiologie de la Nutrition et de
Sécurité
Alimentaire Département de Biologie,
Faculté des Sciences,
Université d’Oran, 31000 - Algérie
Algeria
Dr. Tomohide Uno
Department of Biofunctional chemistry,
Faculty of Agriculture Nada-ku,
Kobe., Hyogo, 657-8501,
Japan
Dr. Ulises Urzúa
Faculty of Medicine,
University of Chile Independencia 1027, Santiago,
Chile
Dr. Aritua Valentine
National Agricultural Biotechnology Center,
Kawanda
Agricultural Research Institute (KARI)
P.O. Box, 7065, Kampala,
Uganda
Prof. Yee-Joo Tan
Institute of Molecular and Cell Biology 61 Biopolis
Drive,
Proteos, Singapore 138673
Singapore
Prof. Viroj Wiwanitkit
Department of Laboratory Medicine,
Faculty of Medicine, Chulalongkorn University,
Bangkok
Thailand
Dr. Thomas Silou
Universit of Brazzaville BP 389
Congo
Prof. Burtram Clinton Fielding
University of the Western Cape
Western Cape,
South Africa
Dr. Brnčić (Brncic) Mladen
Faculty of Food Technology and Biotechnology,
Pierottijeva 6,
10000 Zagreb,
Croatia.
Dr. Meltem Sesli
College of Tobacco Expertise,
Turkish Republic, Celal Bayar University 45210,
Akhisar, Manisa,
Turkey.
Dr. Idress Hamad Attitalla
Omar El-Mukhtar University,
Faculty of Science,
Botany Department,
El-Beida, Libya.
Dr. Linga R. Gutha
Washington State University at Prosser,
24106 N Bunn Road,
Prosser WA 99350-8694.
Dr Helal Ragab Moussa
Bahnay, Al-bagour, Menoufia,
Egypt.
Dr VIPUL GOHEL
DuPont Industrial Biosciences
Danisco (India) Pvt Ltd
5th Floor, Block 4B,
DLF Corporate Park
DLF Phase III
Gurgaon 122 002
Haryana (INDIA)
Dr Takuji Ohyama
Faculty of Agriculture, Niigata University
Dr Mehdi Vasfi Marandi
University of Tehran
Dr FÜgen DURLU-ÖZKAYA
Gazi Üniversity, Tourism Faculty, Dept. of
Gastronomy and Culinary Art
Dr. Reza Yari
Islamic Azad University, Boroujerd Branch
Dr. Sang-Han Lee
Department of Food Science & Biotechnology,
Kyungpook National University
Daegu 702-701,
Korea.
Dr Zahra Tahmasebi Fard
Roudehen branche, Islamic Azad University
Dr. Bhaskar Dutta
DoD Biotechnology High Performance Computing
Software Applications
Institute (BHSAI)
U.S. Army Medical Research and Materiel
Command
2405 Whittier Drive
Frederick, MD 21702
Dr Ping ZHENG
Zhejiang University, Hangzhou, China
Dr. Muhammad Akram
Faculty of Eastern Medicine and Surgery,
Hamdard Al-Majeed College of Eastern Medicine,
Hamdard University,
Karachi.
Prof. Pilar Morata
University of Malaga
Dr. M. Muruganandam
Departtment of Biotechnology
St. Michael College of Engineering & Technology,
Kalayarkoil,
India.
Dr Hsiu-Chi Cheng
National Cheng Kung University and Hospital.
Dr. Gökhan Aydin
Suleyman Demirel University,
Atabey Vocational School,
Isparta-Türkiye,
Dr. Rajib Roychowdhury
Centre for Biotechnology (CBT),
Visva Bharati,
West-Bengal,
India.
Dr Albert Magrí
Giro Technological Centre
Dr. Kgomotso P. Sibeko
University of Pretoria
Dr Greg Spear
Rush University Medical Center
Dr Jian Wu
Harbin medical university , China
Prof. Pavel Kalac
University of South Bohemia, Czech Republic
Dr Kürsat Korkmaz
Ordu University, Faculty of Agriculture,
Department of Soil Science and Plant Nutrition
Dr. Shuyang Yu
Department of Microbiology, University of Iowa
Address: 51 newton road, 3-730B BSB bldg. Iowa
City, IA, 52246, USA
Dr. Binxing Li
Dr. Mousavi Khaneghah
College of Applied Science and TechnologyApplied Food Science, Tehran, Iran.
Dr. Qing Zhou
Department of Biochemistry and Molecular
Biology,
Oregon Health and Sciences University Portland.
Dr Legesse Adane Bahiru
Department of Chemistry,
Jimma University,
Ethiopia.
Dr James John
School Of Life Sciences,
Pondicherry University,
Kalapet, Pondicherry
Instructions for Author
Electronic submission of manuscripts is strongly
encouraged, provided that the text, tables, and figures are
included in a single Microsoft Word file (preferably in Arial
font).
The cover letter should include the corresponding author's
full address and telephone/fax numbers and should be in
an e-mail message sent to the Editor, with the file, whose
name should begin with the first author's surname, as an
attachment.
Article Types
Three types of manuscripts may be submitted:
Regular articles: These should describe new and carefully
confirmed findings, and experimental procedures should
be given in sufficient detail for others to verify the work.
The length of a full paper should be the minimum required
to describe and interpret the work clearly.
Short Communications: A Short Communication is suitable
for recording the results of complete small investigations
or giving details of new models or hypotheses, innovative
methods, techniques or apparatus. The style of main
sections need not conform to that of full-length papers.
Short communications are 2 to 4 printed pages (about 6 to
12 manuscript pages) in length.
Reviews: Submissions of reviews and perspectives covering
topics of current interest are welcome and encouraged.
Reviews should be concise and no longer than 4-6 printed
pages (about 12 to 18 manuscript pages). Reviews are also
peer-reviewed.
Review Process
All manuscripts are reviewed by an editor and members of
the Editorial Board or qualified outside reviewers. Authors
cannot nominate reviewers. Only reviewers randomly
selected from our database with specialization in the
subject area will be contacted to evaluate the manuscripts.
The process will be blind review.
Decisions will be made as rapidly as possible, and the
journal strives to return reviewers’ comments to authors as
fast as possible. The editorial board will re-review
manuscripts that are accepted pending revision. It is the
goal of the AJFS to publish manuscripts within weeks after
submission.
Regular articles
All portions of the manuscript must be typed doublespaced and all pages numbered starting from the title
page.
The Title should be a brief phrase describing the contents
of the paper. The Title Page should include the authors'
full names and affiliations, the name of the corresponding
author along with phone, fax and E-mail information.
Present addresses of authors should appear as a footnote.
The Abstract should be informative and completely selfexplanatory, briefly present the topic, state the scope of
the experiments, indicate significant data, and point out
major findings and conclusions. The Abstract should be
100 to 200 words in length.. Complete sentences, active
verbs, and the third person should be used, and the
abstract should be written in the past tense. Standard
nomenclature should be used and abbreviations should
be avoided. No literature should be cited.
Following the abstract, about 3 to 10 key words that will
provide indexing references should be listed.
A list of non-standard Abbreviations should be added. In
general, non-standard abbreviations should be used only
when the full term is very long and used often. Each
abbreviation should be spelled out and introduced in
parentheses the first time it is used in the text. Only
recommended SI units should be used. Authors should
use the solidus presentation (mg/ml). Standard
abbreviations (such as ATP and DNA) need not be defined.
The Introduction should provide a clear statement of the
problem, the relevant literature on the subject, and the
proposed approach or solution. It should be
understandable to colleagues from a broad range of
scientific disciplines.
Materials and methods should be complete enough to
allow experiments to be reproduced. However, only truly
new procedures should be described in detail; previously
published procedures should be cited, and important
modifications of published procedures should be
mentioned briefly. Capitalize trade names and include the
manufacturer's name and address. Subheadings should be
used. Methods in general use need not be described in
detail.
Results should be presented with clarity and precision.
The results should be written in the past tense when
describing findings in the authors' experiments.
Previously published findings should be written in the
present tense. Results should be explained, but largely
without referring to the literature.
Discussion,
speculation and detailed interpretation of data should
not be included in the Results but should be put into the
Discussion section.
The Discussion should interpret the findings in view of
the results obtained in this and in past studies on this
topic. State the conclusions in a few sentences at the end
of the paper. The Results and Discussion sections can
include subheadings, and when appropriate, both
sections can be combined.
The Acknowledgments of people, grants, funds, etc
should be brief.
Tables should be kept to a minimum and be designed to
be as simple as possible. Tables are to be typed doublespaced throughout, including headings and footnotes.
Each table should be on a separate page, numbered
consecutively in Arabic numerals and supplied with a
heading and a legend. Tables should be self-explanatory
without reference to the text. The details of the methods
used in the experiments should preferably be described
in the legend instead of in the text. The same data should
not be presented in both table and graph form or
repeated in the text.
Figure legends should be typed in numerical order on a
separate sheet. Graphics should be prepared using
applications capable of generating high resolution GIF,
TIFF, JPEG or Powerpoint before pasting in the Microsoft
Word manuscript file. Tables should be prepared in
Microsoft Word. Use Arabic numerals to designate
figures and upper case letters for their parts (Figure 1).
Begin each legend with a title and include sufficient
description so that the figure is understandable without
reading the text of the manuscript. Information given in
legends should not be repeated in the text.
References: In the text, a reference identified by means
of an author‘s name should be followed by the date of
the reference in parentheses. When there are more than
two authors, only the first author‘s name should be
mentioned, followed by ’et al‘. In the event that an
author cited has had two or more works published during
the same year, the reference, both in the text and in the
reference list, should be identified by a lower case letter
like ’a‘ and ’b‘ after the date to distinguish the works.
Examples:
Abayomi (2000), Agindotan et al. (2003), (Kelebeni,
1983), (Usman and Smith, 1992), (Chege, 1998;
1987a,b; Tijani, 1993,1995), (Kumasi et al., 2001)
References should be listed at the end of the paper in
alphabetical order. Articles in preparation or articles
submitted for publication, unpublished observations,
personal communications, etc. should not be included
in the reference list but should only be mentioned in
the article text (e.g., A. Kingori, University of Nairobi,
Kenya, personal communication). Journal names are
abbreviated according to Chemical Abstracts. Authors
are fully responsible for the accuracy of the references.
Examples:
Chikere CB, Omoni VT and Chikere BO (2008).
Distribution of potential nosocomial pathogens in a
hospital environment. Afr. J. Biotechnol. 7: 3535-3539.
Moran GJ, Amii RN, Abrahamian FM, Talan DA (2005).
Methicillinresistant
Staphylococcus
aureus
in
community-acquired skin infections. Emerg. Infect. Dis.
11: 928-930.
Pitout JDD, Church DL, Gregson DB, Chow BL,
McCracken M, Mulvey M, Laupland KB (2007).
Molecular
epidemiology
of
CTXM-producing
Escherichia coli in the Calgary Health Region:
emergence
of
CTX-M-15-producing
isolates.
Antimicrob. Agents Chemother. 51: 1281-1286.
Pelczar JR, Harley JP, Klein DA (1993). Microbiology:
Concepts and Applications. McGraw-Hill Inc., New York,
pp. 591-603.
Short Communications
Short Communications are limited to a maximum of
two figures and one table. They should present a
complete study that is more limited in scope than is
found in full-length papers. The items of manuscript
preparation
listed
above
apply
to
Short
Communications with the following differences: (1)
Abstracts are limited to 100 words; (2) instead of a
separate Materials and Methods section, experimental
procedures may be incorporated into Figure Legends
and Table footnotes; (3) Results and Discussion should
be combined into a single section.
Proofs and Reprints: Electronic proofs will be sent (email attachment) to the corresponding author as a PDF
file. Page proofs are considered to be the final version
of the manuscript. With the exception of typographical
or minor clerical errors, no changes will be made in the
manuscript at the proof stage.
Fees and Charges: Authors are required to pay a $650 handling fee. Publication of an article in the African Journal of
Biotechnology is not contingent upon the author's ability to pay the charges. Neither is acceptance to pay the
handling fee a guarantee that the paper will be accepted for publication. Authors may still request (in advance)
that the editorial office waive some of the handling fee under special circumstances
Copyright: © 2015, Academic Journals.
All rights Reserved. In accessing this journal, you agree that you will access the contents for your own personal use
but not for any commercial use. Any use and or copies of this Journal in whole or in part must include the customary
bibliographic citation, including author attribution, date and article title.
Submission of a manuscript implies: that the work described has not been published before (except in the form of an
abstract or as part of a published lecture, or thesis) that it is not under consideration for publication elsewhere; that if
and when the manuscript is accepted for publication, the authors agree to automatic transfer of the copyright to the
publisher.
Disclaimer of Warranties
In no event shall Academic Journals be liable for any special, incidental, indirect, or consequential damages of any
kind arising out of or in connection with the use of the articles or other material derived from the AJB, whether or
not advised of the possibility of damage, and on any theory of liability.
This publication is provided "as is" without warranty of any kind, either expressed or implied, including, but not
limited to, the implied warranties of merchantability, fitness for a particular purpose, or non-infringement.
Descriptions of, or references to, products or publications does not imply endorsement of that product or publication.
While every effort is made by Academic Journals to see that no inaccurate or misleading data, opinion or statements
appear in this publication, they wish to make it clear that the data and opinions appearing in the articles and
advertisements herein are the responsibility of the contributor or advertiser concerned. Academic Journals makes no
warranty of any kind, either express or implied, regarding the quality, accuracy, availability, or validity of the data or
information in this publication or of any other publication to which it may be linked.
African Journal of Biotechnology
International Journal of Medicine and Medical Sciences
Table of Contents: Volume 14 Number 9, 3 March, 2015
ARTICLES
Status and implementation of reproductive technologies in goats in
emerging countries
Aime J. Garza Arredondo, Adan González Gómez, José Fernando
Vázquez-Armijo, Rogelio Alejandro Ledezma-Torres, Hugo
Bernal-Barragán and Fernando Sánchez-Dávila
The nutritional efficiency of Coffea spp. A review
Lima Deleon Martins, Lindomar de Souza Machado, Marcelo
Antonio Tomaz and José Francisco Teixeira do Amaral
Recent characterization of cowpea aphid-borne mosaic virus (CABMV)
in Bahia State, Brazil, suggests potential regional isolation
José Romário Fernandes de Melo, Antonia dos Reis Figueira, Charles
Neris Moreira and Antonio Carlos de Oliveira
Validation of a reference gene for transcript analysis in cassava
(Manihot esculenta Crantz) and its application in analysis of linamarase
and α-hydroxynitrile lyase expression at different growth stages
Sukhuman Whankaew, Supajit Sraphet, Ratchadaporn Thaikert, Opas
Boonseng, Duncan R. Smith and Kanokporn Triwitayakorn
Detection of MspI polymorphism and the single nucleotide polymorphism
(SNP) of GH gene in camel breeds reared in Egypt
Sekena H. Abd El-Aziem, Heba A.M. Abd El-Kader, Sally S. Alam and Othman
E. Othman
Characterization of cathelicidin gene from buffalo (Bubalus bubalis)
Dhruba Jyoti Kalita
Bacterial mediated amelioration of drought stress in drought tolerant
and susceptible cultivars of rice (Oryza sativa L.)
Yogendra Singh Gusain, U. S. Singh and A. K. Sharma
Table of Contents: Volume 14 Number 9, 3 March, 2015
The efficacy of four gametocides for induction of pollen sterility in
Eragrostis tef (Zucc.) Trotter
Habteab Ghebrehiwot, Richard Burgdorf, Shimelis Hussein and Mark Laing
Genetic diversity of sweet yam “Dioscorea dumetorum “(Kunth) Pax
revealed by morphological traits in two agro-ecological zones of Cameroon
Christian Siadjeu, Gabriel MahbouSomoToukam, Joseph Martin Bell and
S. Nkwate
Isolation and characterization of some drought-related ESTs from barley
Alzahraa Radwan, Rania M. I. Abou Ali, Ahmed Nada, Wardaa Hashem,
Shireen Assem and Ebtissam Husein
Metabolic and biofungicidal properties of maize rhizobacteria for growth
promotion and plant disease resistance
Pacôme A. Noumavo, Nadège A. Agbodjato, Emma W. Gachomo, Hafiz A.
Salami, Farid Baba-Moussa, Adolphe Adjanohoun, Simeon O. Kotchoni and
Lamine Baba-Moussa
High-level lipase production by Aspergillus candidus URM 5611 under
solid state fermentation (SSF) using waste from Siagrus coronata
(Martius) Becari
Cyndy Mary Farias, Odacy Camilo de Souza, Minelli Albuquerque Sousa,
Roberta Cruz, Oliane Maria Correia Magalhães, Érika Valente de Medeiros,
Keila Aparecida Moreira and Cristina Maria de Souza-Motta
Effects of cashew nut shell liquid (CNSL) component upon Aedes aegypti
Lin. (Diptera: Culicidae) larvae’s midgut
Ajit Kumar Passari, Vineet Kumar Mishra, Vijai Kumar Gupta and Bhim
Pratap Singh
In vitro dilutions of thioridaxine with potential to enhance antibiotic
sensitivity in a multidrug resistant Staphylococcus aureus uropathogen
Otajevwo, F. D.
Vol. 14(9), pp. 719-727, 4 March, 2015
DOI: 10.5897/AJB2014.14300
Article Number: 7FCD94450949
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Review
Status and implementation of reproductive
technologies in goats in emerging countries
Aime J. Garza Arredondo1, Adan González Gómez2, José Fernando Vázquez-Armijo3, Rogelio
Alejandro Ledezma-Torres1, Hugo Bernal-Barragán2 and Fernando Sánchez-Dávila2*
1
Universidad Autónoma de Nuevo León, Facultad de Medicina Veterinaria y Zootecnia.
2
Universidad Autónoma de Nuevo León, Facultad de Agronomía, México.
3
Centro Universitario UAEM Temascaltepec, Universidad Autónoma del Estado de México.
Received 3 November, 2014; Accepted 19 February, 2015
In modern cattle breeding, assisted reproductive technologies in small ruminants have been used even
out-of-season breeding, but in emerging countries these technologies have been mainly used for
estrous synchronization and artificial insemination. However, in the last 30 years, significant progress
in the matter of transfers of in vivo derived and in vitro produced embryos has been achieved. Currently,
eight donor embryos are obtained by goat, due to the physiological knowledge of the presence of
dominant follicles; above alter results recovered embryos (4 embryos / donor). Whereas, the goat has
the advantage of presenting a shorter interval between generations compared to cow; this promote
more research in in vitro fertilization, and overcome the limitations presented in a traditional embryo
transfer. However cloning and transgenesis, are two techniques that will begin to have a commercial
application, because goats can be used as bioreactors to produce milk with specific proteins to develop
drugs. The objective of this study was to establish and describe in a general way the use of these
techniques in goats, to promote their use so as to achieve genetic improvement in goats.
Key words: Reproductive technologies, goats, estrous synchronization, embryo transfer.
INTRODUCTION
Worldwide, goat population is predominantly distributed
in tropical, subtropical and semi-desert rural areas under
unfavorable nutritional conditions (Holtz, 2005; Mellado,
2008). Likewise, goats are characterized as being one of
the most fertile domestic species, with up to 90%
conception rate and the litter size varies from 1 to 1.5
offspring each year, depending on the breed, season and
environmental conditions where it is exploited (Mellado,
2008; Cseh et al., 2012). On the other hand, the natural
breeding season of breeds exploited in temperate areas
is restricted to the beginning of autumn and winter, so
mother goats give birth in early spring, which coincides
with natural growth of vegetation (Delgadillo et al., 1999;
Jackson et al., 2006). Since goats belong to the group of
species subject to seasonal fluctuations and considering
the different geographical areas in which they are
exploited, their limited genetic improvement blends with
the photoperiod effect (Delgadillo et al., 1999), the
*Corresponding author. E-mail: [email protected].
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
720
Afr. J. Biotechnol.
nutritional effect (Scaramuzzi et al., 2006) and the health
effect (Cseh et al., 2012), as well as sociocultural aspects
of the majority of the regions in which goats are exploited
and that almost 90% of goat producers have little
knowledge of new technologies (Mellado, 2008). Taking
into consideration the aforementioned, the application of
new technologies in small ruminants has been restricted
in developing countries (Chang et al., 2006; Lehloenya
and Greyling, 2010; Paramio, 2010; Gama and Bressan,
2011; Guerra et al., 2011).
Traditionally, transfer of in vivo produced embryos
include: estrous synchronization techniques, artificial
insemination, superovulation treatments and embryo
implantation (Sánchez-Dávila et al., 2014). However, in
countries with large goat population, the high costs of this
methodology have restricted the use of these techniques
in a massive way. An alternative could be to work with
embryos produced in vitro, in order to be offered cheaper
and shorten the generation interval used in this technique
compared to the in vivo traditional technique. Since in a
traditional MOET programme, the interval between
generations is approximately one year, through in vitro
produced embryos, this can be substantially reduced by
half (5 to 6 months) and theoretically, can double the rate
of genetic gain in the herd (Magalhaes et al., 2011;
Amiridis and Cseh, 2012; Baldassarre, 2012). Additionally, genetic gain can be improved using sex-sorted
semen; however, the use of this technology is very
restricted in small ruminants compared to bovines.
According to the International Embryo Transfer Society,
in 2009, the number of embryos produced in vivo or in
vitro for bovines and small ruminants were 842 376 and 2
086, respectively (Cseh et al., 2012).
Therefore, the objective of the present study was to
describe in a general way the restrictions and advantages
of using assisted reproductive technologies in goats and
worldwide current trends.
ARTIFICIAL INSEMINATION
Great part of the success of genetic improvement in
goats worldwide has been the use of artificial
insemination (AI) in programmes for the upgrading of
goats (Ahmed et al., 2011), since this improvement is
achieved by using an “improved” buck, it requires the
presence of great number of superior bucks to be
evaluated, selected and finally, their genetic value must
be compared with reference males (Gama and Bressan,
2011; Cseh et al., 2012). For instance, in countries such
as France, the systematic use of AI for genetic
improvement of dairy goats, is currently part of the
routine management of the exploitation. The AI technique
in goats could have additional advantages by using it
massively, since goat herds are geographically dispersed
and they are a species subject to seasonal fluctuations.
Basically, as AI technique itself, three techniques have
been promoted which are already in use worldwide
(Holtz, 2005; Amiridis and Cseh, 2012).
The first technique is transcervical insemination, a
method in which the semen is transferred into the uterus,
using a rigid endoscope, a light source and an
insemination gun with recommended dosage between 80
and 100 million of spermatozoids (Holtz, 2005). When
artificial insemination is performed using fresh, diluted
semen, conception rates can be comparable to those in
natural breeding (Paramio, 2010). Conception rates of
minimum 50% and as good average, 60 to 65% are
reported worldwide. However, some breeds have only
reached 40% (Angora breed) (Tasmedir et al., 2011). In
Mexico, the extensive use of AI has been concentrated in
two states: Guanajuato and Coahuila, due to governmental programmes since 2000. The results obtained in
these states show an annual positive genetic trend for
milk production of 2.99 ± 1.06 kg (0.32%), still far below
the 1 to 2% obtained in France (Torres-Vásquez et al.,
2010). In Brazil, pregnancy rates of 59% by transcervical
route are reported, using fresh, diluted semen at 5°C and
coconut water as diluent, mainly in dairy breeds, such as
Saanen. As in other countries, different protocols for
estrous synchronization have been used in Brazil, such
as the use of devices between 5 and seven days,
reaching pregnancy rates between 60 and 73% (Guerra
et al., 2011).
The second technique for AI in goats is laparoscopy,
which was initially used in the 80s in sheep by a group of
Australian researchers; currently, countries in South
America, mainly Argentine, Brazil and Uruguay, have
obtained successful results since the 90s. In general,
substantial and consistent pregnancy rates have been
achieved with the use of this technique in comparison
with the transcervical method (Holtz, 2005). This
technique requires the use of specialized equipment,
which includes: a light source, optical fibre, and dedicated
pipettes from global enterprises. The doe is fasted with
no access to water for a minimum of 12 h before the
procedure is performed. The goat is then placed in a
laparoscopy cradle, positioned in a supine head-down
position to an approximate angle of 45° (Cseh et al.,
2012). Subsequently, a small skin incision is made 10 cm
ventral to the udder on each side of the midline for
introducing laparoscope and insemination pipette. A light
stab action is made and one-half of the semen dose is
deposited in each uterine horn at approximately 5 cm
from the uterine bifurcation. In emerging countries, the
use of these techniques has been directed towards
evaluating the variations in time periods of AI, semen
dose, sperm concentration, type of semen used (fresh,
diluted, refrigerated or frozen-thawed semen), finding
variable pregnancy rates ranging from 43 to 68% (Gama
and Bressan, 2011; Guerra et al., 2011).
The third technique developed in Germany is to expose
the cervix and deposit semen in the uterine horns by
Arredondo et al.
transcervical route, reporting up to 71% of births
compared to 51% obtained by laparoscopy (Holtz, 2005).
The use of this technique has been restricted because no
study has been reported. Future research should be
conducted to standardize protocols for synchronization of
ovulation to achieve pregnancy rates increase using
IATF; and intensify research regarding male effect and
achieve synchrony of estrous and inseminated at estrous
observed. This is with the aim of reducing the use of
hormones and produce meat and milk are free of
hormones and are labeled as ethical and green.
Estrous cycle control (estrous synchronization)
In a simplified form, the aim of estrous synchronization is
that a group of goats show a fertile estrous within a
specified time period between an average of 24 and 48 h
and be able to carry out breeding services, either natural
breeding or AI, using one of the aforementioned
techniques (Holtz, 2005; Fonseca et al., 2005; Fatet et
al., 2011; Cseh et al., 2012; Amiridis and Cseh, 2012;
Álvarez et al., 2013). At global level, estrous synchronization protocols developed in the major centers for goat
(France) and sheep production (Australia), to later
disseminate worldwide; following an important growth in
Uruguay, Brazil, Argentine and Mexico, speeding up this
process by beginning to use real-time ultrasonography, in
order to understand and explain the follicular dynamics in
small ruminants, mainly in sheep and goats (Leboeuf et
al., 2000; Mellado, 2008; Menchaca et al., 2010; Guerra
et al., 2011).
As with the majority of countries worldwide, the
protocols used are based on the use of progestogen or
progesterone treatment in the form of vaginal devices
(sponges/CIDR) or ear implants (Fonseca et al., 2005;
Abecia et al., 2012; Vilariño et al., 2011). This hormonal
manipulation can be used either out or during breeding
season, by means of estrous synchronization protocols,
which mainly differ in the type of device to be used, its
duration, the combination of prostaglandin analogues, as
well as the moment of application of hormones that
induce and synchronize ovulation, such as: equine
chorionic gonadotrophin (eCG), estradiol benzoate and
GnRH (Menchaca and Rubianes, 2007; Menchaca et al.,
2009; Modu-Bukar et al., 2012). However, the use of
progestogen may cause several responses depending on
the cycle phase in which treatment is initiated; for
instance, during the luteal phase, follicular development
speeds up, but at the same time, the number of large
follicles decreases, increasing the rate of follicular atresia
and supporting the persistence of large estrogenic
follicles (Nava et al., 2010). During the follicular phase,
the number of large follicles and ovulation rate decreases
(Riaz et al., 2012).
However, the use of progestogen sources during the
period of sexual rest induces a form of diestrous that
721
generates normal ovarian follicle development. When the
progestogen is removed, the follicles can ovulate during
the season in which breeding fails, due to seasonal
negative feedback action of the hormone, thus it is
necessary that the gonadotropin stimulates total follicle
maturation and ovulation. In each case, the use of
vaginal devices increases progesterone concentration,
but on the second day, it starts to decline, which
physiologically alters Luteinizing Hormone (LH) secretion.
Several alternatives were developed to improve the
aforementioned; one of them is the substitution of the
vaginal device at day seven, in comparison with the
synchronization programme which traditionally substitutes the device between days 11 and 14 (Baldassarre,
2012) and also a prostaglandin F2α (PGF2α) dose is
administered at the moment that the second device is
removed. A second option is the use of short protocols
(five to seven days) with vaginal devices, which began to
develop in the 90s with satisfactory results with respect to
the rate of synchronization and ovulation, either in goats
or in sheep (Menchaca et al., 2007; Menchaca et al.,
2010). It has been determined that short estrous
synchronization protocol induces LH peak from 40 h and
ovulation takes place 60 h after the completion of the
progesterone treatment (Menchaca et al., 2007). When
using short estrous synchronization protocols, the goats
show a new wave of follicles 3.5 days after the insertion
of the device, allowing that in embryo transfer
programmes, the development of dominant follicles is
avoided and better embryonic response will be obtained
(Fonseca et al., 2013). Currently, the use of recycled
CIDR has played a key role in the projection of similar
results between new CIDR (62.5%), sterilized CIDR
(79.5%) and CIDR placed in autoclaves (69%) with
respect to pregnancy rate and estrous rate from 97.5 to
100% (Álvarez et al., 2013). Researchers in South
America confirm that the use of recycled CIDR does not
affect the rate of fertility and pregnancy (Vilariño et al.,
2011; Oliviera et al., 2013). Another device which has
been used in sheep and goat has been the implant
impregnated with the potent progestogen norgestomet
(Crestar), which is inserted in the middle part of the
animal’s ear and one-half of the implant is usually used in
goats. The use of CIDR and subcutaneous implants in
goats showing poor physical development and in goats
kidding for the first time, may be more comfortable in
comparison to sponges that cause stress in the animals
and they are very difficult to remove (Holtz, 2005;
Palvenz et al., 2005; Souza et al., 2011; Penna et al.,
2013).
Accordingly, in the last decade, these two aspects have
been modified in a vast body of scientific literature
worldwide; however, the limitations of the use of synchronization protocols, short or long, because of vaginitis
problems and presence of progesterone in milk, are
justified by a pregnancy rate of 60% (López-Sebastián et
722
Afr. J. Biotechnol.
al., 2007; Menchaca et al., 2007). Nevertheless, they
have gained strength in the European Community and
the marketing of this milk is still legal in our country on a
large scale (Mellado, 2008). An interesting point, linked to
the previous, is the use of eCG in the synchronization
protocols, where the best pregnancy results are obtained
(61%), compared to other sources of synchronization of
ovulation, such as: estradiol benzoate (40%) and GnRH
(39%) (Menchaca et al., 2007; Zarazaga et al., 2014)
considering that further studies must be done to evaluate
alternative sources of ovulation, as previously described.
Although, it has been reported that successive use of
eCG generates development of antibodies, it is still used
in countries such as Mexico and South America, where
pregnancy rate has not been evaluated, due to repeated
use of eCG in goat herds. Other synchronization
protocols have been use based on the use of
prostaglandin F2α analogues (cloprostenol, dinoprost
tromethamine), which are potent luteolytic agents and
can be used during breeding season as an alternative for
estrous synchronization. It has been reported that PGF2α
effectivity is limited between day 3 and 14 of the estrous
cycle and affects the time of LH peak and subsequent
ovulation (Holtz, 2005). Another way to use PGF2α is to
combine it with the male effect and a source of
progesterone (López-Sebastián et al., 2007), where the
treatment involves administering 25 mg of progesterone
in olive oil by intramuscular route at the moment of
introducing the male, followed by a dose of 75 µg of
cloprostenol by intramuscular route, seven days after
exposing the male to the females. Based on this synchronization protocol, a pregnancy rate of 65% is
achieved, compared to the traditional protocols of vaginal
device and the use of eCG at a dose of 350 IU (47%).
Other protocols that have been used in bovines, such as
the ovsynch protocol, which is based on the administration of two doses of GnRH at intervals of 9 days and
PGF2α is applied two days before the second administration of GnRH; this protocol is based on the fact that the
first GnRH injection in the presence of a large follicle
triggers ovulation and the formation of corpus luteum,
considering that the administration of PGF2α will destroy
both, the natural developed corpus luteum and the one
developed by the first GnRH injection, so that the second
GnRH injection triggers ovulation (Holtz et al., 2008).
With the previous protocol, great synchronization of
preovulatory LH peak can be achieved and pregnancy
rates of 58% are obtained (Holtz et al., 2008).
Other natural techniques or so called sustainable are
those related to the combined use of photoperiod, male
effect and nutritional supplementation, for establishing
alternative strategies and breeding management to the
use of drugs (hormones) previously described. Although,
the male effect has been known in sheep and in goats,
groups of researchers are working strongly to be able to
use the male effect in a more efficient way without the
need of hormones. For instance, in sheep and in goats,
the presence of short cycles is not uncommon when a
male is introduced to a group of anoestrus females;
however, a way to avoid it is to administer a dose of
progesterone at the moment the male is introduced.
Nevertheless, this methodology contrasts the use of
hormonal products with the use of clean, green and
ethical methods promoted by groups of researchers
(Delgadillo et al., 2012). Since the 90’s, the interest to
determine the photoperiod is determinant for at least in
some regions of seasonal anoestrus in goats and low
libido in bucks (Pellicer-Rubio et al., 2008; Delgadillo et
al., 2012), has led to use strategies for activating the
male through light programmes that regulate the photoperiod of males, in such a way that they must be
activated in the anoestrus season and be able of inducing
estrous in the anoestrus goat (Delgadillo et al., 2012), as
well as the use of females in heat (Rodríguez-Martínez et
al., 2013) or males treated with testosterone (Véliz et al.,
2013). However, it has been demonstrated that as unique
effect it can be affected by the male itself, varying or
affecting age, breed, physical condition, forms of
grouping, experience of itself, as well as hierarchy. On
the other hand, the doe plays an important role in its
response at the moment the buck is introduced, behaving
differently according to the stage of anoestrus and
breeding season, whereas during breeding season the
effect could be minor, due to high progesterone levels
and during the anoestrus season, the goat gets excited
as soon as the male is introduced and the effect shows
up because of an increase in LH (Delgadillo et al., 2012).
In the breeding season, the male effect has better LH
release output patterns when the goats are in the early
and late luteal phase and not in the middle luteal phase;
whereas high levels of progesterone inhibit further output
of LH (Martínez-Álvarez et al., 2007).
On the other hand, previous isolation of the male is
conditioned even in goats, which is currently determined
that this is not a necessary thing to do, because being
separated from the male or remaining in contact makes
no difference in goats (Delgadillo et al., 2012). The male
effect may increase breeding efficiency in goats and the
behavioural signs of estrous increase in goats exposed to
bucks (Prado et al., 2003). For instance, when goats are
artificially inseminated, sterile service by using a vasectomized buck may reduce the time duration of estrous,
increasing the rate of conception. The presence of the
buck after removing the progestin or after the second
injection of prostaglandin in synchronized goats reduces
the time of pessary withdrawal or injection of prostaglandin for initiating estrous.
The male effect incorporates each aspect of a clean,
green and ethical animal production. It does not need the
use of exogenous hormones, has no negative effect in
the environment and optimizes animal welfare; additionally, animals do not need to be handled or manipulated
Arredondo et al.
at some moment to previous breeding. However, there
are male effect limitations that restrict its deve-lopment as
a reliable, repeatable and flexible tool that can be used in
different breeds, seasons and latitudes. Consequently, it
is proposed that the challenge for today’s scientists is not
only to find solutions to problems, but also understand
when and why they happen. Future research should be
directed to combine the use of hormones and the male
effect. It requires conducting research that achieve
standardized protocols synchroni-zation of ovulation.
Intensify the use of short estrous synchronization
protocols to make them more econo-mical, less time use
of hormones and equal or better results than long estrous
synchronization protocols.
Semen processing
In comparison with bovines, semen processing and its
market in emerging countries, has been restricted,
among other reasons, due to lack of adequate knowledge
about the use of the insemination technique, where goat
producers prefer to have higher pregnancy rates by
natural breeding, instead of using goat semen genetically
evaluated (Mara et al., 2007) whereas currently, purebred
seed stock producers still rely on the importation of
semen from European countries (France, Spain) and
from the United States of America and Canada. Today,
studies are focused on trying to improve the results of
mass motility, progressive motility, abnormalities, live
sperms, acrosomal disruption, among other goat semen
variables (Mellado et al., 2006; Mainga et al., 2010).
Now, studies have been conducted to efficiently use the
egg yolk (Salmani et al., 2014) under different
concentrations, used as an antioxidant (Ahmed et al.,
2011) and alternative use of non-animal origin sources
(soy milk) (Khalifa and El-Saidy, 2006; Salmani et al.,
2014). Alternatively, different times and temperatures of
semen storage have been evaluated (Paulenz et al.,
2005; Islam et al., 2006; Salvador et al., 2006; Nainga et
al., 2010), as well as its wash and centrifugation for
seminal plasma removal (Sariozkan et al., 2010).
Likewise, it has been found that in the use of enzymes,
such as arginine, an enzyme of the urea cycle, which has
two isoforms of mammalian arginase (types I and II), type
II plays an important role in the synthesis of polyamines
and through the parameter of seminal plasma activity of
arginase, there is a high correlation between sperm
motility and sperm concentration (Turk et al., 2011). All
the aforementioned has been carried out with the aim to
avoid one of the biggest problems that goat semen has,
such as presence of the coagulating enzyme of the egg
yolk, which is secreted by bulbourethral glands and
reacts upon contact with the egg yolk and hydrolyzes
lecithin into fatty acids and spermicidal lysolecithin (Cseh
et al., 2012). Likewise, the secretion of bulbourethral
723
glands has a toxic reaction with milk; this effect has been
identified as a lipase (glycoprotein), where this enzyme
hydrolyzes trioline and triglycerides into free fatty acids,
which decrease sperm motility and harm the sperm
acrosomal membrane (Shia et al., 2010). The use of
frozen semen overcomes farm dispersion problems,
enhancing the more accurate genetic evaluation of
animals. However, the success of AI with frozen–thawed
semen is lower than with fresh or cooled semen or that
achieved by natural service. In Alpine and Saanen
breeds, Guerra et al. (2011) observed a kidding rate of 75
and 44% for fresh and frozen semen, respectively.
Overall, AI fertility rates with frozen–thawed semen vary
from 40 to 60%, and seem to be highly affected by
factors such as season, farm (Ahmed et al., 2011; Cseh
and Amiridis, 2012), reproductive status of female
(Leboeuf et al., 2000), and site of semen deposition
(Paulenz et al., 2005).
Transfer of in vivo and in vitro produced embryos
Embryo transfer (ET) consists in administering high
doses of follicle-stimulating hormone (FSH) of porcine or
ovine origin, with the aim to obtain maximum follicular
growth, which develops to the preovulatory follicle stage
(González-Bulnes et al., 2004; Baldassarre, 2012).
According to classic protocols of superovulation, follicular
population starts to modify between 12 and 24 h after the
administration of the first FSH dose (Sánchez et al.,
2013). These changes in follicular population are
associated with an increase in the total number of large
follicles or equal to 2 mm, which grow to 5 mm in
diameter in 12 to 48 h, reaching the preovulatory stage at
48 to 60 h (González-Bulnes et al., 2004). Although, the
follicular growth pattern varies according to the FSH
formulation and the administration protocol, the ovulatory
follicles obtained as result of different protocols of
superovulation are characterized by being smaller than
the ovulatory follicles of non-stimulated, natural cycles
(with gonadotropins)
(Driancourt et al., 1991;
Baldassarre, 2012; Melican and Gavin, 2008). This
decrease in the size of ovulatory follicles has also been
observed during natural cycles in all sheep breeds
considered prolific, such as: Romanov, Booroola Merino
and Chios (Paramio, 2010).
The FSH presents a short half-life; consequently, its
effect on growth and estradiol production is maintained
during shorter periods of time, this is why it has to be
frequently administered (González-Bulnes et al., 2004;
Baldassarre, 2012). FSH-superovulated goats present
lower incidence of premature regression of corpus luteum
in comparison with other treatments, such as eCG, that
also causes luteolysis, due to FSH effect on estradiol
secretion. Therefore, after ovulation, its residual effect is
low and its effect declines on the production of estradiol,
724
Afr. J. Biotechnol.
thus triggering, in smaller number of cases, the cascade
of events that lead to prostaglandin F2α secretion
(González-Bulnes et al., 2004). FSH superovulation
protocols have indeed the disadvantage in that the
hormone has to be frequently administered, due to the
similarity of physiological secretion pattern of FSH during
the follicular stage of the goat and the heterogeneous
response of animals to treatment, mainly because of
limiting factors, both extrinsic (origin, purity and protocol
of gonadotropin administration) and intrinsic (breed, age,
and nutritional and reproductive status), of the animal
(Melican and Gavin, 2008; Menchaca et al., 2010). An
average of six to eight transferable embryos per donor
can be produced in a successful goat MOET program
(Baril et al., 1993; Cognié, 1999; Cognié et al., 2003).
These results, however, depend on many factors
(including breed, age and nutrition) that contribute to the
high variability. It is common for the number of
transferable embryos to range from 0 to 30 per donor
with 25 to 50% of the donors failing to produce any
transferable embryos due to fertilization failure and early
regression of corpora lutea (González-Bulnes et al.,
2004; Lehloenya et al., 2008; Baldasarre, 2012). Multiple
ovulation and embryo transfer in small ruminants in many
countries are restricted to the breeding season, due to
seasonal cyclic activity (Delgadillo et al., 2012). For
instance, in South Africa, it has been reported that Boer
goats show maximum sexual activity in autumn and
minimum activity in spring (Lehloenya and Greyling,
2010). This coincides with González-Bulnes et al. (2004),
who report that certain goat breeds manifest the highest
ovulation rate and embryo performance during the
breeding season and that the minimum ovulation rate, as
well as embryo performance are recorded in the
anoestrus period; however, Lehloenya et al. (2008) and
Sánchez-Dávila et al. (2004), found that multiple
ovulation is independent of the breeding and nonbreeding season in Boer and dairy goats. However,
currently, attempts have been made for changing the
strategies of embryo collection, intensifying the attempts
to avoid laparotomy and consequently, increase the
reproductive life of donors with high genetic potential. For
instance, Fonseca et al. (2013) have evaluated the
nonsurgical technique along with short protocols of estrus
synchronization, with promising results for applying this
technique worldwide; where they found that the
percentage of recovery by wash medium was higher than
90% and 13.4 ± 4.1 of embryos recovered per female
donor.
On the other hand, in vitro embryo production has been
developed a little bit more constantly in small ruminants,
but more in sheep than in goats (Sánchez et al., 2013).
This technology requires specific manipulations, such as:
collection and maturation of oocytes, fertilization and
development of zygotes, and embryos already developed
are frozen or fresh transferred (Amirdis and Cseh, 2012).
However, still today, the fact that embryos produced in
vivo are generally of higher quality than embryos
produced in vitro, due to their high implantation rate and
to better freezing tolerance (Baldassarre, 2012). Today,
still research purposes, oocytes are routinely collected
from slaughtered females. After removing their ovaries
and observing the presence of certain size of follicles,
oocytes are aspirated from each one of the follicles with
sterile syringes. Conversely, it can be done in live
animals by laparotomy, which is used less often, or by
laparoscopy. This collection can be preceded by FSH or
eCG administration for ovarian stimulation or by nonstimulated animals. It has been reported that aspiration of
available follicles decreases in time, taking into
consideration that gonadotropin dose, time of aspiration
with respect to stimulation, aspiration pressure and the
donor, are more determinant factors in cumulus-oocyte
complex recovery rate. Likewise, it is mentioned that
oocyte collection can be carried out both during breeding
season and non-breeding season; considering that in the
latter, melatonin implants can be used to improve the
number of available follicles and oocyte development
(Holtz, 2005; Baldassarre, 2012) then, comes maturation
process (Amiridis and Cseh, 2012). There have been
great changes in the development of oocytes by using
temperatures of 38 to 39°C for 24 h in a humid
atmosphere with 5% of CO2; from then on, oocytes
exhibit the first polar body and metaphase II stage is
completed. The most commonly used maturation medium
is TCM-199 supplemented with pyruvate, inactive serum
and hormones (FSH and LH); what is more, if it is used in
combination with estrogens and FSH, blastocyst
formation rate is improved. Currently, the combination of
growth hormone and ICF-I at a rate of one dose of 100
ng/ml in the maturation medium has been used for
obtaining a more uniform maturation of oocytes.
Likewise, the inclusion of follicular fluid from non-atrestic
follicles or from goats treated with gonadotropin in the
maturation medium, may have some beneficial effect on
oocyte in vitro maturation, because the follicular fluid
contains a number of peptides, steroids and growth
factors (Paramio, 2010, Tasdemir et al., 2011; Amiridis
and Cseh, 2012).
Oocytes with development capacity can be selected
from ovaries of slaughtered goats. Between 1,5 and 2,1
oocytes per ovary are obtained by aspiration or
dissection of follicles. Additionally, cumulus-oocyte
complex (COC) recovery by cutting the ovary is a simple
and more efficient technique in comparison with
aspiration and perforation methods. Follicles larger than 3
mm have more cumulus layers and show a better in vitro
maturation, circumstances to be taken into account for
selecting oocytes at the end of the growth stage. Oocytes
from large follicles (> 5 mm in diameter) generate greater
number of blastocysts than medium-small follicles (< 5
mm in diameter). An average of 9 COC are obtained per
Arredondo et al.
ovary after preparing the goats with FSH. Oocyte
collection by aspiration under laparoscopic observation of
anatomic structures of genetically superior goats, allows
the recovery after FSH priming of 3-4 COC per ovary.
The effects of medium supplementation using glucoproteins (LH, FSH, hCG and TSH) during in vitro maturation of goat oocytes, show that these hormones are
required for successful development of oocytes in AI.
TRANSGENESIS
This technique has been considered the great hope of
the human being, because great quantities of catalytic
proteins can be produced. These have great effect on
certain human diseases, such as the human stimulating
factor of granulocyte colonies. The objective of this
technique is to manipulate the DNA of an individual so
that it expresses its genetic potential and the production
of proteins at large scale can be achieved, since they are
of great benefit to human health and pharmaceutical
industry. Unlike bovines, the goat is an excellent model
for transgenesis worldwide (Paramio, 2014). Also, they
are potentially ideal bioreactor animals for producing
great quantities of recombinant proteins of pharmaceutical use (Guerra et al., 2011), taking into consideration that just as in bovines, there is great loss of
embryos when using this technique, but the great
advantage of goats is that there is a very low percentage
of placental retention, respiratory/cardiovascular dysfunction, abnormal postnatal development and postnatal
losses (quotation). Additionally, goats are an important
source of recombinant protein production, reaching 1 to 5
g/litre of milk produced by transgenic animals. In herds of
transgenic animals, the production rate reaches 300 kg of
this purified product per year (quotation). The methodology of animal cloning employing the technique used in
the creation of the first transgenic animal “Dolly”, is still
inefficient, even more in bovines, where perinatal losses
are high, reaching 63% in the first three months of age of
calves created by the protocol of somatic cell nuclear
transfer (quotation). Considering that today, only recombinant human antithrombin III, produced by the European
Community, is commercially manufactured (quotation).
FINAL CONSIDERATIONS
With respect to first-generation technology, as the case of
estrous and ovulation synchronization, and AI, instead of
standardizing the protocols of both techniques, they
should be focused on their intensive use to increase the
number of offspring as product of AI, using genetically
outstanding bucks. In relation to semen, it is necessary to
conduct further studies in strengthening acrosomal
integrity, as well as to begin to use sex-sorted semen and
725
process it without egg yolk, with the aim to export it
without having health problems. With regard to embryo
transfer, further studies should be carried out to improve
embryo collection by avoiding, blocking or eliminating
presence of dominant follicles, as well as to improve and
disseminate nonsurgical technologies for obtaining more
embryos from female donors during their reproductive
life; whereas the tendency is to eliminate laparotomy
method. Likewise, in vitro fertilization should be
developed in emerging countries to achieve greater
short-term genetic advance. However, the use of
transgenesis is still restricted in this species, mainly due
to cost-benefit of production. Based on the fact that
assisted reproductive technologies aforementioned, must
reach the field level in goat production systems for
improving production and reproductive performance of
goat herds.
Conflict of interest
The authors did not declare any conflict of interest.
ACKNOWLEDGEMENTS
Special thanks to the Department of Agronomy,
Universidad Autónoma de Nuevo León (UANL).
REFERENCES
Abecia JA, Forcada F, and González-Bulnes A (2012). Hormonal
control of reproduction in small ruminants. Anim. Reprod. Sci.
130:173-179.
Ahmed M, Wahida H, Rosnina Y, Gohb YM, Ebrahimib M, Nadiac FM,
Audreyc G (2011). Effect of butylated hydroxytoluene on
cryopreservation of Boer goat semen in Tris egg yolk extender. Anim.
Repr. Sci. 129:44-49.
Alvarez L, Gamboa D, Zarco L, Ungerfeld R (2013). Response to the
buck effect in goats primed with CIDRs, previously used CIDRs, or
previously used autoclaved CIDRs during the non-breeding season.
Liv. Sci. 155:459-462.
Amiridis GS and Cseh S (2012). Assisted reproductive technologies in
the reproductive management of small ruminants. Anim. Repr. Sci.
130:152-161.
Baldasarre H (2012). Practical aspects for implementing in vitro embryo
production and cloning programs in sheep and goats. Anim. Reprod.
9:188-194.
Chang Z, Fan ML, Wu-Tan J (2006). Factors affecting superovulation
and embryo transfer in Boer goats. Asian Austr. J. Anim. Sci. 19:341346.
Cseh S, Faigl V, Amiridis GS (2012). Semen processing and artificial
insemination in health management of small ruminants. Anim. Repr.
Sci. 130:187-192.
Delgadillo JA, Cañedo GA, Chemineau P, Guillaume D, Malpaux B
(1999). Evidence for an annual reproductive rhythm independent of
food availability in male creole goats in subtropical northern Mexico.
Theriogenology 52:727-737.
Delgadillo JA, Duarte G, Flores JA, Vielma J, Hernández H, FitzRodriguez G, Bedos M, Graciela Fernández I, Muñoz-Gutiérrez M,
Retana-Márquez MS, Keller M (2012). Control of the sexual activity of
goats without exogenous hormones: use of photoperiod, male effect
and nutrition. Trop. Subtrop. Agroecos. 15:15-27.
Driancourt MA, Webb R, Fry RC (1991). Does follicular dominance
occur in ewes? J. Reprod. Fert. 93:63-70.
726
Afr. J. Biotechnol.
Fatet A, Pellicer-Rubio MA, Leboeuf B (2011). Reproductive cycle of
goats. Anim. Reprod. Sci. 124:211-219.
Fonseca JF, Bruschi JH, Santos ICC, Viana JHM, Maagalhaes ACM
(2005). Induction of estrus in non lactating dairy goats with diferente
estrous synchrony protocols. Anim. Repr. Sci. 85:117-124.
Fonseca JF, Zambrini FN, Alvim GP, Peixoto MGD, Verneque RS,
Viana JHM (2013). Embryo production and recovery in goats by nonsurgical transcervical technique. Small Rum. Res. 111:96-99.
Gama LT, Bressan MC (2011). Biotechnology applications for the
sustainable management of goat genetic resources. Small Rum. Res.
98:133-146.
Gonzalez-Bulnes A, Baird DT, Campbell BK, Cocero MJ, García-García
RM, Inskeep EK, Lopez-Sebastian A, McNeilly AS, Santiago-Moreno
J, Souza CJH, Veiga-Lopez A (2004). Multiple factors affecting the
efficiency of multiple ovulation and embryo transfer in sheep and
goats. Repr. Fert. and Dev. 16:421-435.
Guerra MMP, Silva SV, Batista AM, Coleto ZF, Silva ECB, Monteiro Jr.
PLJ, Carneiro GF (2011). Goat reproductive biotechnology in Brazil.
Small Rum. Res. 98:157-163.
Holtz W (2005). Recent developments in assited reproduction in goats.
Small Rum. Res. 60:95-110.
Holtz W, Sohnrey B, Gerland M, Driancourt MA (2008). Ovsynch
synchronization and fixed time insemination in goats. Theriogenology
69:785-797.
Islam R, Ahmed K, Deka BC (2006). Effect of holding and washing on
the quality of goat semen. Small Rum. Res. 66:51-57.
Jackson DJ, Fletcher CM, Keisler DH, Whitley NC (2006). Effect of
melengesterol acetate (MGA) treatment or temporary kid removal on
reproductive efficiency in meat goats. Small Rum. Res. 66:253-257.
Khalifa TAA and El-Saidy BE (2006). Pellet-freezing of Damascus goat
semen in a chemically defined extender. Anim. Repr. Sci. 93:303315.
Konyali C, Tomas C, Blanch E, Gomez EA, Graham JK, Moce E (2013).
Optimizing conditions for treating goat semen with cholesterol-loaded
cyclodextrins prior to freezing to improve cryosurvival. Cryobiology
67:124-131.
Leboeuf B, Restall B, Salamon S (2000). Production and storage of
goat semen for artificial insemination. Anim. Repr. Sci. 62:113-141.
Lehloenya KC, Greyling JP. (2010). The ovarian response and embryo
recovery rate in Boer goat does following different superovulation
protocols, during the breeding season, Small Rum. Res. 88:38-43.
Lehloenya KC, Greyling JPC, Grobler S (2008). Effect of season on the
superovulatory response in Boer goat does. Small Rum. Res. 78:7479.
López-Sebastian A, González-Bulnes A, Carrizosa JA, Urrutia B, DíasDelfa C, Santiago-Moreno J, Gómez-Brunet A (2007). New estrus
synchronization and artificial insemination protocol for goats base on
male exposure, progesterone and cloprostenol during the nonbreeding season. Theriogenology 68:1081-1087.
Magalhaes DM, Duarte ABG, Araujo VR, Brito IR, Soares TG, Lima
IMT, Lopes CAP, Campello CC, Rodrigues APR, Figueiredo JR
(2011). In vitro production of a caprine embryo from a preantral
follicle cultured in media supplemented with growth hormone.
Theriogenology 75:182-188.
Mara L, Dattena M, Pilichi S, Sanna D, Branca A, Cappai P (2007).
Effect of different diluents on goat semen fertility. Anim. Reprod. Sci.
102:152-157.
Martínez-Álvarez LE, Hernández-Cerón J, González-Padilla E, PereraMarín G, Valencia J (2007). Serum LH peak and ovulation following
synchronized estrus in goats. Small Rum. Res. 69:124-128.
Melican D and Gavin W (2008). Repeat superovulation, non-surgical
embryo recovery, and surgical embryo transfer in transgenic dairy
goats. Theriogenology 69: 197-203.
Mellado M (2008). Técnicas para el manejo reproductivo de las cabras
en agostadero, Trop Subtrop Agroecos. 9:47-63.
Mellado M, Pastora F, Lopez R, Rios F (2006). Relation between
semen quality and rangeland diets of mixed-breed male goats. J. of
Arid Env. 66:727-737.
Menchaca A, Miller V, Salveraglio V, Rubianes, E (2007). Endocrine,
luteal and follicular responses after the use of the short-term protocol
to synchronize ovulation in goats. Anim. Repr. Sci. 102:76-87.
Menchaca A and Rubianes E (2007). Pregnancy rate obtained with
short-term protocol for timed artificial insemination in goats. Repr.
Dom. Anim. 42:590-593.
Menchaca A, Vilariño M, Crispo M, de Castro T, Rubianes E (2010).
Menchaca A, Vilariño M, Pinczak A, Kmaid S, Saldaña JM (2009).
Progesterone treatment, FSH plus eCG, GnRH administration and
Day 0 protocol for MOET programs in sheep. Theriogenology 72:477483.
Modu-Bukar M, Yusoff R, Haron AW, Dhaliwal GK, Goriman-Khan MA,
Ariff OM (2012). Estrus response and folicular development in Boer
does synchronized with flugestone acetate and PGF2α or their
combination with eCG or FSH. Trop. Anim. Health and Prod.
44:1505-1511.
Nainga SW, Wahida H, Mohd Azamc K, Rosninaa Y, Zukib AB, Kazhala
S, Bukara MM, Theind M, Kyawe T, San MM (2010). Effect of sugars
on characteristics of Boer goat semen after Cryopreservation. Anim.
Repr. Sci. 122: 23-28.
Nava TH, Chango VJ, Finol PG, Torres RP, Carrillo FF, Maldonado SJ,
Gil HL, Adamou A (2010). Efecto de la dosis de eCG sobre la
inducción del celo en cabras mestizas luego de un tratamiento cortó
con Medroxiprogesterona. Rev. Cient. FCV-LUZ 20:181-183.
New approaches to superovulation and embryo transfer in small
ruminants. Repr. Fert. and Dev. 22:113-118.
Oliveira JK, Martins G, Esteves JV, Penna B, Hamond C, Fonseca JF,
Rodrigues AL, Brandao FZ, Lilenbaum W (2013). Changes in the
vaginal flora of goats following a short-term protocol of oestrus
induction and synchronisation with intravaginal sponges as well as
their antimicrobial sensivity. Small Rum. Res. 113:162-166.
Paramio MT (2010). In vivo and in vitro embryo production in goats.
Small Rum. Res. 89:144-148.
Paramio, MT and Izquierdo, D (2014). Assisted reproduction
technologies in goats. Small Rum. Res. 121:21-26.
Paulenz H, Soderquistc L, Adnøyd T, Soltund K, Sæthere PA, Fjellsøye
KR, Andersen- Berg K (2005). Effect of cervical and vaginal
insemination with liquid semen stored at room temperatura on fertility
of goats. Anim. Repr. Sci. 86:109-117.
Pellicer-Rubio MT, Leboeuf B, Bernelas D, Forgerit Y, Pougnard JL,
Bonné JL, Senty E, Breton S, Brun F, Chemineau P (2008). High
fertility using artifitial insemination during deep anoestrus after
induction and synchronisation of ovulatory activity by the “male effect”
in lactating goats subjected to treatment with artificial long days and
progestagens. Anim. Repr. Sci. 109:172-188.
Penna B, Libonati H, Director A, Sarzedas AC, Martins G, Brandao FZ,
Fonseca J, Lilenbaum W (2013). Progestin-impregnated intravaginal
sponges for estrus induction and synchronization influences on goats
vaginal flora and antimicrobial susceptibility. Anim. Repr. Sci. 142:7174.
Prado V, Orihuela A, Lozano S, Isabel Pérez-León I (2003). Effect on
ejaculatory performance and semen parameters of sexually-satiated
male goats (Capra hircus) after changing the stimulus female.
Theriogenology. 60: 261–267.
Riaz H, Sattar A, Arshad MA, Ahmad N (2012). Effect of
synchronization protocols and GnRH treatment on the reproductive
performance in goats. Small Rum. Res. 104:151-155.
Rodriguez-Martínez R, Angel-García O, Guillen-Muñoz JM, RoblesTrillo PA, De Santiago-Miramontes M de los A, Meza-Herrera CA,
Mellado M, Véliz FG (2013). Estrus induction in anestrus mixed breed
goats using the “female-to female effect”. Trop. Anim. Health Prod.
45: 911-915.
Salmani H, Towhidi A, Zhandi M, Bahreini M, Mohsen Sharafi M (2014).
Sánchez F, Bernal H, del Bosque A, González A, Olivares E, Padilla G,
Ledezma R (2013). Superovulation and embryo quality with pFSH in
Katahdin hair sheep during breeding season. A. J. Agr. Res. 8:29772982.
Sánchez-Dávila F, Ledezma-Torres, RA, Padilla-Rivas G, del BosqueGonzález AS, González-Gómez A, Bernal-Barragán H (2014). Effect
of three levels of pFSH on superovulation and embryo quality in
goats during two breeding seasons in Northeastern Mexico. Reprod.
Dom. Anim. 49:40-43.
Arredondo et al.
In vitro assessment of soybean lecithin and egg yolk based diluents
for cryopreservation of goat semen. Cryobiol. 68:276-280.
Salvador I, Yániz J, Viudes-de-Castro MP, Gómez EA, Silvestre MA
(2006). Effect of solid storage on caprine semen conservation at 5°C.
Theriogenology 66:974-981.
Sarıozkan S, Bucak MN, Tuncer PB, Tas¸demir U, Kinet H, Ulutas PA
(2010). Effects of different extenders and centrifugation/washing on
postthaw microscopic-oxidative stress parameters and fertilizing
ability of Angora buck sperm. Theriogenology 73:316-323.
Scaramuzzi RJS, Bruce KC, Jeff AD, Nigel RK, Muhammad K, Minerva
MG, Anongnart S (2006). A review of the effects of supplementary
nutrition in the ewe on the concentrations of reproductive and
metabolic hormones and the mechanisms that regulate
folliculogenesis and ovulation rate. Repr. Nutr. Dev. 46:339-354.
Shia L, Zhang Ch, Yuea W, Shi L, Zhua X, Lei F (2010). Short-term
effect of dietary selenium-enriched yeast on semen parameters,
antioxidant status and Se concentration in goat seminal plasma.
Anim. Feed Sci. Tech. 157:104-108.
Souza JMG, Torres CAA, Maia ALRS, Brandao FZ, Brushi, JH, Viana
JHM (2011). Autoclaved, previously used intravaginal progesterone
devices induces estrus and ovulation in anestrus Toggenburg goats.
Anim. Repr. Sci. 129:50-55.
Tasdemir U, Reha AA, Kaymaz M, Karakas K (2011). Ovarian response
and embryo yield of Angora and Lilis goats given the day 0 protocol
for superovulation in the non-breeding season. Trop. Anim. Health
Prod. 43:1035-1038.
Torres–Vázquez, J.A., Valencia–Posadas, M., Héctor Castillo–Juárez,
H., Montaldo, H.H. 2010. Tendencias genéticas y fenotípicas para
características de producción y composición de la leche en cabras
Saanen de México. Rev. mex. de cienc. pecuarias 1:337-348.
727
Turk G, Gur S, Mehmet-Kandemir F, Sonmez M (2011). Relationship
between seminal plasma arginase activity and semen quality in
Saanen bucks. Small Rum. Res. 97:83-87.
Véliz FG, Meza-Herrera CA, De Santiago-Miramontes MA, ArellanoRodriguez G, Leyva C, Rivas-Muñoz R, Mellado M (2009). Effect of
parity and progesterone priming on induction of reproductive function
in Saanen goats by buck exposure. Liv. Sci. 125:261-265.
Vilariño M, Rubianes E, Menchaca A (2011). Re-use of intravaginal
progesterone devices associated with the Short-term Protocol for
timed artificial insemination in goats. Theriogenology. 75: 1195-1200.
Zarazaga LA, Gatica MC, Gallego-Calvo L, Celi I, Guzmán JL (2014).
The timing of oestrus the provulatory LH surge and ovulation in
Blanca Andaluza goats synchronised by intravaginal progestagen
sponge treatment is modified by season but not by body condition
score. Anim. Reprod. Sci. Article in Press.
Vol. 14(9), pp. 728-734, 4 March, 2015
DOI: 10.5897/AJB2014.14254
Article Number: CE4882A50950
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Review
The nutritional efficiency of Coffea spp. A review
Lima Deleon Martins1*, Lindomar de Souza Machado1, Marcelo Antonio Tomaz1 and
José Francisco Teixeira do Amaral2
1
Department Produção Vegetal, Centro de Ciências Agrárias, Univ. Federal do Espírito Santo (CCA/Ufes), Post
Office Box 16, 29500-000, Alegre, ES, Brazil.
2
Department Engenharia Rural, Centro de Ciências Agrárias, University Federal do Espírito Santo (CCA/Ufes),
PostOffice Box 16, 29500-0 00, Alegre, ES, Brazil.
Received 18 October, 2014; Accepted 16 February, 2015
Reduced soil fertility has been surpassed by the supply of mineral nutrients, which results in increased
rates of plant production and costs. In this context, the optimization of plants’ nutritional efficiency is
critical to increase productivity and reduce the cost of agricultural production systems. The nutritional
efficiency of plants is conditioned by numerous factors and the growing environment. Therefore, the
knowledge of genetic basis and mode of inheritance can assist in selecting genotypes with desirable
agronomic characteristics coupled with nutritional efficiency and genetic variability. The trend of
expanding agricultural frontiers has increased interest in the use of genotypes with the potential to
adapt to adverse conditions of soil fertility. Within crops, the coffee beans are the second most traded
commodity in the world. In this sense, optimization of nutritional efficiency of the coffee has a positive
impact on the sum of efforts to make sustainable activity. This review aimed to present a systematic
analysis of the nutritional efficiency of the coffee.
Key words: Nutrient absorption and utilization, root length, genetic variability.
INTRODUCTION
In the world, coffee is grown in about 80 countries. It is
the second most traded commodity in the world after oil,
generating approximately U$ 90,000 million per year and
involves about 500 million people in its management from
cultivation to final product for consumption. The genus
Coffea comprises more than 100 species, with particular
relevance to Coffea arabica L. and Coffea canephora
Pierre ex Froehner, which together are responsible for
about 99% of the production of coffee beans in the world
(DaMatta and Ramalho, 2006; Ramalho et al., 2013;
Martins et al., 2014). Based on global demand, there
must be awareness of farmers for the activity to be more
sustainable, without harming the environment while
ensuring a better quality of life for future generations.
However, this awareness is connected to adopting
numerous cultivation techniques and management of
crops ground especially in an increase in the use of
efficiency of raw materials, so that the increased
production of coffee is not coupled to a similar increase in
magnitude in fertilizer use.
*Corresponding author: E-mail: [email protected].
Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Martins et al.
The exploration of a coffee with low energy consumption and sustainable environment has stimulated
research to identify mechanisms responsible for the
greater nutritional efficiency, with the aim of utilizing them
by selection and other methods of plant breeding.
Moreover, there has been extensive genetic diversity due
to a series of physiological, morphological and biochemical mechanisms developed by various species of
plants, and also the coffee, when subjected to adverse
conditions of soil fertility (Moura et al., 1999; Cardoso,
2010; Soares, 2013; Martins et al., 2013a, 2013b, 2014).
As absorption, transportation and redistribution of
nutrients have genetic control, it is possible to improve
and/or select cultivars for more efficient utilization of
nutrients (Gabelman and Gerloff, 1983; Amaral et al.,
2011a; Fageria and Moreira, 2011).
Numerous morphological and physiological mechanisms contribute to the efficient use of nutrients, for
example: extensive root system (which allows the
exploration of large soil volume); high ratio between roots
and shoots; root system's ability to modify the rhizosphere (enabling it to overcome low nutrient levels);
increased absorption or utilization efficiency of nutrients;
the ability to maintain normal metabolism with low
nutrient content in tissues and high photosynthetic rate
(Gabelman and Gerloff, 1983; Blair, 1993; Fageria and
Baligar, 1993; Fageria, 1998; Fageria and Moreira,
2011). The low productivity of crop plants in the world’s
many soils is due, in large part, to excess or deficiency of
mineral elements. Acidity, alkalinity, salinity and erosion
promote degradation and low fertility soils; therefore,
correction and soil fertilization, and the use of appropriate
management techniques are essential to achieve yields.
However, in general, the recovery efficiency of nutrients
applied as fertilizer is low: about 50% N, less than 10%
for P and approximately 40% for K (Baligar and Fageria,
1998).
Overall, this context implies the need to select plants
efficient in the absorption and utilization of nutrients
applied to the soil. Thus, optimizing the nutritional
efficiency of coffee is of great importance for increased
productivity, particularly in tropical soils (Fageria, 1989;
Furtine Neto et al., 1998). The study of mineral nutrition
of plants may contribute to diagnose the correct
requirement of soil and plant in the production process,
avoiding misapplication of fertilizers, controlling
restrictions productivity to ensure the sustainability of
agriculture. This review aimed to present a systematic
analysis of the nutritional efficiency of coffee.
CONCEPTS OF NUTRITIONAL EFFICIENCY
Numerous concepts on nutritional efficiency are reported
in the literature, ranging from conceptualization of the
nutrient, species and the researcher. Therefore, the
mechanisms of acquisition and utilization of nutrients
729
should be interpreted to prevent errors in relation to
increased productivity. The term nutritional efficiency is
used to characterize plants in their ability to absorb and
utilize nutrients. Nutritional efficiency is also related to
economic output per unit of fertilizer applied and the
absorption, translocation and use efficiency of nutrients
(Baligar and Fageria, 1998). In the context agronomic
nutritional efficiency refers to the ability to produce low
supply of a nutrient based on standard genotype (Graham,
1984). Physiological, nutritional efficiency can be related
to the efficiency of a genotype to absorb soil nutrient,
distribute it and use it internally (Goddard and Hollis,
1984). The genotypic differences in nutritional efficiency
occur for several reasons, which are related to the
absorption, transport and utilization of nutrients by plants
(Marschner, 1995). These genotypic differences involved
in the mineral nutrition of plants can be explained by
morphological and physiological aspects related to the
absorption of nutrients (Gabelman and Gerloff, 1983).
Plants can be grouped into "effective" and "ineffective"
(Vose, 1987), and "responsive" or "non-responsive" in
relation to converting nutrients in dry matter (Blair, 1993;
Ciat, 1978; Fox, 1978; Amaral et al., 2012; Martins et al.,
2013a; Christo et al., 2014).
Nutritional efficiency can be expressed and calculated
in five different ways (Fageria, 1998): agronomic
efficiency (for example yield increase per unit of nutrient
-1
applied - kg.kg ); physiological efficiency (for example
biological yield obtained (grain + senescent leaves in
-1
crops) per unit of nutrient accumulated - kg.kg );
efficiency in the production of grains (for example
production of grain obtained by the accumulated nutrient
-1
unit - kg.kg ); recovery efficiency (for example the
quantity of nutrient uptake per unit of nutrient applied -1
kg.kg ); use efficiency (unit of dry matter per unit of
-1
nutrients in leaf tissues - kg.kg ]. Most efficient plants in
the absorption, translocation and use of nutrients are
essential to crops in soils with low natural supply, since
they are more adaptable and show better performance
(Caldeira et al., 2002). This suggests the need to
understand these concepts. The increased efficiency of
nutrient absorption may be acquired by: i) adequate
geometry and distribution of the root system; ii) chemical
changes in the rhizosphere and exudation of substances
capable of solubilizing nutrients; iii) presence of
mycorrhizae; iv) tolerance to conditions of low pH or high
levels of exchangeable aluminum; v) faster rate of
absorption under conditions of low nutrient concentrations (Souza, 1994; Fageria, 1998; Fageria and
Moreira, 2011). Factors such as root hairs, mycorrhizae
and root morphology may lead to differences in the
absorption efficiency of nutrient between varieties grown
in soil and, consequently, differences in plants’ nutritional
efficiency.
The efficiency of translocation is largely dependent on
the ability of absorption and movement of the ions
through the roots and also the ability of the system to
730
Afr. J. Biotechnol.
release the absorbed ions to xylem vessels (Taiz and
Zeiger, 2012). The movement of ions through the roots
and their release into the xylem involve several steps that
limit the release to the shoots, probably being the basis of
genotypic differences in absorption and movement of
nutrients (Gerloff and Gabelman, 1983). Thus, the study
of mineral nutrition of a species is related to: i) the
occurrence of variations in long-distance transport; ii) the
occurrence of differences in the accumulation and
release of vacuolar level; and iii) the relative proportion of
the metabolic and non-metabolic nutrient fractions
(Furttini Neto, 1994). The use efficiency can be defined
as biomass production per nutrient unit, divided into two
components; (1) acquisition efficiency corresponds to the
total nutrient by the plant nutrient unit supplied and (2)
utilization efficiency, concerning the matter produced by
total dry on the plant nutrient unit. Overall, use efficiency
of nutrients has been reported as well as the ability of
plants to produce maximum quantities of dry matter with
minimal investment in applied nutrient unit (Swiader et
al., 1994).
Although the efficiency of utilization of nutrients is
present in one genotype ability to produce well on
nutrient-poor, results show that under suitable nutrient
levels there is a tendency of not obtaining effective
genotypes similar to efficient production genotypes
(Gerloff, 1976). Results report that the use efficiency
figures the nutritional efficiency index which shows
greater variability between individuals of the same
species; for example wheat genotypes exhibit wide
variability in the efficiency of internal P utilization and
consequent variation in biomass production (Fageria and
Baligar, 1999). Similar results were also found for the
efficiency of nitrogen utilization in cocoa plants (Ribeiro et
al., 2008).
SYSTEMATIC ANALYSIS OF THE NUTRITIONAL
EFFICIENCY OF COFFEA spp.
The literature is vast in relation to information on mineral
nutrition of coffee, but there are few studies on the
nutritional efficiency of culture. In comparative study of
Arabica coffee cultivars, it was found that the Catuaí is
less demanding on nutrients for variety Mundo Novo,
mainly beacuse it has lower requirement for magnesium
and zinc (Matiello, 1991); however, the Catuaí variety has
low efficiency in the use of nitrogen and sulfur (Correa et
al., 1983); but has high efficiency in utilization of copper,
in relation to variety Mundo Novo. An extensive study on
the nutritional efficiency of Arabica coffee plants in
relation to nitrogen and potassium nutrients was able to
discriminate, based on utilization efficiency of N and K,
some varieties of Arabica coffee. This enabled the
efficient selection and expansion of the genetic basis of
culture in Brazil (Pereira, 1999). Studies on the efficiency
in the production of fruits and relative allocation of
nutrients in cultivars of Arabica coffee (Acaiá IAC-474/19,
Icatu Amarelo IAC-3282, Rubi MG-1192 and Catuaí
Vermelho IAC-99) fertilized with different amounts of
fertilizer indicate that the efficiency of the use of nutrients
for fruit production was different among cultivars only in
scenarios that simulated the pattern of nutrient application on land and 140% of the standard recommendation. There was a trend of superiority of the Rubi MG
1192 and Catuaí Vermelho IAC 99, mainly in higher
fertilization levels (140% of the standard recommendation). This better use of nutrients for fruit production
may explain the better performance of these cultivars for
productivity in these levels of fertilization (Amaral et al.,
2010).
The results report that the efficiency in the production
of roots per unit of nutrient (N, P, K, Ca, Mg and S) of
Acaiá (IAC 474-19) is different (lowest) from Ruby (MG 1192). This suggests a possible genetic variability for
numerous variables, directly or indirectly, related to the
indices of nutritional efficiency of the coffee (Amaral et
al., 2011b). To be inefficient in the absorption and
utilization of zinc, nutritional efficiency of coffee in relation
to mineral nutrient zinc has been investigated (Souza et
al., 2001; Reis and Martinez, 2002; Zabini, 2004). With
the study of three varieties of Arabica coffee, it was
possible to confirm that Catuaí variety uses zinc
absorbed with higher efficiency compared to Icatu; and
variety Mundo Novo has reduced capacity utilization of
zinc, which can be a limiting factor in the production of
grain soils lacking this element (Souza et al., 2001).
In studies of nutritional efficiency, usually genotypes
are grown in different scenarios of mineral nutrient
supply. To study the selection, characterization and
differential tolerance to zinc deficiency progeny of
Arabica coffee, for intermediate parameters of nutritional
efficiency, four progenies of Arabica coffee were subjected
to different scenarios of supply of zinc. This study
revealed that the progeny UFV 4066-5 showed low
demand and was efficient in environment with low supply
of zinc; UFV 4066-3 was demanding and efficient in the
environment with a high supply of zinc; progeny Caturra
Vermelho was intermediate in the requirement and
nutritional efficiency of zinc; the IAC 4376-5 was
undemanding and nutritionally inefficient for zinc. This
leads to the conclusion that there is variability in the
absorption of this micronutrient between progenies of
arabica coffee (Zabini, 2004).
Recently, similar experiments were developed with the
aim of investigating the efficiency use of zinc for coffee
genotypes (MG H-419-1, MG-1192, MG-6851, MG-1474,
MG-1190, IAC 1669-33, IAC-476, IAC 785-15, IPR-102,
San Ramon and São Bernardo,) grown in contrasting
doses of the element in the nutrient solution (0.0 and 6.0
-1
mmol L ). The results show that the IPR-102 variety was
the most efficient in the use of zinc; varieties San Ramon
and São Bernardo had low efficiency. The MG-1192
(Rubi) had high and low utilization efficiency of zinc when
Martins et al.
-1
grown in doses 0.0 and 6.0 mmol L . The MG-6851
-1
(Oeiras) showed low efficiency of use of 6.0 mmol L .
The other varieties were moderately efficient in the use of
the element (Pedrosa et al., 2013). Among the macronutrients required the absence of nitrogen is the most
limiting to the development of the coffee plants; for
implication in expanding leaf area and growth of
vegetation. Due to this importance, studies have been
conducted to ascertain the nutritional efficiency of coffee
in relation to nitrogen, especially the test aimed to
highlight the nutritional efficiency of genotypes and
genetic divergence in different scenarios of nitrogen
-1
supply (adequate supply -7.5 mmol L ; reduced supply -1
1.0 mmol L ; in nutrient solution) (Cardoso, 2010).
Among the 20 cultivars only four (Obatã IAC-1669/20,
Araponga MG-1, Tupi IAC-1669/33 e Catucaí IAC785/15) were classified into the effective use of nitrogen
and further responsive to the addition of this element;
analogously cultivars San Ramon and São Bernardo
were inefficient and unresponsive in relation to nitrogen
supply. The results were promising evidences of the
existence of genetic variability among cultivars of Arabica
coffee in relation to the cultivation of nitrogen-constrained
environment, highlighting the possibility of exploitation in
plant breeding programs to obtain efficient cultivars to N
(Cardoso, 2010).
Potassium has fundamental implications for the
production of coffee beans, especially in the regulation of
water loss and grain filling and ripening. By this fact there
are studies focusing on highlighting the implications of
the nutritional efficiency of coffee plants. In this context,
studies were conducted to highlight the extent of genetic
diversity among cultivars of arabica coffee with nutritional
efficiency for potassium in different scenarios (adequate
-1
-1
supply, 4.0 mmol L ; reduced supply, 1.5 mmol L ) in
nutrient solution (Soares, 2013). The cultivation in
scenario with low potassium supply indicated wide
genetic variability among cultivars of Arabica coffee for
indices of nutritional efficiency, associated with high
genotypic coefficients of determination. This indicates the
possibility of obtaining successes in breeding program for
environments with low potassium supply in the soil
(Soares, 2013). It was possible to group the 11 cultivars
of arabica coffee in five groups of genetic similarity.
Scientific advancement entails the finding of a large
group of cultivars with high efficiency of absorption and
utilization of potassium (Paraíso MG H-419/1, IPR-102,
Rubi MG-1192, Catucaí IAC-785/15, IPR 103, Catuaí
Amarelo IAC-62, Obatã IAC-1669/20, Araponga MG-1,
Catuaí Vermelho IAC-15, Pau Brasil and Caturra
Vermelho). The result shows nine cultivars with high
nutritional efficiency (Obatã IAC-1669/20, Caturra
Amarelo, IPR-102, Catuaí Vermelho IAC-15, Rubi MG1192, Araponga MG-1, Tupi IAC-1669/33, Catucaí IAC785/15 and Caturra Vermelho). Furthermore, cultivars of
Arabica coffee Araponga MG-1, Tupi IAC-1669/33 and
Catucaí IAC-785/15 can be considered efficient and
731
responsive to addition of potassium in the crop
environment (Soares, 2013).
Reports of studies on nutritional efficiency of plants of
the species C. canephora are scarce in the literature. The
study of Reis and Martinez (2002) shows that Conilon
coffee supersedes the efficiency of absorption and translocation of phosphorus and zinc compared to Arabica
coffee (Catuaí). But in comparison, Conilon is more
efficient in the use of P and Zn. The nutritional efficiency
(absorption, translocation and utilization) of Conilon
coffee for phosphorus was systematically studied in test
that aimed to promote the interaction of 13 genotypes
(CV-01, CV-02, CV-03, CV-04, CV-05, CV-06, CV-07,
CV-08, CV-09, CV-10, CV-11, CV-12 and CV-13) at
different supply levels of phosphorus (0, 50, 100 and
150% of recommended phosphorus for Conilon coffee)
(Martins et al., 2013a; Martins et al., 2013b; Martins et
al., 2013d). The results indicate that genotypes conilon
exhibit significantly different behavior depending on the
levels of supply of P2O5 in the soil. This behavior
highlights the finding that the variables of vegetative
growth (number of leaves, stem diameter, plant height
and leaf area), of dry matter (leaves, stem and roots) and
phosphorus use efficiency of genotypes increase linearly
with the supply of P2O5 in the soil (Martins et al., 2013b;
Martins et al., 2013d). The absorption efficiency of
phosphorus in most genotypes of coffee conilon presents
adjustment of the quadratic model. This implication in
efficiency absorption is maximum between 75 and 100%
of the nutrient supply in the soil. The translocation
efficiency of phosphorus genotypes conilon coffee is
differentiated with linear behavior and quadratic. The use
efficiency of phosphorus increases with linear
characteristic for genotypes conilon coffee depending on
the supply of soil P2O5 (Martins et al., 2013b).
The results show that regardless of the supply of
phosphorus in the soil, conilon coffee has high efficiency
in the translocation of phosphorus; occasionally about 75
to 95% of absorbed phosphorus is translocated into the
leaves by conilon coffee (Martins et al., 2013b). The CV02 and CV-13 genotypes were classified as non-efficient
and non-responsive, and coffee conilon CV-04, CV-05
and CV-08 are classified as efficient and responsive
supplier of phosphorus in the soil (Martins et al., 2013a).
Much of the differential behavior of genotypes conilon
coffee in relation to vegetative vigor and nutritional
efficiency was due to genetic variation (Martins et al.,
2013a; Tomaz et al., 2013). Commonly vegetative growth
and differentiated nutritional efficiency are under the
same conditions of soil fertility, for cultivars of the same
species (Fageria, 1989). In the culture of conilon, there is
wide genetic (Ferrão et al., 2008) and phenotypic
variability (Fonseca et al., 2004) between different
materials, reinforcing the above. Studies regarding
nutritional efficiency of conilon coffee in relation to the
supply of N and K have preliminary results. In relation to
potassium supply, there is no evidence that the conilon
732
Afr. J. Biotechnol.
coffee is highly responsive to the supply of potassium in
the soil, because the genotypes CV-01, CV-02, CV-03
and CV-05 presented high efficiency of absorption and
utilization of potassium, independent of K in the soil
(Machado et al., unpublished data). The interaction
between genotypes (CV-01, CV-02, CV-03, CV-04, CV05, CV-06, CV-07, CV-08, CV-09, CV-10, CV-11, CV-12
and CV-13) and different levels of nitrogen rates (0, 50,
100 and 150% of the recommended nitrogen for conilon
coffee) revealed that the absorption and translocation
efficiency of nitrogen of genotypes increased with the
supply of nitrogen in the soil; however, the maximum
efficiency of nitrogen utilization of genotypes is linked to
the supply of 50 to 75% of the recommended nitrogen
supply. The results indicate that the genotypes have
lower translocation efficiency of nitrogen, between 40 to
85%, when compared to translocation of phosphorus.
CV-03, CV-07 and CV-08 genotypes were classified as
non-efficient and non-responsive and genotypes CV-01,
CV-04 and CV-09 weree classified as efficient and
responsive to the supply of nitrogen in the soil.
The nutritional efficiency can be changed under the
influence of cultivation techniques used in coffee. So one
of the issues widely investigated was the nutritional
efficiency of arabica coffee plants grafted under the
hypothesis that the nutritional efficiency of grafted
seedlings of C. arabica grafts of C. canephora can differ
from conventional seedlings. The nutritional efficiency
and the use of N, P, S, Ca, and Mg by plants of coffee
vary depending on the combination of scion / rootstock
(Tomaz et al., 2003). Studies were directed to verify the
nutritional efficiency in relation to N, P and K in the
coffee, from four combined genotypes graft (Catuaí
Vermelho IAC-15, Oeiras MG-6851, H 419-10-3-1-5 and
H 514-5-5-3) and four rootstock (Apoatã LC-2258,
Conilon coffee, Emcapa-8141 e Mundo Novo) in
hydroponics. The results demonstrate the existence of
distinct nutritional efficiency (absorption, translocation
and use) of N, P and K in each combination of rootstock
and graft (Tomaz et al., 2004). Overall, the rootstocks
Apoatã LC 2258 and Mundo Novo showed excellent
performance in relation to nutritional efficiency. It was
observed that MG 6851 Oeiras and H 419-10-3-1-5 had
no benefit by grafting, showing high efficiency in nutrient
utilization (Tomaz et al., 2004). The efficiency of
absorption and utilization of N, P and S has been studied
in plants of C. arabica grafted on C. canephora (Tomaz et
al., 2009) and evaluated at 18 months of age. It was
concluded that the use efficiency of N, P and S (Tomaz et
al., 2009) and K, Ca and Mg (Tomaz et al., 2008) varied
depending on the combination of rootstock and graft as
already evidenced (Tomaz et al., 2004). The variety
Catuaí Vermelho IAC-15 combined with rootstocks ES-26
and ES-23 showed higher use efficiency of N, P and Mg
than ungrafted plants of Catuaí IAC-15. Furthermore,
variety Oeiras MG 6851 showed low absorption efficiency
of K and Mg in relation to plant not grafted, regardless of
the combination studied.
In general, higher rates of translocation of nutrients,
except for S, are observed in seedlings of C. arabica
grafted on C. canephora (Dominghetti et al., 2010). The
influence of grafting on the absorption and use of
micronutrients was also studied, since small changes in
foliar concentrations of drugs can be potentially limited for
many metabolic processes.
As observed for macronutrients (Tomaz et al., 2004;
Tomaz et al., 2008; Tomaz et al., 2009), the nutritional
efficiency of coffee plants to B, Zn, Cu and Mn shows
variation with the combination graft and rootstock used.
Combining Catuaí Vermelho IAC-15 and rootstocks ES26 and ES-23 benefited the efficiency of use of B and Zn
(Tomaz et al., 2011). Another study that can be reported
is the influence of increasing levels of silicon in the soil on
the nutritional efficiency of arabica coffee, modifying
indexes of Icatu and Mundo Novo, and maintaining the
nutritional efficiency of Catuaí unchanged (Pozza et al.,
2009).
CONCLUSION
Overall, there is consent in relation to the concept of
nutritional efficiency to characterize plants in their ability
to absorb and utilize nutrients. Numerous studies show
the differential behavior between species or genotypes of
the same species in relation to the efficiency of
absorption, translocation and use of nutrients. This
differential behavior is explained by genetic variability,
which can be conceptualized as a hereditary trait
genotype that shows significant difference compared to
the other genotype (for indexes of nutritional efficiency),
under ideal or adverse conditions. We present the
existence of genetic variability among coffee genotypes
of the same species, for absorption and use efficient of
nutrients; however, it is necessary to better understand
the mechanisms of absorption and utilization of nutrients,
and also the nature and genetic inheritance in relation to
efficiency.
There are reports that enable one to point clearly that
the grafting in coffee modifies indices of nutritional
efficiency for some essential mineral nutrients in plant
metabolism. The arabica coffee has satisfactory indexes
for absorption and use efficiency of nitrogen in
potassium; however, these rates may vary from those
genotypes, implying that they are classified as efficient
and responsive. The conilon coffee has satisfactory
absorption, translocation and use efficiency of nitrogen
and phosphorus, which also allows us to observe genetic
differences that enable the selection of effective and
responsive genotypes indices.
Conflict of interests
The authors have not declared any conflict of interest.
Martins et al.
REFERENCES
Amaral JFT, Martins LD, Laviola BG, Christo LF, Tomaz MA, Rodrigues
WN (2012). A differential response of physic nut genotypes regarding
phosphorus absorption and utilization is evidenced by a
comprehensive nutrition efficiency analysis. J. Agric. Sci. 4: 164-173.
Amaral JFT, Martinez HEP, Laviola BG, Fernandes Filho EI, Cruz CD
(2010) Eficiência na produção de frutos e alocação relativa de
nutrientes em cultivares de cafeeiro. Revista Ceres. 57:253-262.
Amaral JFT, Martinez HEP, Laviola BG, Fernandes Filho EI, Cruz CD
(2011a). Eficiência de utilização de nutrientes por cultivares de
cafeeiro. Ciência Rural. 41:621-629.
Amaral JFT, Martinez HEP, Laviola BG, Tomaz MA, Fernandes Filho
EI, Cruz CD (2011b). Produtividade e eficiência de uso de nutrientes
por cultivares de cafeeiro. Coffee Sci. 6:65-74.
Baligar VC, Fageria NK (1998). Plant nutrient efficiency: towards the
second paradigm. In: Siqueira JO (Ed.). Inter-relação fertilidade,
biologia do solo e nutrição de plantas. Lavras: Sociedade Brasileira
de Ciência do Solo. pp. 183-204.
Blair G (1993). Nutrient efficiency – what do we really mean. In: Randall
PJ, Delhaize E, Richard RA, Munns R. Genetic aspects of plant
mineral nutrition. Keuver Academic, Dordrecht, The Netherlands. pp.
205-210.
Caldeira MVW, Rondon Neto RM, Schumaker MV (2002). Avaliação da
eficiência nutricional de três procedências australiana de acácia
negra (Acacia mearnsii de Wild.). Revista Árvore. 26(5):615-620.
Cardoso PMR (2010). Análise biométrica da eficiência nutricional para
Nitrogênio em café (Coffea arabica L.). 100 p. Dissertação (Mestrado
Genética e Melhoramento de Plantas), Universidade Estadual do
Norte Fluminense Darcy Ribeiro, Campos dos Goytacazes-RJ.
Christo LF, Martins LD, Colodetti TV, Rodrigues WN, Brinate
SVB, Amaral JFT, Tomaz MA, Laviola BG (2014). Differences
between genotypes of Jatropha curcas L. are evidenced for absortion
and use of nitrogen. Afr. J. Agric. Res. 9:2085-2094.
Ciat - Centro Internacional de Agricultura Tropical (1978). Programa de
frijol. Informativi Annual. Cali, Colombia, pp. 12-13.
Correa JB, Garcia AWR, Costa PC (1983). Extração de nutrientes pelos
cafeeiros Mundo Novo e Catuaí. In: X Congresso brasileiro de
pesquisa cafeeira, Poços de Caldas. Anais. Rio de Janeiro:
IBC/GERCA. pp. 117-183.
DaMatta FM, Ramalho JC (2006). Impacts of drought and temperature
stress on coffee physiology and production: a review. Braz. J. Plant
Physiol. 18:55-81.
Dominghetti AF, Mendonça AC, Guimarães NA, Gladyston RC, Botelho
CE, Guedes Carvalho J (2010). Absorção, translocação e eficiência
no uso dos macronutrientes em cafeiros (Coffea arabica L.)
enxertados em Apoatã IAC 2258 (Coffea canephora). Interciência.
35(11):818-822.
Fageria NK (1989). Solos tropicais e aspectos fisiológicos das culturas.
Brasília: Embrapa/Cnpaf. 425 p.
Fageria NK (1998). Otimização da eficiência nutricional na produção
das culturas. Revista Brasileira de Engenharia Agrícola e Ambiental.
2(1):06-16.
Fageria NK, Baligar VC (1993). Screening crop genotypes for mineral
stresses. In: Workshop on Adaptation of Plants to Soil Stresses.
Lincoln. Proceedings... Lincoln: University of Nebraska. pp. 142-159.
Fageria NK, Baligar VC (1999). Phosphorus-use efficiency in wheat
genotypes. J. Plant Nutr. 22(2):331-340.
Fageria NK, Moreira A (2011). The role of mineral nutrition on root
growth of crop plants. In Donald L (org): Advances in Agronomy,
Burlington: Academic Press. 110:251-331.
Ferrão RG, Cruz CD, Ferreira A, Cecon PR, Ferrão MAG, Fonseca
AFA, Carneiro PCS, Silva MF (2008). Parâmetros genéticos em café
Conilon. Pesquisa Agropecuária Brasileira. 43:61-69.
Fonseca AFA, Ferrão MAG, Ferrão RG, Verdin Filho AC, Volpi OS,
Zucateli F (2004). Conilon Vitória - Incaper 8142: improved Coffea
canephora var. kouillou clone cultivar for the tate of Espírito Santo.
Crop Breed. Appl. Biotechnol. 4:503-505.
Fox RH (1978). Selection for phosphorus efficiency in corn.
Communications in Soil Sci. Plant Anal. 9:13-37.
Furtine Neto AE, Barros NF, Novais RF, Oliveira MFG (1998). Frações
fosfatadas em mudas de Eucalypus. Revista Brasileira de Ciência do
733
Solo. 22:267-274.
Gabelman WH, Gerloff GC (1983). The search for and interpretation of
genetic controls that enhance plant growth under deficiency levels of
a macronutrient. Plant Soil. 72:335-350.
Gerloff GC (1976). Plant efficiencies in the use of nitrogen phosphorus,
and potassium. In: Wright MJ (Eds.). Plant adaptation to mineral
stress in problem soils. Cornell University Agriculture Experimental
Station. pp. 161-173.
Gerloff GC, Gabelman WH (1983). Genetic basics of inorganic plant.
nutririon. In: Lauchli, A, Bieleski RL (Eds.). Inorganic Plant Nutrition.
Berlin, Spring-verlag. pp. 453-480.
Goddard RE, Hollis CA (1984). The genetic basics of forest tree
nutrition. In: Bowen GD, Nambier EKS (Eds.). Nutrition of plantation
forest. London, Academic Press. pp. 237-258.
Graham RD (1984). Breeding of nutritional characteristics in cereais. In:
Tinker RB, Lauchli A (Eds.) Advances in plant nutrition, New York,
Praege. pp. 57-102.
Marschner H (1995). Mineral nutrition of higher plant. 2 ed. London,
Academic Press. 889 p.
Martins LD, Lopes JC, Laviola BG, Colodetti TV, Rodrigues WN
(2013c). Selection of genotypes of Jatropha curcas L. for aluminium
tolerance using the solution-paper method. Idesia. 31: 81-86.
Martins LD, Tomaz MA, Amaral JFT, Braganca SM, Martinez HEP
(2013a). Efficiency and response of conilon coffee clones to
phosphorus fertilization. Revista Ceres. 60: 406-411.
Martins LD, Tomaz MA, Amaral JFT, Braganca SM, Martinez HEP, Reis
EF, Rodrigues WN (2013b). Nutritional efficiency in clones of conilon
coffee for phosphorus. J. Agric. Sci. 5: 130-140.
Martins LD, Tomaz MA, Amaral JFT, Christo LF, Rodrigues WN,
Colodetti TV, Brinate SVB (2013d). Alterações morfológicas em
clones de cafeeiro conilon submetidos a níveis de fósforo. Scientia
Plena. 9: 1-11.
Martins LD, Tomaz MA, Lidon FJC, DaMatta FM, Ramalho JDC (2014).
Combined effects of elevated [CO2] and high temperature on leaf
mineral balance in Coffea spp. plants. Climatic Change. 126: 1-11.
Matiello JB (1991). O café, do cultivo ao consumo. Editora Globo. 320p.
Moura WM, Casali VWD, Cruz CD, Lima PC (1999). Divergência
genética em linhagens de pimentão em relação à eficiência
nutricional de fósforo. Pesquisa Agropecuária Brasileira. 34: 217-224.
Pedrosa AW, Martinez HEP, Cruz CD, Matta FM, Clemente JM, Neto
AP (2013). Characterizing zinc use efficiency in varieties of Arabica
coffee. Acta Scientiarum Agronomy. 35: 343-348.
Pereira JBD (1999). Eficiência nutricional de nitrogênio e de potássio
em plantas de café (Coffea arabica L.). 99 p. Tese (Doutorado em
Fitotecnia), Universidade Federal de Viçosa, Viçosa – MG.
Pozza AAA. Carvalho JG. Guimarães PTG. Figeiredo FC. Araújo AR
(2009). Suprimento do silicato de cálcio e a eficiência nutricional de
variedades de cafeeiro. Revista Brasileira de Ciência do Solo.
33:1705-1714.
Ramalho JDC, Rodrigues APD, Semedo JMN, Pais IMPR, Martins LD,
Costa MCS, LEITAO AEB, Fortunato AS, Batista-Santos P, Palos I,
Tomaz MA, Scotti-Campos P, Lidon FJC, DaMatta FM (2013).
Sustained photosynthetic performance of Coffea spp. under longterm enhanced [CO2]. Plos One. 8: e82712.
Reis Jr R, Martinez HEP (2002). Adição de Zn e absorção, translocação
e utilização de Zn e P por cultivares de cafeeiro. Scientia agrícola.
59(3):537-542.
Ribeiro MAQ, Silva JO, Aitken WM, Machado RCR, Baligar VC (2008).
Nitrogen use efficiency in cacao genotypes. J. Plant Nutr. 31(2):239249.
Soares YJB (2013). Análise biométrica da eficiência nutricional de
potássio em café arábica. 130 p. Tese (Doutora em Produção
Vegetal), Universidade Estadual do Norte Fluminense Darcy Ribeiro,
Campos dos Goytacazes-RJ.
Souza CAS, Guimaraes PTG, Furtini Neto AE, Nogueira FD (2001).
Efeitos de doses de zinco via solo em três cultivares de cafeeiro
(Coffea arabica L.). Ciência e Agrotecnologia. 25(4): 890-899.
Souza ME (1994). Correlação adulto juvenil para eficiência nutricional e
comportamento de clones de Eucalyptus grandis em dois níveis de
fertilidade do solo. Viçosa-MG, 102p. Tese de Mestrado Universidade Federal de Viçosa.
Swiader JM (1994). Genotypic differences in nitrate uptake and utilization
734
Afr. J. Biotechnol.
efficiency in pumpkin hybrids. J. Plant Nutr. 17(10): 1687-1699.
Taiz L, Zeiger E (2012). Plant Physiology. Artmed, Porto Alegre.
Tomaz MA, Martinez HEP, Cruz CD, Ferrari RB, Zambolim L, Sakiyama
NS (2008). Diferenças genéticas na eficiência de absorção, na
translocação e na utilização de K, Ca e Mg em mudas enxertadas de
cafeeiro. Ciência Rural. 38(6):1540-1546.
Tomaz MA, Martinez HEP, Cruz CD, Freitas RS, Pereira AA, Sakiyama
NS (2009). Eficiência relacionada à absorção e utilização de
nitrogênio, fósforo e enxofre, em plantas de cafeeiros enxertadas,
cultivadas em vasos. Ciência e Agrotecnologia. 33(4): 993-1001.
Tomaz MA, Martinez HEP, Rodrigues WN, Ferrari RB, Pereira RB,
Zambolim L, Sakiyama NS (2011). Eficiência de absorção e
utilização de boro, zinco, cobre e manganês em mudas enxertadas
de cafeeiro. Revista Ceres. 58(1):108-114.
Tomaz MA, Martins LD, Amaral JFT, Rodrigues WN, Brinate SVB
(2013). Adubação fosfatada no cafeeiro conilon. In: Partelli FL,
Oliveira MG, Silva MB (Org.). Conilon: Qualidade, adubação e
irrigação. 1ed. São Mateus: Ceunes. 1:132-142.
Tomaz MA, Sakiyama NS, Martinez HEP, Cruz CD, Zambolim, L.;
Pereira AA (2004). Comparison of nutritional efficiency among
hydroponic grafted young coffee trees for N, P, and k. Crop Breed.
Appl. Biotechnol. 4:92-99.
Tomaz MA, Silva SR, Sakiyama NS, Martinez HEP (2003). Eficiência
de absorção, translocação e uso de cálcio, magnésio e enxofre por
mudas enxertadas de Coffea arábica. Revista Brasileira de Ciência
do Solo. 27:885-892.
Vose PB (1987). Genetical aspects of mineral nutrition – progress to
date. In: Gabelman WH, Loughman BC (Ed.). Genetic aspects of
plant mineral nutrition. Dordrecht: Martinus Nijhoff. pp. 3-13.
Zabini AV (2004). Seleção, caracterização e tolerância diferencial à
deficiência de zinco de progênies de cafeeiros (Coffea arabica L.).
118 p. Dissertação (Mestrado em Fitotecnia), Universidade Federal
de Viçosa, Viçosa-MG.
Vol. 14(9), pp. 735-744, 4 March, 2015
DOI: 10.5897/AJB2015.14409
Article Number: D5D38A950951
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Recent characterization of cowpea aphid-borne mosaic
virus (CABMV) in Bahia State, Brazil, suggests potential
regional isolation
José Romário Fernandes de Melo1,2*, Antonia dos Reis Figueira1, Charles Neris Moreira1,2 and
Antonio Carlos de Oliveira3
1
Laboratory of Virology, Department of Phytopathology, Federal University of Lavras (UFLA), Lavras, MG 37200-000,
Brazil.
2
Plant Biotechnology Graduate Program, Federal University of Lavras (UFLA), Lavras, MG 37200-000, Brazil.
3
Laboratory of Plant Genetics, Department of Natural Science, Southwest Bahia State University (UESB), Vitória da
Conquista, BA 45083-900, Brazil.
Received 6 January, 2015; Accepted 16 February, 2015
Woodiness disease is the most important disorder of passion fruit worldwide. The causal agent in Brazil
is the Cowpea aphid-borne mosaic virus (CABMV), and despite the economic relevance of passion fruit
for agriculture there have been recently very few studies about this virus in Brazil and worldwide. This
work reveals the phylogenetic relationships of 10 newly identified CABMV isolates from Bahia State, the
region where CABMV was first identified (in that time reported as PWV) in South America before its
outbreak. The coat protein of 10 CABMV isolates (CABMV-Lns1 - CABMV-Lns10) from Livramento de
Nossa Senhora Country, Bahia State, were sequenced and presented very close identity between
themselves (nucleotide: 97 to 99%, amino acid: 95 to 100%). They are phylogenetically closely related to
Brazilian CABMV, however forming an isolated cluster within the Brazilian clade. According to previous
evidences, our data demonstrate that CABMV-Lns are more closely related to isolates from Southern
rather than from Northern Africa. Other two isolates from Bahia State clustered separately from CABMVLns, but together with isolates from other Brazilian regions thus suggesting that CABMV-Lns are a
strain likely restricted to Bahia. The characterization of new populations of CABMV enables greater
resolution of the evolution of viruses causing woodiness disease in passion fruit vines. Our data shed
light on an as yet unexplored population of CABMV in Brazil and contributes to the understanding of its
evolutionary history.
Key words: Passion fruit, Livramento de Nossa Senhora, Bahia, phylogenetics, woodiness disease.
INTRODUCTION
The passion fruit is one of the most important crops in
Brazil. It belongs to Passiflora genus and Passifloraceae
family. Viral diseases are the most severe in terms of
passion fruit yield loss (Sokhandan et al., 1997; Gibbs et
al., 2008b). This is mainly due to the lack of both quick
and accurate diagnosis as well as effective methods for
disease control (Andrade and Pio-Ribeiro, 2001). In
Brazil and Africa woodiness disease is caused by
Cowpea aphid-borne mosaic virus (CABMV) (McKern et
al., 1994; Nascimento et al., 2006; Maciel et al., 2009).
This is in contrast to Australia where the passion fruit
woodiness virus (PWV) is the most common causal agent
736
Afr. J. Biotechnol.
(Sokhandan et al., 1997) and also to Asia where the
same disease is caused by the East asia passiflora virus
(EAPV) (Iwai et al., 2006). Its genus Potyvirus, family
Potyviridae, contains more agriculturally important plant
viruses than any other (Adams et al., 2005). Although in
the past 15 years molecular studies about Brazilian
CABMV have been carried out (Novaes and Rezende,
2003; Nascimento et al., 2004; Barros et al., 2011;
Cerqueira-Silva et al., 2012; Nicolini et al., 2012),
surprisingly none of them has phylogenetically investigated the virus from the region of largest passion fruit
production in Brazil, the Livramento de Nossa Senhora
County. Exploring the molecular variation of the coat
protein (CP) in CABMV helps to better understand
variability among strains, isolates and related species, to
elucidate the evolutionary history of CABMV as well as
assists to shed light on disease outbreaks in the course
of passion fruit dispersion (Iwai et al., 2006; Gibbs et al.,
2008a; Gibbs et al., 2008b). Bahia State is the place
where passion fruit woodiness disease was firstly identified in Brazil during the 70’s (Chagas et al., 1981) before
its dissemination to most of the countries’ fields. This led
us to hypothesize whether Bahia State might host
phylogenetically different isolates than the rest of Brazil
that could be due to genomic mutation, recombination
with other viral species, selective pressure or other
evolutionary events. In this study we report a phylogenetic characterization of a population of CABMV from the
State of Bahia, in comparison to other viruses causing
fruit woodiness disease in passion fruit vines around the
world.
MATERIALS AND METHODS
Virus and plant resources
Ten CABMV isolates were collected from different passion fruit crop
fields in the farming region of Livramento de Nossa Senhora
Country, Bahia State, Brazil (13° 38′ 34″ S, 41° 50′ 27″ W). Ground
extract from symptomatic leaves was used for inoculation on
healthy passion fruit plants for maintenance, following the method
described by Novaes and Rezende (2003). The 10 CABMV isolates
here reported were named: CABMV-Lns1 to CABMV-Lns10.
Several sequences from passion fruit woodiness disease-related
viruses were acquired from public databases (Supplementary Table
1 and Figure 1).
RNA extraction, PCR, cloning and sequencing
RNA extraction was performed following the Arabidopsis Functional
Genomics Consortium Trizol protocol (Arabidopsis Functional
Genomics Consortium – AFGC, 2013). cDNA synthesis and PCR
(Promega), DNA purification (PCR Purification Kit – NORGEN,
Wizard SV Gel and PCR Clean-Up System – Promega) and cloning
(pGEM-T Easy Vector – Promega, Max Efficiency DH5α Competent
Cell – Invitrogen) were performed as essentially as described in the
manufacturer’s protocol. Newly designed primers for both cDNA
synthesis
and
PCR
were:
CABMV8364-F
(5’CCTTTCCTTCTACGATG-3’),
CABMV9389-R
(5’CAACCGGGGTATGGCCTC-3’),
CABMV8359–F
(5’GGCATCCTTTCCTTCTATG-3’)
and
CABMV9402–R
(5’GGCATCCTTTCCTTCTATG-3’).
Sequencing and phylogenetic analysis
Sequencing of at least three independent clones from each isolate
was performed twice by Macrogen (South Korea). The sequences
were manipulated using DNA Baser Sequence Assembler v2 (DNA
Baser Sequence Assembler v2.x, 2010). Phylogenetic tree was
constructed using MEGA5 (Tamura et al., 2011). For nucleotidebased tree, Neighbor-Joining (NJ) and BioNJ pairwise distances
matrix were estimated by maximum composite likelihood (MLC),
estimated under bootstrap values higher than 70% (1,000
replications).
RESULTS
Analysis of coat protein sequence
Complete CP coding sequence containing 828
nucleotides and 275 amino acids were identified in all ten
CABMV-Lns isolates, in agreement with the sequenced
CABMV genomes (Mlotshwa et al., 2002; Barros et al.,
2011). Very little variation was found amongst the
nucleotide sequence of CABMV-Lns isolates (identity
from 97 to 99%) (Table 1). Comparison of CABMV-Lns
and other CABMV isolates showed sequence identity
varying from 78 to 94%, where the lowest identity was
found with CABMV-Mor, CABMV-Iba and CABMVMonguno isolates (78%) and the highest with CABMVBrs isolate (94%). The identity of amino acid sequences
amongst CABMV-Lns isolates ranged from 95 to 100%
identity (Table 1). When compared to other CABMV
isolates, it ranged from 80 to 96%, when the least identity
was found with CABMV-Bnt isolate (80%) and the highest
with CABMV-TC1 isolate (96%). The CP conserved
motifs of potyviruses were entirely conserved in nearly all
CABMV-Lns isolates, with exception of CABMV-Lns6
which has a substitution of aspartic acid by an alanine
residue at the DAG motif (Supplementary Figure 2).
Phylogenetic profile suggests CABMV-Lns as a strain
restricted to Bahia State
Maximum-likelihood genealogies of nucleotide sequences
*Corresponding author. E-mail: [email protected]. Tel: +49 (0)234 32 24274. Fax: +49(0)234-32-14187.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Abbreviations: CABMV, Cowpea aphid-borne mosaic virus; PWV, passion fruit woodiness virus; EAPV, East asia passiflora virus.
de Melo et al.
Figure 1. Molecular phylogenetic tree of viral species that cause woodiness disease
in Passion fruit plants. The nucleotide coding sequence for the Coat Protein was used
to generate the tree. The relationships were inferred using the Maximum Likelihood
method based on the General Time Reversible model (highest log likelihood 10235.3876 is shown). A discrete Gamma distribution was used to model evolutionary
rate differences among sites (5 categories (+G, parameter = 0.8776)). The branch
length is measured by number of substitutions per site. ■ CABMV-Lns, ● CABMV
from Bahia State, CABMV from Brasília, ○ Other CABMV, □ EAPV and ∆ PWV.
737
738
Afr. J. Biotechnol.
Table 1. Percentage identity of nucleotide (above the diagonal) and amino acid (below the diagonal) sequences of the coding
CP gene from ten CABMV-Lns isolates.
CABMV-Lns1
CABMV-Lns1
CABMV-Lns2
CABMV-Lns3
CABMV-Lns4
CABMV-Lns5
CABMV-Lns6
CABMV-Lns7
CABMV-Lns8
CABMV-Lns9
CABMV-Lns10
--99
99
100
98
96
98
99
99
99
CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMV- CABMVLns2
Lns3
Lns4
Lns5
Lns6
Lns7
Lns8
Lns9
Lns10
99
99
99
99
97
98
99
99
99
--99
99
99
98
99
99
99
99
99
--99
99
98
99
99
99
99
99
99
--99
97
98
99
99
99
98
98
98
--97
98
99
98
98
97
97
96
96
--97
97
98
98
98
98
98
97
95
--98
98
99
98
99
99
98
96
97
--99
99
100
99
99
98
97
98
98
--99
99
100
99
98
97
98
99
99
---
of the CP demonstrate that all CABMV isolates clustered
within a monophyletic clade that comprehends
sequences from Brazil and Africa. CABMV-Lns isolates
formed an isolated cluster inside the CABMV monophyletic clade (Figure 1). Interestingly they clustered
separately from CABMV-Jgr and CABMV-Itb isolates also
identified in Bahia State, which are more closely related
to isolates from the States of Pernambuco and Paraíba,
located around 1,200 km and 1,350 km away from
Livramento de Nossa Senhora, respectively. PWV and
EAPV (Iwai et al., 2006), which are well known different
species from CABMV, formed a distinct clade also
separately from CABMV-Lns (Figure 1).
DISCUSSION
The high identity of nucleotide and amino acid sequences
amongst the ten CABMV-Lns isolates is strong evidence
that they belong to the same strain of CABMV. This
information is of great relevance for purposes of disease
control, once most of the attempts to overcome
woodiness disease in passion fruit such as premunization
with mild strains of CABMV/PWV or pathogen-derived
resistance have been hindered by variant strains of the
same virus (Novaes and Rezende, 2003; Alfenas et al.,
2005, Trevisan et al., 2006; Cerqueira-Silva et al., 2014).
On the other hand, CABMV-Lns clustered separately
from the isolates CABMV-Jgr and CABMV-Itb, which
were also collected in Bahia State. As CABMV-Jgr and
CABMV-Itb clustered together with isolates from rather
far regions, the data suggest that CABMV-Lns are likely a
strain restricted to Bahia State. This finding proposes
either a single introduction of this strain to the area or a
constraint in dissemination of this strain to other places
by plant material, since there is no evidence that the virus
is seed-transmitted in Passion fruit. According to the
demarcation criteria for the Potyvirus genus (King et al.,
2011), our data support the hypothesis that CABMV-Lns
isolates are a different strain from CABMV-Prp, CABMVCr, CABMV-Vni, CABMV-Z, CABMV-Iba, CABMVMonguno, CABMV-Mor, CABMV-MG-Avr, CABMV-PEBnt (80 to 89% amino acid identity). Additionally, our data
confirm the higher sequence identity and closer phylogenetic relationship of CABMV-Lns with Southern African
CABMV rather than isolates from the North of Africa,
which was also previously suggested (Nascimento et al.,
2006). The slave trade between Africa and South
America is the likely event for introduction of CABMV in
Brazil (Gibbs et al., 2008b), by which infected biological
material could have been transported from the South
rather than the North of Africa. However, we are aware
that the limited number of CABMV sequences currently
available, associated to the little information about African
CABMV infecting Passion fruit plants, significantly narrow
down the possibilities of drawing more precise conclusion
on this regard. With reference to the important CP
conserved motifs of potyviruses, the DAG motif is related
to transmissibility of potyviruses by insects (Abdullah et
al., 2009). Isolate CABMV-Lns6 shows a substitution of
aspartic acid by alanine it to the DAG motif
(Supplementary Figure 1). Mutations in this region
significantly reduced transmissibility by insects in
previous studies (Abdullah et al., 2009; López-Moya et
al., 1999). However, unfortunately transmissibility
experiments to investigate the consequences of the
mutated DAG motif on the transmissibility capacity of
CABMV-Lns6 were not suitable before the submission of
this work.
Conclusion
Our data precisely demonstrate that CABMV-Lns belong
also to CABMV species. These isolates can be classified
as a strain of CABMV thus far occurring only in Bahia
State and phylogenetically more distant from other
isolates occurring in the same region. In addition
de Melo et al.
and accordingly to previous reports, they are more
closely related to Southern rather than Northern African
CABMV. The exploitation of a larger number of viral
samples from other as yet unexplored places in the
promising State of Bahia will help to shed light on the
events contributing to the observed regional isolation of
CABMV-Lns. The whole genome sequencing of CABMVLns is ongoing and will allow us to comprehend their
evolutionary history with regard to other related viral
species around the world.
Conflict of interests
The authors did not declare any conflict of interest.
ACKNOWLEDGEMENTS
This study consists one chapter of the first author’s
Master of Science Thesis, funded by the Coordination for
the Improvement of Higher Level Personnel (CAPES) in
the Graduate Program of Plant Biotechnology at the
Federal University of Lavras, MG, Brazil. It was partially
funded by the Research Support Foundation of Bahia
State (FAPESB, 0852/2006, Undergraduate Research
Program-PIC/UESB Scholarship to first author) at the
Southwest Bahia State University (UESB). We
acknowledge the assistance of Prof. Leandro M. de
Freitas (UFBA) for phylogenetic analyses, Allan S.
Pereira and Claudio Benicio C. Silva (UESB) for field
work and Carlos Roberto Torres (UFLA) for plant/virus
maintenance. We also thank Dr. Scott Sinclair for
considerably improving the text and the anonymous
reviewers for their careful reading of our manuscript and
their insightful comments and suggestions.
REFERENCES
Abdullah N, Ismail I, Pillai V, Abdullah R, Sharifudin SA (2009).
Nucleotide sequence of the coat protein of the Malasian passiflora
virus and its 3’ non-coding region. Am. J. Appl. Sci. 6(9): 1633-1636.
Adams MJ, Antoniw JF, Fauquet CM (2005). Molecular criteria for
genus and species discrimination within the family Potyviridae. Arch.
Virol. 150(3):459-479.
Alfenas PF, Braz ASK, Torres LB, Santana EN, Verônica A,
Nascimento S, Zerbini FM (2005). Transgenic Passionfruit
expressing RNA derived from Cowpea aphid-borne mosaic virus is
resistant to passionfruit woodiness disease. Fitopatol. Brasil.
30(1):33-38.
Andrade GP, Pio-Ribeiro G (2001). Estratégias e métodos aplicados ao
controle de fitoviroses. In Michereff SJ and Barros (Ed.) Proteção de
plantas na agricultura sustentável, v. 3, R. Universidade Federal de
Pernambuco, Recife, PE, Brazil, pp. 171-181.
Arabidopsis Functional Genomics Consortium - AFGC (2013). Total
RNA
isolation.
AFGC
Website.
http://www.arabidopsis.org/portals/masc/AFGC/RevisedAFGC/site2R
naL.htm. Accessed 11 November 2013.
Barros DR, Alfenas-Zerbini P, Beserra JEA, Antunes TFS, Zerbini, FM
(2011). Comparative analysis of the genomes of two isolates of
cowpea aphid-borne mosaic virus (CABMV) obtained from different
hosts. Arch. Virol. 156(6):1085-1091.
739
Boxtel J, Thomas C, Maule AJ (2000) Phylogenetic analysis of two
potyvirus pathogens of commercial cowpea lines: implications for
obtaining pathogen-derived resistance. Virus Genes 20:71-77.
Brand, RJ, Burger, JT & Rybicld, EP (1993) Cloning, sequencing, and
expression in Escherichia coli of the coat protein gene of a new
potyvirus infecting South African Passiflora. Archives of
Virology128:29-41.
Brand RJ, Burger JT, Rybicld EP (1993). Cloning, sequencing, and
expression in Escherichia coli of the coat protein gene of a new
potyvirus infecting South African Passiflora. Arch. Virol. 128(1-2): 2941.
Cerqueira-Silva CBM, Conceição LDHCS, Souza AP, Corrêa RX
(2014). A history of passion fruit woodiness disease with emphasis
on the current situation in Brazil and prospects for Brazilian passion
fruit cultivation. Eur. J. Plant Pathol. 139(2): 255-264.
Cerqueira-Silva CBM, Melo JRF, Corrêa RX, Oliveira AC (2012).
Selection of pathometric variables to assess resistance and infectivity
in the passion fruit woodiness pathosystem. Eur. J. Plant Pathol.
134(3): 489-495.
Chagas CM, Kitajima, EW, Lin, MT (1981). Grave moléstia em
maracujá amarelo (Passiflora edulis f. flavicarpa) no Estado da Bahia
causada por um isolado do vírus do "woodiness" do maracujá.
Fitopatol. Bras. 6(2): 259-268. 1981.
Coutts, BA, Kehoe, MA, Webster, CG, Wylie, SJ & Jones, RA (2011)
Indigenous and introduced potyviruses of legumes and Passiflora
spp. from Australia: biological properties and comparison of coat
protein nucleotide sequences. Archives of Virology 156:1757-1774.
DNA Baser Sequence Assembler v2.x (2010). HeracleSoftware.
http://www.DnaBaser.com. Accessed 21 January 2014.
Freitas DS, Maia IG, Arruda, P, Vega J (2002) Molecular
characterization and evolutionary relationships of a potyvirus infecting
Crotalaria in Brazil. Archives of Virology 147:411-417.
Fukumoto T, Nakamura M, Ohshima K, Iwai H (2012b) Genetic
structure and variability of East Asian Passiflora virus population in
Amami-O-shima, Japan. J. Phytopathol. 160:404-411.
Fukumoto T, Nakamura M, Rikitake M, Iwai, H (2012a) Molecular
characterization and specific detection of two genetically
distinguishable strains of East Asian Passiflora virus (EAPV) and
their distribution in southern Japan. Virus Genes 44:141-148.
Gibbs AJ, Mackenzie AM, Wei KJ, Gibbs MJ (2008a). The potyviruses
of Australia. Arch. Virol. 153(8):1411-1420.
Gibbs AJ, Ohshima K, Phillips MJ, Gibbs MJ (2008b). The prehistory of
potyviruses: their initial radiation was during the dawn of agriculture.
PloS One 3: e2523.
Gioria, R (2003) Caracterização sorológica, biológica e molecular de
uma estirpe do Passion fruit woodiness virus que infecta
sistemicamente algumas cucurbitáceas. Dissertation, Escola
Superior de Agricultura Luiz de Queiroz.
Iwai H, Yamashita Y, Nishi N, Nakamura M (2006). The potyvirus
associated with the dappled fruit of Passiflora edulis in Kagoshima
prefecture, Japan is the third strain of the proposed new species East
asian passiflora virus (EAPV) phylogenetically distinguished from
strains of Passion fruit woodiness virus. Arch. Virol. 151(4): 811–818.
King AMQ, Adams MJ, Carstens EB, Lefkowitz EJ (2011). Virus
Taxonomy - Ninth Report of the International Committee on
Taxonomy of Viruses. Elsevier/Academic Press; London, United
Kingdom.
Kitjima, EW, de Alcântara, BK, Madureira, PM, Alfenas-Zerbini, P,
Rezende, JAM & Zerbini, FM (2008) A mosaic of beach bean
(Canavalia rosea) caused by an isolate of Cowpea aphid-borne
mosaic virus (CABMV) in Brazil. Archives of Virology 153:743-747.
López-Moya JJ, Wang RY, Pirone TP (1999). Context of the coat
protein DAG motif affects potyvirus transmissibility by aphids. J. Gen.
Virol. 80(12): 3281-3288.
Maciel SC, Nakano DH, Rezende JAM, Vieira MLC (2009). Screening
of passiflora species for reaction to Cowpea aphid-borne mosaic
virus reveals an immune wild species. Sci. Agric. 66(3): 414-418.
McKern NM, Strike PM, Barnett OW, Dijkstra J, Shukla DD, Ward CW
(1994). Cowpea aphid borne mosaic virus-Morocco and South
African Passiflora virus are strains of the same potyvirus. Arch. Virol.
136(1-2):207-217.
Mlotshwa S, Verver J, Sithole-Niang I, Kampen TV, Kammen AV,
740
Afr. J. Biotechnol.
Wellink J (2002). The genomic sequence of Cowpea aphid-borne
mosaic virus and its similarities with other potyviruses. Arch. Virol.
147(5): 1043-1052.
Nascimento AVS, Santana EN, Braz ASK, Alfenas PF, Pio-Ribeiro G,
Andrade GP, Carvalho MG, Zerbini, MF (2006). Cowpea aphid-borne
mosaic virus (CABMV) is widespread in passion fruit in Brazil and
causes passionfruit woodiness disease. Arch. Virol. 151(9):1797–
1809.
Nascimento AVS, Souza ARR, Alfenas PF, Andrade GP, Carvalho MG,
Pio-Ribeiro G, Zerbini, FM (2004). Análise filogenética de potyvirus
causando endurecimento dos frutos do maracujazeiro no Nordeste
do Brasil. Fitopatol. Bras. 29(4):378-383.
Nicolini C, Rabelo Filho FAC, Resende RO, Andrade GP, Kitajima EW,
Pio-Ribeiro G, Nagata T (2012). Possible host adaptation as an
evolution factor of Cowpea aphid-borne mosaic virus deduced by
coat protein gene analysis. J. Phytopathol. 160(2):82-87.
Novaes QS, Rezende JAM (2003). Selected mild strains of Passion fruit
woodiness virus (PWV) fail to protect pre-immunized vines in Brazil.
Sci. Agric. 60(4):699-708.
Novaes, QS, Rezende, JAM (2005) Protection between strains of
Passion fruit woodiness virus in sunnhemp. Fitopatologia Brasileira,
Brasília 30:307-311.
Sokhandan N, Gillings M, Bowyer J (1997). Polymerase chain reaction
detection and assessment of genetic variation in New South Wales
isolates of Passionfruit woodiness potyvirus. Aust. Plant Pathol.
26(3):155-164.
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011).
MEGA5: molecular evolutionary genetics analysis using maximum
likelihood, evolutionary distance, and maximum parsimony methods.
Mol. Biol. Evol. 28(10):2731-2739.
Trevisan F, Mendes BMJ, Maciel SC, Vieira MLC, Meletti LMM,
Rezende JAM (2006). Resistance to Passion fruit woodiness virus in
transgenic Passionflower expressing the virus coat protein gene.
Plant Dis. 90(8):1026-1030.
Webster CG, Coutts BA, Jones RAC, Jones MGK, Wylie SJ (2007).
Virus impact at the interface of an ancient ecosystem and a recent
agroecosystem: studies on three legume-infecting potyviruses in the
Southwest Australian floristic region. Plant Pathology 56:729-742.
Wylie SJ, Jones MG (2011). The complete genome sequence of a
Passion fruit woodiness virus isolate from Australia determined using
deep sequencing, and its relationship to other potyviruses. Archives
of Virology 156:479-482.
de Melo et al.
Supplementary Table 1. Accession details of all sequences analyzed in this study, available in GenBank (National Center for
Biotechnology Information - NCBI, 2013).
GenBank accession number
KF725706
KF725707
KF725708
KF725709
KF725710
KF725711
KF725712
KF725713
KF725714
KF725715
DQ397527
DQ397528
AY253911
AY433950
AY433951
AY433952
AY434454
AY505342
DQ397530
DQ397531
EU004070
AF368424
AY253907
AY253910
DQ397529
DQ397532
AY253909
AY253906
AY253908
DQ397526
JF833415
JF833416
JF833419
JF833420
JF833421
JF833422
JF833423
JF833424
JF833426
JF833427
JF833428
JF833429
JF833431
JF833432
JF833433
JF833434
JF833417
JF833418
JF833425
DQ397525
Country of origin
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
Brazil
State / area
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Bahia
Sergipe
São Paulo
São Paulo
São Paulo
São Paulo
São Paulo
São Paulo
São Paulo
São Paulo
São Paulo
Paraíba
Paraíba
Espírito Santo
Brasília-DF
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Pernambuco
Rio Grande do Norte
Rio Grande do Norte
Rio Grande do Norte
Minas Gerais
Isolate
CABMV-Lns1
CABMV-Lns2
CABMV-Lns3
CABMV-Lns4
CABMV-Lns5
CABMV-Lns6
CABMV-Lns7
CABMV-Lns8
CABMV-Lns9
CABMV-Lns10
CABMV-Jgr
CABMV-Itb
CABMV-SE1
CABMV-SP
CABMV-F101
CABMV-M2
CABMV-M3
CABMV-F144
CABMV-SP-Vcz
CABMV-Prp
CABMV-Cr
CrMV
CABMV-PB1
CABMV-PB2
CABMV-Vni
CABMV-Brs
CABMV-PE4
CABMV-PE2
CABMV-PE3
CABMV-PE-Bnt
CABMV-LMN1
CABMV-CPL3
CABMV-SLMCP1
CABMV-LMN4
CABMV-LMN3
CABMV-SLMCP2
CABMV-PPL1
CABMV-APL5
CABMV-I4-LP3
CABMV-LP7
CABMV-I12
CABMV-LP1
CABMV-LMN2
CABMV-TC1
CABMV-I11
CABMV-I5
CABMV-GSR1
CABMV-GSR3
CABMV-GSR4
CABMV-MG-Avr
Source / publication
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Gioria et al. (2004)
Gioria et al. (2004)
Gioria et al. (2004)
Gioria et al. (2004)
Novaes e Rezende (2005)
Nascimento et al. (2006)
Nascimento et al. (2006)
Kitjima et al. (2008)
Freitas et al. (2002)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nascimento et al. (2006)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nicolini et al. (2011)
Nascimento et al. (2006)
741
742
Afr. J. Biotechnol.
Supplementary Table 1. Contd.
GenBank accession
number
HQ880242
HQ880243
AJ132414
Y17822
NC_004013
Y18634
D10053
AB627437
AB627436
AB627435
AB604610
AB246773
AB690441
AB690440
Country of origin
State / area
Isolate
Source / publication
Brazil
Brazil
Nigeria
Nigeria
Zimbabwe
Morocco
South Africa
Japan
Japan
Japan
Japan
Japan
Japan
Japan
Minas Gerais
Minas Gerais
Ibadan
Monguno
Harare
N/A
N/A
Kagoshima
Kagoshima
Kagoshima
Kagoshima
Kagoshima
Kagoshima
Kagoshima
CABMV-BR1
CABMV-Avr
CABMV-Iba
CABMV-Moguno
CABMV-Z
CABMV-Mor
SAPV
EAPV-SY
EAPV-YW
EAPV-Arata
EAPV-IB
EAPV-AO
EAPV-TG
EAPV-AT2
AJ430527
Australia
Queensland
PWV-#299
DQ898218
DQ898215
JF427623
DQ898216
DQ898217
JF427621
HQ122652
JF427620
JF427622
JF427619
JF427618
JF427617
JF427616
U67149
U67150
U67151
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
Western Australia
New South Wales
New South Wales
New South Wales
PWV-Cop-1
PWV-Gld-1
PWV-BuW-1
PWV-Car-1
PWV-Ku-1
PWV-CarW-1
PWV-MU2
PWV-MuW-1
PWV-BaW-2
PWV-CP-1
PWV-BaW-1
PWV-CarW-3
PWV-CarW-2
PWV-Cul
PWV-SD-1
+
PWV-NB5c5
Barros et al. (2011)
Barros et al. (2011)
Boxtel et al. (2000)
Boxtel et al. (2000)
Mlotshwa et al. (2002)
Boxtel et al. (2000)
Brand et al. (1993)
Fukumoto et al. (2012a)
Fukumoto et al. (2012a)
Fukumoto et al. (2012a)
Fukumoto et al. (2012a)
Iwai et al. (2006)
Fukumoto et al. (2012b)
Fukumoto et al. (2012b)
Dietzgen et al. (2002
Unpublished)
Webster et al. (2007)
Webster et al. (2007)
Coutts et al. (2011)
Webster et al. (2007)
Webster et al. (2007)
Coutts et al. (2011)
Wylie andJones (2011)
Coutts et al. (2011)
Coutts et al. (2011)
Coutts et al. (2011)
Coutts et al. (2011)
Coutts et al. (2011)
Coutts et al. (2011)
Sokhandan et al. (1997)
Sokhandan et al. (1997)
Sokhandan et al. (1997)
de Melo et al.
Supplementary Figure 1. Location of Brazilian CABMV isolates used in this study. Number in brackets
represents the amount of sequences per location. RN: Rio Grande do Norte, PB: Paraíba, PE: Pernambuco, SE:
Sergipe, BA: Bahia, LNS: Livramento de Nossa Senhora, DF: Distrito Federal (Brasília), MG: Minas Gerais, ES:
Espírito Santo, SP: São Paulo. Maps were adapted from original draws available in Wikimedia Commons and
Free World Maps websites.
743
744
Afr. J. Biotechnol.
Supplementary Figure 2. Multiple alignment of 5’ > 3’ predicted amino acid sequence that encodes CP
gene flaked by NIb at 5’ end and 3’ UTR at 3’ end. Letter with green and blue backgrounds highlights amino
acid substitutions. Letter with yellow background highlights conserved motifs. Letter with grey background
shows recently suggested conserved motifs. Start: Start codon, Stop: stop codon, UTR: untranslated region.
Vol. 14(9), pp. 745-751, 4 March, 2015
DOI: 10.5897/AJB2014.14316
Article Number: 55C839A50953
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Validation of a reference gene for transcript analysis in
cassava (Manihot esculenta Crantz) and its application
in analysis of linamarase and α-hydroxynitrile lyase
expression at different growth stages
Sukhuman Whankaew1, Supajit Sraphet1, Ratchadaporn Thaikert1, Opas Boonseng2,
Duncan R. Smith1 and Kanokporn Triwitayakorn1*
1
Institute of Molecular Biosciences, Mahidol University, Nakhon Pathom 73170, Thailand.
Rayong Field Crops Research Center, Ministry of Agriculture and Cooperatives, Rayong 21150, Thailand.
2
Received 12 November, 2014; Accepted 23 February, 2015
Relative real-time reverse transcription quantitative polymerase chain reaction (RT-qPCR) is a wellestablished method for the precise quantification of gene expression. For accurate relative real-time RTqPCR analysis, validation of the expression of an appropriate reference gene is required. In this study,
the expression of six commonly used reference genes, namely 40S ribosomal protein (40S), actin (ACT),
cyclophilin C (CYCC), EF-1 alpha (EF1), TATA box binding protein (TBP) and polyubiquitin (UBI) was
investigated in leaf and root samples of cassava obtained at 6, 9 and 12 months after planting (MAP). A
transcript stability analysis was undertaken in two different varieties of cassava, namely Huay Bong 60
which has high cyanogenic potential (CN) and Hanatee which has low CN. The results reveal that TBP
was the most stable reference gene for expression studies. This information was applied to an analysis
of linamarase and α-hydroxynitrile lyase gene expression in samples from six low and six high CN
cassava plants collected at 6, 9 and 12 MAP. The results indicate that at 6 MAP, the linamarase
transcript from leaf of the high CN group was significantly increased, and the α-hydroxynitrile lyase
transcript was significantly increased at 12 MAP.
Key words: Cassava, housekeeping gene, hydroxynitrile lyase, linamarase, real-time polymerase chain
reaction (PCR).
INTRODUCTION
Accurate quantification of gene expression is important in
a number of experimental situations, such as in
determining the alteration in expression levels occurring
at a defined biological stages and in detecting the
response of genes to various stimuli (Fraga et al., 2008).
Over the past decade, real-time reverse transcription
quantitative PCR (RT-qPCR) has become the choice for
high-throughput accurate and reproducible quantitation
*Corresponding author. E-mail: [email protected]. Tel: +66-2-800-3624. Ext: 1368. Fax: +66-2-441-9906.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
746
Afr. J. Biotechnol.
of gene expression (Vandesompele et al., 2002).
Quantification of expression in RT-qPCR experiments is
generally undertaken as either an absolute or as a
relative quantification. An absolute quantification entails
the determination of the copy number of the transcript of
interest based on a calibration curve. Using a calibration
curve requires the time consuming generation of a stable
and reliable calibration standard which must be precisely
quantified (Pfaffl, 2001). However, in most experiments,
determining the absolute transcript copy number is not
essential, and determining the relative changes in gene
expression or a relative quantification is sufficient (Livak
and Schmittgen, 2001).
For relative quantification by real-time RT-qPCR, a
suitable reference gene transcript is required to normalize
the target gene transcript (Pfaffl, 2001). Theoretically, the
reference transcript should allow the effective normalization of different amounts of starting material (Radonić
et al., 2004) and the expression levels of reference genes
should be constant in all samples under investigation and
under all experimental conditions evaluated (Pfaffl, 2001;
Radonić et al., 2004). While there are several commonly
used reference transcripts that have been reported, it is
generally also accepted that no single transcript is
constantly expressed in all tissues and under all experimental conditions, implying that the reference transcript
should be carefully validated before each experiment for
accurate quantification (Pfaffl, 2001; Radonić et al.,
2004).
Cassava (Manihot esculenta Crantz) is an economically
important human and animal food source and industrial
feedstock and world cassava production is expected to
increase in order to supply the industrial demand (Food
and Agriculture Organization, 2012). However, the ability
of cassava to produce the toxic component, hydrogen
cyanide (HCN), is of significant concern. The cyanogenesis
pathway has been well characterized and CN production
starts when vacuoles are ruptured, releasing linamarin
which is hydrolyzed by the enzyme linamarase (LNM),
also known as beta-D-glucosidase (McMahon et al.,
1995). The deglycosylated product, acetone cyanohydrin
is then further enzymatically broken down by αhydroxynitrile lyase (HNL) or can spontaneously
decompose at pH > 5.0 to produce acetone and HCN
(White et al., 1994).
The recent release of draft cassava genome sequence
in “Phytozome” makes it easier to design sequences to
validate reference genes and to analyze the expression
of genes of interest. Although, the expression study of
LNM and HNL have been identified, but the gene
expression study have been done only with 4 month old
plants in in vitro conditions (Echeverry-Solarte et al.,
2013).
Since the stability of reference gene for expression
study of genes affecting cyanogenic potential (CN) has
not been identified elsewhere, this research therefore
sought to validate potential reference transcripts across
growing stages and tissues of two varieties of cassava
with different endogenous CN in order to provide a
transcript suitable for the accurate normalization of realtime quantitative RT-PCR data. The study utilized the
most stable transcript to investigate the expression of
LNM and HNL genes at 3 growing stages of cassava in
vivo. Both root and leaf tissues were used and six plants
each of low and high CN were analyzed, in order to
understand more about transcription pattern at each
stage and tissue systematically.
MATERIALS AND METHODS
Plant sample collection
Cassava varieties Huay Bong 60 (high CN), Hanatee (low CN), and
five low and five high CN plants from a previously described F1
mapping population (Whankaew et al., 2011) were grown at the
Rayong Field Crops Research Center, Department of Agriculture,
Thailand. Cassava leaves and roots were collected at 6, 9, and 12
month after planting (MAP), then snap frozen in liquid nitrogen until
RNA isolation. The CN in all root samples was evaluated at 6, 9
and 12 MAP using the picrate paper kit method (Bradbury et al.,
1999).
RNA isolation and cDNA synthesis
Frozen tissue samples were ground into fine powder using liquid
nitrogen. Fruit-mate™ for RNA purification (Takara, Japan) was
applied to remove polysaccharides and polyphenols. Total RNA
was then extracted using TriReagent® (Molecular Research
Center, USA) according to the supplier’s instruction. The RNA was
treated with DNA free kit (Ambion, USA) to remove DNA
contamination. The concentration of each RNA sample was
measured
by
a
NanoDrop
1000
Spectrophotometer
(Thermoscientific, USA). First-strand cDNA was synthesized from 1
µg total RNA using ImProm-II Reverse Transcription System
(Promega, USA), according to the manufacturer’s instructions.
Primer design and amplification efficiency
Six reference genes including 40S ribosomal protein (40S), actin
(ACT), cyclophilin C (CYCC), EF-1 alpha (EF1), TATA box binding
protein (TBP) and polyubiquitin (UBI) were chosen from the
cassava genome database (www.phytozome.net). Specific primers
were
designed
using
the
PrimerQuest
software
(http://sg.idtdna.com/primerquest/Home/Index). The sequences of
the target genes, LNM and HNL, sourced from previous
publications (Hughes et al., 1992, 1994) were also used for primer
design. The criterion for amplified products ranged from 100 to 300
bp with a Tm of 60 ± 5°C. Hairpin, self-dimer and primer dimer
interactions
were
investigated
using
Oligo
Analyzer
(https://sg.idtdna.com/analyzer/Applications/OligoAnalyzer/).
Each primer was assessed for efficiency of amplification in series
of 2 fold-serially diluted Hanatee cDNA with 3 technical replicates.
Real-time PCR was carried out in 20 μl final volume containing 1 μl
of 1:2 cDNA template, with final concentration of 0.2 μM of each
primer and 1X of KAPA master mix (KAPA SYBR® FAST qPCR Kit,
KAPA Biosystems, MA, USA). The conditions for real-time PCR
was set as recommended by the manufacturer, with an initial 95°C
Whankaew et al.
for 3 min, followed by a total of 40 cycles of a denaturation step at
95°C for 5 s and an annealing temperature of 60°C for 30 s. If the
amplification was not efficient, 3 step cycling was tested by using
an annealing temperature of 55°C for 20 s, followed by a 1 s
extension at 72°C. Specific amplification was assessed by melting
curve analysis. The primer efficiency (E) was calculated from %E =
(10(−1/slope)-1) x 100, according to the MIQE guidelines for qRT-PCR
(Bustin et al., 2009). The efficiency of all primer between 90-105%
was considered for the next step.
Determination of reference genes stability
Real-time PCR amplification of six reference gene transcripts (40S,
ACT, CYCC, EF1, TBP and UBI) was evaluated using cDNA of
Huay Bong 60 and Hanatee from both leaf and root samples
obtained at 6, 9 and 12 MAP for three technical replicates. The
most stable reference gene transcript was established using the
NormFinder program (Andersen et al., 2004).
Quantification of LNM and HNL expression
LNM and HNL were chosen as genes of interest. Real-time PCR of
root and leaf samples from parental Huay Bong 60 and Hanatee
and five plants with low CN and five with high CN were analyzed at
6, 9 and 12 MAP with technical duplicates. The ∆CT method using
the best reference gene was used for relative quantification. The
expression levels of the low and high CN groups was compared
using PASW Statistics 18 (SPSS Inc., 2009).
RESULTS AND DISCUSSION
Validation of reference gene transcripts
The reference gene names, primer sequences and
amplicon length are given in Table 1. The efficiency of
amplification of all primer pairs ranged from 95-105% and
2
r >0.99, which is in accordance with established criteria
for real-time RT-PCR (Bio-Rad Laboratories, 2006;
Dhami and Kumarasinghe, 2014; Ma et al., 2013). In
order to determine the most stable reference genes,
expression levels of transcripts from these six reference
genes were determined in Huay Bong 60 and Hanatee,
which are significantly different in CN (Whankaew et al.,
2011) at 6, 9 and 12 MAP. Stability of the reference
genes according to the NormFinder software are shown
in Figure 1. NormFinder calculates stability values based
on variance estimations for identifying suitable
normalizing genes amongst a set of candidates, with
lower stability value indicating higher expression stability
(Andersen et al., 2004). From the results, TBP was the
most stable reference gene transcript evaluated with a
stability value of 0.01 across samples. Similarly, TBP has
been reported to be the most stable reference gene in
several systems (Fujii et al., 2013; Nakao et al., 2015;
Tratwal et al., 2014). TBP is not only the appropriate
reference gene for a study of cyanogenic potential, but it
can also be applied in expression studies of other traits
747
that show differences between Huay Bong 60 and
Hanatee varieties, such as starch content, yield, first
branch height, etc. However, it should be noted that no
reference gene is appropriate to all tissues and under all
experimental conditions, and therefore the stability
evaluation should be carefully validated for other organisms or different experiments for accurate quantification
(Pfaffl, 2001; Radonić et al., 2004). In this study, however
TBP was used to accurately determine the relative
expression levels of LNM and HNL.
Expression profile of linamarase (LNM) and αhydroxynitrile lyase (HNL)
LNM and HNL are two major genes involved in the
hydrogen cyanide liberating cyanogenesis pathway
(McMahon et al., 1995). The expression profiles of these
genes were analyzed in six plants each of low and high
CN, consisting of the parental Huay Bong 60 and
Hanatee and an additional five plants with low CN and
five with high CN from a previously described F1
mapping population (Whankaew et al., 2011). Expression
of LNM and HNL was extremely low in root samples, with
correspondingly high Ct values, and so expression
analysis is only presented for leaf samples. Low
expression of LMN and HNL in root samples has been
previously reported by others (Santana et al., 2002;
White et al., 1998).
The CN assessed in root samples and the normalized
expression profiles of LMN and HNL in leaf are shown in
Figure 2, and the results of statistical comparison
between groups are shown in Table 2. There was no
difference in the levels of CN in the low CN plants over
the three time points, while the high CN plants showed
significantly higher CN levels at all time points as
compared to the low CN plants as well as showing
significant increase in CN levels at 9 and 12 MAP as
compared to 6 MAP (Table 2). LMN expression did not
vary significantly in the low CN group over the three time
points, and the high CN plants expression was
significantly increased as compared to all other samples
only at 6 MAP (Table 2). HNL expression was
significantly increased at 12 MAP in both the low and
high CN plants as compared to the earlier time points and
at 12 MAP, HNL expression was significantly increased in
the high CN plants as compared to the same time point in
the low CN plants. The significantly high level of
expression of the genes LNM and HNL in the
cyanogenesis pathway corresponded to the high levels of
CN.
Conclusion
For reliable and accurate relative quantification by real
748
Afr. J. Biotechnol.
Table 1. Primer sequences of reference genes and target genes.
Symbol
Full name
Forward primer (5' -> 3')
Reward primer (5' -> 3')
40S
ACT
CYCC
EF1
TBP
UBI
HNL
LNM
40S ribosomal protein
Actin
Cyclophilin C
EF-1 alpha
TATA box binding protein
Polyubiquitin
α-hydroxynitrile lyase
Linamarase
CCTGCTGAAATTGTTGGGAAGCGT
TCCAATTGACCGCGGCTACCTTAT
AGTTAGGGCTCCAAGCAGGAACAA
TGGTACAAGGGCCCAACTCTTCTT
ATGGCAGATCAAGGAGGCTTGGAA
AGGAGGGCCACCACTGACAAATAA
CTGGGCTTCGTACTTCTGAG
GGAGACTCAGCCACAGAACC
AACACAACATCTTTGCCCGAGAGC
ACGCTGGATTGAAGGGAGAGTGAA
AACCACGCCCTCTTCTGATACGTT
TCACAACCATTCCAGGCTTCAGGA
GCAGCGAAACGCTTAGGGTTGTAT
TTCCATCTAGACGCTTCCCTGCAA
TGAACTTCGGTCTCTGAGCC
GCACATCAACTTTACTGTCGG
Annealing temperature (°C)
Product size (bp)
60
60
60
60
55 and 60
60
60
55
155
145
149
172
179
152
127
169
Figure 1. Stability of 6 reference genes for cyanogenic potential study for leaf and root at 6, 9, 12
MAP calculated using NormFinder. A lower stability value corresponds to a higher stability of
transcript expression.
Whankaew et al.
749
Figure 2. Expression level of LNM and HNL in cassava leaf at 6, 9 and 12 MAP. Cyanogenic potential,
LNM transcript and HNL transcript of low and high groups are shown in panels A, B and C, respectively.
Mean values + standard deviation are represented.
time PCR, validation of reference gene transcripts is an
important first step. From the evaluation of two cassava
varieties that have phenotypic differences in CN levels at
6, 9 and 12 MAP in both leaf and root, TBP was found to
be the most stable gene transcript amongst the six gene
transcripts evaluated. Utilizing expression of TBP to
750
Afr. J. Biotechnol.
Table 2. Tabulation of tests of significance for levels of cyanogenic potential (CN) and normalized expression of linamarase (LNM) and αhydroxynitrile lyase (HNL). Samples were taken from cassava leaf and root at 6, 9 and 12 months after planting (MAP) of low and high CN
groups. CN data is from root samples, while expression data is from leaf samples.
6 MAP
9 MAP
12 MAP
6 MAP
9 MAP
12 MAP
Low CN group
6 MAP
9 MAP
12 MAP
0.072
0.221
0.543
0.019*
0.548
0.231
0.000**
0.000**
0.000**
0.000**
0.005**
0.001**
0.001**
0.020*
0.269
-
6 MAP
9 MAP
12 MAP
6 MAP
9 MAP
12 MAP
0.776
0.429
0.000**
0.651
0.806
0.619
0.000**
0.473
0.596
0.000**
0.230
0.298
0.000**
0.000**
0.825
-
6 MAP
9 MAP
12 MAP
6 MAP
9 MAP
12 MAP
0.905
0.046*
0.126
0.335
0.000**
0.035*
0.100
0.278
0.000**
0.594
0.254
0.002**
0.536
0.001**
0.000**
-
Parameter
Low CN group
Cyanogenic potential (ppm)
High CN group
Low CN group
Expression level of LNM
High CN group
Low CN group
Expression level of HNL
High CN group
normalize gene expression levels of LNM and HNL
showed that at an early stage of post planting (6 MAP),
leaves of the high CN group expressed higher levels of
LNM than leaves in the low CN group, whereas HNL
expression was significantly increase at the latest stage
examined (12 MAP) in leaves of both low and high CN
plants, although expression of HNL was significantly
higher in the high CN plants than the low CH plants at 12
MAP. The results of this study will have future application
on the analysis of gene expression of other important
traits in cassava.
Conflict of interest
The authors declared they have no conflict of interest.
ACKNOWLEDGEMENTS
This project was supported by Thailand Research Fund
and Mahidol University (Grant no. TRG5580002).
Rayong Field Crops Research Center, Department of
Agriculture, Thailand is acknowledged for kindly providing
plant materials.
High CN group
6 MAP
9 MAP
12 MAP
REFERENCES
Andersen CL, Jensen JL, Ørntoft TF (2004). Normalization of Real-Time
Quantitative Reverse Transcription-PCR Data: A Model-Based
Variance Estimation Approach to Identify Genes Suited for
Normalization, Applied to Bladder and Colon Cancer Data Sets.
Cancer Res. 64:5245-5250.
Bio-Rad Laboratories I (2006). Real-Time PCR Applications Guide. BioRad Laboratories, Inc.
Bradbury M, Egan S, Bradbury J (1999). Picrate paper kits for
determination of total cyanogens in cassava roots and all forms of
cyanogens in cassava products. J. Sci. Food Agri. 79:593 - 601.
Bustin S, Benes V, Garson J, Hellemans J, Huggett J, Kubista M,
Mueller R, Nolan T, Pfaffl M, Shipley G, Vandesompele J, Wittwer C
(2009). The MIQE Guidelines: Minimum Information for Publication of
Quantitative Real-Time PCR Experiments. Clin. Chem. 55:611-622.
Dhami MK, Kumarasinghe L (2014). A HRM Real-Time PCR Assay for
Rapid and Specific Identification of the Emerging Pest Spotted-Wing
Drosophila
(Drosophila
suzukii).
PLoS
ONE.
doi:10.1371/journal.pone.0098934.
Echeverry-Solarte M, Ocasio-Ramirez V, Figueroa A, González E,
Siritunga D (2013). Expression Profiling of Genes Associated with
Cyanogenesis in Three Cassava Cultivars Containing Varying Levels
of Toxic Cyanogens. Am. J. Plant Sci. 4:1533-1545.
Food and Agriculture Organization (2012). Food outlook. Global
information and early warning system on food and agriculture.
Fraga D, Meulia T, Fenster S (2008). Real-Time PCR. In: Current
Protocols Essential Laboratory Techniques. John Wiley & Sons, Inc.
doi:10.1002/9780470089941.et1003s00.
Fujii Y, Kitaura K, Matsutani T, Shirai K, Suzuki S, Takasaki T, Kumagai
K, Kametani Y, Shiina T, Takabayashi S, Katoh H, Hamada Y,
Kurane I, Suzuki R (2013). Immune-related gene expression profile in
Whankaew et al.
laboratory common marmosets assessed by an accurate quantitative
Real-Time PCR using selected reference genes. PLoS ONE.
doi:10.1371/journal.pone.0056296.
Hughes J, Carvalho FJ, Hughes MA (1994). Purification,
characterization, and cloning of alpha-hydroxynitrile lyase from
cassava (Manihot esculenta Crantz). Arch. Biochem. Biophys. 311:496502.
Hughes MA, Brown K, Pancoro A, Murray BS, Oxtoby E, Hughes J
(1992). A molecular and biochemical analysis of the structure of the
cyanogenic beta-glucosidase (linamarase) from cassava (Manihot
esculenta Cranz). Arch. Biochem. Biophys. 295:273-279.
Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression
data using Real-Time quantitative PCR and the 2−ΔΔCT method.
Methods. 25:402-408.
Ma S, Niu H, Liu C, Zhang J, Hou C, Wang D (2013). Expression
stabilities of candidate reference genes for RT-qPCR under different
stress
conditions
in
soybean.
PLoS
ONE.
doi:10.1371/journal.pone.0075271.
McMahon J, White WLB, Sayre RT (1995). Cyanogenesis in cassava
(Manihot esculenta Crantz). J. Exp. Bot. 46:731 - 741.
Nakao R, Yamamoto S, Yasumoto Y, Kadota K, Oishi K (2015). Impact
of denervation-induced muscle atrophy on housekeeping gene
expression in mice. Muscl. Nerve. 51:276-281.
Pfaffl MW (2001). A new mathematical model for relative quantification
in real-time RT–PCR. Nucleic Acids Res. doi:10.1093/nar/29.9.e45.
Radonić A, Thulke S, Mackay IM, Landt O, Siegert W, Nitsche A (2004).
Guideline to reference gene selection for quantitative real-time PCR.
Biochem. Biophys. Res. Commun. 313:856-862
Santana MA, Vásquez V, Matehus J, Aldao RR (2002). Linamarase
expression in cassava cultivars with roots of low- and high-cyanide
content. Plant Physiol. 129:1686-1694.
SPSS Inc. (2009). PASW Statistics 18, Release version 18.0.0 SPSS
Inc., Chicaco, IL. www.spss.com
Tratwal J, Follin B, Ekblond A, Kastrup J, Haack-Sorensen M (2014).
Identification of a common reference gene pair for qPCR in human
mesenchymal stromal cells from different tissue sources treated with
VEGF. BMC Mol. Biol. 15:11
751
Vandesompele J, De Paepe A, Speleman F (2002). Elimination of
primer-dimer artifacts and genomic coamplification using a two-step
SYBR Green I real-time RT-PCR. Anal. Biochem. 303:95 - 98.
Whankaew S, Poopear S, Kanjanawattanawong S, Tangphatsornruang
S, Boonseng O, Lightfoot DA, Triwitayakorn K (2011). A genome
scan for quantitative trait loci affecting cyanogenic potential of
cassava root in an outbred population. BMC Genomics. 12:266
White WLB, Arias-Garzon DI, McMahon JM, Sayre RT (1998).
Cyanogenesis in Cassava . The Role of Hydroxynitrile Lyase in Root
Cyanide Production. Plant Physiol. 116:1219-1225.
White WLB, McMahon JM, Sayre RT (1994). Regulation of
cyanogenesis in cassava. Acta Hort. 375:69-77.
Vol. 14(9), pp. 752-757, 4 March, 2015
DOI: 10.5897/AJB2014.14374
Article Number: BC6F11D50954
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Detection of MspI polymorphism and the single
nucleotide polymorphism (SNP) of GH gene in camel
breeds reared in Egypt
Sekena H. Abd El-Aziem, Heba A.M. Abd El-Kader, Sally S. Alam and Othman E. Othman*
Cell Biology Department, National Research Centre, Dokki - Giza – Egypt.
Received 15 December, 2014; Accepted 16 February, 2015
Growth hormone (GH) is an anabolic hormone synthesized and secreted by the somatotroph cells of the
anterior lobe of the pituitary gland in a circadian and pulsatile manner, the pattern of which plays an
important role in postnatal longitudinal growth and development, tissue growth, lactation, reproduction
as well as protein, lipid and carbohydrate metabolism. The aim of this study was to detect the genetic
polymorphism of GH gene in five camel breeds reared in Egypt which are Sudany, Somali, Mowaled,
Maghrabi and Falahy, using polymerase chain reaction- restriction fragment length polymorphism (PCRRFLP) technique. Also, this work aimed to identify the single nucleotide polymorphism (SNP) between
different genotypes detected in these camel breeds. The amplified fragment of camel GH at 613-bp was
digested with the restriction enzyme MspI and the result reveals the presence of three different
genotypes; CC, CT and TT in tested breeds. Significant differences were recorded in the genotype
frequencies between these camel breeds. The result shows that the Maghrabi breed that is classified as
a dual purpose camels had higher frequency for allele C (0.75) than those in the other tested four
breeds. The sequence analysis declared the presence of a SNP (C264T) in the amplified fragment which
is responsible for the elimination of the restriction site C^CGG and consequently the appearance of two
different alleles C and T. The nucleotide sequences of camel GH alleles T and C were submitted to
nucleotide sequences database NCBI/Bankit/GenBank and have accession numbers: KP143517 and
KP143518, respectively. It is concluded that only one SNP C→T was detected in GH gene among the five
tested camel breeds reared in Egypt and this nucleotide substitution can be used as a marker for the
genetic biodiversity between these camel breeds. Also, due to the possible association between allele C
and higher growth rate, we can used it in marker assisted selection (MAS) for camels in breeding
program as a way for enhancement of growth trait in camel breeds reared in Egypt.
Key words: Camel breeds in Egypt, GH, PCR, RFLP, SNPs.
INTRODUCTION
The population of old world camelidae in the world is
estimated to be 18.5 million heads. Dromedary camels
comprise 95% of them while the remaining 5% are
Bactrian camel. Bactrian camels are found mainly in the
cold high altitudes of Asia. The Near East, North Africa
and the Sahel region have about 70% (12.6 million) of the
world's Dromedary camels. Somalia and Sudan together
own about half of this number (Kesseba et al., 1991). In
Egypt, the camel population was about 120 thousand
head, (SADS, 2009). It was reported that many camel
El-Aziem et al.
breeds are reared in Egypt but the main camel breeds
are Maghrabi (a dual purpose animal; (meat and milk)
and Falahy, Sudany, Somali and Mowaled (meat type
animal) (Mahrous et al., 2005). Camels are economically
important animals in Egypt where they are dual purpose
animals. In the Nile Valley and Delta, they are mainly
raised for meat production and for some agricultural
labors. In the desert, they are raised equally for meat and
milk production, while some for labors and transport, and
some especially for camel racing. The main biological
role of growth hormone is to control postnatal growth,
although it also has effects on metabolic regulation,
lactation and reproduction (Louveau and Gondret, 2004;
Daverio et al., 2012). Growth hormone gene, with its
functional and positional potential role in the regulation of
growth and metabolism in animals, has been widely used
for marker in several livestock species, including the
cattle (Dybus, 2002; Ge et al., 2003; Beauchemin et al.,
2006; Katoh et al., 2008), sheep (Marques et al., 2006)
and goat (Malveiro et al., 2001; Boutinaud et al., 2003).
The camel growth hormone gene extends over about
1900 bp, and as other mammalian GH genes, it is
organized in five exons separated by four introns (Maniou
et al., 2004). It is a 22 KDa single chain polypeptide
primarily produced and secreted by the somatotrophs of
the anterior pituitary gland in circadian and pulsatile
manner (Dybus, 2002).
Genetic polymorphism can be identified by several
techniques; one of the most commonly used methods is
PCR-RFLP. It is a powerful method for identifying nucleotide sequence variation in amplified DNA and can detect
single base substitutions in enzymatic restriction sites
(Amie Marini et al., 2012). The present study aimed to
detect the genetic polymorphism of GH gene in some
camel breeds reared in Egypt using PCR-RFLP
technique and identify SNPs between different genotypes
detected in these breeds.
653
Thereafter, it was diluted to the working concentration of 50 ng/μl to
be used for polymerase chain reaction.
Polymerase chain reaction (PCR)
A PCR cocktail containing 1.0 mM forward and reverse primers
specific for growth hormone gene, 0.2 mM dNTPs, 10 mM Tris (pH
9), 50 mM KCl, 1.5 mM MgCl2, 0.01% gelatin (w/v), 0.1% Triton X100 and 1.25 units of Taq polymerase was used. The cocktail was
aliquot into PCR tubes with 100 ng of camel DNA. The reaction was
run at 94°C for 5 min, 35 cycles of 94°C for 1 min, 55°C for 30 s,
72°C for 45 s and a final extension at 72°C for 5 min. The PCR
products were electrophoresed on 2% agarose gel and stained with
ethidium bromide to check amplification product. The primers used
in this study were designed on the basis of DNA sequence of the
camel GH gene (Ishag et al., 2010). The primer sequences are:
F:
5′-GTCCTGTGGACAGCTCAC-3′
and
R:
5′TGTCCTCCTCACTGCTTTA-3′
RFLP Genotyping
In order to detect variants of GH gene in different camel breeds, the
PCR products were digested using restriction enzyme; MspI
(Fermentas). 10 µl of PCR product was digested with 1 µl of
FastDigest restriction enzymes for 5 min at 37°C. The restriction
fragments were subjected to electrophoresis in 2% agarose/
ethidium bromide gel (GIBCO, BRL, England) in 1x TBE buffer
(0.09 M Tris-boric acid and 0.002 M EDTA). Gels were visualized
under UV light and documented in FX Molecular Imager apparatus
(BIO-RAD).
DNA sequencing
The PCR products representing each detected genotype of GH
gene in different camel breeds, were purified and sequenced by
Macrogen Incorporation (Seoul, Korea). Sequence analysis and
alignment were carried out using NCBI/BLAST/blastn suite to detect
each single nucleotide substitution between different detected
genotypes. Results of endonuclease restriction were carried out
using FastPCR. The nucleotide sequences of different alleles for
camel GH gene were submitted to GenBank (NCBI, BankIt).
MATERIALS AND METHODS
RESULTS AND DISCUSSION
Blood samples and DNA extraction
Blood samples were collected from jugular vein of 15 individual
camels from each tested breed; Fallahi, Maghrabi, Mowalled,
Sudany and Somali. Genomic DNA was extracted from the whole
blood according to the method described by Miller et al. (1988) with
minor modifications. Briefly, blood samples were mixed with cold 2x
sucrose-triton x-100 and centrifuged at 5000 rpm for 15 min at 4°C.
The nuclear pellet was suspended in lysis buffer, sodium dodecyl
sulfate and proteinase K and incubated overnight in a shaking
water bath at 37°C. Nucleic acids were extracted with saturated
NaCl solution and then washed with 70% ethanol. The DNA pellet
was dissolved in 1x TE buffer and its concentration was determined
by using NanoDrop1000 (Thermo Scientific) Spectrophotometer.
Growth hormone has proven to be the major regulator of
postnatal growth and metabolism in mammals and thus
affects growth rate, body composition, health, milk
production and aging by modulating the expression of
many genes (Carnicella et al., 2003; Ge et al., 2003).
Growth hormone has also been suggested as
responsible for more important and prolonged cell
proliferation in hypertrophied animals (Schoenfeld,
2010). The growth hormone gene in mammals was
comprised of five exons and four introns (Maniou et al.,
2004). The coding region of GH consisted of five exons,
*Corresponding author. E-mail: [email protected]. Fax: 202 33370931.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
754
Afr. J. Biotechnol.
Figure 1. Electrophoretic pattern of PCR-amplified fragment from GH gene in camels. M: 100-bp
ladder marker. Lanes 1-6: 613-bp PCR product amplified from camel DNA.
covering a total transcribed area of about 1.7 kb in
sheep and humans (Byrne el al., 1987; Vize and
Wells,1987), 2.7 kb in cattle (Yao et al.,1996) and 1.9 kb
in camel (Maniou, 2003) and horse (Zhang et al., 2004).
Camels provide mankind with a range of products and
services; like wool, meat, milk and draught power. They
have been domesticated about 3000 years ago and are
present in high numbers in the arid parts of Africa,
particularly in the arid lowlands of Eastern Africa
(Somalia, Sudan, Ethiopia, Kenya and Djibouti)
(Schwartz and Dioli, 1992). The dromedary camel
contributes significantly to family food security in semi dry
and dry climates, and is a major component of the agropastoral systems in vast pastoral areas in Asia and Africa
(Ishag et al., 2010). Camels are economically important
animals in Egypt where they are dual purpose animals
(meat and milk). Improvement of camel productivity and
detection of biodiversity between different camel breeds
has necessitated the genotyping of the productivity trait
genes in these breeds. The development in molecular
genetics techniques has made it possible to identify
differences between individuals at the DNA level.
Recently, genetic polymorphisms at candidate genes
affecting economic traits have stimulated substantial
research interest because of their impending utilization as
an aid to genetic selection and to demarcate evolutionary
relationships in different livestock breeds (Sodhi et al.,
2007). We aimed in this work to detect the genetic
polymorphism of GH gene in some camel breeds reared
in Egypt using PCR-RFLP technique and identify SNPs
between different genotypes detected in these breeds.
The primers used in this study flanked 613-bp fragments
consist of 36 base pairs from exon 1, 243 base pairs from
intron 1, 161 base pair from exon 2 and 173 base pairs
Figure 2. Different genotypes obtained after digestion of PCR
products of camel GH gene with MspI; TT: homozygous
genotype with one undigested fragment at 613-bp, TC:
heterozygous genotype with three fragments at 613-, 349- and
264-bp and CC: homozygous genotype with two digested
fragments at 349- and 264-bp. M: 100-bp ladder marker.
from intron 2 of camel GH gene. The amplified fragments
obtained from all tested camels were of 613-bp (Figure
1). These PCR amplified fragments (613-bp) were
digested with MspI endonuclease. Depending on the
presence or absence of the restriction site (C^CGG) at
position 264^265, we can easily differentiate between
three different genotypes: CC with two digested fragments at 349-and 264-bp, TT with undigested one
fragment at 613-bp and CT with three fragments at 613-,
349- and 264-bp (Figure 2).
El-Aziem et al.
755
Table 1. Genotype and allele frequencies of the GH gene in different camel breeds.
Camel breed
Falahy
Maghrabi
Mowaled
Somali
Sudany
Total
CC
0.20
0.50
0.10
0.09
0.23
0.22
Genotype frequencies
CT
0.40
0.50
0.40
0.18
0.62
0.42
TT
0.40
0.00
0.50
0.73
0.15
0.36
Allele frequencies
C
T
0.40
0.60
0.75
0.25
0.30
0.70
0.18
0.82
0.54
0.46
0.43
0.57
GTCCTGTGGACAGCTCACCAGCTGTGATGGCTGCAGGTAAGTGCCCTAAAATCCCCTTAGGCTTGATGTGTACG
GAAGGGTGATGTGGGGGCCCTGCAGATGGATGGGGCACTAACCTTGGTCTTTGGGGCTTCTGAATGTGAGCGT
GGATATCTATGCCCACACATTTGGCTACATTTTAGAAAGGAAGGGCCCCTGGAGCACAGAGAGGGCTGGCAGG
AGACGAGGCCTCTGGCTCTCCAGGCCCCTTCCTCGCTGGCCCTCCGGTTCTCTCTCTAGGCCCTCGGACCTCC
GTGCTCCTGGCTTTCACCCTGCTCTGCCTGCCCTGGCCTCAGGAGGCGGGTGCCTTCCCAGCCATGCCTCTGT
CCAGCCTGTTTGCCAACGCTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTT
GTAAGCTCCTCAGGGATGGGTGCTAGTGGGGGGTGGCAGTAAGGGGTGAACCCACCCCCCTCTGCATAATGGG
AGGAAACTAACAAGTTCAGGGGTATCTTATCCAAGTGAAGATGCTGTCAGGTGAGCATAAACTGAGGGGGGCTG
TTCTGCATAAAGCAGTGAGGAGGACA
Figure 3. Nucleotide sequence of allele C with nucleotide C at position 264 in the amplified fragment.
GTCCTGTGGACAGCTCACCAGCTGTGATGGCTGCAGGTAAGTGCCCTAAAATCCCCTTAGGCTTGATGTGTACG
GAAGGGTGATGTGGGGGCCCTGCAGATGGATGGGGCACTAACCTTGGTCTTTGGGGCTTCTGAATGTGAGCGT
GGATATCTATGCCCACACATTTGGCTACATTTTAGAAAGGAAGGGCCCCTGGAGCACAGAGAGGGCTGGCAGG
AGACGAGGCCTCTGGCTCTCCAGGCCCCTTCCTCGCTGGCCCTTCGGTTCTCTCTCTAGGCCCTCGGACCTCC
GTGCTCCTGGCTTTCACCCTGCTCTGCCTGCCCTGGCCTCAGGAGGCGGGTGCCTTCCCAGCCATGCCTCTGT
CCAGCCTGTTTGCCAACGCTGTGCTCCGCGCCCAGCACCTGCACCAGCTGGCTGCTGACACCTACAAAGAGTTT
GTAAGCTCCTCAGGGATGGGTGCTAGTGGGGGGTGGCAGTAAGGGGTGAACCCACCCCCCTCTGCATAATGGG
AGGAAACTAACAAGTTCAGGGGTATCTTATCCAAGTGAAGATGCTGTCAGGTGAGCATAAACTGAGGGGGGCTG
TTCTGCATAAAGCAGTGAGGAGGACA
Figure 4. Nucleotide sequence of allele T with nucleotide T at position 264 in the amplified fragment.
The result shows that all tested camel breeds have the
three genotypes with different frequencies with the
exception of Maghrabi breed which carries only CC and
CT genotypes with absence of TT genotype (Table 1).
The highest frequencies of three genotypes were present
in Maghrabi breed for CC homozygous genotypes (0.50),
Sudany breed for CT heterozygous genotype (0.62) and
Somali breed for TT homozygous genotype (0.73). The
frequencies for alleles C and T ranged from 0.18 to 0.75
and from 0.25 to 0.82, respectively, in tested camel
breeds. These three detected genotypes are resulted
from the presence of two different alleles; C (Figure 3)
and T (Figure 4) in tested camel animals. The sequence
analysis of the purified PCR products representing these
three detecting genotypes CC, CT and TT declared the
presence of a single nucleotide polymorphism (C→T) at
position 264 which is responsible for the elimination of
restriction site C^CGG and consequently the differen-
tiation between these three different genotypes C/C
(Figure 5), C/T (Figure 6) and T/T (Figure 7). The
nucleotide sequences of camel GH alleles T and C were
submitted to nucleotide sequences database NCBI/
Bankit/GenBank and have accession numbers:
KP143517 and KP143518, respectively. In the present
study, sequence analysis revealed a single nucleotide
polymorphism C→T, where nucleotide "C" furnished
cutting site for MspI restriction enzyme. Restriction
reaction resulted three different genotypes; homozygous without restriction (TT), homozygous with
restriction (CC) and heterozygous animals (T/C). The
results show significant differences in the allele
frequencies between the breeds. This finding agrees with
the results of Shah (2006) which explained the significant
differences in allele frequencies among Pakistani camel
breeds and also the similar results were reported by
Ishag et al. (2010) in Sudanese camel breeds where they
756
Afr. J. Biotechnol.
Figure 5. Genotype C/C.
Figure 6. Genotype C/T.
Figure 7. Genotype T/T.
studied the RFLP and SNP of GH gene in six Sudanese
camel breeds; Kenani, Lahwee, Rashaidi, Anafi, Bishari
and Kabbashi. The sequence comparison of Sudanese
camel GH sequences with the GenBank sequence
identified one SNP 419C>T in intron 1. The Bishari and
Anafi breeds that are classified as riding camels with
relatively light weight had slightly higher T allele
frequencies (0.57 and 0.48, respectively) than those of
the other four breeds which are classified as pack
camels. On the other hand, other breeds (Kenani,
Lahwee, Rashaidi and Kabbashi) have higher body
weights with low T allele frequencies (0.30 to 0.33) and
El-Aziem et al.
high C allele frequencies (0.67 to 0.70). The relationship
between GH polymorphism and body weight was
evaluated in four Arabian camel breeds (Majaheem,
Saheli, Waddah and Homor) by Afifi et al. (2014).
Thirteen (13) SNPs (two insertion and 11 substitution)
were detected in the Majahem breed and one was
detected in the Waddah and Homor breeds each at
position 419 (C419T). Two SNPs (C419T and T450C)
were detected in the Saheli breed and T450C SNP was
associated with increased estimated body weight. Both
male and female Saheli camels with the CC genotype
had higher body weights than the CT and TT genotypes
(P≤0.05). The SNP T450C, which was detected only in
camels of the Saheli breed, was correlated with greater
body weight.
In our study, the frequency of allele C in the
Maghrabi breed that is classified as a dual purpose
camels was higher (0.75) than those in the other tested
four breeds. This allele may be associated with body
weight as reported by Shah (2006), Ishag et al. (2010)
and Afifi et al. (2014). Consequently, this allele may be
considered as a useful marker in the selection of camels
for higher growth rate and meat production. It is
concluded that only one SNP C→T was detected in GH
gene among the five tested camel breeds reared in Egypt
and this nucleotide substitution can be used as a marker
in different genetic studies including the detection of
genetic biodiversity and establishment of phylogenic tree
for different camel breeds reared in Egypt. Also, due to
the possible association between allele C and higher
growth rate, this can be used in marker assisted selection
(MAS) for camels and enter the camels possess this
allele in breeding program as a way for enhancement of
growth trait in camel breeds reared in Egypt.
Conflict of interests
The authors did not declare any conflict of interest.
REFERENCES
Afifi M, Metwali EMR, Brooks PH (2014). Association between growth
hormone single nucleotide polymorphism and body weight in four
Saudi camel (Camelus dromedarius) breeds. Pak. Vet. J. 34(4):494498.
Amie Marini AB, Aslinda K, Mohd Hifzan R, Muhd Faisal AB, Musaddin
K (2012). HaeIII-RFLP polymorphism of growth hormone gene in
Savanna and Kalahari goats. Malays. J. Anim. Sci. 15:13-19.
Beauchemin VR, Thomas MG, Franke DE, Silver GA (2006). Evaluation
of DNA polymorphisms involving growth hormone relative to growth
and carcass characteristics in Brahman steers. Genet. Mol. Res.
5(3):438-447.
Boutinaud M, Rousseau C, Keisler DH, Jammes H (2003). Growth
hormone and milking frequency act differently on goat mammary
gland in late lactation. J. Dairy Sci. 86(2):509-520.
Byrne C, Wilson B, Ward K (1987). The isolation and characterization of
the ovine growth hormone gene. J. Biol. Sci. 40:459-468.
Carnicella D, Dario C, Bufano G (2003). Polimorfismo del gene GH
performance productive. Large Anim. Rev. 3:3-7.
Daverio S, Di Rocco F, Vidal-Rioja L (2012). The llama (Lama glama)
757
growth hormone gene:Sequence, organization and SNP
identification. Small Rumin. Res. 103: 108- 111.
Dybus A (2002). Associations of growth hormone (GH) and prolactin
(PRL) genes polymorphism with milk production traits in Polish Black
and White cattle. J. Anim. Sci. 20:203-212
Ge W, Davis M, Hines H, Irvin K, Simmen R (2003). Association of
single nucleotide polymorphisms in the growth hormone and growth
hormone receptor genes with blood serum insulin-likegrowth factor I
concentration and growth traits in Angus cattle. J. Anim. Sci. 81:641648.
Ishag IA, Reissmann M, Peters KJ, Musa LM, Ahmed MK (2010).
Phenotypic and molecular characterization of six Sudanese camel
breeds. South Afr. J. Anim. Sci. 40:319-326.
Katoh K, Kouno S, Okazaki A, Suzuki K, Obara Y (2008). Interaction of
GH polymorphism with body weight and endocrine functions in
Japanese black calves. Domest. Anim. Endocrinol. 34(1):25-30.
Kesseba AM, Wardeh FM, Wilson RT, Zaied AA (1991). Camel applied
research and development network. Proceedings of International
conference on camel production and improvement, 10-13 December,
Tobruk, Libya, 21-36.
Louveau I, Gondret F (2004). Regulation of development and
metabolism of adipose tissue by growth hormone and the insulin-like
growth factor system. Domest. Anim. Endocrinol. 27:241-255.
Mahrous KF, Abd-El Mordy M, Abd El-Aziem SH, Hemdan DM (2005).
Genetic variations in one-humped camels present in Egypt. J. Genet.
Eng. Biotechnol. (NRC) 3(1):15-29.
Malveiro E, Pereira M, Marques PX, Santos IC, Belo C, Renaville R
(2001). Polymorphisms at the five exons of the growth hormone gene
in the algarvia goat: Possible association with milk traits. Small
Rumin. Res. 41(2):163-170.
Maniou Z (2003). Molecular evaluation of pituitary growth hormone
(AJ575419). PhD Thesis, Biological Sciences, University of Sussex,
Brighton, UK.
Maniou Z, Wallis OC, Wallis M (2004). Episodic molecular evolution of
pituitary growth hormone in Cetartidactyla. J. Mol. Evol. 58(6):743753.
Marques MR, Santos IC, Carolino N, Belo CC, Renaville R, Cravador A
(2006). Effects of genetic polymorphisms at the growth hormone
gene on milk yield in Serra da Estrela sheep. J. Dairy Res. 73(4):394405.
Miller SM, Dykes DD, Polesky HF (1988). A simple salting out
procedure for extracting DNA from human nucleated cells. Nucleic
Acids Res. 16(3):1215.
Schoenfeld BJ (2010). The mechanism of muscle hypertrophy and their
application to resistance training. J. Strength Cond. Res.
24(10):2857-2872
Schwartz H, Dioli M (1992). The one humped camel in eastern Africa: A
pictorial guide to diseases, health care and management. Verlag
Josef Margraf, Weikersheim, FR Germany.
Shah MG (2006). Differentiation of six Pakistani camel breed by
phenotype and molecular genetics analysis. University of Agriculture,
Faisalabad, Ph.D. Thesis.
Sodhi M, Mukesh M, Prakash B, Mishra B, Sobti R, Karn S, Singhand
S, Ahlawat S (2007). MspI allelic pattern of bovine growth hormone
gene in Indian Zebu cattle (Bosindicus) breeds. Biochem. Genet.
45:145-153
Sustainable Agricultural Development Strategy Towards 2030 (SADS)
(2009). Agricultural Research and Development Council. Arab
Republic of Egypt, Ministry of Agriculture and Land Reclamation. Oct.
2009.
Vize P, Wells J (1987). Spacer alterations, which increase the
expression of porcine growth hormone in E. coli. FEBS Lett. 213:
155-158.
Yao J, Aggrey SE, Zadworny D, Flan Hayes J, Kiihnlein U (1996).
Sequence variations in the bovine growth hormone gene
characterized by single-strand conformation polymorphism (SSCP)
analysis and their association with milk production traits in Holsteins.
Genetics 144:1809-1816
Zhang Y, Xiraigol U, Dugarjav M (2004). Equuscaballus growth
hormone gene, complete CDs (AY837571). Department of Biology,
Inner Mongolia Agric Univ, Huhhot, Inner Mongolia, PR, China.
Vol. 14(9), pp. 758-763, 4 March, 2015
DOI: 10.5897/AJB2013.13518
Article Number: 56CBC4450955
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Characterization of cathelicidin gene from buffalo
(Bubalus bubalis)
Dhruba Jyoti Kalita
Division of Biochemistry, Indian Veterinary Research Institute, Izatnagar, Bareilly, Uttar-Pradesh, India.
Received 29 November, 2013; Accepted 2 February, 2015
Wide spread and indiscriminate use of antibiotics is accompanied by the emergence of microorganism
that are resistant to these agents. Therefore, new approaches are required to address the problem of
antimicrobial resistance. Epithelial linings of living organisms are the source of various antimicrobial
peptides. Keeping this in view, the present experiment was designed to characterize one of the
important natural antimicrobial peptide gene, that is, cathelicidin gene from the buffalo (Bubalus
bubalis) uterine epithelium and explored its potency for use as template for synthesis of novel
antimicrobial agents. Total RNA was isolated from epithelial layer of buffalo uterus and reverse
transcribed using designed primers. The amplified PCR product was purified and cloned. Positive clone
was sequenced and result was analysed using laser gene software (DNA Star, USA). The cDNA of
uterus cathelicidin had 516 bases with complete ORF from 6-452 bp. The predicted pre-propeptide
comprised of 148 amino acids. Mature active peptide had 18 amino acids and had five each of arginine
and tryptophan and four proline residues. From this study, it can be concluded that the buffalo
(Bubalus bubalis) uterus expressed a potent antimicrobial peptide and amino acid sequence of mature
peptide can be used as template for synthesis of novel antimicrobial agents.
Key words: Antimicrobial peptide, buffalo, cationic peptide and cathelicidin.
INTRODUCTION
The availability of complete genome sequences and
development of information technology have provided a
greater opportunity for peptide based drug designing. The
field of structure based drug designing is a rapidly
growing area and the exposition of genomic, proteomic
and structural information has provided new targets and
opportunities for drug lead discovery. In the meat
industry, the use of antibiotics as growth enhancers is a
common practice and extensive use of antibiotic in meat
industry causes an alarming increase of antibiotic
resistance microbes across the world (Gorbach, 2001).
Antibiotic resistance has been posing increasingly
serious concern to the public, health specialist and
animal food producers. Therefore, there is a need of
alternative group of drugs which are active in vivo and
are able to act fast and has broad-spectrum activity, do
not induce bacterial resistance and have limited or no
side effects. Antimicrobial peptides are prevalent throughout the nature as part of the intrinsic defenses of most
organisms. These peptides represent ancient host defense
E-mail: [email protected], [email protected]. Tel: 91-3622337700. Fax: 91-3622337700.
Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Kalita
molecules and act as key elements in non-specific
immunity (Ganz and Lehrer, 1989). Their wide spread
distribution throughout the animal and plant kingdoms,
suggest that antimicrobial peptides have served a
fundamental role in the successful evolution of complex
multicellular organisms (Bals, 2000). New strategies are
required for synthesis of novel antimicrobial agents to
deal with the threat of bacterial resistance (Ravi et al.,
2011).
Antimicrobial peptides hold promise as broad-spectrum
alternatives to conventional antibiotics (Gee et al., 2013).
Mamalian defensin and cathelicidin are the two broad
classes of natural antimicrobial peptides constitute a
large family of endogenous peptide antibiotics with broad
spectrum activity against various bacteria, fungi and
viruses. Expression of human cathelicidin namely hCAP18 and LL-37 is reported respectively in the reproductive
tract (Malm et al., 2000) and skin epithelial cell (Markus
et al., 2012).
Several β-defensin namely, human β-defensin-4 from
testis (Garica et al., 2001), cryptidin from mouse sertoli
cells (Grandjean et al., 1997); Bin1b from rat epididymis
(Li et al., 2001) has been isolated. Antimicrobial peptide
gene from buffalo tongue has been sequenced and
characterized (Kalita and Kumar, 2009). Synthesis of
different length of natural analogue of buffalo lingual
antimicrobial peptide and functional study revealed its
potency against both gram positive and negative bacteria
(Kalita et al., 2009). However till date, antimicrobial
peptide gene in the uterine tract has not been
characterized. Keeping this in view, the present study
was carried out to characterize the cathelicidin from
buffalo (Bubalus bubalis) uterine epithelia to elucidate its
potency to use as blue print for novel antimicrobial
agents.
MATERIALS AND METHODS
Sample collection, RNA extraction and RT-PCR
A total of five numbers of uteri was collected from apparently
healthy buffalo based on the observation and pre rectal clinical
examination before slaughter from local abattoir in ice after washing
by chilled phosphate buffer saline (pH 7.4). RNA was isolated using
TRI Reagent TM (Sigma-Aldrich, USA) following manufacturer
protocol. The purity and integrity of RNA was checked spectrophotometrecally (A260/A280) and 1% agarose gel electrophoresis,
respectively. Reverse transcription of uterus RNA was done with
specific primer designed from published conserve sequences
(Accession No.NM_174001, Accession No. NM_174150, Accession
No. NM_174831, Accession No.174827) and oligonucleotide
sequences for forward 5/GGACCATGCAGACCCAGA 3/ and
reverse primers were 5/TGTCCAGAAGCCCGAATC3/). One-Step
RT-PCR kit (Qiagen Inc., Chatsworth, CA) was used to carry out
the reverse transcription as well as amplification in a single step.
The reaction mixture was prepared by adding 5x RT-PCR buffer 10
µl, 10 mM dNTP mixture 2 µl, primer both forward and reverse (20
pmoles/µl) 2 µl each, RT- PCR master enzyme mix 2 µl, template
RNA (50 ng/µl) 5 µl and nuclease free water 27 µl. The different
cycle condition in PCR was: reverse transcription for 30 min at
759
50°C, initial PCR activation for 15 min at 95°C, denaturation for 1 min
at 94°C, annealing for 1 min at 52°C and extension for 45 s at 72°C
(35 cycles) and final extension was done at 72°C for 5 min. 1.0%
agarose gel electrophoresis was performed for confirmation of
amplified PCR product and specific product was purified by ‘DNA
Elution Kit’ (Sigma - Aldrich, USA.
Cloning, sequencing and in silico analysis
The purified PCR product was ligated to pGEM-T Easy (Promega,
Madison, USA) cloning vector and transformed into freshly
prepared E. coli DH5 competent cells (Chung et al., 1989).
Plating was done on LB agar containing ampicillin (50mg/ml), IPTG
and X-gal (25 mg/ml). The plates were incubated for overnight at
37°C and white recombinant colonies were picked up after
completion of incubation period. Plasmids were isolated (Sambrook
and Russel, 2001) from the overnight grown culture and insert
release was confirmed by EcoR1 digestion. The positive recombinant plasmids of five clones were sequenced and analyzed using
Lasergene Software (DNA Star, USA) with other published
sequences. The amino acid sequence was predicted and the amino
acid distribution in different domain was analyzed using clustal W
analysis programme (DNA Star, USA).
RESULTS
The yield of isolated total RNA from epithelial layer of
uterus was 24.6 µg per mg of tissue and A 260/A280 was
11.87. All the three bands (28S, 18S and 5S) of RNA was
revealed in 1% agarose gel electrophoresis. RT-PCR
product of total RNA gave a specific product of
approximately 516 bp of cathelicidin gene. The purified
product was cloned in pGEM-T Easy (Promega, Madison,
USA) cloning vector (Figure 1).
The sequence result of uterus cathelicidin has been
submitted to NCBI gene data bank and Accession No. EF
050433 has been offered for the sequence). Buffalo
uterus cathelicidin cDNA have full length ORF region
from 6-452 and code pre-propeptide of 148 amino acids
(Figure 2). The ORF region of buffalo uterus and testis
(Accession No. DQ832665) cathelicidin differs by 18
nucleotides at 8, 20, 25, 26, 28, 84, 108, 147, 179, 183,
186, 203, 276, 277, 284, 377, 416 and 436. The buffalo
myeloid indolicidin (AJ812216) was varied by 32
nucleotides with buffalo uterus cathelicidin sequence. At
nucleotide level, uterine cathelicidin showed similarity of
95.7% and 91.0% with testis cathelicidin and indolicidin,
respectively (Figure 3). Similarly, buffalo uterine
cathelicidin shared 70.7, 79.2, 89.9, 71.8, 69.1, 72.3 and
81.0% of identity with Bos taurus CATHL1, 2, 4, 5, 6, 7
and CAMP, respectively (Figure 3).
The predicted pre-propeptide of buffalo uterus
cathelicidin precursor peptide contain 20 strongly basic,
19 strongly acidic, 48 hydrophobic and 42 polar amino
acids. The amino acid alignment with different buffalo
cathelicidin congeners revealed 120 conserved amino
acids (Figure 4). Four additional amino acids (132 to 135)
were observed in both uterine cathelicidin as compared
to buffalo indolicidin. The deduced amino acid sequences
760
Afr. J. Biotechnol.
Figure 1. 1.0% Agarose gel electrophoresis of cloned
uterus cathelicidin cDNA. M, 100 bp ladder; L1, 516 bp RTPCR product; L2, Purified RT-PCR product; L3, Undigested
recombinant plasmid; L4, EcoR1 Digested Recombinant
Plasmid showing the release of insert of 516 bp.
atg cag acc cag agg gcc agc ctc tcg ttg ggg cgg tgg tca ccg tgg ctt ctg ctg ctg ggg ctt
M
Q T
Q
R
A
S
L S
L
G
R W S
P W L L
L
L G
gtg tcc tcg acc agt gcc cag gac ctc agc tac agg gag gcc gtg ctt cgt gct gtg gat cag
V
S
S
T S
A ↑ Q D
L
S
Y
R
E
A
V L R A V
D Q
L
gtg 69
V
23
ctc
aat 138
L
N 46
gag cgg tcc tca gaa gct aat ctc tac cgc ctc ctg gag cta gac ccg cct ccc aag gat gat gca gat 207
E
R
S
S
E
A
N
L
Y
R
L
L
E
L
D
P
P
P
K
D
D
A
D 69
ctg ggc act cga aag cct gtg agc ttc acg gtg aag gag act gtg tgc ccc agg acg act cag cag ccc 276
L
G
T
R
K
P
V
S
F T
V
K
E
T V C
P R T T
Q
Q
P 92
acg gag cgg tgt gac ttc aag gag gaa ggg cgg gtg aag cag tgt gtg ggg aca gtc acc ctg gac ccg 345
T
E
R
C D
F
K E
E
G
R
V
K
Q C
V
G
T
V T L
D P 115
tcc aat gac cag ttt gac cta aac tgt aat gag ctc cag agt gtc agg ata cgc ttt cca tgg cca tgg 414
S
N
D
Q
F
D
L
N C
N
E
L
Q
S
V ↓ R I
R F P W P W 138
cca tgg cca tgg tgg cgc aga ttc cga ggt tga 447
P W P W W R R F R G * 148
Figure 2. Nucleotide and amino acid sequence of buffalo uterus cathelicidin (Accession No. EF 050453).
Single under line indicates the nucleotide sequence of cathelicidin and double underline of single letter
indicates the corresponding amino acid sequence. Numbering in the left shows the numbers of
nucleotide (bold) and amino acids (italic) respectively. The putatitive cleavage site of the signal sequence
(↑) and prosequence (↓) is indicated by an arrow, the stop codon by an asterisk. The mature peptide is
shown on boldface.
Kalita
761
Figure 3. Percent divergence and similarity of buffalo uterine cathelicidin at nucleotide level with different published cathelicidin sequences.
Figure 4. Alignment of amino acid sequence of buffalo uterus cathelicidin with buffalo testis and indolicidin. The consensus
residues were included within the same box.
of cathelicidin showed 31 conserved amino acids with
different species of animals. The percentage similarity
and divergence of uterine cathelicidin with publish
sequences at amino acid level is depicted in the Figure 5.
The uterine cathelicidin had 91.9% amino acid similar
with testis and 85.5% with buffalo indolicidin. Similarly,
the amino acid sequence of uterine cathelicidin shared a
similarity of 65.1, 76.5, 85.5, 63.8, 65.1, 65.8 and 75.2%
762
Afr. J. Biotechnol.
Figure 5. Percent divergence and similarity of buffalo uterine cathelicidin at amino acid level with different published cathelicidin
sequences.
with Bos taurus CATHL 1, 2, 4, 5, 6, 7 and CAMP,
respectively.
DISCUSSION
The nucleotide sequence of uterine cathelicidin showed a
highly conserve 5' nucleotides region and a limited
similarity in 3' region with other published sequences,
which is the common structural features of the
cathelicidin gene (Ganz et al., 1989; Storici and Zanetti,
1993). The deduced pre-propeptides of uterus cathelicidin
cDNA had conserved N-terminal and diverse heterogeneous C-terminal was in agreement with other
cathelicidin congeners (Popsueva et al., 1996; Wu et al.,
1999). Alanine at 29 was conserved in most of the
congeners and it might be the probable site of elastase
mediated proteolytic cleavage to separate the signal
sequence from the prosequence. The signal sequence of
uterine cathelicidin comprised of 1-29 hydrophobic
stretch of amino acid residues and corroborated with
other congeners (Storici et al., 1992; Das et al., 2006).
Valine at 130 was common to all most all pre-propeptide
including uterine cathelicidin indicating the common
processing sites to yield the mature carboxyl terminal
peptides (Storici and Zanetti, 1993; Skerlavaj et al.,
1996). The prosequence of uterine cathelicidin comprised
of 101 amino acid residues from 30 to 130 residues,
which are highly identical to the cathelin motif, an inhibitor
of thiol proteases (Ritonja et al., 1989). The cathelin like
prosequence is the hallmark for all cathelicidin as it
prevents the tissue injury and inflammation by
neutralizing the high cationic charge of mature peptides
by the presence of clusters of negatively charged amino
acids (Storici et al., 1992; Selested et al., 1992; Ganz,
1989). The cathelin domains also have anti-protease
activity and thus confer stability during storage (Ganz,
1989).
Uterine cathelicidin had 18 amino acid residues in the
mature peptide from 131 to 148. The glycine was the last
residues in most of the congeners along with the uterine
cathelicidin and it might probably act as amide donor in
post translation amidation of the C-terminus (Skerlavaj et
al., 1996; Bradbury, 1991). The C-terminal amidation is
essential for its optimum antimicrobial activity which
increases the lipolysaccharide binding ability and
enhances the outer membrane permeabilization (Sitaram
and Nagaraj, 1999; Timothy and Roberte, 1997, Peters et
al., 2010). The C-terminal amidation of peptides provides
an additional hydrogen bond for α-helix stabilization
(Dennison et al., 2005). The amino acid sequence of
uterine cathelicidin had 4 extra stretch of amino acids
namely arginine, phenylalanine, proline and tryptophan
from 133 to 136, respectively. Thus, the mature peptide
of uterine cathelicidin had 5 arginine, 5 tryptophan and 4
proline. The positively charged arginine is essential to
initiate interaction with negatively charged outer bacterial
surface (Timothy and Roberte, 1997; Boman, 1991). The
tryptophan influences the localization of these peptides in
to membrane interfaces (Schiffer et al., 1992).
Proline is an important amino acid that enhances the
microbicidal activity by forming flexible helical kink and
more ordered structure, which increases membrane permeability (Park et al., 2002). Besides, prolines also provide
Kalita
some protection against nonspecific proteolytic degradation of proteases secreted by microorganisms (Vanhoof
et al., 1995). Peptide rich in arginine, trypto-phan and
proline are shown to have strong microbicidal activity
against gram positive and gram negative bacteria
(Selested et al., 1992), fungi (Subbalakshmi and Sitaram,
1998) and virus (Robinson(jr) et al., 1998). Expression of
antimicrobial peptide with high number of arginine along
with tryptophan and proline by buffalo uterine epithelium
help this species to be free from several infectious
reproductive disorders as compared to cattle and other
species. The mature peptide domain had more variation
compared to other region and it is attributed as, genes
involved in immunity and host defense is rapidly diverged
and had undergo positive selection to fight competently in
antigerm war (Emes et al., 2003; Crovella et al., 2005).
Conclusion
From the present study it can be concluded that, mature
amino acids sequence of uterine cathelicidin is comprise
of 5 arginine, 5 tryptophan and 4 proline residues and the
domain can serve as blue print for synthesis of a novel
antimicrobial agent.
Conflict of interest
The authors have not declared any conflict of interest.
REFERENCES
Bals R (2000). Epithelial antibacterial peptides in host defense against
infection. Resp. Res. 1:141-150.
Boman HG (1991). Antibacterial peptides: Key components needed in
immunity. Cell, 65: 205-207.
Bradbury AF, Smyth DG (1991). Peptide amidation. Trend. Biochem.
Sci. 16:112-115.
Chung CT, Niamela SL, Miller RH (1989). One-step preparation of
competent Eschericia coli: transformation and storage of bacterial
cells in the same solution. Proced. Natur. Acad. Sci. 86:2172-2175.
Crovella S, Antcheva N, Zelezetsky I, Boniotto M, Pacor S, Vittoria M,
Tossi A (2005). Primate β-defensins structure-function and evolution.
Curr. Pro. Pept. Sci. 6:7-21.
Das H, Sharma B, Kumar A (2006). Cloning and characterization of
novel cathelicidin cDNA sequence of Bubalus bubalis homologus to
Bos taurus cathelicidins- 4. DNA Seq. 17:407-414.
Dennison SR, Wallace J, Harris F, Phoenix D (2005). Amphiphilic αHelical Antimicrobial Peptides and Their Structure/ Function
Relationships. Pro. Pept let. 12:31-39.
Emes RD, Goodstadt L, Winter E, Ponting CP (2003). Comparison of
genomes of human and mouse lays the foundation of genome
zoology. Hum. Mol. Gen. 12:701-709.
Ganz T, Lehrer R (1989). Antibiotics peptides from higher eukaryotes:
biology and applications. Mol. Med. Today. 5:292-297.
Ganz T, Rayner JR, Valore EV, Tumolo A, Talmadge K, Fuller F
(1989). The structure of the rabbit macrophage defensin genes and
their organ-specific expression. J. Immunol. 143:1358-1365.
Garica JR, Krause A, Scchulz S (2001). Fimpong-Boateng A. Human
beta defensin 4: a novel inducible peptide with a specific saltsensitive spectrum of antimicrobial activity. Feder. Americ. Soc. Exp.
Biol. Lett. 15:1819-1821.
Gee ML , James, AG , Hossain MA, McArthur S, Palombo EA, Wade
JD, Clayton AH (2013). Imaging the action of antimicrobial peptides on
living bacterial cells. Sci. Reports. 3:1557
763
Gorbach SL (2001). Antimicrobial use in animal feed: ime to stop. N.
Engl. J. Med. 345:1202-1203.
Grandjean V, Vincent S, Martin L, Rassoulzadegan M, Cuzin F (1997).
Antimicrobial protection of the mouse testis : Synthesis of defensin of
the cryptdin family. Biol. Reprod. 57:1115-1122.
Li P, Chang Chan H, He Bin, Cheung SOS, Chung YW, Shang Q,
Zhang Y, Zhang Y (2001). An antimicrobial peptide gene found in the
male reproductive system of rats. Sci. 291:1783-1785.
Malm J, Sorenson O, Persson T, Nilsson F, Johansson B, Bjartell A,
Lilja H, Borregard M, Engstein AQ (2000). The human cationic
Antimicrobial protein (h CAP-18) is expressed in the epithelium of
human epididymis, is present in the seminal plasma at high
concentration and is attached to spermatozoa. Infec. Immun.
68:4297-4302.
Markus Reinholz MD, Thomas Ruzicka MD, Jürgen Schauber MD
(2012). Cathelicidin LL-37: An Antimicrobial Peptide with a Role in
Inflammatory Skin Disease. Ann. Drmato. 24:126-135.
Park S, Kim H, Kim C, Yun H, Choi E, Lee B (2002). Role of proline,
cysteine and disulphide bridge in the structure and activity of the
antimicrobial peptide gaegurin5. Biochem. J. 368:171-182.
Peters BM, Shirtliff, EM, Jabra-Rizk MA (2010). Antimicrobial Peptides:
Primeval molecules or future Drugs? Pathogens 6:1-4.
Popsueva A, Zinovjeva M, Visser J, Zijilmans J, Fibbe W, Belyavsky A
(1996). A novel murine cathelin-like protein expressed in bone
marrow. Feder. Am. Soci. Exp. Biol. Lett. 391:5-8.
Ravi C, Jeyashree AR, Devi K (2011). Antimicrobial Peptides from
Insects: An Overview. Res. Biotech. 2:1-7.
Ritonja A, Kopiter M, Jerala R, Turk V (1989). Primary structure of a
new cysteine proteinase inhibitor from pig leucocytes. Feder. Am.
Soci. Exp. Biol. Lett. 255:211-214.
Robinson WE (Jr), McDougall B, Tran D, Selested ME (1998). Anti-HIV1 activity of indolicidin, an antimicrobial peptide from neutrophils. J.
Leuk. Biol. 63:94-100.
Sambrook J, Russel T (2001). Preparation of plasmid DNA by alkaline
lysis with SDS :Minipreparation.Molecular Cloning:A Laboratory
Manual. 3rd Edition. (Cold Spring Harbor, NY). pp. 1.32-1.34.
Schiffer MCH, Chang CH, Stevens J (1992). The functions of
tryptophan residues in membrane proteins. Pro. Eng. 5:213-214.
Selested ME, Novotny MJ, Morris WL, Tang YQ, Smith W, Cullor JS
(1992). Indolicidin, a novel bactericidal tridecapeptide amide from
neutrophils. J. Biol. Chem. 267:4292-4295.
Sitaram N, Nagaraj R (1999). Interaction of antimicrobial peptides with
biological and model membranes: structural and charge requirements
for activity. Biochem. Biophys. Acta. 1462:29-54.
Skerlavaj B, Gennaro R, Bagella L, Merluzzi L, Risso A, Zanetti M
(1996). Biological characterization of two novel cathelicidin-derived
peptides and identification of structural requirements for their
antimicrobial and cell lytic activities. J. Biol. Chem. 271:28375-28381.
Storici P, Schneider C, Zanetti M (1992). cDNA sequence analysis of an
antibiotic dodecapeptide from neutrophils. Feder. Ameri. Soci. Exp.
Biol. Lett. 314:187-190.
Storici P, Zanetti M (1993). A cDNA derived from pig bone marrow cells
predicts a sequence identical to the intestinal antibacterial peptide,
pR-39. Biochem Biophy. Res. Commun. Sci. 196:1058-1065.
Subbalakshmi C, Sitaram N (1998). Mechanism of antimicrobial action
of Indolicidin FEMS Microbiol. Lett. 160: 91-96.
Timothy J, Robert EWH (1997). Improved Activity of a Synthetic
Indolicidin Analog. Antimicrob. Agent. Chemo. 41: 771-775.
Vanhoof G, Goossens F, Meester ID, Hendriks D, Scharpe S (1995).
Proline motifs in peptides and their biological processing. Feder. Am.
Soci. Exp. Biol. J. 9:736-744.
Wu M, Maier E, Benz R, Hancock RE (1999). Mechanism of different
classes of cationic antimicrobial peptides with planer bilayers and
with the cytoplasmic membrane of Escherichia coli. Biochem. J.
38:7235-7248.
Vol. 14(9), pp. 764-773, 4 March, 2015
DOI: 10.5897/AJB2015.14405
Article Number: CBEFAFC50957
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Bacterial mediated amelioration of drought stress in
drought tolerant and susceptible cultivars of rice
(Oryza sativa L.)
Yogendra Singh Gusain1*, U. S. Singh2 and A. K. Sharma1
1
Department of Biological Sciences, G. B. Pant University of Agriculture and Technology, Pantnagar, Uttarakhand,
263145, India.
2
International Rice Research Institute (IRRI) Office NASC Complex, Pusa New Delhi, 110012, India.
Received 5 January 2015; Accepted 23 February, 2015
In the present study, plant growth promoting rhizobacterial (PGPR) strains Pseudomonas fluorescence
strain P2, Pseudomonas jessenii R62, Pseudomonas synxantha R81, Bacillus cereus BSB 38 (14B),
Arthrobacter nitroguajacolicus strainYB3 and strain YB5 were tested for their role in enhancing plant
growth and induction of stress related enzymes in Sahbhagi (drought tolerance) and IR-64 (drought
sensitive) cultivars of rice (Oryza sativa L.) under different level of drought stress. PGPRs, P. jessenii,
R62, P. synxantha, R81 were used as one consortium similarly A. nitroguajacolicus strainYB3 and strain
YB5 were used as other consortia. Most of the PGPR inoculated plants showed enhanced growth as
compared to uninoculated plants under all the level of drought stress. Quantitative analyses of
antioxidant enzymes indicated that majority of the PGPRs inoculated plants in both varieties showed
higher proline content, higher activity of superoxide dismutase (SOD), catalase (CAT), peroxidase
(POD), ascorbate peroxidase (APX) and lower level of hydrogen peroxide (H 2O2), malondialdehyde
(MDA) in leaves at all the level of drought stress. The study suggests that PGPRs alleviates oxidative
damage in rice plants grown under drought by improving plant growth and activating antioxidant
defense systems, thereby improving stability of membranes in plant cells. This study provides evidence
for a beneficial effect of PGPRs application in enhancing drought tolerance of rice under water deficit
conditions.
Key words: Plant growth promoting rhizobacterial (PGPR), plant growth promotion, drought stress, antioxidant,
rice.
INTRODUCTION
Rice (Oryza sativa L.) is the staple food consumed by
more than half of the world population and fulfills 23% of
their caloric demands (Khush, 2003). Rice has semi-
aquatic nature and grown under flooded condition
conventionally to provide nutrient supply and bulky
amounts of water. However due to insufficient water,
*Corresponding author. E-mail: [email protected]. Tel: +919456532064.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Gusain et al.
half of the rice areas in the world do not maintained
flooded condition and thus reduced yield, to some extent,
as a result of drought (Bernier et al., 2008). Rice with little
adaptation under water limited condition is remarkably
sensitive to drought stress (Kamoshita et al., 2008).
Under varieties of environmental stress including drought,
plants showed increased level of reactive oxygen species
(ROS) (Sgherri et al., 1996), which includes superoxide
._
radical (O2 ), hydroxyl free radical (OH), hydrogen
peroxide (H2O2) and singlet oxygen resulting in peroxidation of lipids, denaturation of proteins, mutation of DNA
and various types of cellular oxidative damage (Smirnoff,
1993).
Enhanced membrane lipid peroxide-tion takes place
in both cellular and organelle membranes when ROS
reaches above threshold level, which, in turn affect
normal cellular functioning and act as an indicator of
ROS mediated damage to cell membranes under
stressful conditions (Mishra et al., 2011) and can be
measured by malondialdehyde (MDA) content, one of
the final products of peroxide-tion of unsaturated fatty
acids in phospholipids of membrane (Halliwell and
Gutteridge, 1989). Plant cells are protected against
damaging effect of ROS by antioxidant defense system
comprising enzymatic and non enzymatic component. In
enzymatic component superoxide dismutase (SOD)
catalyses the conversion of superoxide radical into H 2O2
through their varietal isoforms; catalase (CAT) removes
the bulk of H2O2 generated by photorespiration in
peroxysomes; peroxidase (POD) acts on H2O2 for
substrate oxidation in vacuole, cell wall and cytosol;
ascorbate peroxidase (APX) is localized in cytosol and
various organelles and catalyses the conversion of H 2O2
into H2O and thus protected plants against detrimental
effect of ROS (Noctor and Foyer, 1998). Usually, higher
antioxidant activity in plants correlated with enhance
resistant against stress (Sairam and Srivastava, 2001).
Plant growth promoting Rhizobacteria (PGPR) is well
known for their growth-promoting properties like
production of phytohormones, ability to solubilize mineral
phosphate and to antagonize plant pathogens, etc.
(Glick, 1995). PGPR like Pseudomonas fluorescens and
Bacillus subtilis, recently have obtained attention as
inoculants to withstand plants under varied biotic and
abiotic stress conditions because of their excellent root
colonizing ability, versatility in their catabolic activity, and
their capacity to produce a wide range of metabolites and
enzymes (Mayak et al., 2004; Saravanakumar and
Samiyappan, 2007). Several authors have suggested the
possible role of PGPRs to alleviate the oxidative damage
elicited by abiotic stress through the manipulation of
antioxidant enzymes in different crops (Kohler et al.,
2008; Sandhya et al., 2010; Saravanakumar et al., 2011).
In present study we selected the Pseudomonas strain
R62 and R81 because of their importance as a biofertilizer
765
under field condition (Mader et al., 2011; Roesti et al.,
2006). The Arthrobacter nitroguajacolicus were used as
the ability of Arthrobacter species to showed resistance
against desiccation, starvation and other stresses
(Mongodin et al., 2006); and Bacillus and Pseudomonas
has their importance in previous study to withstand plants
under varied biotic and abiotic stress conditions (Mayak
et al., 2004; Saravanakumar and Samiyappan, 2007). All
the selected PGPRs were tested for their plant-growth
promoting ability as well as their role in stress related
enzymatic adaptive mechanisms in terms of antioxidant
enzymes in tolerant and susceptible varieties of rice
under drought stress.
MATERIALS AND METHODS
Bacterial inoculants
For the study, plant growth promoting bacterial strains
Pseudomonas jessenii (R62), Pseudomonas synxantha (R81)
(Mader et al., 2011; Roesti et al., 2006), two strains of Arthrobacter
nitroguajacolicus, strainYB3 and YB5 (Gusain et al., 2015), Bacillus
cereus BSB 38 (14B), and Pseudomonas fluorescence strain P2
were kindly provided by Rhizosphere biology lab of the Department
of Biological Sciences of G. B. Pant University of Agriculture and
Technology Pantnagar. In this study R62 and R81 were used as
consortium (R62+R81), similarly both the strains of A.
nitroguajacolicus YB3 and YB5 were used as consortium (A3+A5).
All these strains grow separately in nutrient broth medium (Himedia,
India) in flasks incubated at 28°C at 120 rpm until the late
exponential phase. The final culture cfu was maintained at 10 7 to
108 cfu ml−1 level.
Rice varieties
Seeds of two genotype of rice, drought tolerant Sahbhagi (Mackill et
al., 2010) and drought susceptible IR-64 (Singh and Ghosh, 2013)
were kindly provided by the IRRI, Pusa New Delhi, India.
Pot experiment
Rice growth promotion by these bacterial strains under drought
stress was performed in greenhouse condition (temperature:
27±2°C, photo period: 16/8 h day/night cycle, light intensity: 400
Em-2s-1, (400-700 nm), and relative humidity: 60%, respectively).
Rice seeds were surface disinfected by immersion in 70% ethanol
and 3% (v/v) sodium hypochlorite for 1 and 5 min. Seeds were
washed thoroughly many times with sterile distilled water then
germinated on sterilized Petri dish. The soil used for the experiment
had pH 8.31, organic carbon of 1.2%, nitrogen of 186.7 kg/h,
phosphorus of 34.91 kg/h, and potassium of 145.6 kg/h. Five
hundred grams of the sterilized soil was filled in pots and watered to
field capacity before sowing the seeds. At the time of sowing seeds
in pots the bacterial inocula were given to 1 ml/pot. Two seedlings
per pot were maintained. After 30 days of sowing, 10 ml of nutrient
solution (Hoagland and Arnon, 1950) were given weekly to each pot
to fulfill the nutrients requirements of the plants. The nine replicate
of each treatment (including control) were arranged according to
the complete randomized design. After 55 days of sowing, the pots
were irrigated up to water holding capacity of soil and left for drought
766
Afr. J. Biotechnol.
stress by withholding the irrigation. Leaf rolling in drought stress
was determined based on rice standard evaluation system
developed by International Rice Research Institute (IRRI). A visual
score was taken of the degree of leaf rolling using a 0 to 9 scale
(leaf rolling at vegetative stage) with 0 leaves for healthy while 9 for
leaves tightly rolled V-shape. The plants were subjected to harvest
at 0, 5 and 9 stages of leaf rolling (0, 8 and 10 days of drought) with
three replicate, out of nine replicate, at each stage randomly
selected for the measurement of growth promoting trait and
antioxidant enzyme activities. After harvesting, fresh weight were
taken immediately and sample were placed in -80°C for
determination of antioxidant activity. Soil water content (SWC) for
each harvesting was calculated using the weight fraction: SWC (%)
= [(FW-DW)/DW] × 100, where FW was the fresh weight of a soil
portion of the middle part of each pot and DW was the dry weight of
the soil portion after drying in a hot air oven at 80°C for 48 h or till
the complete drying of soil (Cha-um et al., 2012).
Estimation of chlorophyll and carotenoid content
Concentration of total chlorophyll and carotenoid was analysed
following the method of Arnon (1949).
Estimation of H2O2, MDA and proline
For estimation of H2O2 and MDA content, leaf material (0.3 g) was
homogenized in 4 ml of 0.1% trichloroacetic acid (TCA).
Homogenate was centrifuged at 10,000 x g for 10 min at 4°C. MDA
content was determined according to procedure of Heath and
Packer (1968). The concentration of MDA was calculated by using
an extinction coefficient of 155 mM-1 cm-1. Hydrogen peroxide was
measured according to Alexieva et al. (2001). The amount of H 2O2
was calculated using standard curve prepared with different
dilutions of a working standard of 100 M of H2O2. Free proline was
determined by the method of Bates et al. (1973).
Estimation of anti-oxidative enzyme
For assays of SOD, CAT and POD, 0.5 g leaf samples (fresh
weight) was homogenized with a pestle in an ice-cold mortar in 5 ml
cold buffer containing: 50 mM potassium phosphate buffer (PH 7.0),
1 mM ethylene diamine tetra acetic acid (EDTA) and 1% (w/v)
polyvinylpyrolidone (PVP). Whole extraction procedure was carried
out at 4°C. The homogenate was centrifuged at 10,000 x g for 30
min at 4°C and the supernatant collected was used to assay
enzymatic activity. For determination of APX activity 0.4 g leaf
sample were homogenised in 4 ml of of ice-cold 25 mM phosphate
buffer (pH 7-8) containing 1% PVP and 0.2 mM EDTA. The
homogenates were filtered, and then centrifuged at 4°C for 15 min
at 18000 g. All the antioxidant enzymes were determined as
described by Zhang and Kirkham (1996). Protein concentration in
the enzyme extract was determined by the method of Bradford
(1976) using bovine serum albumin as a standard.
Statistical analysis
The data presented here are mean values ± SD. The data of
individual stress level has three replicate (n=3) for each treatments
of individual variety. The data were subjected to factorial analysis of
variance (ANOVA), with varieties, stress level and treatments used
for analysis and the differences between the means were compared
using least significant differences at p<0.05. Different letters denote
significant differences among treatments (including control) in two
varieties.
RESULTS AND DISCUSSION
The plants were harvested at 0 days, 8 days and 10 days
of drought and all these stages the soil moisture content
of pot were measured as 640 ± 17.83, 62 ± 03.09 and 37
± 03.30% respectively.
Plant growth parameters
The treatments showed varied effect on the shoot length,
root length, shoot fresh weight and root fresh weight
under all the level of drought stress. However, in majority
of the inoculated plants showed higher effect on growth
parameters as compare to uninoculated plants, although
most of the differences are not significant. Irrespective of
bacterial inoculation and stress level Sahbhagi showed
enhanced effect on growth parameters as compared to
IR-64 (Table 1). The PGPR can show the various kind of
the plant growth promoting (PGP) activities which may be
the mechanism through which they influence the plant
growth promotion (Glick, 1995). The inoculation effect of
our bacterial isolates had remarkable positive effect on
plant fresh weight under non stress and stress condition.
The higher growth enhancement effect of Sahbhagi as
compared to IR-64 under drought stress might be
related with better stress tolerance characteristics of
the variety. Various study indicated that PGPRs
inoculated plants can take up a higher volume of water
and nutrients from rhizosphere soil; the attributes
could be useful for the growth of plants under drought
stress (Alami et al., 2000). However, the highest
benefits of the PGPRs as bioinoculants can occur
when crops faced prolonged stressful condition
(Egamberdiyeva and Hoflich, 2004).
Chlorophyll and carotenoid content
In the present study, a gradual decrease in chlorophyll
and caretenoid content was found with stress in both
varieties. Similar to the growth parameters, majority of
the treatments showed enhanced chlorophyll and
carotenoid contents over control under all the level of
stress (Table 2). The enhanced chlorophyll content may
increase the photosynthetic efficiency of inoculated
plants, and thus may be a reason for the tolerance of
abiotic stress. Increased chlorophyll and caretenoid
content in plants inoculated with PGPR is supported by
previous study (Gururani et al., 2013) where authors
found improved photosynthetic performance in Solanum
Gusain et al.
767
Table 1. Growth promoting effect of PGPRs on two cultivars of rice under 0, 8 and 10 days of drought stress.
Rice
cultivar
Inoculants
Sahbhagi
Control
P2
R62+R81
14B
A3+A5
Shoot length (cm)
0 days
8 days
10 days
ab
ab
a
70.87
67.33
65.17
b
bc
bc
71.92
73.5
74.67
bc
c
c
76.43
79.83
79.17
bc
bc
bc
77.63
76.00
73.17
bc
bc
b
75.47
72.83
71.83
IR-64
Control
P2
R62+R81
14B
A3+A5
69.62
ab
71.20
ab
70.70
ab
70.63
ab
70.20
ab
ab
65.83
ab
67.50
a
64.83
ab
68.17
ab
65.67
ab
67.67
ab
68.67
ab
70.00
ab
69.83
ab
68.17
Root length (cm)
0 days
8 days
10 days
ab
a
ab
22.83
20.17
20.67
b
ab
ab
24.67
21.67
22.97
b
ab
ab
24.87
21.60
23.30
b
ab
ab
24.00
21.20
21.63
ab
b
ab
23.37
21.33
23.63
ab
21.50
ab
25.53
b
24.17
b
24.07
ab
21.60
ab
20.70
ab
23.03
ab
21.13
ab
22.30
ab
21.23
ab
20.63
ab
22.97
ab
21.53
ab
20.87
ab
22.30
Shoot Fresh wt (g/pot)
0 days
8 days 10 days
f
d
ab
10.45
6.33
3.53
g
e
bc
12.32
7.46
4.41
g
e
c
12.86
7.60
4.67
g
e
bc
12.78
7.49
4.10
g
e
bc
12.34
7.07
4.32
f
bc
10.25
g
12.43
g
12.85
g
12.57
g
12.97
4.26
cd
5.42
cd
5.54
c
5.01
c
5.13
a
2.69
b
3.66
b
3.68
ab
3.21
ab
3.24
Root fresh wt (g/pot)
0 days
8 days
10 days
ef
c
ab
6.67
2.68
1.07
gh
d
b
8.24
3.68
1.35
h
d
b
8.37
3.64
1.56
g
cd
b
7.67
3.14
1.23
g
cd
b
7.68
3.07
1.31
e
6.01
fg
7.14
gh
7.79
fg
7.40
f
6.93
Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress.
Table 2. Effect of PGPRs on total chlorophyll and carotenoids content of two cultivars of rice under 0, 8 and 10 days of drought
stress.
Rice
cultivar
Inoculants
Sahbhagi
control
P2
R62+R81
14B
A3+A5
IR-64
control
P2
R62+R81
14B
A3+A5
Total chlorophyll
(mg/g fresh weight)
0 days
8 days
10 days
f
d
ab
4.81
3.17
1.74
f
e
bc
5.11
3.62
1.90
h
e
bc
5.96
3.73
2.04
i
e
c
6.13
3.78
2.26
j
e
c
6.59
3.89
2.35
g
5.54
g
5.21
g
5.22
i
6.14
i
6.15
d
3.12
e
3.58
e
3.60
de
3.40
e
3.62
a
1.41
ab
1.59
ab
1.77
ab
1.76
b
1.88
Carotenoids
(mg/g fresh weight)
0 days
8 days
10 days
g
d
a
11.75
8.51
6.11
gh
ef
bc
12.02
9.91
6.88
h
e
bc
12.27
9.55
6.97
h
ef
c
12.37
10.05
7.16
gh
ef
bc
12.22
9.86
6.92
h
12.55
gh
12.00
gh
12.07
h
12.49
h
12.49
f
10.35
f
10.15
f
10.35
f
10.53
f
10.39
a
6.07
b
6.63
bc
6.99
c
7.59
ab
6.41
Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress.
ab
1.07
b
1.26
b
1.42
b
1.17
ab
1.07
a
0.46
ab
0.63
ab
0.71
ab
0.53
ab
0.63
768
Afr. J. Biotechnol.
Figure 1. (a) H2O2 (b) MDA and (c) Proline content of two genotype of rice inoculated with PGPRs under 0, 8 and 10
days of drought stress. Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two
cultivars at all the level of stress.
tuberosum when inoculated with Bacillus sp. under
abiotic stress.
Hydrogen peroxide content
Among all the treatments, P2 treated plants in Sahbhagi
and IR-64 showed maximum reduction in H2O2 level with
th
1.17 and 1.59 fold respectively, over control in 8 days of
th
drought. In 10 days of drought, only R62+R81 treated
plants in Sahbhagi with 1.15 fold reduction showed
significant effect on H2O2 level, while in IR-64, all the
PGPRs treated plants significantly reduced the H 2O2 level
over control plants (Figure 1a). Under drought, increased
level of H2O2 was well documented which may be due to
the formation of superoxide ion by electron transport
Gusain et al.
chains which dismutase to form H2O2 in chloroplast and
mitochondria (Elstner, 1991). However H2O2 may also be
involved for the formation of highly reactive hydroxyl
radicals by reacting with superoxide radicals in plants
cells (Prousek, 2007) which can initiate self- replicating
reactions leading to peroxidation of membrane lipids and
destruction of proteins, and ultimately cell death (Jaw and
Ching, 1998). Here the level of H2O2 in plants gradually
increased with increase in stress level, however the
results indicated that treated plants of both varieties
showed the reduced level of H2O2 as compared to their
respective control, although the difference were not
significant in all the treatments. In this study, irrespective
of treatments and stress level, Sahbhagi showed the
reduced (35.27%) level of H2O2 as compared to IR-64,
which might be an attribute of a tolerance variety to cope
with drought stress. It is believed that under drought
stress, PGPRs treated plants showed the high amount of
reactive oxygen species (ROS) scavenging agent which
may help plants to maintain the reduced level of H 2O2
(Moslemi et al., 2011).
Malondialdehyde content
th
In 0 and 8 days of stress there was non-significant effect
th
of the treatments over the control while at 10 days of
stress all the bacterial treatment significantly reduced the
MDA content when compared with control in both
varieties (Figure 1b). MDA is one of the byproducts of
lipid peroxidation, which is one of the consequences of
higher accumulation of ROS such as H2O2, superoxide
radical and hydroxyl radical in plant cell and could reflect
the degree of peroxidation of membrane lipids (Gill and
Tuteja, 2010). Here under severe drought both varieties
showed higher MDA content in leaves which may be
associated with higher accumulation of H2O2 in stressed
plants. However the PGPRs treated plants in both varieties showed remarkably lesser amount of MDA content
as compared to their respective control, suggesting the
involvement of PGPRs in ROS metabolism in rice plants.
In overall, irrespective of treatments and stress level
sahbhagi performed better with 81.53% lesser MDA
content as compared to IR-64. This might be an attribute
of tolerant variety that helps to sustain it under prolonged
environmental stress condition. Less MDA content in
drought tolerance Phaseolus acutifolius as compared to
sensitive ones have also been obtained by El-Tayeb
(2006).
Proline accumulation
In plants with 0 days of stress, bacterial inoculation was
non-significant over the control while in stressed, all the
769
PGPRs treated plants except R62+R81 treated plants of
th
Sahbhagi in 8 days of drought, showed the significant
increase in proline contents in both of the varieties of rice
th
at both the level of stress. In 10 days of stress, a
maximum increase of 1.08 fold in proline content was
observed in R62+R81 treated plants of Sahbhagi while
in IR-64, a maximum increase in 1.09 fold was
observed in 14B treated plants over control (Figure 1c).
High proline contents in plant cells may be due to higher
induction of proline biosynthesis which may help cells to
maintain their water status and protects their vital function
against the consequences of drought stress (Yoshiba et
al., 1997). Higher proline accumulation in inoculated
plants may indicate higher plant tolerance to water stress.
Irrespective of treatments, proline accumulation was
higher (105.43%) in IR-64 as compare to Sahbhagi in
th
early drought stress (in 8 days of drought), while in
severe drought stress both the varieties accumulate
proline in almost similar ways, the attribute might
differentiate the tolerance and sensitive varieties of rice
and suggesting the vital role of proline as an
osmoregulatory solute in plants (Kumar et al., 2011).
Similarly in various studies on abiotic stresses, plants
showed the varietal differences in proline accumulation
(Yadav et al., 2004; Liu et al., 2011).
Superoxide dismutase activity
The SOD activity were continued to increase till the last
th
th
day of drought (10 days of drought). On the 8 day of
drought, P2 showed 1.76 fold increased SOD over
control in Sahbhagi, followed by A3+A5 with 1.36 fold
increase. In IR-64, Arthrobacter A3+A5 increased the
1.78 fold SOD activity over control followed by R62+R81
th
with 1.65 fold. On the 10 days of drought, A3+A5 with
1.93 fold followed by P2 with 1.65 fold maximally
increased the SOD activity over control in Sahbhagi. In
IR-64 all the treated plants showed significantly higher
th
activity of SOD as compared to control plants in 10 days
of drought. Among the treatments, R62+R81 with 1.75
fold followed by Arthrobacter A3+A5 with 1.72 fold
maximally increased the SOD activity over control (Figure
2a). It is suppose that SOD catalyses the dismutation of
superoxide radical into H2O2, which is further obliterate by
CAT and POD activity (Scandalios, 1993). Here the
increased SOD activity in stressed plants may be either
due to increased production of ROS or could be a
protective mechanism adopted by rice plants against
ROS and oxidative damage. The higher level of SOD
activity in inoculated plants could be related with the
enhanced protective mechanism induced by PGPRs in
plants to reduce the level of H2O2. An earlier study
demonstrated that mechanisms that reduce oxidative
stress indirectly play an important role in drought
770
Afr. J. Biotechnol.
Figure 2. (a) SOD, (b) POD, (c) CAT and (d) APX activity of two genotype of rice, inoculated with PGPRs, under 0, 8 and 10 days of drought
stress. Mean followed by same letter are not significantly different (P<0.05) for a particular trait in two cultivars at all the level of stress.
Gusain et al.
771
Ascorbate peroxidase activity
tolerance (Bowler et al., 1992).
th
Peroxidase activity
Sahbhagi strain P2 with 1.39 fold maximally increased
the POD activity followed by 14B with 1.34 fold which
th
increased activity under 8 days of drought. Similarly in
IR-64 with 1.25 fold, Pseudomonas strain P2 maximally
increased the POD activity followed by R62+R81 with 1.2
th
fold. In 10 days of drought Arthrobacter (with 1.81 fold),
14B (with 1.71 fold) and P2 (with 1.26 fold) significantly
increased the POD activity over control in Sahbhagi,
while IR-64 Pseudomonas strain P2 (with 1.27 fold) and
R62+R81(with 1.27 fold) showed significant effect on
POD activity over control (Figure 2b). Irrespective of the
treatments, IR-64 showed 25.72% higher POD activity as
compared to Sahbhagi. Under stress condition, increased
level of peroxidase in plants can be correlated with an
increased level of ROS in plants cells (Radotic et al.,
2000). Similar to the present study, PGPRs mediated
increased POD activity under drought stress has also
been reported in green gram plants by Saravanakumar et
al. (2011).
Catalase activity
th
The catalase activity increased in the 8 day of drought
th
and then decreased under severe drought stress in 10
day. A non significant effect was observed in all the
treatments with control plants under 0 days of stress. In
th
8 days of drought 14B and A3+A5 significantly
increased the CAT activity in Sahbhagi, while IR-64, P2,
14B and A3+A5 significantly increased the catalase
th
activity over control. In the 10 days of drought, 14B with
1.67 fold maximally increased the catalase activity over
control in Sahbhagi. In IR-64, P2 with 1.64 fold
significantly increased the CAT activity as compared to
uninoculated plants (Figure 2c). Irrespective of treatments and stress level 91.25% increased CAT activity
was reported in IR-64 as compared to Sahbhagi. Here
th
the catalase activity increased at the 8 day of drought
th
and decreased under severe stress condition after 10
days of drought which either suggest catalase poor
affinity for H2O2 or it may have undergone subsequent
degradation of H2O2 due to photoinactivation in the
presence of light (Hertwig et al., 1992). Similar decline in
catalase activity in plants has also been observed in
varieties under stressful condition (Hertwig et al., 1992;
Radotic et al., 2000). However, all the inoculated plants
showed higher catalase activity as compared to their
respective control which suggests the PGPR mediated
reduction of oxidative stress in plants (Saravanakumar et
al., 2011).
In the 8 day of drought 14B (with 1.8 fold), A3+A5 (with
1.58 fold) and pseudomonas strain P2 (with1.41 fold)
significantly increased the APX activity over control in
Sahbhagi. In IR-64, Arthrobacter (with 1.79 fold) and
pseudomonas strain P2 (with 1.69 fold) showed
significant effect on APX activity over control. Similarly in
th
the 10 day of drought 14B (with 1.23 fold) Arthrobacter
(with 1.54 fold) and pseudomonas strain P2 (with1.19
fold) significantly increased the APX activity over control
in Sahbhagi. In IR-64 all the treated plants showed
significantly increased level of APX activity over control
(Figure 2d). Overall (irrespective of treatments and stress
level), Sahbhagi showed 12.25% higher APX activity as
compared to IR-64. APX acted on H2O2 and prevents its
accumulation in cells via ascorbate-glutathione pathway
(Foyer and Halliwell, 1976). An increased activity of APX
in PGPRs treated plants as observed here could be
related with the decreased concentration of H2O2 in rice
under drought stress suggesting a key role of APX in
detoxification of H2O2 under drought stress and appear to
constitute a basic antioxidative defense mechanism in
plants (Madhusudhan et al., 2003). However, in the
overall antioxidant study, higher activity of CAT, POD
and APX could interrelate with lower activities of H2O2 in
all the treated plants as compared to their respective
control, as all these antioxidant acted as an scavenger on
H2O2 (Gill and Tuteza, 2010).
Conclusion
It was observed from the present study that PGPRs
inoculation induced plants to produce the higher amount
of antioxidant under drought stress which might be a
basis for the lower accumulation of H2O2 in inoculated
plants as compared to their respective control. Both the
genotype differs in their response to different growth and
biochemical parameters under drought stress condition,
however, lower accumulation of H2O2 in Sahbhagi
indicated that this cultivar might have an efficient ROS
quenching system at cellular level, which might help it to
withstand prolonged drought. Overall, the study shows
the significance of PGPRs as the alleviation of drought
stress in rice and suggest the further utilization of
selected PGPRs as biofertilizer under drought prone
environment.
Conflict of interest
The authors declared they have no conflict of interest.
ACKNOWLEDGEMENTS
The first author is very thankful to the International Rice
772
Afr. J. Biotechnol.
Research Institute (IRRI), Philippine for
financial support through the STRASA project.
providing
REFERENCES
Alami Y, Achouak W, Marol C, Heulin T (2000). Rhizosphere soil
aggregation and plant growth promotion of sunflowers by
exopolysaccharide producing Rhizobium sp. strain isolated from
sunflower roots. Appl. Environ. Microbiol.66:3393-3398.
Alexieva V, Sergiev I, Mapelli S, Karanov E (2001). The effect of
drought and ultraviolet radiation on growth and stress markers in pea
and wheat. Plant Cell Environ. 24:1337-1344.
Arnon DI (1949). Copper enzymes in isolated chloroplast polyphenol
oxidase in Beta vulgaris. Plant physiol. 24:1-15.
Bates LS, Waldren RP, Teare ID (1973). Rapid determination of free
proline for water–stress studies. Plant Soil.39:205-207.
Bernier J, Atlin GN, Serraj R, Kumar A, Spaner D (2008). Breeding
upland rice for drought resistance. J. Sci. Food Agric.88: 927-39.
Bowler C, Vanmontagu M, Inze D (1992). Superoxide-dismutase and
stress tolerance. Annu. Rev. Plant Physiol. Plant Mol. Biol. 43:83116.
Bradford MM (1976). A rapid and sensitive method for the quantification
of microgram quantities of protein utilizing the principle of protein-dye
binding. Anal. Biochem. 72:246–254.
Cha-um S, Yooyongwech S, Supaibulwatana K (2012). Water-deficit
tolerant classification in mutant lines of indica rice. Sci. Agric.
69(2):135-141.
Egamberdiyeva D, Hoflich G (2004). Effect of plant growthpromoting
bacteria on growth and nutrient uptake of cotton and pea in a semiarid region of Uzbekistan. J. Arid. Environ. 56:293-301.
Elstner EF (1991). Mechanism of oxygen activation in different
compartments. in: Pell EJ, Steffen KL (Eds.), Active
Oxygen/Oxidative Stress and Plant Metabolism. American Society of
Plant Physiologists, Roseville. pp. 13-25.
El-Tayeb MA (2006). Differential responses of pigments, lipid
peroxidation, organic solutes, catalase and per-oxidase activity in the
leaves of two Vicia faba L. cultivars to drought. J. Agri. Biol. 8(1):
116-122.
Foyer CH, Halliwell B (1976). The presence of glutathione and
glutathione reductase in chloroplasts: a proposed role in ascorbic
acid metabolism. Planta. 133:21-25.
Gill SS, Tuteja N (2010). Reactive oxygen species and antioxidant
machinery in abiotic stress tolerance in crop plants. Plant Physiol.
Biochem. 48:909-930.
Glick BR (1995). The enhancement of plant growth by free living
bacteria. Can. J. Microbiol. 41:109-114.
Gururani MA, Upadhyaya CP, Venkatesh J, Baskar V, Park SW (2013).
Plant growth promoting rhizobacteria enhance abiotic stress
tolerance in Solanum tuberosum through inducing changes in the
expression of ROS scavenging enzymes and improved
photosynthetic performance. J. Plant Growth Regul. 32(2): 245-258.
Gusain YS, Kamal R, Mehta CM, Singh US, Sharma AK (2015).
Phosphate solubilizing and indole-3-acetic acid producing bacteria
from the soil of Garhwal Himalaya aimed to improve the growth of
rice. J. Environ. Biol. 36:301-307.
Halliwell B, Gutteridge JMC (1989). Free Radicals in Biology and
Medicine (2nd ed) Clarendon Press, Oxford.
Heath RL, Packer L (1968). Photoperoxidation in isolated chloroplasts:
I. Kinetics and stoichiometry of fatty acid peroxidation. Arch.
Biochem. Biophysic. 125(1):189-198.
Hertwig B, Streb P, Feierabend J (1992). Light dependency of catalase
synthesis and degradation in leaves and the influence of interfering
stress conditions. Plant Physiol. 100:1547-1553.
Hoagland DR, Arnon DI (1950). The water-culture method for growing
plants without soil. Calif. Agr .Expt. Sta. Circ. 347:1-32.
Jaw NL, Ching HK (1998). Effect of oxidative stress caused by
Hydrogen peroxide on senescence of rice leaves. Bot. Bull. Acad.
Sin. 39:161-165.
Kamoshita A, Babu RC, Boopathi NM, Fukai S (2008). Phenotypic and
genotypic analysis of drought-resistance traits for development of rice
cultivars adapted to rainfed environments. Field Crops Res. 109:1-23.
Khush G (2003). Productivity improvements in rice. Nutr. Rev. 61:S114S116.
Kohler J, Hernandez JA, Caravaca F, Roldàn A (2008). Plant-growthpromoting rhizobacteria and abuscular mycorrhizal fungi modify
alleviation biochemical mechanisms in water-stressed plants. Funct.
Plant Biol. 35:141-151.
Kumar RR, Karajol K, Naik GR (2011). Effect of polyethylene glycol
induced water stress on physiological and biochemical responses in
pigeonpea (Cajanus cajan L. Millsp.). Recent Res. Sci. Tech. 3:148152.
Liu C, Liu Y, Guo K, Dayong Fan D, Li G, Zheng Y, Yu L, Yang R
(2011). Effect of drought on pigments, osmotic djustment and
antioxidant enzymes in six woody plant species in karst habitats of
south western China. Environ. Exp. Bot. 71:174-183.
Mackill DJ, Ismail AM, Pamplona AM, Sanchez DL, Carandang JJ,
Septiningsih EM (2010). Stress Tolerant Rice Varieties for Adaptation
to a Changing Climate. Crop Environment & Bioinformatics.7:250259.
Mader P, Kaiser F, Adholeya A, Singh R, Uppal HS, Sharma AK,
Srivastava R, Sahai V, Aragno M, Wiemken A, Johri BN, Fried PM
(2011). Inoculation of root microorganisms for sustainable wheat-rice
and wheat black gram rotations in India. Soil Biol. Biochem. 43:609619.
Madhusudhan R, Ishikawa T, Sawa Y, Shiqeoka S, Shibata H (2003).
Characterization of an ascorbate peroxidase in plastids of tobacco
BY-2 cells. Physiol. Plant. 117:550-557.
Mayak S, Tirosh T, Glick BR (2004). Plant growth promoting bacteria
that confer resistance to water stress in tomato and pepper. Plant
Sci. 166:525-530.
Mishra S, Jha AB, Dubey RS (2011). Arsenite treatment induces
oxidative stress, upregulates antioxidant system, and causes
phytochelatin synthesis in rice seedlings. Protoplasma 248(3): 565–
577.
Mongodin EF, Shapir N, Daugherty SC, De Boy RT, Emerson JB,
Shvartzbeyn A, Raduneet D, Vamathevan J, Riggs F, Grinberg V,
Khouri H, Wackett LP, Nelson KE, Sadowsky MJ (2006). Secrets of
soil survival revealed by the genome sequence of Arthrobacter
aurescens TC1. PLoS Genetics 2(12):2094-2106.
Moslemi Z, habibi D, Asgharezadeh A, Ardakani MR, Mohammadi A,
Mohammadi M (2011). Response of phytohormones and biochemical
markers of maize to super absorbent polymer and plant growth
promoting rhizobacteria under drought stress. American Eurasian J.
Agric.& Environ. Sci. 10 (5):787-796.
Noctor G, Foyer CH (1998). Ascorbate and glutathione: keeping active
oxygen under control. Annu. Rev. Plant Physiol. Plant Mol. Biol.
49:249-279.
Prousek J (2007). Fenton chemistry in biology and medicine. Pure Appl.
Chem. 79(12):2325-2338.
Radotic K, Ducic T, Mutavdzic D (2000). Changes in peroxidase activity
and isozymes in spruce needles after exposure to different
concentrations of cadmium. Environ. Exp. Bot. 44:105-113.
Roesti D, Gaur R, Johri BN, Imfeld G, Sharma S, Kawaljeet K, Aragno
M(2006). Plant growth stage, fertiliser management and bioinoculation of arbuscular mycorrhizal fungi and plant growth
promoting rhizobacteria affect the rhizobacterial community structure
in rain-fed wheat fields. . Soil Biol. Biochem. 38:1111-1120.
Sairam RK, Srivastava GS (2001). Water stress tolerance of wheat
(Triticum aestivum L.): Variations in hydrogen peroxide accumulation
and antioxidant activity in tolerant and susceptible genotypes. J.
Agron. Crop Sci. 186:63-70.
Sandhya V, Ali SKZ, Grover M, Reddy G, Venkateswarlu B (2010).
Effect of plant growth promoting Pseudomonas spp. on compatible
solutes, antioxidant status and plant growth of maize under drought
stress. Plant Growth. Regul. 62:21-30.
Saravanakumar D, Kavino M, Raguchander T, Subbian P, Samiyappan
Gusain et al.
R (2011). Plant growth promoting bacteria enhance water stress
resistance in green gram plants. Acta Physiol. Plant. 33:203-209.
Saravanakumar D, Samiyappan R (2007). ACC deaminase from
Pseudomonas fluorescens mediated saline resistance in groundnut
(Arachis hypogea) plants. J. Appl. Microbiol. 102:1283-1292.
Scandalios JG (1993). Oxygen stress and superoxide dismutases. Plant
Physiol. 101:7-12.
Sgherri CLM, Pinzino C, Navari-Izzo F (1996). Sunflowers seedlings
subjected to stress by water deficit: changes in O2 production related
to the composition of thylakoid membranes. Physiol. Plant. 96:446452.
Singh KK, Ghosh S (2013). Regulation of glutamine synthetase
isoforms in two differentially drought-tolerant rice (Oryza sativa L.)
cultivars under water deficit conditions. Plant Cell Reports 32(2):183193.
Smirnoff N (1993). The role of active oxygen in the response of plants to
water deficit and desiccation. New Phytol. 125:27-58.
773
Yadav RS, Sharma RK, Yadav RM (2004). Effect of simulated drought
on free proline accumulation in some wheat (Triticum aestivum L.)
genotypes. Indian J. Agric. Biochem. 17:43-44.
Yoshiba Y, Kiyosue T, Nakashima K, Yamaguchi-Shinozaki K,
Shinozaki K(1997). Regulation of levels of proline as an osmolyte in
plants under water stress. Plant Cell Physiol. 38:1095-1102.
Zhang J, Kirkham MB (1996). Antioxidant responses to drought in
sunflower and sorghum seedlings. New Phytologist 132:361-373.
Vol. 14(9), pp. 774-780, 4 March, 2015
DOI: 10.5897/AJB2014.14376
Article Number: DDC6D4B50958
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
The efficacy of four gametocides for induction of pollen
sterility in Eragrostis tef (Zucc.) Trotter
Habteab Ghebrehiwot1*, Richard Burgdorf2, Shimelis Hussein1 and Mark Laing1,2
1
African Centre for Crop Improvement, University of KwaZulu-Natal, Private Bag X01, Scottsville 3209, Pietermaritzburg,
South Africa.
2
Department of Plant Pathology University of KwaZulu-Natal, Private Bag X01, Scottsville 3209, Pietermaritzburg,
South Africa.
Received 17 December, 2014; Accepted 19 February, 2015
Effective chemical hybridizing agents (CHAs) or male gametocides enhance cross pollination in plant
breeding and genetic analysis of traits. The present study examined the efficacy and optimum
concentration of four CHAs, namely: 2-chloroethyl phosphonic acid (Ethrel), ethyl 4'-fluorooxanilate
®
(E4FO), 2, 4-dichlorphenoxy acetic acid (2, 4-D) and Promalin (1.8% GA47 – gibberellins A4+A7 and 1.8%
6-BA–benzyladenine) on pollen sterility and seeding of a tef line (DZ-01-3186). Seed-derived and
individually grown tef plants were treated with foliar applications of the four CHAs (at four levels each)
sprayed once at the early booting stage, and bagged to control cross pollination. Female fertility was
assessed by recording seed set following controlled pollinations. Although all the CHAs caused some
pollen sterility, their efficacy levels varied from 9.77 to 99.50% in treated plants compared to the control
(6.68 +/- 1.04%). Pollen sterility increased with increasing CHA concentration. Near-complete pollen
sterility (99.50 ± 0.50%) was achieved by the application of E4FO at rates of 1500 to 3000 ppm, and Ethrel
®
at 5000 ppm. All the CHAs significantly reduced seed yield, with E4FO, Ethrel and Promalin at 5000
ppm causing the highest reduction, essentially yielding no seed. In the period following the application
of the CHAs, plants treated with E4FO (1000 – 1500 ppm) exhibited stigmas that remained fertile. Hence,
it is recommended that E4FO (at 1000 – 1500 ppm) can be used as a chemical emasculation agent for tef,
with the least phytotoxicity and the highest female fertility.
Key words: Eragrostis tef, Ethrel, ethyl4-florooxanilate, female fertility, gametocides, pollen sterility.
INTRODUCTION
Tef [Eragrostis tef (Zucc.) Trotter] is an autogamous
cereal food crop that has been cultivated in the Horn of
Africa (Eritrea and Ethiopia) for over 2000 years (Ingram
and Doyle, 2003). The grain is used to make a variety of
food products, including a spongy fermented pancake
called “Enjera” that regionally serves as a staple food. In
Ethiopia, tef is considered the most important crop
covering the greatest land area under cereal cultivation
(Ketema, 1997). Despite a long history of cultivation,
grain production is hampered by the low yield levels of
*Corresponding author. E-mail: [email protected].
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Ghebrehiwot et al.
the available cultivars, and vulnerability of the crop to
lodging, which routinely causes yield reductions of 17 to
25% (Ketema, 1983). At the moment, the mean national
-1
-1
grain yield of tef stands at 1.46 t ha or 1465 kg.ha
(Central Statistics Authority, 2014). Improved varieties of
-1
tef provide grain yields of 1700-2200 kg.ha on farmers’
-1
fields and 2200-2800 kg.ha under research-managed
situations. Estimates are that the crop could yield as
-1
much as 6000 kg.ha , had it received adequate research
attention (Ketema, 1997; Teklu and Tefera, 2005).
Research on tef improvement began in the late 1950s
in Ethiopia. This genetic improvement programme utilized
mass and/or pure-line selection directly from the existing
germplasm, hybridization, as well as the initiation of
induced mutations (Belay et al., 2006). The major
breeding objectives were to improve grain yield and to
develop drought and lodging-resistant varieties of tef.
Attempts to improve grain yield have resulted in a
number of improved varieties. However, breeding efforts
to develop lodging-resistant tef varieties have not yet
succeeded due to the tedious and meticulous crossing
technique of tef, attributed to its pollination process
(Gugsa and Loerz, 2013). In tef, pollination occurs only
during the early hours of the morning and requires the
employment of an appropriate artificial hybridization
technique. Under Ethiopian climatic conditions, tef
flowers open and are fertilised only between 6:45 and
7:45 a.m. (Berhe, 1976; Ketema, 1997). In addition to this,
the small size of its reproductive structures and its
autogamous nature has made microscopic emasculation
and cross pollination obligatory, which requires appropriate equipment and skilled personnel (Berhe and Miller,
1976; Ketema, 1997; Gugsa and Loerz, 2013). In a selfpollinated crop such as tef, with the male and female
organs in the same flower (monoecious), the application
of chemical hybridizing agents (CHAs) that selectively
impair the male gamete would be of a great value in plant
breeding or genetic analysis of traits, reducing the time
invested in the laborious procedure of hand emasculation.
Male sterility is defined as the failure of a plant to
produce functional anthers, pollen and/or male gametes
during its reproductive stage. It can be triggered by
multiple factors including adverse growth conditions such
as temperature (Endo et al., 2009), diseases, inheritance,
mutations or chemical agents (McRae, 1985; Budar and
Pelletier, 2001). The deliberate elimination of the male
gamete using CHAs has been established as a
potentially viable approach in commercial hybrid seed
production (Van Der Kley, 1954; Tu and Banga, 1998). It
would solve many problems, such as the elimination of
tedious hand emasculation, allowing for combinations of
suitable parents, eliminating the need for expensive,
complex and limiting cytoplasmic male sterility systems,
increasing crossing choices in plant breeding and
simplifying genetic analysis of self-pollinating crops. An
effective CHA should induce an acceptable level of male
sterility while retaining a high degree of female fertility
775
(Cross and Ladyman, 1991). The major groups of
chemicals screened so far for their possible CHA
potential include auxins, antiauxins, growth regulators,
arsenicals, ethylene-releasing compounds, halogenated
aliphatic acids and several other patented chemicals
(Batch et al., 1980). Several derivatives of oxalinates (Ali
et al., 1999; Chakraborty and Devakumar, 2006a) and
growth regulators (Badino, 1981; Praba and Thangaraj,
2005) were effective in inducing pollen sterility in various
crops without negative effects on female fertility. The
effectiveness of some CHAs (e.g. Ethrel) is genotype,
dose and stage specific which limits their value (Bennet
and Hughes, 1972).
Ali et al. (1999) examined the relative efficacy of three
CHAs, including E4FO, on male sterility of rice (Oryza
sativa). They reported that E4FO applied @1500 ppm at
meiosis was the most effective CHA, causing the most
pollen and spikelet sterility, the widest spectrum of action
on multiple varieties and the least phytotoxicity. Foliar
applications of Ethrel at rates ranging between 1000 and
4000 ppm also induced useful levels of male sterility in
barley (Hordeum vulgare) (Kumar et al., 1976; Verma
and Kuman, 1978), spring wheat (Triticum aestivu)
(Rowell and Miller, 1971; Dotlacil and Apltauerova, 1978;
Jan and Rowell, 1981), rice (Oryza sativa) (Parmar et al.,
1979) and tef (Berhe and Miller, 1978). However, studies
have also demonstrated that Ethrel induces significant
levels of female sterility at the rates of application
required for male sterility (Hughes et al., 1974; Berhe and
Miller, 1978; Dotlacil and Apltauerova, 1978). There are
also reports that Ethrel may cause defoliation in certain
species (Morgan, 1969; Pedersen et al., 2006). As a
selective CHA, 2, 4-dichlorphenoxy acetic acid (2, 4-D) is
also one of the most widely studied CHAs (Helal and
Zaiki, 1981). Foliar applications of 2, 4-D on tomato
(Rehm, 1952), rice (Helal and Zaiki, 1981) and sesame
(Prakash et al., 2001) induced high levels of male sterility.
By contrast, the application of 0.4% 2, 4-D did not induce
acceptable levels of pollen sterility in rice (Praba and
Thangaraj, 2005).
The gametocidal property of gibberellic acid in inducing
male sterility is also well studied in many corps including
maize (Nelson and Rossman, 1958), common Onion
(Van Der Meer and Van Bennekom, 1976; Badino, 1981),
coriander (Kalidasu et al., 2009) and many other
flowering plants (Sawhney and Shukula, 1994). Despite
the volume of research on CHAs, there are no reports of
male sterilizing CHAs being used for tef breeding (Berhe
and Miller, 1976, 1978). In pursuit of a potential
alternative for hand emasculation, the present study
examined the efficacy and determined the optimum
concentration of four CHAs on male sterility and
subsequent seed set in tef. The chief objectives were 1)
to identify an effective and suitable CHA for use in tef
without adverse effects; 2) to standardize the concentration of the CHA for inducing an acceptable level of male
sterility; 3) to investigate the morphological and physiological
776
Afr. J. Biotechnol.
changes induced by the CHA and; 4) to investigate posttreatment female fertility/sterility through the assessments
of seed set after controlled pollination.
MATERIALS AND METHODS
The CHAs and plant material
The tef variety - DZ-01-3186 was used for this particular study. Four
CHAs were used in the study, Ethrel, ethyl 4'-fluorooxanilate
(E4FO), Promalin® and 2, 4-D. The concentration levels tested
were: Ethrel at 1000, 2000, 3000 and 5000 ppm; E4FO at 1000,
1500, 2000, 3000 ppm, Promalin® at 50, 100, 150 and 300 ppm; 2,
4-D at 10, 50, 100 and 500 ppm. At all concentration levels, 5% of
Tween 80® (0.2%) was added as a wetting agent.
Growing conditions, treatments and experimental design
Experiments were conducted in an environmentally controlled
glasshouse maintained at an air temperature of 28 ± 2.5°C. The tef
plants were grown from seeds sown directly into plastic pots (250
mm in diameter and 210 mm in height) filled with 75% composted
pine bark and 25% river sand. Ten seeds per pot were sown,
thinned-out to one plant per pot at the trifoliate stage. All lateral
tillers were constantly clipped off, allowing only one dominant tiller
to grow to flowering. The tef plants received an optimal fertigation,
scheduled twice a day and weeds were hand controlled. The CHA
solutions were applied on once at the panicle initiation stage when
the flower head (panicle) was 10-12 mm long and panicles were
then bagged to avoid cross pollination. The sprays were applied
with a small power sprayer and hand gun to thoroughly wet the
inflorescence, leaf and stem surfaces. The quantity of liquid
sprayed per plant was approximately 4 to 5 ml. The control plants
were sprayed with same amount of tap-water. To test the effect of
the wetter, a blank solution of Tween-80® (0.2% v/v) without CHA,
was also applied. The four CHAs, with four concentration levels
each, the water control (n=4) and the Tween 80® control (n= 4),
were arranged in a completely randomized design with 18
treatments in four replications. Within the glasshouse, the pots were
randomly rotated on a weekly basis to minimize positional effects.
One week after the application of CHAs, pollen grains were
sampled from each plant and analysed for viability/sterility. After
screening the potency of the CHAs, to study the effect of the CHAs
(that is, E4FO and Ethrel) on female fertility, four additional potted
tef plants were sprayed with E4FO and Ethrel at 4 concentration
levels each and the plants were subsequently hand cross pollinated,
and left unbagged. At the end of the trial season, seeds produced
from the mother plants were manually collected, counted and
recorded. Difference in seed yield from panicles treated with CHAs
followed by bagging to avoid cross pollination (SYPP) and seed set
from panicles treated CHAs followed by artificial pollination (SSPP)
would indicate the number of viable female organs (stigmas)
remaining in the period following the CHAs treatment.
Pollen sterility test
A range of techniques were tested to visualise pollen grains (data
not presented). The best technique for differentiating between
viable and non-viable pollen grains of tef was achieved using an
aniline blue lactophenol staining technique. The aniline blue
lactophenol solution was prepared by mixing 5 ml of 1% aqueous
aniline blue, 20 g phenol crystals (C6H5O4), 40 ml glycerol, 20 ml
lactic acid and 20 ml of distilled water (Kearms and Inouye, 1993).
A week after the application of the CHAs, plant inflorescences
(spikes) were collected and stored in 70% ethanol until slide prepara-
ration. Pollen grains from newly dehisced florets were released onto
a droplet of aniline blue lactophenol solution on a glass microscope
slide. The droplet was covered with a cover slip and the pollen
grains were allowed to stain for 3 h at 21°C before scoring. The
preparation was then examined under a Zeiss Axio Scope A1
brightfield light microscope (Carl Zeiss, Ltd., Canada) equipped with
an AxioCam camera and image captured using Axio Vision 2.05
software (Carl Zeiss Ltd., Canada). It was possible to vividly
visualise the pollen grains at 40X magnification, with viable pollen
grains appearing solid-blue and non-viable pollen grains appearing
turquoise in colour (Figure 1a). A minimum of 300 pollen grains
were counted from each sample by selecting random fields of view.
Pollen grains from the control plants were also investigated to
detect differences in pollen sterility/viability.
Statistical analysis
Levels of pollen sterility were computed by dividing the number of
unstained (sterile pollen grains) by the total number of pollen grains
(stained plus unstained) per field of view, expressed as a
percentage. Data was normalised by square root transformation.
The seed yield per panicle (SYPP) was estimated through
approximation of the 1000-seed weight following the procedures
described by Wiliam (1985). In variety DZ-01-3186, the 1000-seeds
weight was found to be 294 mg. To obtain an estimate of SYPP,
total harvested seed yield per panicle (weight) was divided by 294
and then multiplied by 1000. Data was subjected to one-way
analysis of variance (ANOVA) using GenStat 14th edition Inc.
(GenStat, 2011). Duncan’s multiple range test procedure was used
at P < 0.05 to compare the significance of differences among
treatment means.
RESULTS
The effects of the four CHAs on levels of pollen sterility
and subsequent SYPP are presented in Tables 1 and 2.
A low level of pollen sterility (6.68 ± 1.04%) was observed
®
in the untreated control plants. The wetter, Tween 80
had no significant effect on pollen sterility (5.05%). The
treatments had a highly significant (P< 0.001) effect on
pollen sterility (Table 1). Levels of pollen sterility
increased with increases in CHA concentration (Table 3).
Compared to the control, all the CHAs and at all
concentration levels except 2, 4-D at 10 ppm to 50 ppm
induced significant increases in pollen sterility, which
ranged between 19.03 ± 1.00% to 99.50 ± 0.50%. Near
complete male sterility percentage was achieved by the
application of E4FO at rates ranging between 1500 to
3000 ppm and Ethrel at 5000 ppm. The CHAs also had a
highly significant effect on SYPP (Table 2). Compared to
the control (5564.28 ± 181.88), plants treated with the
®
wetter, Tween 80 , did not exhibit any significant
reduction in SYPP. In contrast, plants treated with all
®
levels of E4FO, all levels of Ethrel, and Promalin at 300
ppm, exhibited the greatest reduction in SYPP,
essentially yielding no seed (Table 3). In CHA treated
plants, relatively more SYPP was obtained from plants
®
treated with 2, 4-D. Promalin at rates ranging between
50 to 150 ppm showed a greater reduction in SYPP than
®
those treated with 2, 4-D. Promalin treated plants
showed some phytotoxicity symptoms such as growth
Ghebrehiwot et al.
777
Figure 1. A) Pollen grains of Eragrostis tef visualised under light microscope 40X magnification. Non-viable pollen grains (black
arrow) and viable pollens (yellow arrows). B) Anther of Eragrostis tef filled with non-viable pollen grains. C) Growth deformity (coiling)
caused by Promalin® treatment of tef. D) Premature senescence and floret collapse caused by Ethrel and Promalin ® treatment.
Table 1. One-way analysis of variance (ANOVA) of the effect of the CHAs on percentage
of pollen sterility in Eragrostis tef.
Source of variation
Treatments
Residual
Total
d.f.
17
54
71
s.s.
83002.24
1167.97
84170.21
m.s.
4882.48
21.63
v.r.
225.74
F pr.
<0.001
Table 2. One-way analysis of variance (ANOVA) of the effect of the CHAs on seed yield per
panicle (SYPP) of non-pollinated Eragrostis tef plants.
Source of variation
Treatments
Residual
Total
d.f.
17
54
71
s.s.
345579304
29603056
375182360
deformity (coiling) and frequent dryness of inflorescences
®
(Table 3 and Figure 1b). Promalin at a rate of 5000 ppm
caused an extreme reduction in seed set, due to floret
collapse (Table 3 and Figure 1). At higher doses of 100
and 500 ppm, 2, 4-D treated plants exhibited excessive
elongation of the inflorescence and drooping (Table 3).
By contrast, treating the tef plants with all rates of Ethrel,
and E4FO at a rate of 3000 ppm, led to early premature
desiccation and ultimately to floret collapse. t-test
m.s.
20328194
548205
v.r.
37.08
F pr.
<.001
comparison between the CHAs-treated-pollinated vs
CHAs-treated-non-pollinated tef plants showed a highly
significant (t = 5.496; P < 0.00) difference in seed set per
panicle (SSPP). Artificial pollination of the plants
previously treated with E4FO at rates of 1000 to 1500
ppm, showed a significant improvement in SSPP. By
contrast, artificial pollination of the plants previously
treated with all rates of Ethrel did not show any significant
improvement in SSPP (Table 3).
778
Afr. J. Biotechnol.
Table 3. The effect of four different chemical hybridizing agents (CHAs) applied at four different concentration levels on pollen sterility, seed yield per panicle (SYPP) and seed set per
panicle (SSPP) of Eragrostis tef (Zucc.) Trotter, cultivar Etsub (Var: DZ-01-3186). Phytotoxicity symptoms observed on CHA treated plants compared to untreated controls.
CHAs concentration
(ppm)
1000
1500
2000
3000
Pollen sterility
(%)
Ethrel
1000
2000
3000
5000
79.00 ± 2.68
bc
82.00 ± 6.38
bc
83.00 ± 1.47
a
94.12 ± 0.58
2, 4-D
10
50
100
500
9.77 ± 0.47
hi
13.53 ± 1.31
h
19.03 ± 1.00
g
29.94 ± 1.76
50
54.83 ± 0.73
f
218.40 ± 23.78
100
57.19 ± 0.94
f
197.95 ± 26.99
150
64.58 ± 1.20
e
1390.00 ± 348.24
300
74.40 ± 2.98
d
0.00 ± 0.00
0
6.86 ± 1.04
i
5572.64 ± 170.34
a
5572.64 ± 170.34
a
No phytotoxicity symptoms observed
(0.02% v/v)
6.05 ± 1.64
i
5564.28 ± 181.88
a
5664.28 ± 181.88
a
No phytotoxicity symptoms observed
CHAs
E4FO
Promalin
SYPP+SE of selfpollinated plants
86.41 ± 2.86
a
95.83 ± 4.17
a
98.61 ± 1.39
a
99.50 ± 0.50
b
0.00 ± 0.00
f
0.00 ± 0.00
f
0.00 ± 0.00
f
0.00 ± 0.00
cd
0.00 ± 0.00
f
0.00 ± 0.00
f
0.00 ± 0.00
f
0.00 ± 0.00
i
SSPP+SE of artificially
pollinated plants
f
569.7 ± 39.97
c
281.00 ± 27.41
cd
241.20 ± 17.17
d
34.20 ± 5.49
b
f
9.50 ± 3.88
d
3.00 ± 1.91
d
00.00 ± 0.00
d
00.00 ± 0.00
No phytotoxicity symptoms observed
No phytotoxicity symptoms observed
No phytotoxicity symptoms observed
Floret dryness and early premature senescence
d
a
5592.17 ± 749.69
b
4377.45 ± 976.26
b
4031.60 ± 308.38
c
2933.87 ± 673.58
Observations
Floret dryness and early premature senescence
Floret dryness and early premature senescence
Floret dryness and early premature senescence
Floret dryness and early premature senescence
*
*
*
*
Panicle elongation and drooping
Panicle elongation and drooping
Panicle elongation and lightly seeded panicle
Panicle elongation and lightly seeded panicle
e
*
Twisting inflorescence and leaves, week and
premature senescence
e
*
Twisting inflorescence and leaves week and
premature senescence
*
Twisting inflorescence and leaves week and
premature senescence
*
Twisting inflorescence and leaves week and
premature senescence
®
Control I (Tap water
spray)
®
Control II (Tween 80 )
d
f
Values in the same column with shared letter(s) are not statistically different according to Duncan’s multiple range test at the 5% level of significance.
Ghebrehiwot et al.
DISCUSSION
Hybridization in tef is a tedious and difficult undertaking
that relies on hand emasculation. Hand emasculated tef
often fail to yield any seed (Berhe and Miller, 1978).
Currently, a large number of CHAs are being developed
to induce mass emasculation in a number of crops for the
purpose of hybrid seed production, or as a substitute for
hand emasculation (Tu and Banga, 1998; Praba and
Thangaraj, 2005; Chakraborty and Devakumar, 2006b).
Results of the present study cast some light on the
possibility of using CHAs for tef breeding.
It is interesting that E4FO and Ethrel induced the
highest levels of male (pollen) sterility in tef. These two
CHAs also induced the greatest reduction in the SYPP of
the non-pollinated (bagged) plants. The lack of seed
production, together with the high levels of pollen sterility
found in plants treated with E4FO and Ethrel indicates
the effectiveness of these CHAs in mass emasculation of
the male gametes in tef. However, it is not sufficient that
a CHA should cause a high level of male sterility, but it
should not cause any adverse side effects to the rest of
the plant (Chakraborty and Devakumar, 2006a).
Therefore, determining the effects of the CHAs on
phytotoxicity and female fertility were equally important.
Artificial pollination of the plants previously treated with
E4FO (at a rate of 1000 – 1500 ppm) resulted in
significant increases in seed set per panicle (SSPP). By
contrast, Ethrel sprayed plants did not show significant
increases in SSPP after artificial pollination. Tef is a
predominantly self-pollinating, monogamous plant and
the degree of natural outcrossing is less than 1%
(Ketema, 1997). These results indicated that the plants
sprayed with E4FO at 1000 to 1500 ppm had female
organs (stigmas) that remained fertile to alien pollination,
but all rates of Ethrel diminished the female fertility in the
period following the application of the CHAs.
In the phytotoxicity study the tef plants treated with
E4FO at 1000 to 2000 ppm had no detectable adverse
effects on growth of tef. By contrast, all levels of Ethrel
and E4FO at the highest level of 3000 ppm led to early
premature desiccation and ultimately floret collapse.
Similar deleterious effects of Ethrel on tef were reported
by Berhe and Miller (1978). These authors examined the
gametocidal effect of Ethrel on two varieties of tef. In this
study, foliar applications of 600, 900, and 1,200 ppm
were applied three times during heading and all the
treatments were effective in reducing seed set with no
signs of phytotoxicity. However, ovary and ovular tissue
in sterilized florets underwent premature desiccation and
ultimately lead to female sterility. Due to its deleterious
effects on female fertility, Ethrel was not recommended
as a useful CHA for tef (Berhe and Miller, 1978). The tef
plants treated with all levels of 2, 4-D exhibited low levels
of male sterility and only a slight reduction in SYPP. This
treatment also caused certain undesirable phytotoxic
symptoms including panicle elongation and drooping. The
®
tef plants sprayed with all levels of Promalin showed
779
more pollen sterility and reduction in seed yield, but there
were also detectable growth deformities such as stem
weakness, coiling and low plant vigour. Therefore, these
two CHAs cannot be recommended as viable CHAs for
tef breeding.
The lactophenol cotton blue staining technique
provided an excellent technique for the visualisation of
pollen sterility/viability in tef. E4FO was the most effective
CHA, inducing the highest levels of pollen sterility, with
the least phytotoxicity. The good seed set in artificially
pollinated plants previously treated with E4FO (at 1000 –
2000 ppm) indicates that the plants had viable female
reproductive structures that remained receptive to pollen
in the period following the application of the CHAs. Hence,
it can be recommended that E4FO applied once at a
booting stage, and at rates of 1000 to 1500 ppm (a
relatively wide application window), can be used as an
efficient CHA for inducing high levels of male sterility
without adverse effects on female fertility in tef. Further
studies are needed to determine the potential application
of E4FO in commercial hybrid seed production of tef and
for its use in breeding programmes and fine-tune
concentrations of E4FO. Given that the effect of CHAs on
plant development, growth, morphology and female
fertility often shows a characteristic of genotype specificity (Kaul, 1988), further studies are required to screen
responses of multiple tef varieties and gametocides at a
gradient of concentration levels.
Conclusion
Amongst all the Chemical Hybridizing Agents tested, a
single spray of E4FO (1000 - 1500 ppm) induced the
highest level of pollen sterility in tef without significant
damage on female fertility and least phytotoxicity. Hence,
it is recommended that E4FO (at 1000 - 2000 ppm) can
be used as a potent chemical emasculation agent for tef.
Given that CHAs are genotype specific; the results are
applicable for this particular tef variety only.
Conflict of interest
The authors have not declared any conflict of interest.
REFERENCES
Ali AJ, Devakumar C, Zaman FU, Siddiq EA (1999). Identification of
potent gametocides for selective induction of male sterility in
rice. Indian J. Genet. Plant. Breed. 59:429-436.
Badino M (1981). Gametocidal effects of gibberellic acid (GA3, GA4+ 7)
on common onion (Allium cepa L.).[Conference paper]. Acta Hort
(Netherlands) 111:79-88.
Batch JJ, Parry KP, Rowe CF, Lawerence DK, Brown MJ (1980).
Method of controlling pollen formation in monoecious and
hermaphrodite plants using oxanilates and their derivatives. In:
Johnson JC (Ed) Plant Growth Regulators and Herbicides,
Antagonists-Recent Advances. Noyes Data Corporation, New Jersey,
82-89.
Belay G, Tefera H, Tadesse B, Metaferia G, Jarra D, Tadesse T (2006).
Participatory variety selection in the Ethiopian cereal tef (Eragrostis
tef). Exp. Agri. 42:91-101.
780
Afr. J. Biotechnol.
Bennet MD, Hughes WG (1972). Additional mitosis in wheat pollen
induced by Ethrel. Nature 240:260-268.
Berhe T (1976). A breakthrough in tef breeding technique. FAO Inf. Bull.
Cereal Imp. and Prod. Near East Project 12:11-13.
Berhe T, Miller DG (1976). Sensitivity of tef [Eragrostis tef (Zucc.)
Trotter] to removal of floral parts. Crop Sci. 16:307-308.
Berhe T, Miller DG (1978). Studies of ethephon as a possible selective
male gametocide on tef. Crop Sci. 18:35-38.
Budar F, Pelletier G (2001). Male sterility in plants: occurrence,
determinism, significance and use. Comptes Rendus de l'Académie
des Sciences-Series III-Sciences de la Vie 324:543-550.
Central Statistics Authority (2014). Agricultural sample survey,
2013/2014, Volume 1. Report on area and production of major crops
(private peasant holdings, meher season). Statistical Bulletin. 532,
Addis Ababa, Ethiopia.
Chakraborty K, Devakumar C (2006a). Ethyloxanilates as specific male
gametocides for wheat (Triticum aestivum L.). Plant Breed. 125:441447.
Chakraborty K, Devakumar C (2006b). Evaluation of chemical
compounds for induction of male sterility in wheat (Triticum aestivum
L.). Euphytica 147:329-335.
Cross JW, Ladyman JAR (1991). Chemical agents that inhibit pollen
development: tools for research. Sex Plant Reprod. 4:235-243.
Dotlacil L, Apltauerová M (1978). Pollen sterility induced by Ethrel and
its utilization in hybridization of wheat. Euphytica 27:353-360.
Endo M, Tsuchiya T, Hamada K, Kawamura S, Yano K, Ohshima M,
Kawagishi-Kobayashi M (2009). High temperatures cause male
sterility in rice plants with transcriptional alterations during pollen
development. Plant Cell Physiol. 50:1911-1922.
GenStat (2011). GENSTAT® 14th edition for windows. ©VSN
International Ltd., Hemel Hempstead, UK.
Gugsa L, Loerz H (2013). Male sterility and gametoclonal variations
from gynogenically derived polyploids of tef (Eragrostis tef), Zucc.
Trotter. Afr. J. Plant Sci. 7:53-60.
Helal RM, Zaiki ME (1981). Effect of 2, 4-D and ethephon foliar sprays
on induction of male sterility in egg plant. Egypt J. Hortic. 8:101-108.
Hughes WG, Bennett MD, Bodden JJ, Galanopoulou S (1974). Effects
of time of application of ethrel on male sterility and ear emergence in
wheat Triticum aestivum. Annals Appl. Biol. 76:243-252.
Ingram AL, Doyle JJ (2003). The origin and evolution of Eragrostis tef
(Poaceae) and related polyploids: evidence from nuclear waxy and
plastid rps16. Am. J. Bot. 90:116-122.
Jan CC, Rowell PL (1981). Response of wheat tillers at different
growing stages to gametocide treatment. Euphytica 30:501-504.
Kalidasu G, Sarada C, Reddy PV, Yellam T (2009). Use of male
gametocide: An alternative to cumbersome emasculation in coriander
(Coriandrum sativum L.). J. Hortic. For. 1:126-132.
Kaul MLH (1988). Male sterility in higher plants. Monogr. Theor. Appl.
Genet. 10:193-220.
Kearns CA, Inouye DW (1993). Techniques for Pollination Biologists.
University Press of Colorado, Niwot, CO. pp. 77-151.
Ketema S (1983). Studies of Lodging. Floral Biology and Breeding
Techniques in Tef (Eragrostis tef (Zucc.) Trotter). PhD Thesis,
University of London, London, UK.
Ketema S (1997). Tef [Eragrostis tef (Zucc.) Trotter.]. Promoting the
Conservation and Use of Underutilized and Neglected Crops, Vol. 12.
Institute of Plant Genetics and Crop Plant Research,
Gatersleben/International Plant Genetic Resources Institute, Rome,
Italy.
Kumar J, Verma MM, Singh K, Gagneja MR (1976). Effectiveness of
Ethrel as an androcide in barley. Crop Improv. 3:39-42.
McRae DH (1985). Advances in chemical hybridization. Plant Breeding
Rev. 3:169-191
Morgan PW (1969). Stimulation of ethylene evolution and abscission in
cotton by 2 chloroethanephosphonic acid. Plant Physiol. 44: 337-341.
Nelson PM, Rossman EC (1958). Chemical induction of male sterility in
inbred maize by use of gibberellins. Science 27:1500-1501.
Parmar KS, Siddiq EA, Swaminathan MS (1979). Chemical induction of
male sterility in rice. Indian J. Genet. Pl. Br. 39:529-541.
Pedersen MK, Burton JD, Coble HD (2006). Effect of cyclanilide,
ethephon, auxin transport inhibitors, and temperature on whole plant
defoliation. Crop Sci. 46:1666-1672.
Praba ML, Thangaraj M (2005). Effect of growth regulators and
chemicals on pollen sterility in TGMS lines of rice. Plant Growth
Regul. 46:117-124
Prakash M, Veeramani BB, Kannan K, Vasline YA, Ganesan J (2001).
Effect of 2, 4-D and Ethrel on induction of pollen sterility in sesame.
Sesame and Safflower Newsletter 16:39-41.
Rehm S (1952). Male sterile plants by chemical treatment. Nature
170:38-39.
Rowell PL, Miller DG (1971). Induction of male sterility in wheat with 2chloroethylphosphonic acid (Ethrel). Crop Sci. 11:629-631.
Sawhney VK, Shukla A (1994). Male sterility in flowering plants: are
plant growth substances involved? Am. J. Bot. 81:1640-1647.
Teklu Y, Tefera H (2005). Genetic improvement in grain yield potential
and associated agronomic traits of tef (Eragrostis tef). Euphytica
141:247-254.
Tu ZP, Banga SK (1998). Chemical hybridizing agents. Hybrid Cultivar
Development. Narosa Publishing House, New Dehli, India. pp. 160180.
Van der Kley FK (1954). Male sterility and its importance in breeding
heterosis varieties. Euphytica 3:117-124.
Van der Meer QP, Van Bennekom JL (1976). Gibberellic acid as a
gametocide for the common onion (Allium cepa L.). II. The effect of
GA 4/7. Euphytica 25:293-296
Verma MM, Kumar J (1978). Ethrel-a male gametocide that can replace
the male sterility genes in barley. Euphytica 27:865-868.
Willan RL (1985). A guide to forest seed handling with special reference
to the tropics (No. 20/2).
Vol. 14(9), pp. 781-793, 4 March, 2015
DOI: 10.5897/AJB2014.14067
Article Number: 8A6D1B550960
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Genetic diversity of sweet yam “Dioscorea dumetorum
“(Kunth) Pax revealed by morphological traits in two
agro-ecological zones of Cameroon
Christian Siadjeu1, Gabriel MahbouSomoToukam1,2*, Joseph Martin Bell1 and S. Nkwate3
1
Department of Plant Biology, Faculty of Science, University of Yaounde 1, PO Box 812, Yaounde, Cameroon.
2
Institute of Agricultural Research for Development (IRAD), PO Box 2067, Yaounde, Cameroon.
3
Appropriate Development for Africa Foundation (ADAF), “FermeEcole de Baham” (FEBO). PO Box 11646, Yaounde,
Cameroon
Received 23 July, 2014; Accepted 22 January, 2015
Genetic diversity of 43 Dioscorea dumetorum accessions and two of Dioscorea cayenensis Lam as outgroup species was evaluated for qualitative and quantitative traits in two different agro-climatic zones
Baham (05°20.040' N/010°22.572’ E and 1634±3 masl, agro-ecological zone III with rainfall of 1500 to 2000
mm, and mean annual temperature of 19°C) and Ekona (04°12.773'N/009°19.425'E and 445±3 masl, agroecological zone IV with rainfall of 2500 to 4000 mm and mean annual temperature of 26°C). Forty one
(41) morphological characters according to International Plant Genetic Resources Institute (IPGRI)
descriptor, including nine quantitative and 32 qualitative characters were analyzed for multivariate
analysis using cluster analysis, principal component analysis (PCA), and analysis of variance. For
quantitative characters, cluster analysis revealed three major clusters. The first three components with
eigen values > 1 contributed 83% of the variability. The PCA results indicate that traits which largely
contributed to the variability within and between the accessions were stem length, leaf length, internode
number, leaf width, harvest index, leaf number and internode length. Traits such as harvest index,
internode number and stem length showed high heritability and high genetic advance. For qualitative
traits, cluster and principal component analysis revealed two major clusters in Baham as well as in
Ekona. The traits such as spines on stem base, spines on stem above base, spines length contributed
to the variability within and between the accessions. However, the limits of morphological characters in
the study of diversity have been detected.
Key words: Dioscorea dumetorum, morphological traits, characterization, agro-climatic zone, Cameroon.
INTRODUCTION
Yams constitute a staple food crop for over 100 million
people in the humid and sub humid tropics (Mignouna et
al., 2003). Yams (Dioscorea spp.) belong to the family of
Dioscoreaceae and are widely distributed throughout the
humid and sub humid tropics with about 600 described
species (Coursey, 1976). Among the eight yam species
*Corresponding author. E-mail address: [email protected]. Tel: +237 99 55 0111, +237 78 34 28 84.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
782
Afr. J. Biotechnol.
commonly grown and consumed in West Africa,
Dioscorea dumetorum is the most nutritious (Sefa-Deheh
and Afoakwa, 2002). D. dumetorum, which belongs to the
family Dioscoreaceae, originated in tropical Africa and
occurs in both wild and cultivated forms but its cultivation
is still restricted in West and Central Africa (Degras,
1993). Cultivation of D. dumetorum, reported especially in
West Africa, is widespread in Western Cameroon (Treche
and Delpeuch, 1979). Tubers of D. dumetorum are rich in
protein (9.6%), fairly balanced in essential amino acids
(chemical score of 0.94) and its starch is easily digestible
(Mbome Lape and Trèche, 1994; Afoakwa and SefaDedeh, 2001). The use of D. dumetorum as famine food
is therefore recommended with caution. D. dumetorum is
not only used for human consumption but also for
pharmaceutical purposes. Thus, a novel bio-active
compound dioscoretine in D. dumetorum has been
detected (Iwu et al., 1990), which is acceptable pharmaceutically and which can be used advantageously as a
hypoglycemic agent to reduce the blood glucose level in
situations of acute stress such as experienced by
patients with hyperthermia, trauma, sepsis and burns and
those undergoing general anesthesia (Sonibare et al.,
2010). In the practice of folk medicine in West Africa, D.
dumetorum has been used by herbalists and traditional
medical practitioners for the treatment of diabetes and as
a topical anesthetic while others have used it as an arrow
poison and as bait for monkeys (Corley et al., 1985).
Agronomically, D. dumetorum is high-yielding, with
yields of 10 and 40 tones/hectare recorded under
traditional farming conditions and in agricultural stations,
respectively (Lyonga and Ayuk-takem, 1979; NgongNasah et al., 1980; Treche, 1989). It is one of the only
two species in which high level of resistance to two major
nematode parasites of yam has been reported (Kwoseh,
2000). Unlike the other yams, staking is not necessary to
maintain yield (Agbor-Egbe and Treche, 1995) and the
tubers grow near the surface of the soil. This saves
labour and allows for mechanization of harvest (SefaDedeh and Afoakwa, 2002). Despite these qualities, in
general little information is available on D. dumetorum
diversity but in the case of Cameroon no information is
available. Genetic diversity is the prerequisite for any
plant breeding program.
Furthermore, the key to success for any genetic
improvement programme lies in the availability and
measure of genetic variability of desired traits. Morphological characterization is an important first step in
description and classification of crop germplasm because
a breeding program mainly depends upon the magnitude
of genetic variability. However, morphological traits have
been widely used in the study of yam germplasm and
other yam species, specifically to determine the relationships between the various species and landraces, as well
as to develop identification keys (Dansi et al., 1999;
Mignouna et al., 2002; Norman et al., 2011; Tamiru et al.,
2011). Such studies have not been conducted on D.
dumetorum species. The aim of this study was to assess
the genetic diversity of D. dumetorum in two different
agro-ecological zones of Cameroon in order to show the
influence of environmental conditions on morphological
characters.
MATERIALS AND METHOD
Plant materials
A total of 43 accessions of D. dumetorum with 2 accessions of
Dioscorea cayenensis as out-group species are considered in this
study (Table 1). 42 are collected from various localities in the main
yam growing regions (West, South-West and Nord-west) in
Cameroon, 3 from Nigeria. Two accessions of D. cayenensis were
chosen as out-group species. The accessions were planted in the
same period (April 2013) in two experimental fields, one in the West
region at „‟Ferme Ecole Boukue‟‟ (FEBO) in Baham and the other in
the South-West region at „‟Institue de Recherche Agricole pour le
Developpement‟‟ (IRAD) of Ekona. There was no control over
environmental conditions. FEBO is located at latitude 05°20.040' N,
longitude 010°22.572 E and an elevation of 1634±3 m asl. FEBO
belongs to agro-ecological zone III (Western highlands)
characterized by rainfall of 1500 to 2000 mm, with mean annual
temperature of 19°C (Anonymous, 2008) whereas, IRAD of Ekona
is located at latitude 04°12.773'N, longitude 009°19.425'E, and
elevation of 445±3 m and belongs to agro-ecological zone IV
(Humid forest with monomodal rainfall) with rainfall of 2500 to 4000
mm and mean annual temperature of 26°C (Figure 1).
Field planting
The tubers were planted in the field at 1 m spacing in each row, and
1 m between rows. The tubers were planted in an arranged
randomized complete block with a replicate plot of ten plants per
accession. Each plant was supported by an independent stake of
Phyllostachys to induce good canopy development (Figure 2).
Morphological characterization
The morphological description was done according to International
Plant Genetic Resources Institute (IPGRI) and International Institute
of Tropical Agriculture (IITA) descriptors for yam (IPGRI/IITA,
1997). These descriptors for yam have been previously used for
characterizing cultivated yam (Dansi et al., 1999; Mignouna et al.,
2002; Tamiru et al., 2011).
Data collection and analysis
Data was recorded on different types of qualitative and quantitative
morphological characters with varying scales of measurements
(Table 2). The characters were measured on all the plants in each
replication, and mean values from the two replications were used
for analysis. Data was analyzed for simple statistic (mean, standard
deviation, and variance). Variance components (genotypic δ 2g and
phenotypic δ2p) were estimated using Wricke and Weber (1986)
formula. Phenotypic (PCV) and genotypic (GCV) coefficient of
variation were evaluated as suggested by Singh and Chaudhry
(1985). Heritability (broad sense h2) and genetic advance as
percentage of mean were calculated as per Hanson et al. (1956)
and Johnson et al. (1955), respectively. Cluster analysis was
performed using single linkage with the Euclidean distance. The
analyses were made using the computer program IBM/SPSS
Siadjeu et al.
783
Table 1. Accessions of D. dumetorum used in this study.
Accessions
code
Alou 1
Babadjou1
Babungo 1
Bafut 1
Baham cayenensis 1
Bambalang 1
Bambui 1
Bamendjou1
Bamendjou2
Bamokonbou1
Bana1
Bandjoun cayenensis 2
Banga bakundu sweet 1
Bangang 1
Bangang 2
Bangangté1
Bangou1
Batibo 1
Bayangam1
Bayangam 2
Bekora 1
Bekora 2
Buea sweet 1
Buea sweet white yam 1
Dschang1
Ekona Muyuka sweet white 1
Fenkam-Foto1
Fongo-Tongo1
Fonkouankem1
Fundong 1
Guzang 1
Ibo sweet 1
Ibo sweet 2
Ibo sweet 3*
Kumbo 1
Lysoka sweet 1
Mabondji sweet white 1
Mabondji sweet yellow 1
Mankon 1
Mbongue sweet 1
Muyuka 1
Muyuka 2
Muyuka 3
Nkwen 1
Penda-boko sweet 1
Local
name
Meleuh
Neliola
Leueh
Nelegha
Leng
Leueh
Neleghe-ndongbeu
Chechio
Torguem
Nelio
Chinchi
Leng
Sweet yam
Neliola
Nelio
Peule
Torgai
Aysoh
Chechio
Torguem
Sweet yam
Sweet yam
Sweet yam
Sweet yam
Lilio
Sweet yam
Chechio
Nloh-nelek
Torga
Alim
Ndong-mbeck
Ibo sweet
Ibo sweet
Ibo sweet
Reeg
Lysoka sweet yam
Sweet yam mabondji
Sweet yam mabondji
Ndong-nebengha
Sweet yam
Sweet yam
Sweet yam
Sweet yam
Zolik
Penda-boko sweet 1
Area of
Altitude
collection
(±3 masl.)
Alou
1606
Mbouda
1395
Babungo
1182
Bafut
1123
Baham
1647
Bambalang
1185
Bambui
1262
Baham
1647
Baham
1647
Bafoussam
1414
Bafang
1167
Bandjoun
1509
Muyuka
62
Bangang
1776
Bangang
1776
Bangangté
1350
Bangangté
1350
Batibo
1127
Bayamgan
1560
Bayamgan
1560
Bekora
60
Bekora
60
Muea
554
Muea
438
Dschang
1337
Muea
401
Bafoussam
1414
Fongo-Tongo
1460
Bafang
1167
Fundong
1554
Guzang
1233
Banga Bakondu
56
Banga Bakondu
56
Banga Bakondu
56
Kumbo
1722
Lysoka
60
Mabondji
80
Mabondji
80
Mankon
1253
Muyuka
62
Muea
554
Muea
554
Muyuka
62
Nkwen
1251
Muea
554
Latitude
(N)
05°31.240‟
05°37.488‟
06°03.984‟
06°05.187‟
05°20.063‟
05°53.644‟
06°00.797‟
05°20.063‟
05°20.063‟
05°28.781‟
05°09.365‟
05°22.392‟
04°17.314‟
05°34.303‟
05°34.303‟
05°08.379‟
05°08.379‟
05°50.144‟
05°17.930‟
05°17.930‟
04°36.114‟
04°36.114‟
04°10.149‟
04°12.295‟
05°26.637‟
04°12.740‟
05°28.781‟
05°30.118‟
05°09.365‟
06°16.790‟
05°49.983‟
04°24.103‟
04°24.103‟
04°24.103‟
06°12.386‟
04°11.306‟
04°33.745‟
04°33.745‟
05°58.172‟
04°17.314‟
04°10.149‟
04°10.149‟
04°17.314‟
05°57.717‟
04°10.149‟
Longitude
(E)
009°56.479‟
010°15.668‟
010°26.823‟
010°07.094‟
010°22.118‟
010°30.814‟
010°13.635‟
010°22.118‟
010°22.118‟
010°25.197‟
010°10.147‟
010°24.960‟
009°24.451‟
010°09.133‟
010°09.133‟
010°31.406‟
010°31.406‟
009°53.467‟
010°26.446‟
010°26.446‟
009°05.704‟
009°05.704‟
009°18.149‟
009°19.912‟
010°03.404‟
009°19.554‟
010°25.197‟
009°59.976‟
010°10.147‟
010°17.075‟
009°55.278‟
009°26.522‟
009°26.522‟
009°26.522‟
010°40.478‟
009°18.745‟
009°11.806‟
009°11.806‟
010°08.541‟
009°24.451‟
009°18.149‟
009°18.149‟
009°24.451‟
010°10.078‟
009°18.149‟
* These accessions collected in Cameroon come from Nigeria.
statistics 20. Quantitative and qualitative characters were analyzed
separately to avoid the effect due to the difference in scale. Thus,
for quantitative characters, cluster analysis was conducted on the
basis of average distance of k-means whereas for qualitative
characters, it was on the basis of average linkage. Out-group
species was used to give a root to the tree in hierarchical cluster
784
Afr. J. Biotechnol.
0
30
60
90
120
150 km
North-West Region
AEZ 3
Fudong
Bafut
Kumbo
Bamenda
Batibo
Santa
Mbouda
South West Region
AEZ 4
Nkambe
Alou
Dschang
Baham
Bafang
Banguem
West Region
AE Z 3
Galim
Foumbot
Bafoussam
Bandjoun
Bayangam
Bangangté
Bazou
Kumba
Ekondo-Titi
MBongue
Muyuka
Ekona
Buea
Douala
Figure 1. Map of the sample collection areas including the two experimental sites (Baham and Ekona) and
some locations where accessions have been collected.
analysis. Principal component analysis was used for variables
reduction. Multivariate analyses are a valid system to deal with
germplasm collections (Falcinelli et al., 2008).
RESULTS
The estimates of genotypic and phenotypic variance,
broad sense heritability and genetic advance in percentages of means and genotypic and phenotypic coefficients of variation are given in Table 3. Variance analysis
for characters revealed highly significant differences
among genotypes for all the traits evaluated. Genetic
advance as percentage of the mean was highest for
harvest index (86.84%, P=0.05), internode number
(59.03%, P=0.05), and stem length (53.45%, P=0.05)
(Table 3). Broad sense heritability estimates was high for
all the characters. The magnitude of phenotypic coefficient of variation (PCV) values for all the traits was
higher than the corresponding genotypic coefficient of
variation. The highest values of genetic advance as
percentage of mean were for harvest index (86.84%),
internode number (59.03%) and stem length (53.45%).
The first three components with eigen values > 1
contributed 83.26% of the variability, while the first
component (PC1) alone accounted for 60% of the total of
the variation amongst 45 accessions evaluated for nine
Siadjeu et al.
785
A
A
B
Figure 2. Experimental fields. A: IRAD (Ekona); B: FEBO (Baham).
quantitative traits (Table 4). The first principal component
(PC1) was more related to stem length, leaf length,
internode number and leaf width. The second principal
component (PC2), explaining 18.49% of total variation
was associated with harvest index, leaf number and
internode length. The third principal component (PC3),
explaining 14% of total variation was correlated with day
to emergence and stem diameter.
Based on the average distance of k-means, quantitative traits accessions were grouped into three. Group I
consisted of five accessions, group II of 10, and group III
of 30 accessions. Cluster I was constituted by one accession from the North-West (30), three from South-West (1,
24, 26) and one accession of D. cayenensis (12). Cluster
II, included three accessions from the West region (8, 15,
and 20), two accessions from Nigeria (32, 34), four from
South-West region (13, 37, 43, and 45) and one
accession from out-group species (5). Cluster II included
all the D. dumetorum accessions form West, North-West,
South-West regions and Nigeria. Mean values along S.D.
for each cluster (Table 5) showed that accessions in
Cluster II were highest mean performance for most of the
characters studied. Accessions of this cluster gave high
yielding and medium number of days to emergence,
whereas accessions in cluster I was high yielding but
more days to emergence. The first two principal components were plotted to observe relationships between the
clusters (Figure 3). Cluster I and III were clearly
separated, whereas cluster II was not clearly separated.
Morphology diversity
qualitative characters
assessed
by
cluster
for
Cluster analysis using single linkage of 32 morphological
qualitative characters gave two major groups in Baham
(Figure 4) and two major groups in Ekona (Figure 5).
Cluster I in Baham was constituted of 34 accessions. It
included all the accessions from West and North-West
region with six accessions from South-West region (1, 13,
23, 24, 43 and 37) and three from Nigeria (32, 33 and
34). This cluster is characterized by low spines on and
786
Afr. J. Biotechnol.
Table 2.Morphological descriptors used for characterization.
Characters
Young stem
Days to emerge*
Stem length (cm) *
Internode number*
Adult stem
Internode length (cm)*
Presence/absence of spines
Spine length**
Spines on stem base**
Spines on stem above base**
Vigour of entire plant**
Twining habit**
Twining direction**
Adult stem colour**
Stem diameter*
State
0 absent, 1present
3= short, 5= intermediate,7= long
3= few, 7= many
3= few, 7= many
3=low, 5=intermediate, 7=high
2= no, 1= yes
1= clockwise, 2= anticlockwise
1= green, 2= purplish green, 3= brownish green, 4= dark brown, 5= purple
Young leaves
Leaf number at 20 days after emergence*
Adult leaves
Petiole length (cm)**
Leaf lenght (cm)*
Leaf width (cm)*
Leaf tip (mm)**
Leaf type*
Leaf colour**
Leaf base shape**
Leaf density**
Leaf margin**
Position of leaves**
Leaf lobation**
Leaf Apex shape**
Flowering
Flowering**
Fructification**
Tuber
Presence/absence of aerial tuber**
Number of tubers per seedbed**
Tuber length (cm)**
Tuber skin colour**
Tuber skin thickness**
Tuber shape**
Tendency of tuber to branch**
Place where tuber branched**
Root on the tuber surface**
Place of roots on the tuber**
Presence/absence of cracks on the tuber
surface**
Tuber skin thickness**
Flesh colour of lower part of tuber**
1= ≤5 cm, 2= 6-9 cm, 3= ≥10 cm
1= <2 mm, 2= 2-5 mm, 3= >5 mm
1= Simple, 2= Compound
1= green, 2= purple
1= ovate, 2= cordate, 3= cordate long, 4= cordate broad, 5=sagittate long, 6= sagittate broad, 7= hastate
3= low, 5= intermediate, 7= high
1=entire, 2= serrate
1= alternate, 2= opposite, 3= alternate at base/opposite above
1= shallowly lobed, 2= deeply lobed
1 Obtuse, 2 Acute, 3 Emarginate
0 no, 1 yes
0 no, 1 yes
0 absent, 1 present
1= one, 2= few (2-5), 3=several (>5)
1= ≤20 cm, 2= 21 - 40 cm, 3 ≥41 cm
1=Light maroon, 2= dark maroon, 3=greyish
1= <1 mm, 2= ≥1 mm
1= round,2= oval, 3= oval-oblong,4= cylindrical,5= flattened,6= irregular
3= slightly branched, 5= branched,7= highly branched
1= upper third, 2= middle, 3= lower third
3= few, 7= many
1= lower, 2= middle, 3= upper, 4= entire tuber
0= absence, 1= present
1= <1mm, 2 ≥1mm
1= white,2= yellowish white or off-white,3= yellow,4= orange,5= light purple,6= purple 7= purple with white,8= white with purple,9=
outer purple/inner yellowish
Harvest index*
*State not specified in IPGRI/IITA, ** Characters used for clustering and principal component analysis.
Siadjeu et al.
787
Table 3. Basic statistics, variance components (δ2g, δ2p), genotypic (GCV) and
phenotypic (PCV) coefficient of variations, broad sense of heritability (h 2) and genetic
advance (GA %, P=0.05) for 43 accessions of D. dumetorum and 2 accessions of D.
cayenensis
2
2
2
Character
Mean ± S.E.
δg
δp
h
GCV PCV GA (%)
Day to emergence
20.15±0.33 654.74 688.48 0.95 0.53 0.54 44.18
Stem length (cm)
90.47 ±1.22 4751.57 5364.35 0.89 0.50 0.53 53.45
Internode number
10.58±0.21
98.41
118.67 0.83 0.49 0.54 59.03
Number of Leave
11.68±0.23 270.51 287.69 0.94 0.51 0.53 44.34
Leaf length/ leaf width 1.49±0.01
0.42
0.43
0.96 0.73 0.75 44.77
Stem diameter (cm)
0.47±0.01
0.26
0.27
0.97 0.58 0.59 45.28
Internode length (cm) 14.40±0.15
32.38
40.62 0.80 0.29 0.33 37.56
Harvest index (%)
3.40±0.23
64.86
95.77 0.68 0.61 0.75 86.84
Table 4. Principal component (PCs) for
nine quantitative characters in 43
accessions of D. dumetorum and two
accessions of D. cayenensis.
Parameter
Eigenvalue
Variance (%)
Cumulative (%)
Stem length
Leaf length
Internode number
Leaf width
Harvest index
Leaf number
Internode length
Day to emergence
Stem diameter
PC1
4.57
50.83
50.83
0.90
0.85
0.85
0.72
-0.08
0.49
0.62
-0.15
0.48
PC2
1.66
18.49
69.32
0.31
0.14
-0.07
0.44
0.79
0.78
0.68
0.10
-0.09
PC3
1.25
13.94
83.26
0.07
0.27
-0.14
0.22
0.00
0.08
-0.04
0.96
0.84
Table 5. Mean and S.D. for three clusters on agronomic traits.
Trait
Cluster I
Cluster II
Cluster III
Stem length (cm)
51.77±8.61 122.60±14.65 82.95±8.29
Leaf length (cm)
8.05±0.46
13.10±1.62 10.85±1.11
Internode number
7.99 ± 2.50
14.54±4.66
9.48±1.60
Leaf width (cm)
5.71±1.48
9.50±1.85
7.13±0.78
Harvest index
5.31±6.69
4.47±1.75
2.51±1.64
Leaf number
9.91±3.80
16.56±7.06 10.14±1.69
Internode length (cm) 8.43±2.33
16.09±2.22 13.71±1.49
Day to emergence
29.33±15.09 25.55±10.43 20.61±7.82
Stem diameter
0.37±0.13
0.66±0.16
0.48±0.15
above stem base. Cluster II contained nine accessions
(21, 22, 26, 36, 38, 40, 41, 42 and 45). All the accessions
of this cluster were from South-West region. They were
characterized by many spines on and above stem base,
except accession 36 with low spines on stem base. In
Ekona, Cluster I was constituted by 31 accessions. It
included all the accessions from West and North-West
regions with six accessions from South-West region (1,
13, 23, 36, 37 and 43). As in Baham, this cluster was
characterized by low spines on and above stem base.
788
Afr. J. Biotechnol.
Figure 3. Scattered diagram of 43 accessions of D. dumetorum and 2 accessions of D.
cayenensis for two PCs. The digits 1, 2 and 3 represent the cluster number.
Cluster II contained nine accessions from South-West
(21, 22, 24, 26, 38, 40, 41, 42 and 45) and three from
Nigeria (32, 33 and 34). They were characterized by
many spines on and above stem base. It contained the
only accession which formed flowers and fruits (32).
Morphology diversity assessed
component for qualitative characters
by
principal
The result of principal component analysis based on 25
and 26 qualitative characters of 43 accessions of D.
dumetorum in Baham and Ekona, respectively, are
presented in Tables 6 and 7. In Baham six principal
components are observed with Eigen-values greater than
1.0 contrary to Ekona with seven principal components.
In Baham, the first six principal components explained
71.39% of the variation, while the first principal component (PC1) alone explained 21.60% of the total
variation. The PC1 had high loading for tendency of tuber
branched, tuber shape, leaf density, number of tuber per
seedbed, flowering. The second component (PC2) explaining about 16% of total variation was correlated with
spines on stem base, spines on stem above base, spines
length and plant vigor. The third component (PC3)
explaining about 11% of total variation was mainly
associated with characters such as roots on tuber
surface, place of roots on the tuber surface, and cracks
on the tuber surface.
In Ekona, the first seven principal components
explained 77.34% of the variation, while the first principal
component (PC1) alone explained about 22% of the total
variation. The PC1 had high loading for spines on stem
base, spines on stem abovebase, spines length and
tuber length. The second component (PC2) explaining
about 17% of total variation was correlated with roots on
tuber surface, and place of roots on the tuber surface.
The third component (PC3) explaining about 12% of total
variation was mainly associated with characters such as
tuber shape, petiole length and leaf density.
To assess the scores of individual accessions PC1 and
PC2 were plotted (Figure 6). In Baham, the biggest set
which represented the cluster I in cluster analysis
occupied the low corner of the plot with relatively the
highest positive and negative values for PC1. Contrary to
cluster analysis, PCA analysis detected one sub-group
within cluster I. This sub-group was constituted by nine
accessions from West (8, 9, 10, 15, and 20), South-West
(37 and 43) regions and Nigeria (32 and 33). It constituted the flowering accessions. The second set
represented the cluster II which occupied the top corner
of the plot with relatively high score for PC2. In Ekona,
the biggest set which represented the cluster I in cluster
analysis occupied the right corner of the plot with
relatively the highest positive and negative values for
PC2.
The second set represented the cluster II, and occupied the left corner of the plot with relatively high positive
Siadjeu et al.
789
0
I
I
II II
Banga bakudu sweet 1
Muyuka 3
Bamendjou 1
Mabondji sweet white 1
Alou 1
Fundong 1
Batibo 1
Bafut 1
Mankon 1
Bangangté 1
Babungo 1
Dschang 1
Bangang 1
Kumbo 1
Nkwen
Babadjou 1
Bana1
Fenkam-foto1
Bambalang 1
Ibo sweet 1
Ibo sweet 3
Bamendjou 2
Bangang 2
Bamokonbou 1
Bayangam 2
Ibo sweet 2
Bambui 1
Bangou 1
Guzang 1
Fongo-tongo 1
Fonkouankem 1
Buea sweet 1
Bayangam 1
Buea sweet white yam 1
Bekora 1
Muyuka 1
Bekora 2
Muyuka 2
Penda-boko sweet 1
Mabondji sweet yellow 1
Mbongue sweet 1
Ekona Muyuka sweet white 1
Lysoka sweet 1
Baham cayenensis 1
Bandjoun cayenensis 1
5
Rescaled Distance Cluster Combine
10
15
20
25
13
43
8
37
1
30
18
4
39
16
3
25
14
35
44
2
11
27
6
32
34
9
15
10
20
33
7
17
31
28
29
23
19
24
21
41
22
42
45
38
40
26
36
5
12
Figure 4. Relationship of 43 accessions of D. dumetorum and 2 accessions of D. cayenensis based on single linkage clustering of 32
qualitative characters in Baham.
score for PC1.
DISCUSSION
The key to success of any genetic improvement
programme lies in the availability of genetic variability of
the desired traits (Heller, 1996). Morphological charac-
terization is an important first step in description and
classification of crop germplasm because a breeding
program mainly depends upon the magnitude of genetic
variability (Ghafoor et al., 2001).
Quantitative characters
For all the quantitative characters, the magnitude of
790
Afr. J. Biotechnol.
0
I
II
Bambui 1
Nkwen 1
Bambalang 1
Bana1
Bangang 1
Bamendjou 1
Banga bakundu sweet 1
Muyuka 3
Mabondji sweet white 1
Bafut 1
Fenkam-foto1
Batibo 1
Dschang 1
Kumbo 1
Babadjou 1
Babungo 1
Mankon 1
Fundong 1
Alou 1
Bangangté 1
Bayangam 1
Bangang 2
Bayangam 2
Fongo-tongo 1
Lysoka sweet 1
Fonkouankem 1
Guzang 1
Bamokonbou 1
Bamendjou 2
Bangou 1
Buea sweet 1
Bekora 1
Muyuka 1
Bekora 2
Mbongue sweet 1
Muyuka 2
Penda-boko sweet 1
Ibo sweet 1
Ibo sweet 3
Mabondji sweet yellow 1
Buea sweet white yam 1
Ekona Muyuka sweet white 1
Ibo sweet 2
Baham cayenensis 1
Bandjoun cayenensis 1
5
Rescaled Distance Cluster Combine
10
15
20
25
7
44
6
11
14
8
13
43
37
4
27
18
25
35
2
3
39
30
1
16
19
15
20
28
36
29
31
10
9
17
23
21
41
22
40
42
45
32
34
38
24
26
33
5
12
Figure 5. Relationship of 43 accessions of D. dumetorum and 2 accessions of D. cayenensis based on single linkage
clustering of 32 qualitative characters in Ekona.
Table 6. Principal components (PCs) for qualitative characters in 43 accessions of
D. dumetorum in Baham.
Parameter
Eigenvalue
% of variance
Cumulative (%)
Tendency of tuber branched
Tuber shape
Leaf density
Number of tuber per seedbed
PC 1
4.10
21.60
21.60
0.761
0.744
0.726
0.658
PC 2
3.03
15.96
37.57
-0.094
-0.206
-0.203
-0.099
PC 3
2.13
11.21
48.78
0.048
0.049
0.146
-0.204
PC 4
1.68
8.86
57.64
-0.255
0.222
0.137
0.269
PC 5
1.38
7.25
64.89
0.079
-0.400
0.422
0.231
PC 6
1.23
6.50
71.39
0.187
-0.020
0.075
-0.305
Siadjeu et al.
791
Table 6. Contd.
Parameter
Flowering
Tuber length
Spines on above stem base
Spines length
Spines on stem base
Plant vigour
Roots on tuber surface
Place of roots on the tuber surface
Cracks on the tuber surface
Leaf lobation
Tuber flesh colour
Petiole length
Place where tuber branched
Aerial tuber
Tuber skin thickness
PC 1
0.645
0.413
-0.160
0.013
-0.269
0.496
0.099
0.145
0.031
0.066
-0.132
0.145
0.121
0.004
-0.048
PC 2
0.271
-0.058
0.884
0.878
0.862
0.638
-0.094
-0.139
0.264
0.084
-0.083
0.064
-0.146
-0.151
0.111
PC 3
0.208
0.351
-0.122
-0.152
-0.108
0.009
0.935
0.905
-0.609
-0.136
0.253
0.250
-0.405
-0.047
-0.138
PC 4
-0.264
-0.128
0.224
0.005
-0.157
-0.222
0.093
0.077
0.156
0.795
0.694
0.105
-0.107
-0.141
-0.279
PC 5
0.264
-0.164
-0.007
-0.024
-0.102
0.287
-0.004
0.067
-0.191
0.084
-0.069
0.790
0.509
-0.137
-0.197
PC 6
0.038
-0.331
-0.019
-0.115
-0.115
-0.086
0.109
0.135
0.274
-0.007
0.090
-0.012
0.043
0.795
-0.649
Table 7. Principal components (PCs) for qualitative characters in 43 accessions of D.
dumetorum in Ekona.
Parameter
Eigenvalue
% of variance
Cumulative (%)
Spines on above stem base
Spines on stem base
Spines length
Tuber length
Roots on tuber surface
Place of roots on the tuber surface
Tuber shape
Petiole length
Leaf density
Cracks on the tuber surface
Flowering
Number of tuber per seedbed
Tuber flesh colour
Leaf lobation
Plant vigour
Tendency of tuber branched
Tuber skin thickness
Aerial tuber
Fruit formation
Place where tuber branched
PC 1
4.40
22.01
22.01
0.914
0.914
0.876
0.712
-0.139
-0.139
0.191
0.164
-0.228
0.375
0.174
-0.394
-0.041
0.224
0.485
-0.221
0.399
-0.053
0.225
0.273
phenotypic coefficient of variation (PCV) values for all the
traits was near the corresponding genotypic coefficient of
variation. This indicated a highly significant effect of
genotype on phenotypic expression with little effect of the
environment (Manju and Sreelathakumary, 2002). High
PC 2
3.48
17.39
39.40
-0.115
-0.115
-0.117
0.110
0.962
0.962
0.311
0.071
0.123
-0.336
0.047
0.050
0.033
-0.092
-0.016
0.041
0.379
-0.196
0.003
0.467
PC 3
2.42
12.11
51.50
-0.166
-0.166
-0.051
0.190
0.002
0.002
-0.712
0.673
0.655
-0.486
-0.001
0.074
-0.179
0.170
0.232
0.088
-0.163
0.225
-0.069
0.075
PC 4
1.53
7.65
59.16
-0.094
-0.094
0.198
0.357
0.033
0.033
0.198
0.140
0.434
0.175
0.851
0.422
-0.109
0.320
0.274
0.098
0.167
-0.176
0.457
0.073
PC 5
1.31
6.56
65.72
0.086
0.086
-0.190
0.071
0.010
0.010
-0.073
-0.088
-0.319
0.090
0.049
-0.269
0.812
0.738
-0.532
0.032
-0.062
-0.056
-0.029
-0.188
PC 6
1.18
5.92
71.65
-0.029
-0.029
0.030
-0.064
0.059
0.059
0.263
0.394
0.151
0.251
0.144
0.242
-0.050
0.184
0.289
0.834
0.575
0.282
-0.282
0.254
PC 7
1.14
5.69
77.34
0.086
0.086
-0.014
0.054
-0.035
-0.035
-0.162
0.047
0.154
0.087
-0.009
0.268
-0.003
-0.157
0.046
0.148
-0.029
0.743
0.707
0.536
GCV along with high heritability and high genetic
advance will provide better information than single
parameters alone (Saha et al., 1990; Baye et al., 2005).
Hence, traits such as harvest index, internode number
and stem length can be improved in the breeding
792
Afr. J. Biotechnol.
II
I
II
I
A
1
2
B
1
2
Figure 6. Plot of the first (PC1) and the second (PC2) principal components for 43 accessions of D. dumetorum based on qualitative
characters. A: Baham; B: Ekona. The numbers represent the accessions.
program of D. dumetorum. However, all the traits of this
study showed high heritability, and according to Manju
and Sreelathakumary (2002), high heritability estimates
indicate the presence of large number of fixable variable
additive factors and hence these traits may be improved
by selection. The PCA revealed that stem length, leaf
length, internode number, leaf width, harvest index, leaf
number and internode length were positive, indicating
that these traits contributed at their peak towards
diversity and can be used in the classification of D.
dumetorum accession.
Qualitative character
Cluster analysis using single linkage of 32 morphological
qualitative characters gave two major groups of D.
dumetorum accessions in Ekona as well as in Baham
with a few differences between the members of these
groups, that is, accession 32 formed flowers and fruits in
Ekona but has not flowered in Baham. This difference is
probably due to environmental effects, in fact plants
respond and adapt differently to pressure differences
imposed by distinctive agro-climatic zones (Singh et al.,
1998). There was no clear separation between accessions and area of collection. The same result has been
reported by Sonibare et al. (2010), resulting fromthe
natural migration of populations. Cluster analysis has
also clearly separated D. dumetorum accessions from D.
cayenensis accessions in the two areas of cultivation.
This observation is explained by the fact that both
species belong to two different sections; lasiophyton and
Enantiophylum for D. dumetorum and D. cayenensis,
respectively. The section lasiophyton is characterized by
the fact that the vines twine to the right, that is, in a
clockwise direction when viewed from the ground
upwards, whereas species in section Enantiophylum
twine to the left (Onwueme and Winston, 1994).
The PCA analysis is a way of identifying patterns in the
data and expressing the data in such a way as to
highlight their similarities and differences (Winterota et
al., 2008). Traits such as the tendency of the tuber to
branch, tuber shape, leaf density, number of tubers per
seedbed, flowering, spines on stem base, spines on stem
above base, spines length and plant vigor were positive
for PC1 and PC2, thus contributing to the maximum
diversity of D. dumetorum accessions, whereas in Ekona,
we had traits such as spines on stem base, spines on
stem above base, spines length and tuber length, roots
on tuber surface and place of roots on the tuber surface.
This difference is related to the fact that plants react
differently to varying environmental conditions. That is
why morphological and agronomic features cannot be
relied upon due to the inconsistency in identification
(Muthamia et al., 2013).
The results were consistent between cluster and PCA
analysis, but the PC detected in Baham shows that the
subgroup of D. dumetorum was constituted by the
flowering accessions. Thus, grouping accessions by
multivariate methods is practical value in the breeding
programme, Ghafoor et al. (2001) have already remarked
this in blackgram (Vigna mungo L.).
Conclusion
This study shows the relatively high genetic diversity of
D. dumetorum accessions. This diversity could effectively
be used in the breeding programme of D. dumetorum
accessions. Although, morphological traits allowed the
Siadjeu et al.
separation of D. dumetorum in different clusters, their
expression is subjected to agro-climatic variations and
thus provide limited genetic information. This is why,
molecular markers are recommended with caution to
reveal the full extent of existing biodiversity of D.
dumetorum in Cameroon.
Conflict of interests
The authors did not declare any conflict of interest.
REFERENCES
Afoakwa EO, Sefa-Dedeh S (2001). Chemical composition and quality
changes in trifoliate yam Dioscorea dumetorum tubers after harvest.
J. Food Chem. 75(1):85-91.
Agbor-Egbe T, Treche S (1995). Evaluation of the chemical composition
of Cameroonian yam germplasm. J. Food Compost. Anal. 8:274283.
Anonymous (2008). Second report on the state of plant genetic
resources for food and agriculture in Cameroon. Institute of
Agricultural Research and Development (IRAD), Yaounde, Cameroon
74 p.
Baye B, Ravishankar R, Singh H (2005). Variability and association of
tuber yield and related traits in potato (Solanum tubersum L.). Ethiop.
J. Agric. Sci. 18(1):103-121.
Corley D, Tempesta MS, Iwu M (1985). Convulsant alkaloids from
Dioscorea dumetorum. Tetrahedron Lett. 26 (13):1615-1618.
Coursey DG (1976). The origins and domestication of yams in Africa. In:
Origins of African domestication. Ed Harlan JR. Mouton Publisher pp.
383-408.
Dansi A, Mignouna HD, Zoundjihékpon J, Sangaré A, Asiedu R, Quin F
(1999) Morphological diversity, cultivar groups and possible descent
in the cultivated yams (D. cayenensis / D. rotundata) complex in
Benin Republic. Gen. Res. Crop Evol. 46:371-388.
Degras L (1993). The yam: a tropical root crop (2ndedn.). London:
Macmilan Press Ltd. 408 p.
Falcinelli M, Veronesi F, Lorenzetti S (1988). Evaluation of an Italian
germplasm collection of Lolium perenne L. through a multivariate
approach. In: Proceedings of the Eucarpia Fodder Crops Section
Meeting, Lusignan, France. pp. 22-24.
Ghafoor A, Sharif A, Ahmad Z, Zahid MA, Rabbani MA (2001). Genetic
diversity in blackgram (Vigna mungo L. Hepper). Field Crops Res.
69:183-190.
Hanson CH, Robinson HF, Comstock RE (1956). Biometrical studies on
yield in segregating population of Korean lespedesa. Agron. J. 48:
268-272.
Heller J (1996). Physic nut Jatropha curcas L. Promoting the
conservation and use of underutilized and neglected crops. Institute
of Plant Genetic and Crop Plant Research, Gatersleben/International
Plant Genetic Resource Institute, Rome.
IPGRI/IITA (1997). Descriptors for Yam (Dioscorea spp.). International
Plant Genetic Resources Institute (IPGRI), Rome), International
Institute for Tropical Agriculture (IITA) (Ibadan) 53 p.
Iwu MM, Okunji CO, Ohiaeri GO, Akah P, Corley D, Tempesta MS
(1990). Hypoglycaemic activity of dioscoretine from tubers of
Dioscorea dumetorum in normal and alloxan diabetic rabbits. Planta
Med. 56 (3):264-268.
Johnson HW, Robinson HF, Conmstock RE (1955). Estimates of
genetic and environmental variability in soybeans. Agron. J. 47:314318.
Kwoseh CK (2000). Identification of resistance to major nematode pest
of yams (Dioscorea spp.) in West Africa. PhD thesis. University of
Reading, UK. 196 p.
793
Lyonga SN, Ayuk-takem JA (1979). Collection, selection and agronomic
studies on edible yams (Dioscorea spp.) in Cameroun. Proceedings
of Fifth International Symposium of Tropical Root Crops. pp. 217-243.
Manju PR, Sreelathakumary I (2002).Genetic variability, heritability and
genetic advance in hot Chilli (Capsicum Chinense Jacq.). J. Trop.
Agric. 40:4-6.
Mbome Lape I, Trèche S (1994). Nutritional quality of yams (D.
rotundata and D. dumetorum) flours for growing rats. J. Sci. Food
Agric. 66: 447-455.
Mignouna HD, Abang MM, Fagbemi SA (2003). A comparative
assessment of molecular marker assays (AFLP, RAPD and SSR) for
white yam (Dioscorea rotundata) germplasm characterization. Ann.
Appl. Biol. 142:269-276.
Mignouna HD, Dansi A, Zok S (2002). Morphological and isozymic
diversity of the cultivated yams (Dioscorea cayenensis/ Dioscorea
rotundata complex) of Cameroon. Genet. Resour. Crop Evol. 49:2129.
Muthamia ZK, Morag FE, Nyende AB, Mamati EG, Wanjala BW (2013).
Estimation of genetic diversity of the Kenyan yam (Dioscorea spp.)
using microsatellite markers. Afr. J. Biotechnol. 12(40):5845-5851.
Ngong-Nassah E, Lyonga SN, Ayuk-Takem J (1980).How to grow yams
for better yields. Technical Bulletin N° 3, IRA, Bambui, Cameroon.
Norman PE, Tongoona P, Shanahan PE (2011). Diversity of the
morphological traits of yam (Dioscorea spp.) genotypes from Sierra
Leone. J. Appl. Biosci. 45:3045-3058.
Onwueme IC, Winston BC (1994). Tropical Root and Tuber Crops:
Production, Perspectives and Future Prospects. Food & Agriculture
Org (Ed.), Rome 228 p.
Saha SC, Mishira SN, Mishira RS (1990). Genetic variation in F2
generation of Chilli capsicum. NewsLett. 8:29-30.
Sefa-Dedeh S, Afoakwa EO (2002). Biochemical and textural changes
in trifoliate yam Dioscorea dumetorum tubers after harvest. Food
Chem. 79:27-40.
Singh AK, Smart J, Simpson CE, Raina SN (1998). Genetic variation
visa-vis molecular polymorphism in groundnut, Arachis hypogaea L.
Genet. Resour. Crop. Evol. 45:119-126.
Singh RK, Chaudhry BD (1985). Biometrical Methods in Quantitative
Genetic Analysis. Kalyani Publishers, Ludhiana 303 p.
Sonibare Mubo A, Asiedu R, Albach DC (2010). Genetic diversity of
Dioscorea dumetorum (Kunth) Pax using Amplified Fragment Length
Polymorphisms (AFLP) and cpDNA. Biochem. Syst. Ecol 38:320-334.
Tamiru M, Becker HC, Maass BL 2011. Comparative analysis of
morphological and farmers cognitive diversity in yam landraces
(Dioscorea spp.) from Southern Ethiopia. Trop. Agric. Dev. 55(1):2843.
Treche S (1989). Nutritional potential of yams (Dioscorea spp.) cultived
in Cameroon. Appendices. Thesis, ORSTOM Editions, Collection
Studies and Thesis, Paris. 595p.
Treche S, Delpeuch F (1979). Evidence for the development of
membrane thickening in the parenchyma of tubers of Dioscorea
dumetorum during storage. C. R. Hebd. Seances Acad. Sci. 288:6770.
Winterota R, Mikulikova R, Mazac J, Havelec P (2008). Assessment of
authenticity of fruits spirits by gas chromatographic and staple
isotope ratio analyses. Czech J. Food Sci. 26:368-375.
Wricke H, Weber WE (1986). Quantitative genetics and selection in
plant breeding. Berlin: Walter de Gruyter and Co.
Vol. 14(9), pp. 794-810, 4 March, 2015
DOI: 10.5897/AJB2014.14273
Article Number: E58842250962
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Isolation and characterization of some drought-related
ESTs from barley
Alzahraa Radwan1, Rania M. I. Abou Ali2*, Ahmed Nada1,4, Wardaa Hashem2, Shireen Assem1
and Ebtissam Husein3
1
Department of Plant Molecular Biology, AGERI, ARC, Egypt.
Department of Nucleic Acids and Protein Structure, AGERI, ARC, Egypt.
3
Department of Genetics, Faculty of Agriculture, Cairo University, Egypt.
4
Faculty of Biotechnology, October University for Modern Sciences and Arts (MSA), Egypt.
2
Received 27 October, 2014; Accepted 16 February, 2015
Drought is one of the main constraints facing crops and affecting their production. In a trial to
investigate and understand drought effect, differential display experiments were performed where;
about 107 DD-fragments have been isolated from wild barley plants subjected to drought treatment.
These fragments were categorized according to their gene expression into four categories: 1) up
regulated genes; 2) up and down regulated; 3) down regulated and 4) down and up regulated genes. The
isolated fragments were cloned and sequenced. Sequence analysis using GeneBank database revealed
that some fragments have significant similarities with starch branching enzyme I (sbeI) gene; glycosyl
transferase family 1 gene; Retrotransposons Ty3-gypsy subclass; gag-polypeptide of LTR copia-type
retroelement gene; IMP cyclohydrolase/phosphoribosylaminoimidazolecarboxamide formyltransferase
and unknown proteins. Some other fragments have significant similarity with Triticum aestivum gene for
TaAP2-B, complete cds and 3B chromosome, clone BAC TA3B63N2. These results indicate that starch
metabolism, transposon elements and purine metabolism might have been affected by drought stress.
Key words: Wild barley, differential display, drought; starch metabolism, purine metabolism.
INTRODUCTION
Barley (Hordeum vulgare L) is an important cereal crops.
It is ranked as the fourth crop in the 2007 world wide
cereal crops’ ranking. It is one member of the grass
family. Barley is used for brewing malts for beer, animal
feed and certain distilled beverages, and it is a
component of human health foods. From evolution point
of view, the scientists have hypothesized that the
Hordeum spontaneum is the ancestor plant for all types
of barley. Since the stone age, barley has been cultivated
and consumed. It can grow in many areas because of its
adaptability and durability (Fastnaught, 2001). It has
many health benefits such as in heart diseases, diabetes,
lower level of cholesterol, levels of blood sugar and also
as vitamins and antioxidants (Smith, 2004). Barley is
*Corresponding author. E-mail: [email protected].
Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Radwan et al.
mainly grown in the north coastal regions of Egypt under
rain fed conditions and in the newly reclaimed lands
under irrigation. The area of barley production has been
increased, especially in the newly reclaimed lands. Barley
is a grain cereal that grown in semi-arid areas. These
areas are known with harsh environmental conditions
such as drought. Barley can be germinated and grown in
such sever conditions. The early growth stages are
considered as the most susceptible period to drought
stress and the big challenge in the plant productivity
(Amini, 2013). Despite of all these difficulties, barley can
grow in these semi-arid areas like Egypt. According to
Stanca et al. (2003), barley gene content has several
good gene candidates that enhance the adaptability of
plants to live in the wide harsh environmental conditions.
Drought stress is considered as one of the main
constraints facing the production of plant crops in the
newly reclaimed areas of Egypt. In drought stress, plants
suffer wilting from decreased photosynthetic activity, and
osmotic fluctuations. Also, they are susceptible during the
reproductive stage, reducing yield and fertility (Ashraf,
2010). Many efforts have been made to improve crop
production under the conditions of drought stress. Unlike
animals, plants cannot escape from environmental
stresses that might cause severe damages. Therefore,
plants have several adaptation mechanisms that help to
tolerate osmotic stress coming from heat, salt and/or
drought stresses. These adaptation mechanisms are
performed through induction of a plant molecular
response (Cattivelli et al., 2011). According to Cattivelli et
al. (2011), plant molecular response is performed in three
consequence steps; starts with the perception of the
external environmental stress followed by signal
transduction process to induce selective gene(s) as a
final step to accumulate specific protective molecule.
Induction of these stress related gene(s) is regulated and
controlled by transcriptional elements. These molecular
responses improve the ability of the plant to adapt such
harsh environmental conditions. In the last 20 years,
several stress-related DNA fragments and genes have
been fully characterized.
The productivity of the plant is too sensitive to the water
insufficiency which result from nearly all types of
environmental stresses specially the drought stress.
Drought stress might cause yield loss more than any
other factor that cause loss in the crop yield. Drought
stress has a direct effect on plant development where it
affects the water/nutrient relationship, respiration and
photosynthesis processes (Farooq et al., 2009). Drought
causes reduction in transpiration, photosynthesis, and
also other biochemical processes related to development,
crop productivity and plant growth (Tiwari et al., 2010).
Moreover, drought stress has a direct effect on plant
morphology where it causes reduction in the leaf size,
prolongation of stem and induction of root proliferation
(Farooq et al., 2009). The increase in the osmoprotectants synthesis such as soluble sugar and proline enables
795
plants to survive through drought stress. This increase is
considered as one of the common metabolic adaptations
(Waseem et al., 2011).
There are several drought-related genes that have
been characterized, such as element-binding DNA fragments during drought stress, aquaporin, late embryogenesis abundant proteins (LEA’s) and dehydrin family.
According to the newly discovered biotechnological techniques, drought tolerance mechanisms can be enhanced
through breeding, marker-assisted techniques and
genetic engineering and gene manipulation for drought
related gene(s) (Farooq et al., 2009). Many studies have
been done on the effect of drought stress on barley
growth, production and its adaptation against this stress
(Cattivelli et al., 2011; Amini, 2011; Vaezi et al., 2010).
Differential display technique (DD-PCR) is a powerful
technique for studying the co-current expression of upand down regulated genes and subsequently isolating
those genes. The differential display technique was
described for the first time by Liang and Pardee (1992).
The differential display technique has been used to study
the gene expression in barley, where differentially
expressed genes have been isolated from shoots of
barley seedlings treated with cold, drought and ABA
(Malatrasi et al., 2006).
Also, barley plants were subjected to drought for four
days to compare the palea, lemma and awn transcriptoms (Abebe et al., 2010). El-Shehawi et al. (2011) have
used the same technique in wheat to study and isolate
cDNAs to represent tissue specific genes. They have
isolated, cloned and sequenced many tissue specific
cDNAs fragments.
Also, Eissa et al. (2007) have isolated, characterized,
cloned and sequenced some ESTs from wild barley (H.
spontaneum L.) which was subjected to 250 mM NaCl
using DD technique. On the other hand, DD-PCR
technique has been used in drought stress studies on
different plants such as sugarcane culms (Iskandar et al.,
2011); the effect of ABA on wild type Vicia villosa (Abou
Ali et al., 2010)
The aim of the current study was to investigate the
effect of drought stress on wild barley (H. spontaneum
L.), and to isolate and identify some drought related gene
fragments and candidates from barley treated shoots
(under drought stress).
MATERIALS AND METHODS
Plant materials
The wild barley (H. spontaneum L.) seeds were washed for 1 min
with 70% ethanol by shaking and then removed, followed by
soaking in 20% sodium hypochlorite (commercial Clorox)
supplemented with few drops of Tween 20 for 10 min. The seeds
were washed several times using sterilized distilled water and then
germinated on MS medium (Duchefa Biochemie, M0222.0050) for 8
days. For treatment, seedlings were dehydrated for 0, 3 and 10 h
on 3 mm Whatman filter paper at room temperature according to
796
Afr. J. Biotechnol.
Gao et al. (2008). The control seedlings were left in the MS media.
After that, the treated and control seedlings were harvested, and
quick frozen in liquid nitrogen, then stored at -80°C until RNA
extraction.
Isolation of RNA and differential display-polymerase chain
reaction (DD-PCR)
The TriPure Isolation Reagent (Cat. No. 11 667 157 001, RocheGermany) was used for total RNA isolation from the shoots of
drought treated wild barley (H. spontaneum L.) plants (3 and 10 h)
and shoots of control barley plants; about 200 mg tissues were
used in each RNA extraction. The DD-PCR reactions were
described in RNAmap kit (GenHunter Corporation, USA). Each
cDNA reaction contained 2 μg total RNA, 2 μM anchor primer (T11C
or T11G), 1.0 μl of dNTPs (10 mM), and 1.0 μl MMLV reverse
transcriptase (200 U/μl). The reverse transcription (RT) reactions
were performed for 50 min at 42°C followed by incubation for 15
min at 70°C. The list of primers sequences is shown in Table 1.
PCR amplification of cDNA
One micro lilter of each cDNA reaction was used for PCR
amplification in the presence of 1.0 μl of dNTPs (25 μM), 1.0 μl
anchored primer (2 μM), the same as in the RT reaction, 1.0 μl
arbitrary primer (2 μM namely AP1, AP2, AP3 or AP5), 1 μl MgCl2
(25 mM) and 0.3 μl Taq DNA polymerase (5 U/ μl) (Fermantas,
USA). The PCR program was: 4 min at 94°C (1 cycle); 1 min at
94°C, 2 min at 42°C, 1 min at 72°C (40 cycles); 10 min at 72°C (1
cycle). The products of PCR were loaded on a 6% acrylamide gel
after denaturation of PCR products at 90°C for 5 min. The silver
staining system (Promega, USA) has been used for gels
visualization.
Isolation of DD fragments and cloning
The differentially display bands were cut from the gel and extracted
according to Abou Ali et al. (2010). The nomenclature of the
isolated fragment was depending on the primers combination that
were used in the PCR reaction. For example, the primers
combination between anchor primer G and arbitrary primer 3
showed 6 differentially display fragments and the fragment number
1 was named G3-1. This system of nomenclature was followed in
all isolated fragments. Then the bands were re-amplified using the
same PCR reactions conditions as mentioned before. The pGEM-T
easy system (Promega, USA) was used for cloning. Callard et al.
(1996) method was used for the plasmid isolation, the modified
boiling method. For right colonies screening, EcoR1 digestions
were used (Sambrook et al., 1989).
Sequencing of the cDNA insert
Sanger et al. (1977) method was used for sequencing. The basic
local alignment search tool (BLAST) in the GeneBank databases
was used for comparing nucleotide sequence or the deduced amino
acid sequence of each sequenced clones (http://www.ncbi.
nlm.nih.gov) according to Altschul et al. (1997). The conserved
rejoin alignments were done according to Marchler-Baue et al.
(2013).
RESULTS AND DISCUSSION
Wild barley (H. spontaneum L) seedlings were subjected
to drought stress treatment and subsequently differential
mRNA display technique was used to isolate genes and
fragments that might be related to drought stress
treatment from treated seedlings. The PCR products of
different primer pair combinations were loaded on
sequencing gels and the cDNA fragments were
visualized by silver staining (Figures 1 and 2). One
hundred and seven fragments were found to be
differentially displayed due to drought treatment of the
barley.
Expression patterns of DD fragments
The differentially displayed fragments were isolated and
classified into four categories according to their patterns
of expression: category i) included 37 DD- fragments
which were observed to be up-regulated in seedling
shoots in response to drought treatment across the
time; category ii) included 34 DD- fragments which were
up-regulated after 3 h and then down-regulated in shoots
after 10 h of drought treatment; category iii) included 15
DD- fragments which were down regulated in shoots of
treated seedlings across time, whereas, category iv)
included 21 DD- fragments which down-regulated after 3
h and then up-regulated in shoots after 10 h of drought
treatment (Table 2). Thirty (30) differentially display
fragments were detected in the primers combination
between anchor primer G and arbitrary primer 4 while,
the primers combination between anchor primer G and
arbitrary primer 5 gave 10 differentially display fragments.
Seven differentially display fragments were observed in
the primers combination between anchor primer C and
arbitrary primer 1 while, the primers combination between
anchor primer C and arbitrary primer 2 gave 40
differentially display fragments. Finally, the primers
combination between anchor primer C and arbitrary
primer 3 gave 14 differentially display fragments.
Cloning and sequencing
The DD fragments were eluted, and cloned in pGEM-T
easy vector. The cloning was confirmed using EcoR1
Digestion (Figure 3A and B). Twenty five (11, 4, 10)
cloned fragments have been sequenced. Figure 4 shows
the results of the sequencing.
Sequence alignment using Genebank databases
The resulted sequences were subjected to alignment
analysis using GeneBank databases and the analysis
results revealed significant similarities between the
sequences of the isolated fragments and sequences of
different genes recorded in the GeneBank databases.
Table 3 summarizes the sequence alignment analysis
Radwan et al.
Figure 1. Polyacrylamide gels of DD cDNAs from untreated (C) and drought treated wild barley (Hordeum
sponteneum L.) shoots (3 and 10 h) using different primer combinations of anchored primer T 11C, with
arbitrary primer 1, 2 and 3 (AP1, AP2 and AP3). Arrows indicate a number of differentially expressed bands
on a duplicate basis. The long arrow shows the direction of band selection (from the top to the bottom of the
gel).
797
798
Afr. J. Biotechnol.
Figure 2. Polyacrylamide gels of DD cDNAs from untreated (C) and drought treated wild barley
(Hordeum sponteneum L.) shoots (3 and 10 h) using different primer combinations of anchored
primer T11G, with arbitrary primer 3, 4 and 5 (AP3, AP4 and AP5). Arrows indicate a number of
differentially expressed bands on a duplicate basis. The long arrow shows the direction of band
selection (from the top to the bottom of the gel).
Radwan et al.
799
Table 1. The primers sequences.
Primer name
a- Anchored primers
T11C
T11G
b- Arbitrary primers
AP1
AP2
AP3
AP5
Primer sequence
5'- TTT TTT TTT TTC- 3'
5'- TTT TTT TTT TTG -3'
5'- AAG CTT GAT TGC C -3'
5'- AAG CTT CGA CTG T -3'
5'- AAG CTT TGG TCA G -3'
5'- AAG CTT AGT AGG C -3'
Table 2. Expression pattern for barley isolated DD-fragments.
Category
Clone name
Expression profile
3h
3h
10 h
10 h
Regulation
type
C*
C
Category I
G4-1, G4-5, G4-12, G4-18, G4-21, G4-27, G5-1, G52, G5-4, G5-7, G5-8, G5-9, C1-6, C1-7, C2-3, C2-11,
C2-12, C2-15, C2-16, C2-18, C2-23, C2-24, C2-27,
C2-28, C2-29, C2-30, C2-33, C2-34, C2-35, C2-36,
C2-37, C2-38, C3-1, C3-2, C3-5, C3-10, G5-5
-
-
-
-
+
+
Up regulation
Category II
G4-3, G4-4, G4-7, G4-8, G4-9, G4-14, G4-26, G4-30,
G4-31, G3-2, G3-3, G3-5, G3-6, C1-5, C2-4, C2-5,
C2-6, C2-7, C2-10, C2-17, C2-19, C2-20, C2-21, C222, C2-25, C2-26, C2-39, C2-40, C3-3, C3-6, C3-7,
C3-8, C3-12, C3-14
-
-
+
+
-
-
Up-down
regulation
Category III
G4-15, G4-17, G4-20, G4-24, G4-32, G5-3, G5-6,
G5-10, G3-1, G3-4, C1-4, C2-1, C2-2, C2-13, C214,
+
+
-
-
-
-
Down
regulation
Category IV
G4-2, G4-6, G4-10, G4-13, G4-16, G4-19, G4-22,
G4-25, G4-28, G4-29, C1-1, C1-2, C1-3, C2-8, C2-9,
C2-31, C2-32, C3-4, C3-9, C3-11,
+
+
-
-
+
+
Down-up
regulation
*C, Control; 3 and 10 h drought treatment for 3 and 10 h, respectively.
Figure 3. The screening of some clones using EcoR1 enzyme digestion. A) Lane 1, 1 Kb Marker (Fermantas); lane 2,
undigested pGEM-T easy vector; lane 3, digested pGEM-T easy vector using EcoR1 enzyme; lane 4, digestion of C1-1;
lane 5, digestion of C1-2; Lane 6, digestion of C1-3; lane 7, digestion of C1-4; lane 7, digestion of C1-4; lane 8, digestion of
C1-5; lane 9, digestion of C1-6; lane 10, digestion of C1-7; lane 11, digestion of C1-8; lane 12, digestion of C1-9. B) lane 1,
50 bp (Fermantas); lane 2, undigested C3-1 fragment; lane 3, digested C3-1 fragment using EcoR1 enzyme; lane 4,
undigested C3-2 fragment; lane 5, digested C3-2 fragment; lane 6, undigested C3-3 fragment; lane 7, digested C3-3
fragment; lane 8, undigested C3-4 fragment; lane 9, digested C3-4 fragment; lane 10, 1kb DNA marker (Fermantas).
800
Afr. J. Biotechnol.
C1-1 (492 bp)
TAGGTTTTCTATGGCATGGCTAATTCTTGCTCTAAAATTGCCATCATGCTAATTTTGTCAACCTGCTAACAGCA
TGTTCTATTCTGCAAAAATCATAGTAATTAATTTATACATCATATGGAGTTGTGTCCATGTAGTAAGTTGGGG
TATGCCATGTCTACTACATGCCCATGTATTTTTCATAACCTAAAATCTTAAAAATGCACGCGCTCGATTTGGG
GCAATCAAGCTTAGTTAAGCTTGATTGCCATGTAGGTTTTCTATGGCATGGCTAATTCTTGCTCTAAAATTGC
CATCATGCTAAATTTGTCAACCTGCTAACAGCATGTTCTATTCTGCAAAAATCATAGTAATTAATTTATACATC
ATATGGAGTTGTGTCCATGTAGTAAGTTGGGGTATGCCATGTCTACTACATGCCCATGTATTTTTCATAACCT
AAAATCTTAAAAATGCACGCGCTCGATTTGGGGCAATCAAGCTTAA
C1-2 (636 bp)
AATTCGATTAAGCTTGATTGCCAACCACTTATCTGAGGAATTAATGCCTCTCACATTCCAGTTTAAGATATTC
CAAGTTGCATTGTTATTCATTAATAATCAGTTTGGTGATACTGAAGTCAGCAGAGCCCACCCCCTGATGACA
ATCCCAGGCCATAAATTTTTTTGTTTCCACAAAAAGTACAGAGCATTGTAAATATGTTGGGACATTCCAGCA
GTGGACATAGTAGGTGAGGAGGTGAGCCAAAGCATCCAAAGTCGATTGCCCACAGCTTCCAAGGCAACAG
ATAGGACAGAAGTCTCAGCCATAAGTGGATACCAGAGTTGACATACCAGGAAGCTTGATTGCCATGCAACG
AATGCACTAAGAGCTATAAGTGTATGAAAGCTCAATATGAAAACTCAGTGGCTGTGCATCTAATCTATAATG
AAAAATTCCCACTAGTATATGAAAGTGACAACATAGGAGACTCTCCATATGAAGAACATAGTGGTACTTTGA
AGCACTAGTGTCTAGCATGCCCCTTTTTTCTTTTTCTATGTTTTCTTTTTTTCCTTTTTTCTCTCTCCCATTTTCCG
GAGTCCCACCCTGACATGTGGGGCAATCAAGCTTAATCACTAGTGAATTCGCGGCCG
C1-3 (460 bp)
AATTCCATTAACCTGGATGGCATCCACTGGACTGTGTTTGAATTATTTTGCTTTACCCGTGGGCACACATTTG
TCTGCAATTCTCTGTATGTGCTTACTTCAGGCTTTCTCACAACTCATCCCGACATGAGCCTCATATATACGTGG
GGGCATCAGGCTTCTGAGGCCGAGGATGCTTAAACACATACCTGCAACAATAGTATCATGTCGCCGCATTA
GTTTTATGTTAATTTCGTGGGTTTTACTTAGATTTCTTGCTCTCAAGAAACTAAAAGTAGACCTTTCACTAGTT
GGTGGATCCCAGTGAACACCGTCGTATGGAGCTCCAAATTTAGAGGCATCAGCAATTGCATAACGAATCCA
TGCAGGAATCCGATCAACCCATACTCCATCTTCATGGTGAAATCGAAATTTAACCCTTGGAATTATGGGGGA
TGGCAGGTTTCCCGTTGACTTGGG
C1-4 (504 bp)
TAAGCTTGATTGCCTAAAACGGAAGACTCAAGATATGGGTGATTTAATAGATGTTCTGACGAGGTATGTTG
AGTTAGACGGCATAAAGGTTCCTGGCTCAGACACGGTTAAGGTAGCAAGAACAATCAACAAGGTGGAAAC
CATGAAGGTAAAAATAACAAACAGAGCAGCCTTAGGGAGAGTTATAATTTGTGGCTAATACGAATACTAGG
TTCAAGAACCAGCGCTGCTCTAGAGGAGCTTACAATGGTAATAAGTCGCACAATTATGAGGAAGCACTCAA
GGTGCCTTGCCGAAAGCATAGTACCTAAAACAATTCATCTACTCACTCATGGGAGAAGTGTTATATTATGCA
CGAGTTAATAGTGGAGGATATACGAGTCAGTATGGTTAAACTGATTCACAAGGCGGCTCGTGTGGCGGATT
CTCGGGATCAATTTCCAATGAACCAGACGGCTAGTGATCGGATTTTCAGCACCAATGAAACACTCGCAATGG
GAAGC
C1-5 (370 bp)
GCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATT
AAGCTTGATTGCCGAAGGAATCTACAAATATTGTGGAGGAATCCCTTATAGAATGGGAAGTGACTACATTA
AAAAGGGATATAGCCCGAAATAAAAAGATTAGTGCGCTTCGCCTTGAATAACATGATAAGGGGCTAGTTCC
TGATTATAATGCAATAAGAGATAGTTTGCAAGAAGATGAATCTTTGCCAATTGATAGAATTGGCGAGCAAA
ATATGGTTCTACAATAATGCATATGCCTTCACCTAGTACAGCATCATACTGTACACCCCTTACACAATTGCAA
Figure 4. Results of clones sequencing.
Radwan et al.
C1-7 7 (511 bp)
GATT
GATTGCCCTTCGGGTCCAAGTGAAATTTTACCTCAGCAGAACTTAGTTCCTGTAAATGATCTTGACAG
CTTAGCCCTGAAAATGAATGACGTCATGCAAGACGCCAGCAAATACTACGTTGCCTTTGATGAAAAG
TTTTTACCTCATAATATGGCAGCGCAATATTTAGACTACTTTAATATTCAGATCGATAATCAAAAATAA
TCCACTATATTTTTTGTATTTTGCCTTCGGCAATCAAGCTTAAGCTTGATTGCCCTTCGGGTCCAAGT
GAAATTTTACCACAGCAAAATTTAGTTCCTGTAAATGATCTTGACAGCTTAGCCCTGAAAATGAGTGA
CGTCATGCAAGACGCCAGCAAATACTACGTTACCTTTGATGAAAAGTTTTTACCTCATAATATCGCAG
CGCAATATTTAGACTACTTTAATATTCAGATCGATAATCAAAAATAATCCACTATATTTTTTGTATTTTG
CCTTCGGCAATCAAGCTTAAATC
C2-2 9 (621 bp)
AAGCTTCGACTGTCCACTCGAAAGTATCTAATTTCTTCATGAGTCGGTACAGAGGAAGTGCTTTCTC
GCCGAGTCGACTGATGAACCTGCTGAAAGCCTCTAGGCAACCTGTGAGACGATGAACATCGTGGAT
TCTGACCGGCCTCTCCATCGGACGATGGTCCCGATCTTTTCGGGGTTGACATCGATCCCTCGTTCAT
AAACGAAGAAACCGAGTAACTTCCCGCTGGGAACACCGAATGAACATTTGGTGGTGTTAAGCTTGAT
ATCGTCCCTATGAAGGTTGGCAAACTTTTCTGCCAAGTCAGTCAGCAGGTCGGAACCTTTGCGTGAC
TTGACTACGATATCATCCATATACGCCTCCACATTCCGGCCGATCTGGTCGAGGAGACATTTTTGGA
TCATGCGCATAAAGGTAGCTCCTGCATTCTTCATACCGAATGGCATAGTGATGTAGCAGAAGCACCC
GAATGGGGTGATGAAGGCTGTTTTTAATTCATCGGGGCCATACAGACGGATCTGATGATAGCCCGA
ATAGGCATCTAGAAATGACAGACGCTCGCAACCCACAGTCGAAGCTTAATCACTAGTGAATTCGCGG
CCGCCTGCAGGTCGACCAT
C2-3 (637 bp)
GACGAGTGCATGCTCGGCGCATGCGGCGCGGGATTCGATTAGCTTTCGACTGTTTTTTATAGATTCC
AGGATCAGCCAATAGTATCAGCCAGCTGGCGTTCTGTCAAATTTGGCGAACTGATGCTCACATAAGT
CAGTAACTTTTTAGCTATTTCTTTTAAGTCTGTAGCCGTCATTTTATTACTACGCGTAAAGGAAACAAC
CTGCTTTAACGTATTTTCTACCAAAGGTTTTCCACTAGCATCATAAATTTCCCCACGAGCAGAACTGG
TTGTGACCTTGGTCTGACTAGCTGAGGCTAGCTTTTTTTCGTAAAAATCCTTGTTCAAAACCTGCATA
TACAACAAACGACCAATAATGGTCATAAAGAGCAAAATGACGATTGAAAACAATAAATTAAGCCGAAT
CGGAATCGAATGGCTGTTAAATTTTCTCATACAAATCAGTCTCATTTCTAATTAAAATCTTACTCTTAA
TTGTACCACAATTTGAGCAGAAAATTATGGAAAAGTAAGAAGCTTTTTTCGTTTTTACAGTAAGATAC
GTTTTTATTTATTCATCCCTATATTATATGTTATAATGAATGTAAAAGTTCAATAATCTAGTCTTTTTCC
AACACGACTCACAGTCGAAGCTT
C2-4 (411 bp)
GACGAGTCGCTGCTCCGGCGCCATGGCGGCCGCGGGATTCGATTAGCTTCGACTGTAGCAGATAA
AGACTTTTTAAAAAGGAAAGAAGAAAATGACTAAACGCGCACTAATTAGTGTTTCAGACAAAGCGGG
CATTGTTGAATTTGCCCAAGACTCAAAAAACTCGGTTGGGACATCATCTCGACAGGTGGGACTAAAG
TTGCCCTTGACAATGCTGGGGTAGATACCATTGCTATCGACGATGTGACTGGTTTCCCAGAAATGAT
GGATCTCGTGTGAAGACCCTACACCCGAAGATCTACTGTGGCCTTCCTAATTTTTGTCGTATTTTACT
CCTACTCTTGCCACTCCGAATATTAAATCAAATTTAAACCTATAAAAGACTATCCACCCACATCTTCCA
CACATAA
C2-5 (684bp)
AAGCTTCGACTGTATATTGATGTTACTTAGGAGGTTATAGTATATGAGTACGCTCTCCAACTGTATCT
CATTTTTGGAAACATTCTCATCATCTCCTGCTCCAACGCACATTTTAGAAGTAAGAATTCCCCTCGTC
TCGCACGGACATGGTTTTCTCATTCATACCGCCGCATGAATGTTCCTCACACGACAAACACACCAGA
ACACTAGCACTCATGCCGAACTACTATGCCCCCCCAAGCAAGAAAGTGCTCCACATGAACCAACGC
TATCGATACTTCTCTCTAATTTTGTCCTCCGCGCGCAGGTTAACTTTGATACCCGCTGTAGATGATGT
CCCTTTTTCACCGGATCCTAGACATGCTGAAGGCGAAAGGACATTACTTTAATGCCTGTGTGTTGGC
CGATACCATTGAGGATTTCTGACCACCTCCTTCAGATTTCGCCAGATAAATTGATCTGCGACGAAGC
CTTCACCGTGTAATCCCGTAAGGCATCCTCGAATACTGATAGTGCATTAACTGTATTGTGCTTTTTGT
TCTTTCTCACACATCTTCCTGCAAGCATCCAGCAAAAAGGATCTCAAAATCTGACCAACTTCTGAGAA
TATCTGTTATTCCCTAACCCCAGAACACCGATCGATAAATCCCTTCTGAATAACCACAGTCTACAACT
CCCTCGGAG
Figure 4. Contd.
801
802
Afr. J. Biotechnol.
C2-6 (901bp)
GCGATGCATCTAGATTAGCTTCGACTGTGGAGAAGTTGAAAATATTTCCTAAATAATTAAATTGAGTTAAGGACCTA
TTGAGAAAAATTCTAAAGAAGTGTAGTTCGGAGTTCGTTATAAATTGATATTTAAGAGTGTTGCGACGAGTACCCGA
TGCTTGATTGGGTTGATTGATCTGTGTAAATGGTGAATTAATGATGTTGCATTATGATATTGTTGTATGATGATGATA
ATTATTGTTGTTTTTATTAACAGTCGAAGCTTAATCGGATCCCGGGCCCGTCGACTGCAGAGGCCTGCATGCAAGCT
TTCCCTATAGTGAGTCGTATTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCA
CAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATT
AATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCG
CGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTG
CGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAAC
ATGTGAGCAAAAGGCCAGCAAAAGGTCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCC
CCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGG
CGTTTCCCCCTGGAAGCTCCCTTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCG
C2-8 ( 862 bp)
AATTCGATTAAGCTTCGACTGTGCATAGTAATCCGACTAAGTTGAGACTTGGTATTGCGCCAAAGCACTCGGCTGAT
GACCATGAAGCAAGCACTAGCGAGGCAAAGCCACGAGACCCTAAATACACTCGGCCATGGTGGTGTCCTCCAGGG
CTAACAAAGACACAAAAGAGGAAATTACAAAGGTTGAGGAATCAAGAGATGGCAGAACGGGAGGCCGAGAAACA
AAGGGATAAATTATTCAATGACACTCGGCCCATGATACCTACAAAACAAGTGTGGAAGCCTAAACAAGTACAAAAT
GCAGCGGCTTCTACATCTATTACAGCAACACTTGCATCATCAAAATAGGATGATGTAGTTATGACACTTTTTCCATCG
CCTATTGCTTCCTATTCACTTGAACATATTTCAGATTCCATGGACACACCCAAGGAGGAAGATGATATTTTATATTAT
GAGCTTACACCAGTTCATGAAGGTATGGATATCAATATGGTGTATTATTTACCCGCTGAATTTCTTGCTCTAGATGAA
GAAGGGGAGGTGGCTCAGCTAGATTTTGGCCCTAAAAATGCAATATTCGAGAAGCCAGAAGAACTGGTGACACAC
TTGAAACCGTTGTATCTAAGAGGTCACATTAATGGATCACCACTTACTTGGATGCTTGTTGACGGTGGTGTTGTGGT
GAATCTTATGCCCTATTCGGTCTTCATGAAGTGGTCTTGCCCGACAATAAATTGATAAAGATCAATATGGTACTTAAT
GGATTTGAAGGCCATGAGAAAATTGCAACCAAAGGTGTTATGTATGTGGAACTTTACAGTCGAAGCTTATCTCAGT
GATTCGCGGCCGCTGCAGCC
C2-9 (659 bp)
AAGCTCGACTGTCAACGTTGCTGACTATTGATTGTAGCCGCGAGTCCAGAAAAGGGGTGCTTTCTGTTCCGGCCATT
CTTCTCATCTCCAGCGCTAACCCTGATTATGTTGGATGGGCGATGTCGACACTTGCTAGGACCTGGGTGACTCATTCC
TATCGACGCATGATGGTAACATTCTCGCCAAATAAATTAAACCTCTAGCGCTCATTCTCAAATTTGATGCCCGTTGAT
GGAGGAAAGTGAAGCCCTTGAACCAATGCACTCAAAATTCCATATTCGGATGGTTGTCCGCATCGTTTTCCACTAGG
ATACTCGACTGCTTATCATGTCCGATGATCATCAGAACTTGCCAGATACAGCAGGCCCATGGATACAAGGCTTAATC
ACTTTAAGTTCTCAGTTTAATCTTCTTGGGATCTTTCACCTCCCTCAGACTCCTAAATAATCTATAAGCTATTGGCTTTC
AATTGAGTGAGTTTTAGGATGAATATTCTGATGATCTGACTCAATTCTTTTCCGGCATCAAGCAAATCTGATGGTTCT
CATGCATCTAGAACTTCCTCCTCTCTAAAGATGGCCATCTTTGTAACAATACCCTAGACCTCCGTAACCTCAGAAATCT
GATTGATTATTCATTTTCTAAATCAAAAGCTTTAC
Figure 4. Contd.
results.
Starch metabolism
The first fragment to be discussed is C1-3 (460 bp) which
has down and up regulation pattern. The expression
pattern decreased after 3 h drought treatment then
increased after 10 h treatment. Blastn sequence analysis
revealed significant similarities between C1-3 isolated
fragment and starch branching enzyme I (sbeI)
Genebank Accession No. AY304541 isolated from H.
Radwan et al.
803
C3-1 (720 bp)
GATGTCAGCGACCTCGAATCAGCTTCAACTAGGTACTCTTTCAAGTAGTACTATTTAGAATCCAAAGAATGACAATCAATATT
TTTCCATCACCACTCAAAATAGTAAGGACACCATTGATAATCTCATGGTTGTAGTTGATCAAGCTAGGAATGATGTCATTGAT
ATAAATAAGGCACCTGAAGAGGAATCTAAAAAGTTGGTGACTAGTGGGGAGTCATTACTACAATCGACAGGTGTTTATAAA
ATTGTTGAGAAGGATAAAAAGAAGAGAAAATAGTTGAGCCCGTGTTAAAGACCATTCCATAACCTACCCCTCATTTTCCTTAA
AGATTGAAGAAGAAATAAGACAATAGGAAGTATCAGAAGTTTTTGTGGATATTGAAAAAAATTCTGTTAATATTTCTTTTATC
AAAACATTTATGCAGATTCCTAGATACGCTATGTTCATGAAGGATTTTGTTACTAGAAAGCGGATGGTGAGTTCTTAGATAAC
TAATAATGTTCATCATTGTAGTGACATCATATTTTGATCATTGGTTGAGAAGAAGGAGGAATCTAGAGCATTTACTATTCTTT
GTACTATCGGGTCCTTCCGCTTCTCTCGAGCTTTATGTAAATTGGGATAAGCTATAAATTTGATGTTGTTGGTAGTGTACAAG
TAGCTGGGGTTGGTGGCACCCAAACCTACCTCTATGAGGTTATTGATGGCTGACCAAA
C3- 2 (813 bp)
AAGATTGACAGGAAAGCAATGTCGGATCAACAAAAGCGTGACTTCAAAAATCACCACAAGGCCAGAACCATTCTTCTCAGC
GCCATCTCTTACGCTGAATACGAAAAGATATCTAACAGAGACACATCAAAGAACATGTTTGACTCACTCAGAATGACGCATG
AAGGAAACATTCAGGTCAAAGAAACTAAAGCTCTTGCGCTCATTCAGAAGTATGAGGCATTCAAAATGGAAGAAAGTGAAT
CCATTGAAACAATGTTCTCAAGATTCCAAATTCTGGTGGCTGGTCTCAAGGTTCTGGACAAAGGATACTCTACTGCTGATCAT
GTCAAGAAGATCATCAGAATCTTGCCAAAACAGTGGAGGCCAATGGTTACAGCGCTGAAGCTAGCTAAAGATCTCAACAAA
ATTTCTCTGGAGGAACTTATCAGCTCCCTCAGAAGTCACGAGATAGAGCTAGAAGCTGATGAACCTCAAAAGCAAGGTAAG
CCTTTAGCATTAAAATATAACAGAAGATCTGACTCTAAAGTTTTGCAGGCAGTTAAAGAAACATCTGATGGGTCCTCATCAGA
AGAAGATGAACTTTCCCTCCTCTCCAGAAGAGTGAACCAACTATGGAAGAAGAGGCAAAGGAAGTTCAGGAATCCCAGAAG
ATCTGATCAGAATGAGTCCTCTTCCAGATACAGAAAGCCAGACTCCTCCTCTGGATACAGAAGATCTGAAGGCTCTTCAGGA
AGCAGAAAGTCAAACACCAAAGACATCACGTGCTATGAATGCAACGAGCAAGGACATTATAAGAGTGACTGACCAAAG
C3- 3 (496 bp)
GCCGCACCATCGTGTCACTGACTCACAGGTACCGCTAGAGCTTTTGGGATGTATTCAAGGTCATGCAAGGCGACCTTGTGAT
CACCTGGGCTGATTTCAAGGAAGGATTCCGCACGTCCCACATTCAATCAAGAGTCGTGGCTATCAAGAAGTGGGAATTTTTG
AGAGTTGAAGCAAGGAAGTGTATATGTAAACGAGTACATGCAAAAGTTCAACCTCCTGTTGAGATATTCCCCTAAAGATGAC
ACCACTAAGGCTGCCAATATAGAACTCTTCATGGAAGGACTCTCGCAGTCCCTAGAGTATCAACTCGTTGTTTGCGATTTCCA
CACCTTCTTCCACCTGGTGAACCAGTCCCTTATGTCGAACACAAGCATCGTGCCATGGAAGATACTCGCAAGAGCAAGATGA
TCAGCAAGGCTAGTTCCAGCAACCAAAAGCCTTGCCCCTGGCAGCTATCTCCCGTCAAGCCAACCTATCAGCCTGACCAAAG
CTT
C3- 8 (264 bp)
AAGCTTTGGTCAGGTCCATGATTTCCTAGCAATCCATGGCACCATTGTTTAGTGAAATTCTGGCTGTATATACTCAATGTCAC
GTTCAATGTTATGACACCGTATCTGACTTTCTATAAGACAGTAAATATAAAAACAGTACAGAACACAGTCAATTGTTTACCCA
GCTCAGTGTACAACATCACCTACTCTGGGGGCTACCAAGCCAGGGAGGAAATCCACTATAAGAGACGTTATTTCAGGAATAA
GTCAAACAGTTGATCT
Figure 4. Contd.
vulgare (Table 3). Also, blastx analysis of the same
fragment using GeneBank databases revealed high
similarities between it and the starch branching gene sebl
isolated from H. vulgare Genebank Accession No.
AAP72268. The results of sequence analysis using blastx
and conserved blast alignments (Marchler-Baue et al.,
2013) analysis tools revealed that C1-3 fragment has
conserved regions with alpha amylase catalytic domain
found in bacterial and eukaryotic branching enzymes
(BEs) and 1,4 alpha glucan branching enzyme. This gene
is responsible for introducing alpha-1,6 branch points to
form amylopectin.
Starch branching enzymes (SBEs) have been found in
different plant developing stages in the barley storage
tissues (Sun et al., 1998). During different stages of
development, the plants need starch branching activities.
SBEs found in many isoforms, they can be classified into
two major groups based on catalytic and structural
properties, the first group is SBE family II or A and the
other group, is SBE family I or B. SBEI was up-regulated
under salt treatment in rice while SBEIII was downregulated on the other hand, the contents of glucose and
fructose increased (Theerawita et al., 2012). When barley
plant was subjected to drought, many genes involved in
carbohydrates metabolism were down regulated
(Abebe et al., 2010). Normally, starch synthesis is
inhibited under water deficit condition (Mahajan and
Tuteja, 2005) but alpha- amylase is found to be up
regulated in treated Vitis vinifera plants under cold stress
(Xin et al., 2013). The current results show that the SBEI
804
Afr. J. Biotechnol.
Table 3. Genebank Homology results for some differential display fragments.
Fragment
name
Fragment
length (bp)
Clone 1 C1-1
486
C1-2
613
C1-3
C1-4
Blast N
Homology results
Accession number
No significant similarity
Blast X
E-value, Identity
Homology results Accession
number
E-value, Identity
-
No significant similarity
-
Triticum aestivum gene for
TaAP2-B, complete cds Access.
no AB749309
8e-66
-202/237 (85%)
No significant similarity
-
460
Hordeum vulgare starch branching
enzyme I (sbeI) mRNA, partial
cds; nuclear gene for plastid
product Access. no AY304541
2e-79
-177/181(98%)
starch branching enzyme I
[Hordeum vulgare] Access. no
AAP72268
It showed conserved region
504
No significant similarity
C1-5
370
Triticum aestivum 3B
chromosome, clone BAC
TA3B63N2
Access. no AM932689
C1-6
570
No significant similarity
C1-7
511
C2-1
Short
sequence
C2-2
C2-3
621
637
2e-27
-69/143(48%)
-
No significant similarity
-
5e-78
-230/269 (86%)
No significant similarity
-
-
Glycosyl transferase family 1
(Enhyrobacter aerosaccus)
Access. no WP_007116863
-2e-13
- 34/59 (58%)
No significant similarity
-
Glycosyl transferase family 1
(Enhyrobacter aerosaccus)
Access. no WP_007116863
It showed conserved region
6e-14
-34/62 (55%)
- No significant similarity
-
- No Significant similarity
- Hordeum vulgare vrs1 locus,
complete sequence; and Hox1
gene, complete cds Access. no
EF067844
- Hordeum vulgare DNA, downstream region of HvNAS1 gene
Access. no AB023436
- No significant similarity
- 0.0
-539/576(94%)
-0.0
-532/576(92%)
-
Retrotransposon protein, putative,
Ty3-gypsy subclass [Oryza sativa
Japonica Group] Access. no
ABA93610
It showed conserved region
- No significant similarity
-
4e-80
-120/192(63%)
-
Radwan et al.
805
Table 3. Contd.
Fragment name
Fragment
length (bp)
C2-4
411
Blast N
Homology results Accession
number
Streptococcus parasanguinis
ATCC 15912, complete genome
CP002843.1
Blast X
E-value and
identity
2e-96
-245/270 (91%)
Homology results Accession number
E-value and identity
-IMP cyclohydrolase
[Streptococcus infantis]
Access. no WP_006154970
- IMP
Cyclohydrolase/Phosphoribosylaminoimidazole
carboxamide formyltransferase [Streptococcus
sp. HSISS2] Access. no WP_021144787
It showed conserved region
-1e-28
-57/57 (100%)
4e-28
56/57 (98%)
C2-5
684
No significant similarity
-
No significant similarity
C2-6
901
No significant similarity
-
Hypothetical protein, partial
[SAR86 cluster bacterium SAR86C] Access. no
WP_010157945
9e-45
-79/80 (99%)
Retrotransposon protein, putative, unclassified
[Oryza sativa Japonica Group]
Access. no ABA96795
4e-40
-89/197 (45%)
C2-8
862
C2-9
G5-5
G5-7
G5-8
G5-9
659
C3-1
No sequence
No sequence
No sequence
720
Hordeum vulgare subsp. vulgare
Rpg4 gene, complete sequence;
RGA1 (RGA1) gene, complete
cds; Rpg5 gene, complete
sequence; PP2C (PP2C) gene,
complete cds; and ADF3 gene,
complete sequence
Access. no EU812563
No significant similarity
No significant similarity
Solanum lycopersicum strain
Heinz 1706 chromosome 10
clone hba-26b13 map 10
Accession no AC244352
0.0
-696/819(85%)
-
- 1e-06
-170/253(67%)
No significant similarity
No significant similarity
Hypothetical protein with similarity to putative
retroelement [Oryza sativa Japonica Group]
Accession no AC113339_5
-
-
2e-15
-42/112 (38%)
806
Afr. J. Biotechnol.
Table 3. Contd.
Fragment name
C3-2
C3-3
C3-8
Fragment
length (bp)
Blast N
Homology results
Accession number
Blast X
E-value and identity
Homology results accession number
E-value and identity
813bp
Lotus japonicus genomic
DNA, chromosome 1, clone:
LjT26E16, TM0103,
Access. no AP0096
-2e-62
-323/441(73%)
-TNP1 [Medicago truncatula] 5e- Access. no
XP_003590350
-Serine/threonine protein kinase SRPK1
[Medicago truncatula] Accession no
XP_003629120.
It showed conserved region
-Integrase, catalytic region; Zinc finger, CCHCtype; Peptidase aspartic, catalytic [Medicago
truncatula] Accession no ABD32582
496 bp
-Triticum aestivum
chromosome 3B-specific BAC
library, contig ctg1030b
Access. no FN564435
1e-63
-338/461(73%)
retrotransposon protein, putative, Ty3-gypsy
sub-class [Oryza sativa Japonica Group]
Access. no AAX95143
3e-13
-29/71 (41%)
264
-Glycine max strain Williams
82 clone GM_WBb0083G02,
complete sequence Access.
no AC235334
-Glycine max NB-LRR type
disease resistance protein
Rps1-k-1 (Rps1-k-1) and NBLRR type disease resistance
protein Rps1-k-2 (Rps1-k-2)
genes, complete cds Access.
no EU450800
hypothetical protein MTR_1g045380
[Medicago truncatula]
Access. no XP_003590165
-1.3
18/25 (72%)
expression was affected by drought.
Glycosyl transferase gene family 1 (cell wall
metabolism)
The results of blast x analysis have revealed that
the two fragments, C1-6 and C1-7 have significant
similarities with glycosyl transferase gene family 1
isolated from Enhyrobacter aerosaccus Genebank
4e-20
101/125(81%)
2e-18
100/125(80%)
Accession No. WP_007116863 with E-value 12e13 and 6e-14, respectively. The results of blastx
and conserved blast alignments revealed that C16 and C1-7 fragments have conserved regions
with glycosyl transferase GTF domain (MarchlerBaue et al., 2013). Their expression was found to
be up regulated in the differential expression
experiment. The glycosyl transferase enzymes
(GTFs) (EC2.4) are enzymes that catalyze the
glycosyl (sugar) residues transfer during biosyn-
-1e-37
-71/134 (53%)
-2e-35
-70/134 (52%)
thesis and degradation of glycolipids, glycoproteins and polysaccharides to the acceptor which
regulate the acceptors properties such as
solubility, activity and transport within the cells.
The glycosyltransferase have been classified into
more than 90 gene families according to catalytic
specificity, sequence similarities and consensus
sequences. UDP glycosyltransferase gene was
found to be up-regulated transcripts in cold
treated V. vinifera plants (Xin et al., 2013).
Radwan et al.
Glycosyl transferase family 1 and 2 have been isolated
from drought treated Gossypium herbaceum roots
(Ranjan et al., 2012).
Transposons elements
The results of the differential display experiments
revealed that the DD- fragment C2-2 (621 bp) showed
down regulation after 3 and 10 h treatment. In blastx, the
isolated fragment gave significant similarities with
retrotransposon protein, putative, Ty3-gypsy subclass
(Oryza sativa Japonica Group, Genebank Accession No.
ABA93610.) It showed conserved region with
RT_superfamily including putative active site, putative
nucleic binding site, putative NTP binding site and
RT_LTR retrotransposon protein (Marchler-Baue et al.,
2013). On the other hand, the results of blastn analysis
showed similarities between the isolated fragment and H.
vulgare vrs1 locus, complete sequence and Hox1 gene.
Retrotransposon elements were found to be down
regulated in chickpea under drought stress (Deokr et al.,
2011). The results of the differential display experiments
revealed that the C3-3 fragment (496 bp) was up and
down regulated under the treatment condition where, it
has expression pattern up in 3 h and down in 10 h under
drought treatment. The results of Blastx analysis revealed
that the isolated fragment has significant similarities with
retrotransposon protein, putative, Ty3-gypsy sub-class
(O. sativa Japonica Group) but with different Genebank
Accession number AAX95143, while, it gave similarities
in blastn analysis with H. vulgar BAC 631P8 Genebank
Accession No. DQ249273 DD- fragment C2-8 (862 bp)
that has up and down regulation pattern and gave
similarities with retrotansposon protein putative,
unclassified (O. sativa Japonica Group, Genebank
Accession No. ABA96795 in blastx analysis while, in
blastn analysis, it has a significant analysis with H.
vulgare subsp. vulgare Rpg4; RGA1 gene; Rpg5 gene;
PP2C gene; and ADF3 gene, Genebank Accession No.
EU812563. However, DD- fragment C3-1 (720 bp) that
was up-regulated in the differential expression
experiment showed significant similarities in blastx with
hypothetical protein with similarity to putative
retroelement (O. sativa Japonica Group) but with different
Genebank Accession No.AAM08859 and AC113339.
Using blastn analysis, DD- fragment C3-1 showed
similarities with Solanum lycopersicum strain Heinz 1706
chromosome 10 clone hba-26b13 map 10, Genebank
Accession No. AC244352
Grandbastien (1998) showed that the retrotransposons
activation by external change and stresses is common in
eukaryotes, including plants. He suggested that several
well-characterized plant retrotransposons transcriptional
activation seemed to be linked tightly to active molecular
pathways by stress which is under the cis regulatory
sequences activation. The retrotransposons could play a
807
role in their regulatory features modification. Different
biotic and abiotic stresses activated most transposable
elements in plant (Le et al., 2007) such as BARE-1
increased under drought in barley and then decreased
(Kalendar et al., 2000), which showed the transposons
activation played as stress adaptation. Wang et al. (2011)
have isolated four retrotransponson elements from rice
subjected to drought. Eissa el al. (2007 have isolated
BARE-2 and partial BAGY-2 retrotransposons elements
from wild barley (H. spontaneum L.) under salinity, it was
down regulated.
Tomita et al. (2011) have suggested that BARE-1
element in Hordeum was the active at the recent time
while the transposable elements majority of high-copy
seemed to be inactive which might be interesting to
perceive the adaptive evolution processes of plant. Polok
and Zielinski (2011) have confirmed the transposons role
in speciation in barley and many mobile transposons in
the past are became stable at present.
IMP
cyclohydrolase
Nucleotide
(synthesis of nitrogenous compounds)
metabolism
DD-fragment C2-4 (411 bp) showed up-regulation in 3 h
treatment and then down regulation in 10 h. This
fragment has similarities with IMP cyclohydrolase
(Streptococcus infantis) Genebank Accession No.
WP_006154970
IMP
cyclohydrolase/
Phosphoribosylaminoimidazolecarboxamide
formyltransferase (Streptococcus sp. HSISS2] Genebank
Accession No. WP_021144787 while, blastn analysis
revealed similarities with Streptococcus parasanguinis
ATCC 15912, Genebank Accession No. CP002843.
According to Marchler-Baue et al. (2013) analysis
method, It has conserved regions for IMPCH[cd01421],
Inosine
monophosphate
cyclohydrolase
domain,
PurH[COG0138],
AICAR
transformylase/IMP
cyclohydrolase PurH (only IMP cyclohydrolase domain in
Aful),
purH
[TIGR00355],
phosphoribosylaminoimidazolecarboxamide
formyltransferase/IMP
cyclohydrolase;
PurH\
is
bifunctional: IMP cyclohydrolase (EC 3.5.4.10) and
purH[PRK00881],
bifunctional
phosphoribosylaminoimidazolecarboxamide
formyltransferase/IMP cyclohydrolase. The enzyme
aminoimidazole
carboxamide
ribonucleotide
transformylase/inosine monophosphate cyclohydrolase
(purHJ) (ATIC) encodes a bifunctional protein that
catalyzes the last two steps of the de novo purine
biosynthetic pathway. The biosynthetic pathway of purine
has been considered as an important target for antiviral,
anticancer and antimicrobial drug development because
of the purine nucleotides critical role in the synthesis of
RNA and DNA (Zhang et al., 2008).
Abou Ali et al. (2010) isolated 2 DD- fragments from
shoots of V. villosa wild plant treated with abscisic acid
808
Afr. J. Biotechnol.
which showed similarities with ATP binding/ kinase/ uracil
phosphoribosyltransferase-uridine kinase (Arabidopsis
thaliana) and IMP dehydrogenase/GMP reductase
(Medicago truncatula), respectively. IMP dehydrogenase
catalyzes the rate-limiting step in de novo biosynthesis of
guanine nucleotides and has an essential role in
providing necessary precursors for DNA and RNA
synthesis.
IMP
cyclohydrolase/phosphoribosylaminoimidazolecarboxami
de formyltransferase is one of the housekeeping
enzymes involved in nucleotide metabolism. In the past, it
was thought that the housekeeping genes are expressed
in all cells at a consistent level. But, it is proved that the
expression of these genes is very dynamic to meet the
metabolic demands of plant cells. These changes can
have an effect on plant development, so there is now a
great concern about their expression. The housekeeping
genes have important activities in survival of plant under
stress (Moffatt and Ashihara, 2002). The identification
mechanisms by which plant cells monitor and respond to
their basic metabolic requirements rely on the integration
of transcript, protein and metabolite profiles of different
cell types (Fiehn et al., 2001). Unfortunately, the
housekeeping genes expression levels complicate their
analysis because small differences in activity (2 to 3
folds) may cause large metabolic impacts so they are
difficult to be reproducibly detected.
Fragments with chromosomes similarities
The differentially display fragment C1-2 (613 bp), has
down and up regulation expression pattern, showed
similarities in blastn with Triticum aestivum gene for
TaAP2-B, complete cds Genebank Accession No.
AB749309. While C1-5 fragment (370 bp), has up and
down regulation expression pattern, showed similarities
with T. aestivum 3B chromosome, clone BAC TA3B63N2
Genebank Accession No. AM932689. Both fragments
gave no significant similarities in blastx analysis.
gave similarities between the C3-8 isolated fragment and
Glycine max strain Williams 82 clone GM_WBb0083G02,
complete sequence Genebank Accession No. AC235334
Glycine max NB-LRR type disease resistance protein
Rps1-k-1 (Rps1-k-1) and NB-LRR type disease resistance protein Rps1-k-2 (Rps1-k-2) genes, complete cds
Genebank Accession No. EU450800. Fragments C3-2
(813 bp) expression pattern was up regulated. It gave
similarities with TNP1 (M. truncatula) Genebank
Accession No. XP_003590350, hypothetical protein
MTR_5g060670 (M. truncatula) Genebank Accession No.
XP_003614875, Serine/threonine protein kinase SRPK1
(M. truncatula) Genebank Accession No. XP_003629120,
integrase, catalytic region; Zinc finger, CCHC-type;
Peptidase aspartic, catalytic (M. truncatula), Genebank
Accession No. ABD32582. MTR_8g073400 included
several domains, zf-CCHC; zinc knuckle, rve; Integrase
core domain, gag_pre-integrs; GAG-pre-integrase
domain, UBN2; gag-polypeptide of LTR copia-type,
PKc_like; protein kinases, catalytic domain. All of these
genes are shared together with UBN2 [pfam14223], gagpolypeptide of LTR copia-type domain. Three Serine/
threonine protein kinases were isolated from treated V.
vinifera plants under cold stress and was found to be up
regulated (Xin et al., 2013). These kinds of kinases
regulate several biological processes in plant cells and
were found to be localized in the cell wall and also,
responded to the external environmental challenges
(Morris and Walker, 2003). In Arabidopsis, SNF1-type
serine/threonine protein kinase of wheat was found to
enhance tolerance to multi- stress (Mao et al., 2010).
According to Marchler-Baue et al. (2013), it showed a
conserved domain with UBN2 [pfam14223], gagpolypeptide of LTR copia-type. This family is found in
plants and fungi, and contains LTR-polyproteins. In blast
N, it gave similarities with Lotus japonicus genomic DNA,
chromosome 1; clone LjT26E16, TM0103, Genebank
Accession No. AP009652.
Fragments with no significant similarities
Unknown proteins
Fragment C2-6 (901 bp) showed up regulation in 3 h
treatment and then down regulation in 10 h treatment in
the differential display experiment. It was cloned and
sequenced. In the blastx sequence analysis, it gives
significant similarities with hypothetical protein, partial
sequence (SAR86 cluster bacterium SAR86C, Genebank
Accession No. WP_010157945 while it does not give any
significant similarities in blastn. C3-8 (264 bp)
differentially displayed fragment was up regulated after 3
h of drought treatment then down regulated after 10 h.
The blastx analysis showed similarities with hypothetical
protein MTR_1g045380 (Medicago truncatula, Genebank
Accession No. XP_003590165 while, the blastn analysis
Six DD fragments, C1-1 fragment (486 bp) with down and
up regulation; C1-4 fragment (504 bp) with down
regulation; C2-3 (637 bp) with up-regulation; C2-5 (684
bp) with up and down regulation; C2-9 fragment (659 bp)
with down and up regulation and G5-5 with up regulation,
gave no significant similarities neither in blast N nor blast
X.
Conclusion
When wild barley plants were subjected to drought, they
exhibit tolerance through some genes expression.
Several drought–related stress fragments have been
isolated and categorized into four categories according to
Radwan et al.
their expression: up; up and down: down and down and
up regulation. These fragments were found to be involved
in starch metabolism, cell wall metabolism, transposon
element and purine metabolism. These genes especially
starch metabolism genes help in the grain production.
Also, there are some isolated fragments that showed
similarities with drought-related stress genes; their
function are unpredictable. To determine the individual
regulated genes role in drought stress response, some
biotechnological technique like RNAi could be used to
silencing these genes and then evaluates the importance
of each one of these gene using molecular and
physiological techniques under drought stress. This study
in the laboratory cannot give a full picture about
understanding the crop response to drought and the
drought stress transcriptome alone but with some field
experiments combined with some physiological studies in
the future will be needed in future studies to provide a
clear picture in the molecular mechanisms which control
the drought stress adaptation. Numbers of important
genes were identified in this study, and it will be a good
start for doing more biotechnological studies. This study
will serve as source for discovery of new candidate genes
with different gene expression and can be used in further
work for manipulating drought tolerance crops. In the
future, the transformation of economic crops with some of
identified genes will increase stress tolerance to drought
and also some other abiotic stresses.
Conflict of interests
The authors have not declared any conflict of interests.
REFERENCES
Abebe T, Melmaiee K, Berg V, Wise RP (2010). Drought response in
the spikes of barley: gene expression in the lemma, palea, awn, and
seed. Funct. Integ. Geno. 10(2):191-205.
Abou Ali RMI, Shanab GML, Haider AS, Eissa HF, Salem AM (2010).
Characterization and expression of abscisic acid inducible gene (s) in
wild legumes. Egypt J. Genet. Cytol. 39(1):57-72.
Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ (1997). Gapped BLAST and PSI-BLAST: a new
generation of protein database search programs. Nucl. Acids Res.
25:3389-3402.
Amini R (2013). Drought stress tolerance of barley (Hordeum vulgare
L.) affected by priming with PEG. IJFAS J. 2(20):803-808
Ashraf M (2010). Inducing drought tolerance in plants: Recent
advances. Biotech. Adv. 28:169-183.
Callard D, Lescure B, Mazzolini L (1996). A method or the elimination of
false positives generated by mRNA differentially display technique.
Biotech. 16(6):1096-1103.
Cattivelli L, Ceccarelli S, Romagosa I, Stanca M (2011). Abiotic
stresses in barley: problems and solutions. pp 282-306. In: Ullrich SE
(ed) Barley: production, improvement, and uses, Wiley-Blackwell
Eissa HF, Saleh OM, Dyer WE (2007). Genomic characterization of
stress related genes from wild barley. Egypt J. Genet. Cytol. 36(1):123.
El-Shehawi AM, Elseehy MM, Hedgcoth C (2011). Isolation and
sequence analysis of wheat tissue-specific cdnas by differential
display. Plant Mol. Biol. Rep. 29(1):135-148.
809
Farooq M, Wahid A, Kobayashi N, Fujita D, Basra SMA (2009). Plant
Drought Stress: Effects, Mechanisms and Management. Agro. Sust.
Dev. 29(1):185-212
Fastnaught CE (2001). Barley fibre. In: Cho, S., Dreher, M. (Eds.).
Handbook of Dietary Fibre. Marcel Dekker, New York, pp. 519-542.
Fiehn O, Kloska S, Altmann T (2001). Integrated studies on plant
biology using multiparallel techniques. Curr. Opin. Biotech. 12:82-86.
Gao J, Xiao Q, Yin L, He G (2008). Isolation of cDNAs clones for genes
up-regulated in drought-treated Alternanthera philoxeroides root. Mol.
Biol. Rep. 35:485-488.
Grandbastien MA (1998). Activation of plant retrotransposons under
stress conditions. Trends Plant Sci. 3(5):181-187.
Iskandar HM, Casu RE, Fletcher AT, Schmidt S, Xu J, Maclean DJ,
Manners JM, Bonnett GD (2011). Identification of drought-response
genes and a study of their expression during sucrose accumulation
and water deficit in sugarcane culms. BMC Plant Biol. 11:12.
Kalendar R, Tanskanen J, Immonen S, Nevo E, Schulman A (2000).
Genome evolution of wild barley (Hordeum spontaneum) by BARE-1
retrotransposon dynamics in response to sharp microclimatic
divergence. Proc. Natl. Acad. Sci. USA, 97:6603-6607.
Le Q, Melayah D, Bonnivard E, Petit M, Grandbastien MA (2007).
Distribution dynamics of the Tnt1 retrotransposon in tobacco. Mol.
Genet. Genom. 278(6):639-651.
Liang P, Pardee AB (1992). Differential display of eukaryotic messenger
RNA by means of the polymerase chain reaction. Sci. 257: 967-971.
Mahajan S, Tuteja N (2005). Cold, salinity and drought stresses: an
overview. Arch. Biochem. Biophys. 444:139-158.
Malatrasi M, Corradi M, Svensson JT, Close TJ, Gulli M, Marmiroli N
(2006). A branched-chain amino acid aminotransferase gene
isolated fromHordeum vulgare is differentially regulated by
drought stress. Theo. Appl. Genet. 113(6):965-976.
Mao X, Zhang H, Tian S, Chang X, Jing R (2010). TaSnRK2.4, SNF1type serine/threonine protein kinase of wheat (Triticum aestivum L.),
confers enhanced multistress tolerance in Arabidopsis. J. Exp. Bot.
61:683-696.
Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK,
DeWeese-Scott C, Fong JH, Geer LY (2013). CDD: conserved
domains and protein three-dimensional structure. Nucl. Acids Res.
41(D1):D384-352.
Moffatt BA, Ashihara H (2002). Purine and Pyrimidine Nucleotide
Synthesis and Metabolism. In The Arabidopsis Book, Somerville CR,
Meyerowitz EM eds (Rockville, MD: American Society of Plant
Biologists).
Morris ER, Walker JC (2003). Receptor-like protein kinases: the keys to
response. Curr. Opin. Plant Biol. 6:339-342.
Polok K, Zielinski R (2011). Mutagenic treatment induces high
transposon variation in barley (Hordeum vulgare L.). Acta. Agric.
Slov. 97(3):179-188.
Ranjan A, Pandey N, Lakhwani D, Kumar DN, Pathre U, Sawant S
(2012). Comparative transcriptomic analysis of roots of contrasting
Gossypium herbaceum genotypes revealing adaptation to drought.
BMC Genom. 13:680.
Sambrook J, Fritsch EF, Maniatis T (1989). Molecular
cloning: A
laboratory manual, 2 nd ed. Cold Spring Harbor Laboratory, Cold
Spring Harbor, NY.
Sanger F, Nicklen S, Coulson AR (1977). Biochemistry DNA
sequencing
with chain-terminatinginhibitors (DNA polymerase/
nucleotide sequences/ bacteriophage 4X174). Proc. Nati. Acad. Sci.
USA. 74:5463-5467.
Smith A (2004). Oxford Encyclopedia of Food and Drink in America
(New York: Oxford University Press). pp. 77-85.
Stanca AM, Romagosa I, Takeda K, Lundborg T, Terzi V, Cattivelli L
(2003). Diversity in abiotic stresses. pp. 179-199. In von Bothmer R,
Knüpffer H, van Hintum T, Sato K (ed.) Diversity in barley (Hordeum
vulgare L.), Elsevier
Sun C, Sathish P, Ahlandsberg S, Jansson C (1998). The Two Genes
Encoding Starch-Branching Enzymes IIa and IIb Are Differentially
Expressed in Barley. Plant Physiol. 118:37-49.
Theerawita C, Boriboonkaset T, Chaum S, Supaibulwatana K,
Kirdmanee C (2012). Transcriptional regulations of the genes of
starch metabolism and physiological changes in response to salt
stress rice (Oryza sativa L.) seedlings. Physiol. Mol. Biol. Plants,
810
Afr. J. Biotechnol.
18(3):197-208.
Tiwari JK, Munshi AD, Kumar R, Pandey RN, Arora A, Bhat JS, Sureja
AK (2010). Effect of salt stress on cucumber: Na+/K+ ratio, osmolyte
concentration, phenols and chlorophyll content. Acta. Physiol. Plant
32:103-114
Tomita M, Okutani A, Beiles A, Nevo E (2011). Genomic, RNA, and
ecological divergences of the Revolvertransposon-like multi gene
family in Triticea. BMC Evol. Biol. 11:269.
Vaezi B, Bavei V, Shiran B (2010). Screening of barley genotypes for
drought tolerance byagro-physiological traits in field condition. Afr. J.
Agric. Res. 5(9):881-892
Wang WS, Pan YJ, Zhao XQ, Dwivedi D, Zhu LH, Ali J, Li ZK (2011).
Drought-induced site-specific DNA methylation and its association
with drought tolerance in rice (Oryza sativa L.). J. Exp. Bot.
62(6):1951-1960.
Waseem M, Ali A, Tahir M, Nadeem MA, Ayub M, Tanveer A, Ahmad R,
Hussain M (2011). Mechanism of drought tolerance in plant and its
management through different methods. Cont. J. Agric. Sci. 5(1):1025
Xin H, Zhu W, Wang L, Xiang Y, Fang L et al. (2013). Genome Wide
Transcriptional Profile Analysis of Vitis amurensis and Vitis vinifera in
Response to Cold Stress. PLoS ONE 8(3): e58740.
Zhang Y, Morar M, Ealick SE (2008). Structural Biology of the Purine
Biosynthetic Pathway. Cell Mol Life Sci. 65(23):3699-3724.
Vol. 14(9), pp. 811-819, 4 March, 2015
DOI: 10.5897/AJB2014.14132
Article Number: 7EB252D50963
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Metabolic and biofungicidal properties of
maize rhizobacteria for growth promotion and
plant disease resistance
Pacôme A. Noumavo1, Nadège A. Agbodjato1, Emma W. Gachomo2,3, Hafiz A. Salami1, Farid
Baba-Moussa4, Adolphe Adjanohoun5, Simeon O. Kotchoni2,3 and Lamine Baba-Moussa1*
1
Laboratoire de Biologie et de Typage Moléculaire en Microbiologie, Département de Biochimie et de Biologie Cellulaire,
Faculté des Sciences et Techniques, Université d’Abomey-Calavi 05 BP 1604 Cotonou, Bénin.
2
Department of Biology, Rutgers University, 315 Penn St., Camden, NJ 08102, USA.
3
Center for Computational and Integrative Biology (CCIB), Rutgers University, 315 Penn St., Camden, NJ 08102, USA.
4
Laboratoire de Microbiologie et de Technologie Alimentaire, Faculté des Sciences et Techniques, Université d’AbomeyCalavi, Bénin.
5
Centre de Recherches Agricoles Sud, Institut National des Recherches Agricoles du Bénin, Attogon, BP 884 Cotonou,
Bénin.
Received 27 August, 2014; Accepted 19 February, 2015
Plant growth promoting rhizobacteria (PGPR) are known to influence plant growing both by direct
and/or indirect mechanisms. This study aimed to establish PGPR profile of 15 bacteria isolated from
maize (Zea mays L.) rhizosphere in Benin. These rhizobacteria were screened in vitro for the plant
growth promoting traits like production of indole acetic acid (IAA), ammonia (NH3), hydrogen cyanide
(HCN), catalase, exopolysaccharides and antifungal activity against phytopathogenic fungi for example
Fusarium verticillioides, that is an important maize pathogenic. Most rhizobacteria strains were found to
produce catalase (100%), exopolysaccharides (100%), ammonia (86.66%), hydrogen cyanide (80%) and
indole acetic acid (60%). Pseudomonas putida, Pseudomonas fluorescens and Azospirillum lipoferum
have highly produced many of the investigated metabolites. Streptomyces hygroscopicus,
Streptomyces fasciculatus, Pseudomonas aeruginosa, P. putida, P. fluorescens and A. lipoferum
inhibited mycelial growth of F. verticillioides and Aspergillus ochraceus. P. fluorescens and P.
aeruginosa were highly antagonistic against F. verticillioides (52.24% of mycelial growth inhibition) and
A. ochraceus (58.33% of mycelial growth inhibition). These results suggest the possibility to use these
rhizobacteria as biological fertilization to increase maize yield and the biological control of F.
verticillioides and A. ochraceus.
Key words: Rhizobacteria, Plant growth promoting rhizobacteria (PGPR), antifungal activities, biological
control, Benin.
INTRODUCTION
Agriculture is increasingly dependent on the use of
chemical fertilizers, growth regulators and pesticides to
increase yield. Continued use of such chemical causes
wide spread problems in environmental pollution, animal
812
Afr. J. Biotechnol.
and human health, destruction of natural biological
communities and modifies natural nutrient recycling
(Karuppiah and Rajaram, 2011). One of the solutions to
these problems is the use of bioresources to replace the
chemical products. To face this situation, the use of bioresources to replace these synthesis products is
increasingly considered. Among these bio-resources, the
use of Rhizobacteria attracts more and more scientists’
attention. The rhizosphere is the area around and under
the influence of plant roots and it is known to promote the
growth of different prokaryotic and eukaryotic microorganisms (Wahyudi et al., 2011; Cardon and Gage, 2006).
Rhizospheric microorganisms can have positive, negative
or neutral effects on plant growth and can be classified
into following categories bacteria, fungi, actinomycetes,
protozoa and algae among many others (Paul and Clark,
1996). Indeed, among these microorganisms, bacteria
are the most studied and well known probably because
they grow quickly and they have the ability to use a wide
range of substances as carbon or nitrogen sources
(Karuppiah and Rajaram, 2011). Some of the bacteria
found in the rhizosphere include plant growth promoting
rhizobacteria (PGPR). The term PGPR comprises of
many bacterial species belonging to Pseudomonas,
Azospirillum, Azotobacter, Klebsiella, Enterobacter,
Alcaligenes, Arthrobacter, Burkholderia, Bacillus and
Serratia genus (Saharan and Nehra, 2011) and which
improve plant growth.
The mechanisms used by PGPR to promote plant
growth are not fully understood. PGPR rhizobacteria use
one or more direct or indirect mechanisms to improve the
growth and health plants. The direct promotion by PGPR
entails either providing the plant with a plant growth
promoting substances that are synthesized by the
bacterium or facilitating the uptake of certain plant
nutrients from the environment. The indirect promotion of
plant growth occurs when PGPR lessen or prevent the
deleterious effect of one or more phytopathogenic microorganisms. These mechanisms can be triggered
simultaneously or individually at different stages of the
plant development (Ahmad et al., 2008). Several direct
mechanisms such as atmospheric nitrogen (N2) fixation,
minerals (for example phosphate) solubilization, antagonism against phytopathogenic microorganisms by
production of siderophores, and the ability to produce or
change the concentration of the phytohormones (indole3-acetic acid, gibberellic acid, cytokinines and ethylene)
have been reported (Nelson, 2004). Examples of indirect
mechanisms include production of antibiotics, lytic
enzymes, hydrogen cyanide, catalase, siderophores and
competition for space and nutrients. These mechanisms
include those involved in the host plant, pathogens
andharmful microbes’ biological control (Khan et al.,
2006). Thus, the plant health may not be affected in
presence of pathogens microorganisms and favorable
conditions to cause the diseases, because PGPR destroy
the pathogen molecular signal or open plant induced
systemic resistance (ISR).
The present study aimed to establish the PGPR profile
of 15 rhizobacteria isolated from maize rhizosphere in
Benin, in order to select the best PGPR.
MATERIALS AND METHODS
Microorganisms
The bacteria strains (15) used, were Azospirillum lipoferum,
Pseudomonas putida, Pseudomonas aeruginosa, Pseudomonas
fluorescens, Streptomyces hygroscopicus, Streptomyces rimosus,
Streptomyces
fasciculatus,
Bacillus
coagulans,
Bacillus
thuringiensis, Bacillus pumilus, Bacillus polymixa, Bacillus
licheniformis, Bacillus lentus, Bacillus circulans and Bacillus firmus.
These bacteria were previously isolated from the maize rhizosphere
in Benin (West Africa), and were biochemically characterized by
standard methods of Cappuccino and Sherman (1992) and Aneja
(2003). The bacteria cultures were maintained on Muller Hinton
(MH) broth with 10% of glycerol at -20°C. At the onset of the
experiments all the strains were grown on their respective selective
medium: Pseudomonas on King’s B medium, Bacillus on Nutrient
agar, Azospirillum on NFb-medium and Streptomyces on Kusterglycérol medium.
Screening of rhizobacteria for different metabolites
Indole acetic acid production
The production of indole acetic acid (IAA) was detected by adapting
method described by Brick et al. (1991). Bacteria were grown in
nutrient broth supplemented with L-Tryptophan (500 µg/ml) at 36 ±
2°C for 48 h. Fully grown cultures were centrifuged at 3000 rpm for
30 min. Two (2) ml of the supernatant were mixed with 2 drops of
orthophosphoric acid and 4 ml of Salkowski reagent (50 ml of 35%
perchloric acid, 1 ml of 0.5 M ferric chloride solution). The
appearance of a pink color after 25 to 30 min, indicates IAA
production. According to the color intensity, three point scale (+ =
low intensity; ++ = Average intensity and +++ = high intensity) were
used for analyze the results.
Hydrogen cyanide production
All rhizobacteria were investigated for the production of hydrogen
cyanide (HCN) by the method of Lorck (1948). Bacterial streaks
were made on nutrient agar enriched with glycine (4.4 g/l) poured
*Corresponding author. E-mail address: [email protected]. Tel: +229 97.12.34.68.
Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Abbreviations: IAA, Indole acetic acid; HCN, hydrogen cyanide; PGPR, plant growth promoting rhizobacteria; ISR, Induced
Systemic Resistance; EPS, exopolysaccharides; IPA, indole pyruvic acid.
Noumavo et al.
into Petri dishes. The top of the plate was covered with a Whatman
filter paper No. 1 soaked in 2% sodium carbonate in 0.5% picric
acid solution. After sealed with parafilm, those plates were
incubated at 36 ± 2°C for 4 days. The positive reaction of HCN
production is shown by apparition of orange to red color. According
to the color intensity, three point scale (+ = low intensity; ++ =
Average intensity and +++ = high intensity) were used to analyze
the results.
813
Where, r1 = diameter of pathogen growth in monoculture (control);
r2 = diameter of pathogen growth in dual culture.
Data analysis and photo manipulation
Catalase production
Catalase is an enzyme which hydrolyzes the hydrogen peroxide
(H2O2) to oxygen and water. With a sterile pipette, a bacterial
colony was dispersed in a drop of hydrogen peroxide previously
deposited on a clean dry slide. The positive reaction is shown by an
immediate release of oxygen bubbles forming foam solution (Riegel
et al., 2006).
Exopolysaccharides production
The exopolysaccharides (EPS) production was estimated by
modified method of Damery and Alexander (1969). Bacteria strains
were inoculated into Erlenmeyer flask containing 25 ml of yeast
extract mannitol (YEM) broth supplemented with 1% of carbon
source (glucose). The inoculated flasks were incubated at 36 ± 2°C
on a gyro-rotatory shaker at 150 rpm for 72 h. After incubation, the
bacterial suspension was centrifuged at 3500 rpm for 30 min and
the supernatant was mixed with two volumes of chilled acetone.
The crude polysaccharide developed was collected by centrifugation at 3500 × g for 30 min. The EPS was washed with distilled
water and acetone (alternately), and weighed after overnight drying
at 105°C.
Ammonia production
The production of ammonia by rhizobacteria was tested by peptone
water method (Cappuccino and Sherman, 1992). The strains were
inoculated in peptone water (10 ml) and incubated for 48 to 72 h at
36 ± 2°C. After incubation, Nessler’s reagent (0.5 ml) was added to
each tube. The ammonia production was showed by development
of brown to yellow color. According to the color intensity, three
point scale (+ = low intensity; ++ = average intensity and +++ = high
intensity) were used to analyze the results.
Antifungal activity of rhizobacteria
The antifungal activity of rhizobacteria against some phytopathogenic fungi namely Fusarium verticillioides, Aspergillus ochraceus,
Aspergillus tamarii and Aspergillus wentii was assessed by dual
culture method according to Kumar et al. (2002). A disk (5 mm
diameter) was cut out from a young culture of the fungal pathogen
and placed in the middle of a Petri dish of potato dextrose agar
(PDA). Ten (10) µl of a rhizobacteria suspension (approx. 108
CFU/ml) were spotted 2 cm from and on opposite sides of the
fungus infected disk. The control Petri dishes were realized by
monocultures of each pathogen. The Petri dishes were incubated at
26 ± 1°C and checked for zones of inhibition of mycelium growth
after seven (7) days when the fungal mycelium had reached the
edge of the Petri dish. When the pathogen grew over the
rhizobacteria, we concluded that rhizobacteria did not have
antifungal activity. On the other hand, when fungal growth was
restricted by the rhizobacteria, the rhizobacteria’s antifungal activity
(percentage of inhibition) was calculated by the following formula:
The data were analyzed by using Microsoft Office Excel software
version 2003. The graphs were realized by using the same
software. Adobe Photoshop version 7.0 was used for photos
treatment.
RESULTS
Production of plant growth promoting metabolites
(PGPM) by rhizobacteria strains
Fifteen (15) rhizobacteria strains were evaluated for
production of the plant growth promoting metabolites as
catalase, ammonia, hydrogen cyanide, exopolysaccharides and indole acetic acid (IAA) as well as for
antifungal properties. All the 15 strains had produced
catalase, and exopolysaccharides (Figure 1), while 86.66,
80 and 60% of the strains had produced ammonia,
hydrogen cyanide and IAA, respectively. Nine of the
strains were found to have antifungal properties (Figure
1). Of the four bacteria genera (Bacillus, Streptomyces,
Pseudomonas and Azospirillum) used for production of
PGP metabolites searching, all the strains of
Pseudomonas and Azospirillum were found to produce
catalase, ammonia, hydrogen cyanide, IAA and
exopolysaccharides. The production of plant growth
promoting metabolites (PGPM) by different genera of the
15 rhizobacteria strains tested in this study is presented
in Figure 2. All the species of Pseudomonas and
Azospirillum tested were found to produce catalase,
ammonia, hydrogen cyanide, indole acetic acid and
exopolysaccharides.
All the species of Streptomyces and Bacillus have
produced catalase and exopolysaccharides, while 87.5
and 66.7% of the Bacillus and Streptomyces species
have respectively produced ammonia. Only 75 and
66.7% of Bacillus and Streptomyces species have
respectively produced hydrogen cyanide, whereas 62.5%
of Bacillus species have produced IAA but none of
Streptomyces species have produced any IAA
Quantification of PGP-metabolites
rhizobacteria strains
produced
by
Table 1 provides a detailed profile of different rhizobacteria species for the parameters previously evaluated
(catalase production, ammonia, cyanide hydrogen, indole
acetic acid and exopolysaccharides) and an estimate the
levels production of these parameters. When reading this
814
Afr. J. Biotechnol.
Figure 1. Production of plant growth promoting metabolites by rhizobacteria strains. Cat =Catalase; NH 3=ammonia;
HCN=hydrogen cyanide; IAA= indole acetic acid; EPS= exopolysaccharides; AFA= antifungal activity.
Figure 2. Production of plant growth promoting metabolites by different genera of rhizobacteria. Cat=Catalase;
NH3=ammonia; HCN=hydrogen cyanide; IAA=indole acetic acid; EPS=exopolysaccharides; AFA= antifungal activity.
Noumavo et al.
815
Table 1. Estimation of plant growth promoting metabolites produced by rhizobacteria.
Rhizobacteria
B. coagulans
B. thuringiensis
B. circulans
B. polymixa
B. licheniformis
B. firmus
B. lentus
B. pumilus
S. hygroscopicus
S. rimosus
S. fasciculatus
P. aeruginosa
P. putida
P. fluorescens
A. lipoferum
Cat
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
NH3
+
++
+
+
+
+
+
+
ND
+
+
+++
+++
++
Production
HCN
+
+
ND
+
+
+
ND
+
+
ND
+
+
+++
+++
+++
IAA
+
++
ND
+
+
ND
ND
+
ND
ND
ND
++
+++
+++
+++
EPS
+++
+
++
++
++
++
+
+
+
+
+
+
++
+++
++
Cat = Catalase; NH3 = ammonia; HCN = hydrogen cyanide; IAA = indole acetic acid; EPS =
exopolysaccharides ; B. = Bacillus ; S. = Streptomyces ; P. = Pseudomonas ; A. = Azospirillum ;
+ = low ; ++ = average ; +++ = high ; ND = not detected.
table, we can observe that the different rhizobacteria do
not have the same potential for production of PGPmetabolites. Thus, Pseudomonas putida and P.
fluorescens highly produce ammonia, while Azospirillum
lipoferum and B. thuringiensis have an average ammonia
production. On the contrary, S. rimosus and B. lentus do
not produce ammonia. The other strains lowly produced
ammonia.
A. lipoferum, P. fluorescens and P. putida showed high
production level of hydrogen cyanide and indole acetic
acid. S. rimosus, B. lentus, B. circulans, S. fasciculatus,
S. rimosus, S. hygroscopicus, B. lentus, B. firmus and B.
circulans have not produced the hydrogen cyanide and
indole acetic acid. Apart from P. fluorescens that displays
high production of exopolysaccharides, all the other
rhizobacteria had low or average produced exopolysaccharides.
Antagonism assay of rhizobacteria strains against
phytopathogenic fungi
The antifungal properties of the rhizobacteria strains used
in this study were tested against plant pathogenic:
Fusarium verticillioides, Aspergillus Ochraceus, A.
Tamarii and A. wentii. The growth of F. verticillioides was
inhibited by S. hygroscopicus, S. fasciculatus, P.
aeruginosa, P. putida, P. fluorescens and A. lipoferum to
varying degrees. An inhibition zone was observed in Petri
dishes for A. ochraceus co-inoculated with P. aeruginosa,
S. hygroscopicus, S. fasciculatus, P. putida, P.
fluorescens and A. lipoferum (Table 2). B. thuringiensis,
B. licheniformis, B. firmus, B. lentus and S. rimosus did
not inhibit the growth of any of the pathogenic fungi
tested (Table 2). No antagonism was observed between
rhizobacteria strains and A. tamarii and A. Wentii (Figure
3d). In opposite, S. hygroscopicus, S. fasciculatus, P.
aeruginosa, P. putida, P. fluorescens and A. lipoferum
have inhibited the normal A. ochraceus mycelial growth.
P. aeruginosa, S. hygroscopicus and S. fasciculatus
have induced the mycelial growth inhibition of A.
ochraceus respectively with the rate of 58.33, 57.98 and
57.73% (Table 2). Many rhizobacteria strains have
presented the antagonism against F. verticillioides.
Indeed, all rhizobacteria except B. thuringiensis, B.
licheniformis, B. firmus, B. lentus (Figure 3c), B. pumilus
and S. rimosus have inhibited the mycelial growth of F.
verticillioides. S. fasciculatus (50.25%) (Figure 3b), A.
lipoferum (50.58%) and P. fluorescens (52.24%) have
strongly inhibited mycelial growth of F. verticillioides. It
was remarked that all rhizobacteria display antagonistic
effect to A. ochraceus which have also inhibited F.
verticillioides.
DISCUSSION
Understanding the bacteria mechanisms of root colonization and plant growth is crucial to improve the biological control methods against the plant pathogens and
efficient use of plant growth promoting rhizobacteria
(Kloepper et al., 1980). Indeed, PGPR properties investi-
816
Afr. J. Biotechnol.
Table 2. Antifungal profiles of rhizobacteria strains.
Rhizobacteria
B. coagulans
B. thuringiensis
B. circulans
B. polymixa
B. licheniformis
B. firmus
B. lentus
B. pumilus
S. hygroscopicus
S. rimosus
S. fasciculatus
P. aeruginosa
P. putida
P. fluorescens
A. lipoferum
Mycelial growth inhibition over control (%)
F. verticillioides
A. ochraceus
A. tamarii
41.46
48.42
34.49
46.43
57.73
50.25
57.98
49.25
58.33
48.59
55.00
52.24
51.16
50.58
52.38
-
A = Azospirillum; As = Aspergillus; F = Fusarium; - = no inhibition.
Figure 3. Antagonism between rhizobacteria and plant
pathogens. a=Mono-culture of F. verticillioides; b= dual
culture of F. verticillioides and S. fasciculatus; c=dual culture
of F. verticillioides and B. lentus; d=dual culture of A wenti
and B. firmus; e=mono culture of A. wenii.
A. wentii
-
Noumavo et al.
gating the different rhizobacteria in the study revealed
interesting results that illuminate their PGPR profiles. All
rhizobacteria strains used in this study produced
catalase. These strains are in the genera Bacillus,
Pseudomonas, Azotobacter and Streptomyces. Previous
studies by Rathaur et al. (2012) showed that Bacillus
spp., Pseudomonas spp., and Azotobacter spp., isolated
from Withania somnifera (Ashwagandha), were also able
to produce catalase. The ability to produce catalase gives
the bacteria an added advantage because it makes them
potentially more resistant to environmental, mechanical
and chemical stresses (Rathaur et al., 2012). The ability
of PGPR to produce ammonia is considered as an
important measure to influence indirectly plant growth
(Karuppiah and Rajaram, 2011). About eighty-six percent
(86%) of tested rhizobacteria had produced ammonia
(87.5% of Bacillus spp., 66.6% of Streptomyces spp.,
100% of Pseudomonas spp., and Azospirillum spp.,). P.
putida and P. fluorescens displayed high production of
ammonia, while Azospirillum lipoferum and B.
thuringiensis had average production. In studies by other
researchers, ammonia production was detected in 95% of
strains isolated from the rhizosphere of rice, mangroves
and soils contaminated by effluent (Samuel and
Muthukkaruppan, 2011, Joseph et al., 2007). B. subtilis
MA-2 and P. fluorescens MA-4 known to be real
producers of ammonia were shown to significantly
increase the biomass of medicinal and aromatic plants
such as geranium (Mishra et al., 2008). All the studied
strains have produced low to moderate amount of
exopolysaccharides, except P. fluorescens that displayed
high production.
Exopolysaccharides (EPS) produced by rhizobacteria
join soil aggregates and change their porosity (Alami et
al., 2000). Thus, the soil porosity which is directly
associated to the transfer of water from the soil to plant
roots, is influenced by bacterial activity. Bacterial EPS
produced on root surfaces also contribute to the
maintenance of the water flow required for photosynthetic
activity and plant growth.
In addition, EPS can limit or retard the soil dessiccation
under water stress conditions. Conversely, in water
excess (flooding), EPS help to prevent the dispersion of
clay soil (Henao and Mazeau, 2009). Only 60% of the
strains were able to produce IAA (100% of Pseudomonas
spp. and Azospirillum spp., 62.5% of Bacillus spp., 0% of
Streptomyces spp.,).
A. lipoferum, P. fluorescens and P. putida have produced large amounts of IAA. Several bacterial species for
example Bacillus spp., Pseudomonas spp., Azotobacter
spp., Azospirillium spp., Phosphobacteria
spp.,
Glucanoacetobacter
spp.,
Aspergillus
spp.
and
Penicillium spp. have been reported to produce IAA
(Shobha and Kumudini, 2012, Wahyudi et al., 2011). IAA
production by PGPR varies according to species and
strains origin. This may also be influenced by growth
conditions, stage of development and the substrate
817
availability (Ashrafuzzaman et al., 2009). The IAA
produced by rhizobacteria plays a major role in roots
elongation and can directly promote roots growth by cells
elongation and cells division stimulation or indirectly
influences the ACC (Amino cyclopropane-1-carboxylate)deaminase activity in rhizobacteria (Rathaur et al., 2012).
In addition, Patten and Glick (2002) reported that low
levels of IAA can stimulate roots elongation, while high
levels of IAA stimulate the lateral and adventitious roots
formation. The ACC-deaminase product by PGPR,
hydrolyzes plant’s ACC, an immediate precursor of plant
ethylene hormone, which prevents production of toxic
ethylene levels (Patten and Glick, 2002). The ability of
rhizobacteria to use tryptophan added to their culture
medium is an important parameter to detect and quantify
their IAA production. Tryptophan is the main precursor of
the bacterial IAA biosynthesis via the Indole Pyruvic Acid
(IPA) pathway (Patten and Glick, 1996). IAA is part of
many secondary metabolites produced by rhizobacteria
in abundance during the stationary phase, even in the
absence of tryptophan (Wahyudi et al., 2011).
Another important trait of PGPR, that may indirectly
influence the plant growth, is the production of hydrogen
cyanide. Eighty percent (80%) of rhizobacteria tested
produced hydrogen cyanide (100% of Pseudomonas
spp., Azospirillum spp., 75% of Bacillus spp., 66.6% of
Streptomyces spp.). In a study by Karuppiah and
Rajaram (2011), 75% of Bacillus spp., isolated produced
hydrogen cyanide, whereas only 40% of rhizobacteria
isolated from bean (Phaseolus vulgaris L.) in France by
Kumar et al. (2012) produced the same secondary
metabolite. Many rhizobacteria displayed antagonism
against phytopathogenic fungi: S. hygroscopicus, S.
fasciculatus, P. aeruginosa, P. putida, P. fluorescens and
A. lipoferum significantly (51.16 to 58.33%) inhibited the
mycelial growth of A. ochraceus. All rhizobacteria except
B. thuringiensis, B. licheniformis, B. firmus, B. lentus, B.
pumilus and S. rimosus inhibited the F. verticillioides
mycelia growth by 34.49 to 52.24%. Fatima et al. (2009)
showed that Azospirillum WPR-42 and Azospirillum WM 3 isolated from wheat (Triticum turgidum) inhibited
mycelial growth of Rhizoctonia solani by 55 and 75%,
respectively. Wahyudi et al. (2011) also demonstred that
isolates of Bacillus spp. inhibited mycelial growth of
Sclerotium rolfsii and F. oxysporum by 8.33 and 25%,
respectively. None of the rhizobacteria tested in this
study were antagonistic against A. tamarii and A. wentii.
This suggests that the modes of action and types of
antifungal metabolites produced vary from a rhizobacteria
to another (Williams and Asher, 1996). The reduction of
fungal growth by some PGPR and the in vitro inhibition
zones may be probably due to antifungal substances
and/or lytic enzymes released by PGPR. Indeed, the
synthesis of a wide range antibiotics is most common
character associated with the ability of PGPR to preclude
the plant pathogens proliferation (Mazurier et al., 2009).
The antibiosis mechanism is well-known and perhaps
818
Afr. J. Biotechnol.
most importantly used by PGPR to limit the pathogens’
invasion. It consists of direct inhibition of the pathogen
growth through the antifungal metabolites and/or antibiotics production (Adam, 2008). B. subtilis strains
produce a variety of powerful antifungal metabolites such
as zwittermycine-A, kanosamine (Peypoux et al., 1999)
and lipopeptides belonging to surfactin, iturin and the
fengycin families (Rahman et al., 2007). Some antifungal
molecules, produced by Pseudomonas spp, such as
hydrogen cyanide (HCN), viscosamide, pyoluteorine, 2,4diacetylphloroglucinol, pyrrolnitrin, phenazines and
butyrolactone are also implicated in the bio-control (Haas
and Defago, 2005).
Conclusion
This study focused on establishing the PGPR profiles of
bacteria isolated from maize rhizosphere in Benin. Most
of the rhizobacteria strains were found to produce
catalase, exopolysaccharides, ammonia, hydrogen
cyanide and indole acetic acid. P. putida, P. fluorescens
and A. lipoferum produced most of the investigated
metabolites. These results suggest the possibility to use
these rhizobacteria as biological fertilization to increase
the maize yield. S. hygroscopicus, S. fasciculatus, P.
aeruginosa, P. putida, P. fluorescens and A. lipoferum
inhibited mycelial growth of F. verticillioides and A.
ochraceus. P. fluorescens and P. aeruginosa were highly
antagonistic against F. verticillioides and A. ochraceus
and can be used in biological control of these
phytopathogenic fungi.
Conflict of interests
The authors declare that they have no competing
interests.
ACKNOWLEDGEMENTS
The authors thanked the International Foundation of
Science (IFS research grant No. C/5252-1) and West
Africa
Agricultural
Productivity
Programme
(WAAPP/PPAAO) for funding this work.
REFERENCES
Adam A (2008). The systemic resistance induced in tomato and
cucumber and stimulation of the lipoxygenase pathway by nonpathogenic rhizobacteria. Ph.D. Thesis, University of Liège. Liège.
Belgium. p. 148. Ahmad F, Ahmad I, Khan MS (2008). Screening of
free-living rhizospheric bacteria for their multiple growth promoting
activities. Microbiol. Res. 163:173-181.
Alami Y, Achouak W, Marol C, Heulin T (2000). Rhizosphere soil
aggregation and plant growth promotion of sunflower by an EPSproducing Rhizobium sp. isolated from sunflower roots. Appl.
Environ. Microbiol. 66:3393-3398.
Aneja KR (2003). Experiments in Microbiology, Plant pathology and
Biotechnology. 4th ed. New Age International Publishers, Daryaganj,
New Delhi.
Ashrafuzzaman M, Hossen FA, Ismail MR, Hoque MA, Islam ZM,
Shahidullah SM, Meon S (2009). Efficiency of plant growthpromoting rhizobacteria (PGPR) for the enhancement of rice
growth. Afr. J. Biotechnol. 8: 1247-1252.
Brick JM, Bostock RM, Silverstone SE (1991). Rapid in situ assay for
indoleacetic acid production by bacteria immobilized on nitrocellulose
membrane. Appl. Environ. Microbiol. 57: 535-538.
Cappuccino JC, Sherman N (1992). Microbiology: A Laboratory Manual.
Benjamin (ed). Cumming Publishing Company, New York. USA. pp.
125-179.
Cardon ZJ, Gage DJ (2006). Resource exchange in the rhizosphere:
molecular tools and the microbial perspective. Anim. Rev. Ecol. Evol.
Syst. 37:459-488.
Damery JT, Alexander M (1969). Physiological differences between
effective and ineffective strains of Rhizobium. Soil. Sci. 108: 209-215.
Fatima Z, Saleemi M, Zia M, Sultan T, Aslam M, Rehman R, Fayyaz
Chaudhary M (2009). Antifungal activity of Plant Growth-Promoting
Rhizobacteria isolates against rhizoctonia solani in wheat. Afr. J.
biotechnol. 8:219-225.
Haas D, Defago G (2005). Biological control of soil-borne pathogens by
fluorescent pseudomonads. Nat. Rev. Microbiol. 3: 307-319.
Henao LJ, Mazeau K (2009). Molecular modelling studies of clayexopolysaccharide complexes: soil aggregation and water retention
phenomena. Mat. Sci. Engin. 29: 2326-2332.
Joseph B, Ranjan Patra R, Lawrence R (2007). Characterization of
plant growth promoting rhizobacteria associated with chickpea (Cicer
arietinum L.). Int. J. Plant. Prod. 2: 141-152.Karuppiah P, Rajaram S
(2011). Exploring the Potential of Chromium Reducing Bacillus sp.
and there Plant Growth Promoting Activities. J. Microbiol. Res. 1:1723.
Khan MS, Zaidi A, Wani PA (2006). Role of phosphate solubilizing
microorganisms in sustainable agriculture-a review. Agron Sustain.
Dev. 27:29-43.
Kloepper JW, Schroth MN, Miller TD (1980). Effects of rhizosphere
colonization by plant growth promoting rhizobacteria on potato plant
development and yield. Ecol. Epidemiol. 70:1078-1082
Kumar A, Kumar A, Devi S, Patil S, Payal C, Negi S (2012). Isolation,
screening and characterization of bacteria from Rhizospheric soils for
different plant growth promotion (PGP) activities: an in vitro study.
Recent Res. Sci. Technol. 4:01-05.
Kumar NR, Arasu VT, Gunasekaran P (2002). Genotyping of antifungal
compounds producing plant promoting rhizobacteria, Pseudomonas
fluorescens. Curr. Sci. 82:1463-466.
Lorck H (1948). Production of hydrocyanic acid by bacteria. Physiol.
Plantarum. 1:142-146.
Mazurier S, Corberand T, Lemanceau P, Raaijmakers JM (2009).
Phenazine antibiotics produced by fluorescent pseudomonads
contribute to natural soil suppressiveness to Fusarium wilt. ISME J..
3: 977-991.
Mishra PK, Mishra S, Selvakumar G, Bisht SC, Kundu S, Bisht JK,
Gupta HS (2008). Characterization of a psychrotrophic plant growth
promoting Pseudomonas PGERs17 (MTCC 9000) isolated from
North Western Indian Himalayas. Annal. Microbiol. 58: 1-8.
Nelson LM (2004). Plant growth promoting rhizobacteria (PGPR):
Prospect for new inoculants. Crop Managt. doi: 10. 1094/CM-20040301-05-RV.
Patten CL, Glick BR (1996). Bacterial biosynthesis of indole-3-acetic
acid. Can. J. Microbiol. 42:207-220.
Patten CL, Glick BR (2002). Role of Pseudomonas putida indoleacetic
acid in development of the host plant root system. Appl. Environ.
Microbiol. 68:3795-3801.
Paul EA, Clark FE (1996). Soil Microbiology and Biochemistry.
Academics Press, San Diego: CA, USA, p. 340.
Peypoux F, Bonmatin JM, Wallach J (1999). Recent trends in the
biochemistry of surfactin. Appl. Environ. Microbiol. 51: 553-563.
Rathaur P, Ramteke PW, Waseem W, John SA (2012). Isolation and
characterization of nickel and cadmium tolerant plant growth
promoting rhizobacteria from rhizosphere of Withania somnifera. J.
Biol. Environ. Sci. 6:253-261.
Noumavo et al.
Rahman M, Ano T, Shoda M (2007). Biofilm fermentation of iturin A by a
recombinant strain of Bacillus subtilis 168. J. Biotechnol. 127: 503507.
Riegel P, Archambaud M, Clavé D, Vergnaud M (2006). Bactérie de
culture et d’identification difficiles. Biomérieux, Paris, France. pp. 93112.
Saharan BS, Nehra V (2011). Plant Growth Promoting Rhizobacteria: A
Critical Review. LSMR. 21: 1-30.
Samuel S, Muthukkaruppan SM (2011). Characterization of plant
growth promoting rhizobacteria and fungi associated with rice,
mangrove and effluent contaminated soil. Curr. Bot. 2: 22-25.
819
Shobha G, Kumudini BS (2012). Antagonistic effect of the newly
isolated PGPR Bacillus spp. on Fusarium oxysporum. Int. J. Appl.
Sci. Eng. Res. 1:463-474.
Wahyudi AT, Astuti RP, Widyawati A, Meryandini A, Nawangsih AA
(2011). Characterization of Bacillus sp. strains isolated from
rhizosphere of soybean plants for their use as potential plant growth
for promoting Rhizobacteria. J. Microbiol. Antimicrobial. 3:34-40.
Williams GE, Asher MJC (1996). Selection of rhizobacteria for the
control of Phythium ultimum and Aphanomyces cochiliodes on
sugerbeet seedlings. Crop Prot. 15:479-486.
Vol. 14(9), pp. 820-828, 4 March, 2015
DOI: 10.5897/AJB2014.14339
Article Number: 664332050964
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
High-level lipase production by Aspergillus candidus
URM 5611 under solid state fermentation (SSF) using
waste from Siagrus coronata (Martius) Becari
Cyndy Mary Farias1, Odacy Camilo de Souza1, Minelli Albuquerque Sousa1, Roberta Cruz1,
Oliane Maria Correia Magalhães1, Érika Valente de Medeiros2, Keila Aparecida Moreira2 and
Cristina Maria de Souza-Motta1*
1
Mycology Department, CCB, Federal University of Pernambuco, Av. Professor Nelson Chaves, s/n, 50670-420, Cidade
Universitária, Recife, Pernambuco, Brazil.
2
Academic Unit of Garanhuns, Federal Rural University of Pernambuco, Av. Bom Pastor, s/n, 55292-270, Mundaú,
Garanhuns, Pernambuco, Brazil.
Received 25 November, 2014; Accepted 19 February, 2015
The current study evaluated lipase production by Aspergillus candidus URM 5611 through solid state
fermentation (SSF) by using almond bran licuri as a new substrate. The microorganism produced high
-1
levels of the enzyme (395.105 U gds ), thus surpassing those previously reported in the literature. The
variable moisture content, the inductor concentration, temperature and pH were analyzed. The best
production conditions were initial moisture content of 75%, 0% of inductor, at 25°C, pH 5.5, in 10.0 g of
substrate. The variables initial moisture and inductor contents showed significant effects on lipase
production by increasing enzyme activity in about 200% when compared with the initial screening
-1
(197.44 U gds ). Optimum lipase activity was obtained at pH 2.5 at an optimum temperature of 65°C. The
lipase was stable from pH 2.5 to 9.0 and at temperatures between 30 to 65°C. Results from the study are
promising for the economic use and value addition from these important agro residues, which are
abundantly available in Brazil. This is the first report on lipase production by A. candidus URM 5611
reaching a much higher yield of enzyme under SSF with almond bran licuri used as substrate.
Key words: Aspergillus candidus URM 5611, solid state fermentation (SSF), licuri waste, lipase
characterization.
INTRODUCTION
The enzymes from microbial sources receive special
attention in the global market for bioproducts, due to their
current and potential application in industry, mainly in
detergents, oils and fats, dairy manufactures and
pharmaceutical industries (Ângelo, 2014). Lipases stand
out among the enzymes produced by fungi (Contesini et
al., 2010). Lipases (EC 3.1.1.3, triacylglycerol
acilhydrolases) are enzymes that occupy a prominent
place among biocatalysts, and they have many
applications (Ali et al., 2014). For this reason, its market
share in global industrial enzymes grows significantly
(Reinehra et al., 2014).
In the future, this enzyme class will have industrial and
commercial importance comparable to that of peptidases,
which sale in industrial enzymes ranges from 25 to 40%
(Barros et al., 2010; Ghasemi et al., 2011). The industrial
Farias et al.
lipases are mainly used as additives for washing
detergents, food industries, especially in the preparation
of chocolate substitutes and in the production of special
flavors.
Moreover, it has been widely used in the manufacture
of cosmetics (tanning), in sewage treatment, and trancesterification of triglycerides (Treichel et al., 2010; Kotogán
et al., 2014). The widening application of microbial
lipases in biotechnology has necessitated the continued
research and development of novel lipases by means of
extensive screening and optimisation of process parameters (Mostafa and El-Hadi, 2010). The biotechnological potential of lipases is related to the fact that these
enzymes catalyze not only the hydrolysis reactions, but
also the esterification and transesterification reactions,
and they keep their chemical structure and activity in
different organic solvents (Tan et al., 2004).
In addition, they do not often require the presence of
cofactors, they catalyze various reactions at low temperature and pressure, have a broad specificity for substrates
and exhibit high enantioselectivity (Reis et al., 2009;
Contesini et al., 2010). They can be commonly found in
nature and derive from animal, plant and microorganisms
sources.
Numerous filamentous fungi species produce these
enzymes, especially those from the genus Aspergillus
(Contesini et al., 2010; Fleuri et al., 2014). The genus
Aspergillus is currently considered as one of the largest
biotechnological substance producers, with several
species found in nature (Liu et al., 2006). There are about
837 (Hawksworth et al., 2011) Aspergillus species
commonly isolated from soil and decaying plants. These
fungi produce a number of extracellular enzymes (among
them: lipases), many of which are applied in different
industry sectors (Contesini et al., 2010; Fleuri et al.,
2014).
Solid state fermentation (SSF) has become a major
attraction for the production of this enzyme, like other
products of high added value, due to the use of agroindustrial wastes as well as the obtained increased
volumetric productivity (Ramachandran et al., 2007;
Casciatori et al., 2014).
Despite functional electrical stimulation (FES)
advantages, this technology is still not widely used for
lipase production in large scale. This fact is due to the
lack of systematic studies at bench scale, for example,
the definition of microorganisms producing suitable
substrates and culture conditions (Holker and Lenz,
2005; Fleuri et al., 2014).
However, there are few studies on lipase production by
Aspergillus species through SSF. Therefore, there is the
821
need for further studies on these microorganisms’ potential for enzyme production by this method, as well as on
new substrates to be used during fermentation.
This study aimed to investigate lipase production by
Aspergillus species preserved under mineral oil in
Micoteca URM Culture Collection (WDCM604) under
SSF using low cost residue. It also aimed to optimize
culture conditions for production and evaluate enzyme
stability regarding changes in pH and temperature.
MATERIALS AND METHODS
Microorganisms and inoculum preparation
Eighteen isolates of Aspergillus isolated from castor bean obtained
from the Micoteca URM culture collection (URM, Recife, Brazil,
WDCM604) (Micoteca, 2014) were inoculated on malt extract agar
(MEA (g L−1): malt 20, glucose 20, peptone 1, and agar 20) and
kept at 28°C. Spores of each isolate were transferred under strict
aseptic conditions to 10 mL of sterile distilled water with 0.1%
Tween 80. After homogenization, the spores in the suspension
were counted by means of a Neubauer chamber in order to obtain
the concentration of 5x108 spores mL-1 (Sabu et al., 2005).
Solid state fermentation (SSF)
Solid substrate
Almond bran licuri (Syagrus coronata (Martius) Beccari) were
obtained from COOPERLIC - Cooperative Lanyard sand
Processing, Licuri in Caldeirão Grande, Bahia, Brazil. The waste
was flushed with sterile distilled water and dried in an oven
(QUIMIS, Q316M2, São Paulo, Brazil) at 55°C for 48 h.
Lipase production under SSF
As for lipase production in 250 ml Erlenmeyer flasks, 10 g bran
licuri were added with 1% olive oil, in order to induce it. The mixture
was moistened with phosphate buffer (0.1 mol L -1). The initial
moisture content was adjusted to 50% and pH 7.0. The flasks were
autoclaved, cooled and inoculated with 1 mL of the spore
suspension at a concentration of 5 x 108 spores mL-1 and incubated
at 30°C (BOD, TECNAL, TE-371, São Paulo, Brazil) for 48, 72 and
96 h (Sabu et al., 2005).
Enzymes extraction
Fifty (50) mL of sterile distilled water containing 0.01% Tween 80
were added to each flask and kept on a rotary shaker (TECNAL) at
150 rpm for 10 min. The fermented substrate was subjected to
filtration by using sterile lint and serial filter paper (CELAB 22.15
microns) with the aid of a vacuum pump. The resulting supernatants
were assayed for lipase activity. All fermentation tests were carried
out in three independent experiments (Brunk et al., 2005).
*Corresponding author. Email: [email protected]. Tel: +55 81 2126 8948. Fax: +55 81 2126 8480.
Author(s) agree that this article remain permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Abbreviation: SSF, Solid state fermentation.
822
Afr. J. Biotechnol.
Table 1. Variable levels of the 24 experimental design for the production
of lipase (U gds-1) in SSF by Aspergillus candidus URM 5611 using bran
licuri as substrate.
Variable
Inductor (I)
Im (%)
T (ºC)
pH
Low (-1)
5.0
45
25
5.5
Levels
Central (0)
10.0
60
32.5
6.5
High (+1)
15.0
75
40
7.5
I, inductor; Im, initial moisture content; T, temperature.
Enzyme activity
The enzymatic activity was accomplished by titrimetric method
using olive oil (10% w/ v) as substrate for the enzyme dosage,
which was emulsified with arabic gum (5% w v-1) in distilled water. 5
mL of this emulsion was added to 1 mL of crude enzyme extract,
and incubated for 1 h at 37°C, then titrated with NaOH solution
(0.05 M) according to Watanabe et al. (1977). The activity dosage
was performed by using phenolphthalein as indicator and the
arithmetic mean of the values was used to determine the enzyme
activity calculation. One lipase activity unit was defined as the
amount of enzyme that releases 1 µ mole fatty acid per minute,
under the conditions described above, and that can be determined
through the equation by Leal (2002). The moisture of each sample
was determined according to the AOAC (2003) for further
conversion of the results into dry substrate (U gds-1).
Experimental design and statistical analysis
The influence of temperature (T), initial moisture content (Im),
inductor (I) and pH (pH) on lipase production was evaluated from
the results of the experiments performed according to a 24 factorial
design (Bruns et al., 2006), plus four central points (Table 1). All
statistical analyses were performed by using Statistic 8.0 software
(Statsoft, 2001).
Enzyme partial characterization
Lipase activity of the crude enzyme extract was measured at
different pH and temperature values as well as the effect of pH on
the enzymatic activity stability.
Effect of pH on the enzymatic activity stability
The pH effect was determined by enzymatic activity at 50°C; the
crude enzyme extract was emulsified for 3 min with gum arabic (5%
w/v) in olive oils at different pH, by using the following buffers:
citrate - phosphate (2.5 to 3.5); acetate (4.0 to 4.5); citrate phosphate (5.0 to 7.0) and Tris-HCl (7.4 to 9.0), all 0.05 M. In order
to determine enzyme pH stability, the enzyme extract was
previously subjected to the action of different pH values by using
buffer solutions with pH ranging from 2.5 to 9.0 for periods of 60,
120 and 180 min and it was then subjected to the determination of
lipase activity as described above. The analyses were performed in
triplicate.
Effect of temperature on the enzymatic activity stability
The temperature effect was determined with pH optimal constant of
2.5 by incubating the enzyme extract with the respective substrate,
with temperature variations between 30 to 80°C, with a variation
range of 5°C for a period of 60, 120 and 180 min. The enzymatic
activity was performed as previously described. All analyses were
performed in triplicate. Aiming to determine the temperature stability
of the enzyme, the extract was preincubated at temperatures
ranging from 30 to 80°C for 60 min and it was then subjected to
lipase activity determination. The analyses were performed in
triplicate.
RESULTS AND DISCUSSION
Screening for lipase production
All the 18 tested cultures of Aspergillus produced high
levels of lipase when bran licuri was used as substrate.
Eleven of the 18 culture (61.1%) samples yielded over
100/ gds. A. candidus URM 5611 was the best producer
-1
with 197.44 U gds , followed by Aspergillus flavus URM
5794 and Aspergillus sclerotiorum URM 5792 with
-1
production of 163.25 and 154.21 U gds , respectively,
(Table 2). Because of the high level of lipase (197.44 U
-1
gds ) produced by A. candidus URM 5611, this
microorganism was selected to study the best conditions
for enzyme production. Palma et al. (2000) obtained
maximum lipase activity by Penicillium restrictum 27.8 U
-1
gds by using babassu palm supplemented with peptone
as substrate. In solid-state cultivation on a mixture of
sunflower seed meal and sugarcane bagasse, Alberton et
al. (2010) evaluated lipase production by Rhizopus
-1
microsporus. The maximum production was 26 U gds ,
and it was applied to the treatment of dairy waste. When
compared with the results obtained in the current study,
species from genus Aspergillus appear to be most
promising for lipase production by SSF, since they
produce high levels of the enzyme. Castiglioni et al.
(2009) tested lipase production by Aspergillus fumigatus
under SSF by using shell and rice bran oil, and olive
added as carbon source. The obtained value of the total
-1
activity of 117.02 U gds was similar to that obtained in
the present study by Aspergillus caespitosus URM 5938
with almond bran licuri and olive oil as carbon source and
-1
total activity of 117.33 U gds . However, it was still less
than the maximum value obtained with A. candidus URM
-1
5611 which showed total activity of 197.44 U gds . Fleuri
Farias et al.
823
Table 2. Total lipase activity (U gds-1) produced by cultures of Aspergillus using licuri bran as substrates and
incubated for 96 h.
a
Access number URM
5910
5938
5611
5608
5794
5698
5620
5827
5838
5870
5609
5787
5792
5615
5774
5606
5829
5701
Species
Aspergillus awamorii Nakaz.
Aspergillus caespitosus Raper & Thom
Aspergillus candidus Link
Aspergillus duricaulis Raper & Fennell
Aspergillus flavus Link
Aspergillus fumigatus Fresen.
Aspergillus japonicus Saio
Aspergillus melleus Yukawa
Aspergillus niger Tiegh.
Aspergillus niveus Blochwitz
Aspergillus ochraceus K. Wilh.
Aspergillus parasiticus Speare
Aspergillus sclerotiorum Huber
Aspergillus stromatoides Raper & Fennell.
Aspergillus sydowii (Bain. & Sart.) Thom & Church
Aspergillus terreus Thom
Aspergillus variecolor Thom & Raper
Aspergillus versicolor (Vuill.)Tiraboschi
Lipase activity
99.08
117.37
197.44
74.33
163.25
90.91
106.27
112.88
84.71
115.57
128.73
110.00
154.21
128.28
94.90
81.89
95.47
143.33
a
Access number in the Micoteca URM culture collections (Recife, Pernambuco, Brazil).
et al. (2014), evaluated lipase production by an
Aspergillus strain, by using wheat bran, soybean meal
and soybean meal with sugarcane bagasse as substrate,
through SSF. The authors observed lipase activity of
-1
67.5, 58 and 57.3 U gds
for each substrate,
respectively. Compared to the present study, A. candidus
-1
URM 5611 showed higher lipase activity (197.44 U gds ).
Such microorganism is preserved in a Culture Collection
of reference in Brazil (Micoteca URM Culture Collection
(WDCM604), and it was duly identified. The fungi from
genus Aspergillus are widely used in enzyme production.
The lipase production by Aspergillus species has been
widely reported, mainly because this enzyme is usually
extracellular. Lipase (EC 3.1.1.3) (triacylglycerol lipase)
also called triacylglycerol acylhydrolase, catalyzes the
hydrolysis of ester bonds from oils and fats and may act
in synthesis reactions (esterification, interesterification,
alcoholysis, acidolysis and aminolysis) (Sharma et al.,
2001). These reactions have the advantage of giving
biotechnological potential to enzymes, such as stability in
organic solvents, and no requirement for cofactors broad
specificity (Azeredo et al., 2007). In the present study, A.
candidus URM 5611 proved to be a major lipase
producer, and it was selected for enzymatic optimization
and characterization. This is the first report on lipase
production by an isolate from this species.
Effects of the variables on lipase production
A. candidus URM 5611 presented efficient lipolytic activity
(LA) when olive oil is used as inductor, but in the absence
of this oil, there was an increase in production with higher
activity. Therefore, it was selected to a study on the effect
of independent variables such as temperature, pH,
moisture, and induce lipase production in solid state
fermentation for 48 h (Table 3). The maximum lipase
activity produced by A. candidus URM 5611 was 397.158
-1
U gds in run 3 as follows: 48 h of fermentation using 0%
olive oil at pH 5.5, 75% moisture at 25°C. When
-1
compared with the initial screening (197.44 U gds ), after
production optimization, A. candidus URM 5611 had its
lipase production increased by 200%. This value (397.15
-1
U gds ) was higher than that reported in the literature so
far. For example, Kempka et al. (2008) tested a strain of
Penicillium verrucosum by using soybean meal as
substrate at 27.5°C with moisture of 55% and an activity
-1
of 40 U gds within 48 h of fermentation. Ul-Haq and
-1
Idress Rajoka (2002) found 48 U gds activity by the
fungus Rhizopus oligosporus by using almond cake as
substrate at 30°C for 72 h. However, it is less than the
lipase activity obtained by Mala et al. (2007) who
evaluated the lipase production by A. niger at 30°C, 62%
moisture using wheat bran and sesame cake as
-1
substrates, and obtained 384 U gds at 72 h of
fermentation. Thus, A. candidus 5611 URM showed to be
most promising for lipase production under SSF at high
levels. The Pareto chart shows the estimated effects of
the variables (main effect or first-order) and the
interactions between variables (second order effect) on
the response variables (biomass and lipase activity), in
order of magnitude. The length of the bars is proportional
824
Afr. J. Biotechnol.
Table 3. Experimental design results for lipase production under SSF fermentation by Aspergillus candidus URM 5611.
Run
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Experimental variables
Temperature (°C) Initial moisture (%)
25
45
40
45
25
75
40
75
25
45
40
45
25
75
40
75
25
45
40
45
25
75
40
75
25
45
40
45
25
75
40
75
32.5
60
32.5
60
32.5
60
32.5
60
Inductor (%)
0
0
0
0
3
3
3
3
0
0
0
0
3
3
3
3
1.5
1.5
1.5
1.5
to the standardized variable effect. The vertical line can
be used to determine that the effects were statistically
significant, because the bars that extend through this line
correspond to statistically significant effects with confidence level of 95% (Porto et al., 2008). The effects have
been demonstrated in these variables, as well as the
interactions between them (Figure 1). It was observed
that, at 48 h of fermentation, the humidity showed a
positive effect, whereas the oil showed a negative effect,
which means that higher moisture levels and lower
inductor are better for lipase production. The other
variables showed no effect on lipase production.
Fermentation using only licuri almond meal, without the
addition of olive oil and the accretion of moisture are
sufficient to get a good lipase production by A. candidus
URM 5611. This result can be explained due to high lipid
content in the substrate composition (49.2 + 0.08;
Source: Crepaldi et al (2001), which suggested the
occurrence of inhibition by excess substrate.
Lipids generally lead to increased lipase production
(Mahadik et al., 2002; Dominguez et al., 2003). However,
in the current study, the increased lipid source seems to
have had an inhibitory effect on enzyme production. A
similar situation was observed by Vargas (2008) who
evaluated lipase production by Penicillium simplicissimum
and found that the addition of oil to the different soybean
cakes used as substrate resulted in a decreased lipase
production. This fact suggested the occurrence of
inhibition by excess substrate. As the amount of water is
pH
5.5
5.5
5.5
5.5
5.5
5.5
5.5
5.5
7.5
7.5
7.5
7.5
7.5
7.5
7.5
7.5
6.5
6.5
6.5
6.5
Total activity (U gds
48 h
72 h
77.66
39.55
73.90
35.44
397.15
153.15
112.71
38.04
45.78
20.53
45.03
21.56
90.73
34.33
77.04
32.16
71.33
26.63
79.38
27.61
87.92
51.14
395.10
150.10
45.75
21.17
54.21
20.03
85.36
39.14
85.95
35.08
67.17
38.75
74.92
34.99
76.61
46.85
86.81
42.67
-1
)
96 h
25.55
31.83
62.18
43.20
20.46
18.94
34.61
27.15
24.32
26.93
46.52
60.18
19.59
23.13
30.78
31.69
37.10
33.53
43.68
43.31
always limited, controlling the level of moisture is
essential to process optimization in the solid state. The
water content suitable for the substrate must enable the
formation of a water film on the surface in order to
facilitate dissolution and transfer of nutrients and oxygen.
However, the spaces among the particles must remain
free to allow oxygen diffusion and heat dissipation
(Gervais and Molin, 2003; Sanchez, 2009). The moisture,
at very low levels, impairs the transport of nutrients and
toxins through the membrane and it can cause the loss of
functional properties of cellular metabolic chain enzymes
(Gervais and Molin, 2003).
According to Mahanta et al. (2008), water content is a
significant factor in substrate physical properties. High
water content leads to decrease on substrate porosity,
there by decreasing gas exchange. Moreover, low water
content may result in reduction of microbial growth and in
consequent decreased enzyme production. Initially,
Dantas and Aquino (2010) evaluated the influence of
water content between 35 and 65% on several substrates
(castor cake, babassu pie, pumpkin seeds, avocado peel
and coffee grounds) in lipase production by A. niger
under SSF. Higher production of lipase (24.6 U/g) was
obtained when babassu pie was used as carbon source
with water content of 45%. This relationship can be better
understood by observing the plot square (Figure 2). It can
be seen that the highest effect values are at the base,
and they correspond to moisture, but this effect is
opposite in relation to inductor concentrations. The best
Farias et al.
825
Figure 1. Pareto chart of interaction effects on the response of lipase activity produced by Aspergillus candidus URM 5611
after 48 h of cultivation.
conditions for enzymes production with lipolytic activity
can be obtained without added inductor and increased
moisture in the fermentation medium. By analyzing the
fermentation costs, the current result is very interesting
when a process on an industrial scale is designed. It is
more advantageous to the industry to produce lipolytic
enzymes using low cost substrates.
Enzyme characterization
pH effect on lipase activity and stability
As for the characterization of lipase produced by A.
candidus URM 5611, the crude enzyme extract was
chosen as the best condition for enzyme production
(Table 3, Run 03). The highest lipase activity was
obtained at pH 2.5. The lipase from A. candidus URM
5611 was stable at pH range from 2.5 to 9.0 with activity
values above 65% for 180 min. The maximum stability
was observed at pH 7.4 with 79% residual activity. These
results show that lipase is stable over a wide pH range.
Figure 3 shows the formation of two peaks, possibly due
to the presence of isoenzymes. Therefore, there is a
need for further studies on the purification of this enzyme.
Mahadik et al. (2002) observed that lipases produced by
A. niger NCIM 1207 had maximal activity at pH 2.5, and
Falony et al. (2006) demonstrated lipase stability at a pH
range of 2.0 to 10.0 for A. niger, thus corroborating the
results from the current study. Moreover, Pera et al.
(2006) reported that the optimum pH activity of A. niger is
of approximately 6.0. Ângelo et al. (2014) characterized
the lipase produced by Fusarium oxysporum, and found
increased lipolytic activity at pH 8.5. The enzyme was
stable at pH range from 5.5 to 6.5, and showed low
stability at pH 8.5. It is known that lipases have isoforms,
depending on the origin of the enzyme. Furthermore,
assay conditions, incubation team, pH, temperature,
substrate and the used methodology can directly affect
enzymes kinetic properties and stability (Carvalho et al.,
2005).
Effect of temperature on activity and stability
The effect of temperature on lipase activity demonstrated
that the maximum relative activity was obtained at 65°C,
for 180 min. The enzyme was most stable at 60 and 65°C
with 120% residual activity, for 180 min. These results
show that the lipase is stable over a wide temperature
range. Maia et al. (2001) evaluated the optimum
temperature of lipase from Fusarium solani and found it
at 35°C. Pastore et al. (2003) studied the characteristics
of the lipase produced by a strain of Rhizopus, and found
the optimum temperature of 40°C. Saxena et al. (2003)
reported that the optimum temperature of lipase from A.
826
Afr. J. Biotechnol.
Figure 2. Square of the variables (inductor and moisture) as the response variable under lipolytic activity.
Figure 3. Effect (
) and stability (
) of lipase residual activity (%) on pH in SSF produced by
Aspergillus candidus URM 5611 after 180 min of incubation with initial pH ranging from 2.5 to 9.0.
carneus was 37°C, thus differing from the results
obtained in the current study, since the optimum
temperature for the activity of lipase produced by A.
candidus was of 65°C. Carvalho et al. (2005) evaluated
kinetic properties of the lipase by Geotrichum candindum
in crude extract, and found that the enzyme was stable
up to 50°C. Ângelo et al. (2014) evaluated the
temperature effect on the activity of lipase from F.
oxysporum, and found the optimum temperature of 40°C.
In view of the stability results obtained at different
temperatures for the lipase produced by solid state
fermentation of A. candidus URM 5611, there were thermo-
Farias et al.
stable lipases when it is incubated for 180 min at
temperatures between 30 to 80°C in constant pH of 2.5.
Thermostability is important for the application of lipase in
the detergent industry. Thermostable lipases have been
isolated from many sources, including Mucor pusillus,
Rhizopus and Aspergillus terreus (Singh and
Mukhopadhyay, 2012). A more stable lipase alone has
maximum activity at 60°C and it loses at least 90% of its
activity after 15 min at 60°C (Said and Pietro, 2004).
Conflict of interests
The authors did not declare any conflict of interest.
ACKNOWLEDGEMENTS
The authors acknowledge FACEPE IBPG-0086-2.03/08,
FINEP ref. 2083/07, FACEPE APQ-0483-2.12/10 and
CNPq 552410/2005-5. The authors also gratefully
acknowledge the COOPERLIC, the Micoteca URM, of the
Mycology Department at UFPE, Brazil.
REFERENCES
Alberton D, Mitchell DA, Cordova J, Peralta-Zamora P, Krieger N.
(2010). Production of a Fermented Solid Containing Lipases of
Rhizopus microsporus and Its Application in the Pre-Hydrolysis of a
High-Fat Dairy Wasterwater. Food Technol. Biotechnol. 48 (1): 28-35.
Ali S, Ren S, Huang Z (2014). Extracellular lipase of an
entomopathogenic fungus effecting larvae of a scale insect. J. Basic
Microbiol. 54:1-12.
Ângelo T, Silva RRS, Cabral, H (2014). Concomitant production of
peptidases and lipases by fungus using agroindustrial residue in
solid-state fermentation. Int. J. Curr. Microbiol. App. Sci. 3(5):810823.
AOAC Internation (2003). Official Methods of Analysis of AOAC
International.17th edition. 2nd revision.Gaithersburg, MD, USA,
Association of Analitycal Communities.
Azeredo LAI, Gomes PM, Sant’anna JrGL, Castilho LR, Freire DMG
(2007). Production and regulation of lipase activity from Penicillium
restrictum in submerged and solid-state fermentations. Curr.
Microbiol. 54(5):361-365.
Barros M, Fleuri LF, Macedo GA (2010). Seed lipases: Sources,
applications and properties – A review. Braz. J. Chem. Eng. 27(1):1529.
Bruns RE, Scarminio IS, Neto BB (2006). Statistical DesignChemometrics, 1st ed., Amsterdam: Elsevier, 422 p.
Carvalho PO, Calafatti AS, Marassi M, Silva DM, Contesini FJ, Bizaco
R (2005). Potencial de biocatálise enantiosseletiva de lipases
microbianas. Quím. Nova. 28(4):614-621.
Casciatori FP, Laurentino CL, Taboga SR, Casciatori PA, Thoméo JC
(2014). Structural properties of beds packed with agro-industrial solid
by-products applicable for solid-state fermentation: Experimental data
and effects on process performance. Chem. Engin. J. 255:214-224.
Castiglioni GL, Bertolin TE, Costa JAV (2009). Produção de
biossurfactnte por Aspergillus fumigatus utilizando resíduos
agroindustriais como substrato. Quím. Nova 32(2):292-295.
Contesini FJ, Lopes DB, Macedo GA, Nascimento MG, Carvalho PO
(2010). Aspergillus sp. lipase: potential biocatalyst for industrial use.
J. Mol. Catal. B: Enzymatic, 67: 163-171.Crepaldi IC, AlmeidaMuradian LB de, Rios MDG, Penteado M de VC, Salatino A (2001).
Composição nutricional do fruto de licuri (Syagrus coronata (Martius)
Beccari) Rer. bras. Bot. SP, 24 (2).
Dantas EM, Aquino LCL (2010). Fermentação em Estado Sólido de
diferentes resíduos para a obtenção de Lipase Microbiana. Ver. Bras.
Prod. Agroin. Campina Grande 12(1):81-87.
827
Dominguez A, Costas M, Longo MA, Sanroman A (2003). A novel
application of solid state culture: production of lipases by Yarrowia
lipolytica. Biotechnol. Lett. 25:1225-1229.
Falony
G, Armas JC, Mendoza JCD, Hernández JLM (2006).
Production of A. niger Lipase, Food Technol. Biotechnol. 44 (2):235240.
Gervais P, Molin P (2003). The role of water in solid-state fermentation.
Biochem. Eng. J. 13:85-101.
Fleuri LF, Novelli PK, Delgado CHO, Pivetta MR, Pereira MS, Arcuri M
de LC, Capoville BL (2014). Biochemical characterisation and
application of lipases producedby Aspergillus sp. on solid-state
fermentation using three substrates. Int. J. Food Sci. Technol.
49(12):2585-2591.
Ghasemi Y, Rasoul-Amini S, Kazemi A, Zarrini G, Morowvat M
H, Kargar M (2011). Isolation and characterization of some
moderately halophilic bacteria with lipase activity. Microbiol.
80(4):483-487.
Hawksworth DL, Crous PW, Redhead AS, Reynolds DR, Samson RA,
Seifert KA, Taylor JW, Wingfield MJ (2011). The Amsterdam
declaration on fungal nomenclature. IMA Fung. 2(105): 112.
Holker U, Lenz J (2005). Solid-state fermentation – are there any
biotechnological advantages? Curr. Opin. Microbiol. 8(3): 301-306.
Kempka AP, Lipke NL, Pinheiro TLF, Menocin S, Treichel H, Freire
DMG, Di Luccio M, Oliveira D (2008). Response surface method to
optimize the production and characterization of lipase from
Penicillium verrucosum in solid-state fermentation. Bioprocess
Biosyst. Eng. 31(2): 119-125.
Kotogán A, Németh B, Vágvölgyi C, Papp T, Takó M (2014). Screening
for extracellular lipase enzymes with transesterification capacity in
mucoromycotina strains lipolytic activity of mucoromycotina strains,
Food Technol. Biotechnol. 52(1):73-82.
Leal MCMR, Cammarota MC, Freire DMG, Sant`anna Jr GL (2002).
Hydrolytic enzymes as coajuvants in the anaerobic treatment of dairy
wastewaters. Braz. J. Chem. Eng. 19:175-180.
Liu C, Huanng LC, Chang CT, Sung HY (2006). Purification and
characterization of soluble invertases from suspension-cultured
bamboo (Bambusa edulis) cells. Food Chem. 96: 621-631.
Mahadik ND, Puntambekar US, Bastawde KB, Khire JM, Gokhale DV
(2002). Production of acidic lipase by Aspergillus niger in solid state
fermentation. Process Biochnol. 38:715-721.
Mahanta N, Gupta A, Khare SK (2008). Production of protease and
lipase by solvent tolerant Pseudomonas aeruginosa PseA in solidstate fermentation using Jatropha curcas seed cake as substrate.
Bioresour. Technol. 99: 1729-1735.
Mala JGS, Edwinoliver NG, Kamini NR, Puvanakrishnan R (2007).
Mixed substrate solid state fermentation for production and extraction
of lipase from Aspergillus niger MTCC 2594. J. Gen. Appl. Microbiol.
53(4): 247-253.
Maia MMD, Heasley A, Camargo de Morais MM, Melo EHM, Morais
JrMA, Ledingham WM, Lima Filho JL (2001). Effect of culture
conditions on lipase production by Fusarium solani in batch
fermentation. Bioresour. Technol. 76:23-27.
Micoteca.
Histórico.
(2014).
Disponível
em:
<
http://www.ufpe.br/micoteca/historico.html>. Acesso em: 01/11/2014.
Mostafa H, El-Hadi AA (2010). Immobilization of Mucor racemosus
NRRL 3631 lipase with different polymer carriers produced by
radiation polymerization. Malayas J. Microbiol. 6(2):149-155.
Palma MB, Pinto AL, Gombert AK, Seitz KH, Kivatinitz SC, Castilho LR,
Freire DMG (2000). Lipase production by Penicillium restrictum using
solid waste of industrial babassu oil production as substrate. Appl.
Biochem. Biotechnol. 84-86:1137-1145.
Pastore GM, Costa VSR, Koblitz MGB (2003). Purificação parcial e
caracterização bioquímica de lipases extracelular produzida por nova
linhagem de Rhizopus sp. Ciênc. Tecnol. Aliment. 23(2):135-140.
Pera LM, Romero CM, Baigori MD, Castro GR (2006). Lipase extracts
from A. niger, Food Technol. Biotechnol. 44(2):247-252.
Porto TS, Medeiros e Silva GM, Porto CS, Cavalcanti MTH, Neto BB,
Lima-Filho JL, Converti A, Porto ALF, Pessoa Jr A (2008). Liquid–
liquid extraction of proteases from fermented broth by PEG/citrate
aqueous two-phase system. Chem. Eng. Process. 47:716-721.
Ramachandran S, Singh SK, Larroche C, Soccol CR, Pandey A (2007).
Oil cakes and their biotechnological applications - A review. Bioresour.
828
Afr. J. Biotechnol.
Technol. 98(10):2000-2009.
Reinehra CO, Rizzardia J, Silva MF, Oliveira D, Treichel H, Colla, LA
(2014). Produção de lipases de Aspergillus niger e Aspergillus
fumigatus através de fermentação em estado sólido, avaliação da
especificidade do substrato e seu uso em reações de esterificação e
alcoólise. Quim. Nova. 37(3):454-460.
Reis P, Holmberg K, Watzke H, Leser ME, Miller R (2009). Lipases at
interfaces: A review. Adv. Colloid Interface Sci. 147-148:237-250.
Sabu A, Kiran GS, Pandey A (2005). Purification and characterization of
tannin acyl hydrolase from Aspergillus niger ATCC 16620. Food
Technol. Biotechnol. 43(2):133-138.
Said S, Pietro RCLR (2004). Enzimas como agentes biotecnológicos.
Ribeirão Preto: Editora Legis Summa. p. 412.
Sanchez C (2009). Lignocellulosic residues: biodegradation and
bioconversion by fungi. Biotechnol. Adv. 27(2):185-94.
Saxena RK, Davidson WS, Sheoran A, Giri B (2003). Purification and
characterization of an alkaline thermostable lipase from
Aspergilluscarneus. Process Biochem. 39:239-247.
Sharma R, Chisti Y, Banerjee UC (2001). Production, purification,
characterization, and applications of lipases. Biotechnol. Adv. 19:627662.
Singh AK, Mukhopadhyay M (2012). Overview of fungal lipase: A
review. Appl. Biochem. Biotecnol. 166:486-520.
Statsoft, inc. Statistica (data analysis software system), version 6
(2001). (Software estatístico).
Tan T, Zhang M, Xu J, Zhang J (2004). Optimization of culture
conditions and properties of lipase from Penicillium camembertii
Thom PG-3. Proc. Biochem. 39: 1495-1502.
Treichel H, Oliveira D, Mazutti MA, Luccio MD, Oliveira JV (2010). A
review on microbial lipases production. Food Bioprocess Technol. 3:
182-196.
Ul-Haq I, Idress S, Rajoka MI (2002). Production of lipases by Rhizopus
oligosporus by solid-state fermentation. Process Biochem. 37: 637641.
Watanabe N, Ota Y, Minoda Y, Yamada K (1977). Isolation and
identification of alkaline lipases producing microorganismos, cultural
conditions and some properties. Agric. Biol. Chem. 41:1353-1348.
Vol. 14(9), pp. 829-834, 4 March, 2015
DOI: 10.5897/AJB2014.14347
Article Number: 760435A50965
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
Effects of cashew nut shell liquid (CNSL) component
upon Aedes aegypti Lin. (Diptera: Culicidae)
larvae’s midgut
Ajit Kumar Passari1, Vineet Kumar Mishra1, Vijai Kumar Gupta2 and Bhim Pratap Singh1*
1
Molecular Microbiology and Systematics Laboratory, Department of Biotechnology, Aizawl, Mizoram University,
Mizoram 796004 India.
2
Molecular Glyco-Biotechnology Group, Department of Biochemistry, National University of Ireland Galway, Galway,
Ireland.
Received 29 November, 2014; Accepted 23 February, 2015
The cashew nut shell liquid (CNSL) has been associated with a number of biological activities. The aim
of this study was to evaluate the insecticidal potential caused by CNSL from Anacardium occidentalle L.
(Anacardiaceae) upon Aedes aegypti and verify histomorphological alterations in the larval midgut. The
experiments were carried out using third instar A. aegypti larvae, exposed to CNSL at different
concentrations. After 24 h, the larvae were treated and stained with hematoxylin-eosin (HE).
Morphometric analyzes were performed on the A. aegypti larvae midgut and registered by
photomicroscopy. Anacardic acid was identified in CNSL by high performance liquid chromatography
(HPLC) and showed 69% purity. The minimum concentration of CNSL that promoted mortality of A.
-1
-1
-1
aegypti larvae (LC10) was 0.01 mg mL ; the LC90 was 0.139 mg mL and the LC50 was 0.07 mg mL .
Changes in the midgut were severe in larvae treated with CNSL, especially at concentrations of 1.0 to
-1
0.01 mg mL ; degeneration of the lining, hypersecretion of epithelial cells, increased vacuoles, and
separation of the epithelial cells from the basal membrane, and disintegration of the brush border and
rd
damage of the peritrophic membrane occurred. CNSL caused damage to the midgut of 3 instars of A.
aegypti by irreversibly disrupting their complete larval development.
Key words: Dengue fever, bioinsecticids from plants, morfology of midgut.
INTRODUCTION
Aedes aegypti (Lin, 1762) is the vector mosquito that has
the highest current dispersion in urban areas over the
world and the medical importance of its vectorial capacity
is to disseminate four serotypes of dengue virus as well
*Corresponding author. E-mail: [email protected]. Tel: (67) 9643-1980.
Abbreviations: CNSL, Cashew nut shell liquid; HE, hematoxylin-eosin; HPLC, High performance liquid chromatography; BOD,
biological oxygen demand; LD, lethal doses.
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
830
Afr. J. Biotechnol.
as yellow fever. The insect’s diurnal haematophagic
activity, the synanthropic behavior and anthropophilic
habits associated with the physical complexity of urban
centers have hampered its combat (Bessera et al., 2009).
Each year infections with dengue virus are estimated to
be responsible for more than 100 million of classic cases
and more than 500 thousand cases of dengue
hemorrhagic fever worldwide (Halstead et al., 2007). In
Brazil Dengue fever has reached about 3 million cases
since 1986.
The states with the highest incidence were Acre
(3619.5 cases per 100 000 inhabitants), Mato Grosso do
Sul (2,521.1 cases per 100 000 inhabitants), Goiás
(1353.1 cases per 100 000 inhabitants), Rondônia
(1256.4 cases per 100 000 inhabitants), Roraima (1146.9
cases per 100 000 inhabitants) and Mato Grosso
(1,095.5 cases per 100 000 inhabitants). These six states
account for 75% of cases in Brazil (Oliveira et al., 2011).
Synthetic insecticides, such as pyrethroids and
organophosphates, are commonly used to control
mosquitoes, but this application exposes operators and
environments. It also leads to the development of
mosquito resistance to the compounds (Rodriguez et al.,
2007). Chemical control with organophosphates was
shown to be inefficient in fighting the mosquito, and
among the organophosphates, temephos was reported
as Aedes-resistant by Melo-Santos et al. (2010). The
search for new substances such as those extracted from
plants has received special attention for natural
molecules. Complex extracts certainly reduces the risk of
resistance and the environmental toxicity (Wandscheer et
al., 2004). According to Phukerd and Soonwera (2013),
the use of plants and active molecules like proteins or
secondary metabolites could act against insect defense
mechanisms, causing them harm by inhibiting the
digestive process and/or altering their metabolisms.
Species from the botanical family Anacardiaceae, in
special genus Anacardium, are currently being
investigated for this purpose. Furthermore, Anacardium
occidentale L. (cashew tree) stood out among the 11
species under investigation in recent years, certainly due
to its high composition of phenolic lipids with antioxidant,
antigenotoxic, cytostatic (Stasiuk and Kozubel, 2010) and
insecticide activities (Asogwa et al., 2007), among others.
These compounds, namely anacardic acids, constitute
about 90% of the cashew nut shell liquid (CNSL) and is
the main industrial and manufactured byproduct of this
resinous plant (Mazzetto et al., 2009). A significant
number of biological activities is credited to this acid,
among them is the insecticidal effect on A. aegypti
(Laurens et al., 1997; Lomonaco et al., 2009;
Mukhopadhyay et al., 2010; Oliveira et al., 2011).
The aim of this study was to evaluate the insecticidal
potential of anacardic acid, a CNSL component from A.
occidentalle L. (Anacardiaceae), upon A. aegypti and
verify the histomorphological alterations in the larval
midgut.
MATERIALS AND METHODS
Source of plant material
The CNSL was provided by Kardol Chemical Industry, Campo
Grande, Mato Grosso do Sul - Brazil, from the endocarp of the A.
occidentale. The extraction of LCC is occurred with company
standard and patented methodology.
High performance liquid chromatography (HPLC)
The CNSL was further submitted to HPLC (Varian 210, Diode
Arrangement Detector) and software Star WS (workstation) was
used. The columns used were reverse phase C-18 (Phenomenex)
and the pre-column C-18. The elution process was carried out with
a graded program of solvent A: acetonitrile/water/acetic acid; and B:
100% of tetrahydrofurane. The pump flow rate was 1 mL min -1 and
20 μL were injected (22°C).
Identification of the compound with the aid of DAD detector
scanning in the spectral range of 200 to 800 nm did not reveal
interferences in retention time of the sample in HPLC by the
developed elution method. Standard was easily identified and
quantified based on their absorption spectra in the UV region and in
retention time. Standard found in extracts were unambiguously
identified by performing co-injection experiments in which aliquots
of the extract and standard were mixed and diluted to a known
volume, and analyzed through HPLC. The content estimation of the
anacardic acid (≥85%, Sigma Aldrich) in the CNSL was performed
by external calibration.
Bioassays
The experiments were performed in the Laboratories of Entomology
of Dom Bosco Catholic University (UCDB), Campo Grande, MS.
Larvae of late 3rd and early 4th instar of A. aegypti were used in the
tests, from mass rearing of eggs aged from two to three months
after oviposition, obtained from successive generations in vitro
maintained with blood meal for one hour and half every two
alternate days in the presence of partial light and temperature
between 25 and 30°C according to a validated method of Porto et
al. (2013) for conditions established by the use of biological oxygen
demand (BOD).
In order to confirm, susceptibility tests were performed with
concurrent positive control of Rotenone concentrations ranging
from 0.005 to 0.020 mg mL-1. The larvicidal biotest was performed
in quadruplicates using four different concentrations of CNSL: 1.0,
0.1, 0.01 and 0.001 mg mL-1, in batteries of tests at different times,
because the product is only 69% of anacardic acid and a mixture of
several minor components. Twenty-five larvae were exposed to
each specimen in the test solutions (25 mL) for 24 h, this is an
acute test; after this period, the number of dead insects and
survivors through stimulation with Pasteur pipette was observed.
Individuals that did not move after stimulation were considered
dead. Concentrations with the highest mortality were submitted to
calculate the concentrations of larvicide Lethal Doses (LD).
Statistical analyses
The results obtained were statistically analyzed by the Probit
method (Mclaughlin et al., 1991), using software Leora® (Polo
9735947870655352). The following standard doses prior dilution
1:10 considering the highest and the lowest toxic dose and four
doses between 0 and 100% effect were used. Then, parametric
analysis was performed by the probit method, using a random
Passari et al.
831
Figure 1. Lethal concentrations (mg mL-1) of different concentration of CNSL.
variable associated with a cumulative probability of response
between binary zero (0) and one (1). Once the calculation is set at
X2 or chi-square where defines the occurrence of two different
variables, and calculating to compare proportions by dispersing 90,
95 and 99% confidence.
Histology
The larvae were left standing in their respective concentrations for
24 h before further analysis was done at the darkened cephalic
capsule at room temperature in formaldehyde (4%) for a period of 2
h. These samples were processed in increasing concentrations of
ethanol and embedded in paraffin, sectioned at 5 μm and stained
with hematoxylin-eosin (HE). The morphometric analyzes were
performed in the midgut of the A. aegypti larval digestive system,
and captured in photomicroscope by Samsung® video camera,
coupled to microscope Bioval L2000C, using software IMAGELAB
version 2.4.
(Figure 2). Tests carried out with diluted CNSL caused
-1
mortality of dilution from 0.01 to 0.1 mg mL , and the
confidence interval for mortality is a significance level of
P <0.05. Anacardic acids and derivatives have been
reported in a number of works as having insecticidal
action, particularly for A. aegypti (Lomonaco et al., 2009).
The results of this study demonstrate that A. aegypti
-1
larvae and pupae are highly susceptible to 0.012 mg mL
CNSL. Larvae and pupae of Anopheles subpictus,
-1
however, are susceptible to 0.038 mg mL
Cardanol/CNSL solution (Mukhopadhyay et al., 2010).
-1
The cardol (LC50 = 14.20 ± 0.62 mg mL ) and cardanol
-1
(LC50 = 32.90 ± 0.2 mg mL ) obtained from CNLS
showed activity for A. aegypti (Lomonaco et al., 2009).
According to Oliveira et al. (2011), the three components
of CNSL demonstrated good larvicidal activity against A.
-1
aegypti (LC50 = 12.40 mg L for anacardic acid; 10.22 mg
-1
-1
L for cardol; and 14.45 mg L for cardanol).
RESULTS AND DISCUSSION
Composition of the CNSL and calculation of lethal
concentrations (LC)
The product was provided by Kardol, in which HPLC
analysis showed the presence of 69% of anacardic acid
and the remainder as a pool of substances according to
benchmark analysis. From the larval mortality curve
2
(Y=28.635ln(x) + 138.8, R = 0.9181) in relation to
increasing concentrations of CNSL (Figure 1), the
minimum concentration capable of producing mortality
-1
(LD10) was 0.01 mg mL and the maximum concentra-1
tion of toxicity (LD90) was 0.13 mg mL . The LC50 was
-1
calculated in the dilution range of about 0.07 mg mL
Histological analyses
The third instar A. aegypti larvae in the control group
showed elongated and wormlike external appearance.
The histological sections showed a normal morphology of
stomodeum stomach and intestinal cecum (Figure 3AB).
In the middle region of low cylindrical cells, acidophilic
cytoplasm with variable areas, central spherical nucleus
and clear nucleolus were seen. The brush border is
thicker and marked (previous) and the peritrophic matrix
(PM) is evident (Figure 3C). Morphological analysis in the
treated group based on different concentrations of CNSL
-1
showed concentration of 0.001 mg mL in three regions,
832
Afr. J. Biotechnol.
Figure 2. Larvae without treatment (A) and subjected to exposure of larvae active CNSL (B), 40x
magnification.
Figure 3. Photomicrography of 3rd instar larvae Aedes aegypti digestive system tissue. Control group. A) longitudinal section of
gastric cecum, cardia valve (cv), anterior midgut (am), middle midgut (mm), lumen (L). HE. 100X. B) Transversal section of
gastric cecum, ingesta (i), brush border (arrows), HE. 400X. C) Longitudinal section of posterior midgut (pm) and its brush
borders (arrows), HE. 400X.
cell shedding in the midgut, food debris and
fragmentation of MP. The changes were apparent in
gastric cecum, such as loss of brush border, and the
absence of material ingested by the larvae in the lumen
(Figure 4A). In the middle midgut, lining cells were
rounded, with lots of side crossings and scaling, with a
decrease in brush border and profuse secretion in the
lumen (Figure 4B). The epithelium hindgut cells
completely lost the lateral junction of flooring and base,
resulting in detachment of the cells to the lumen of the
hindgut. The brush border was evidenced in these cells
(Figure 4C).
The transition zone between the anterior and medial
regions were formed by throttling midgut with intestinal
-1
obstruction at a concentration of 0.1 mg mL (Figure 5A);
in the posterior region, the cells had elongated brush
border. The deleterious changes included total or partial
destruction of the lining cells, high vacuolization of the
cytoplasm and increased subperitrophic space with
accumulation of acidophilic materials (Figure 5C). The
Culicidae midgut of the larvae comprises three regions
(previous, middle and further) and is formed by a layer of
epithelial cells lining integral supported by a cylindrical
basement membrane. Like other insects, insect
abdominal region, in addition to its digestive function,
provides chemical defense function, mechanical protecttion and defense against pathogens (Roel et al., 2010).
The first change caused by anacardic acid in A. aegypti
larvae was related to movement, contrasting the control
group that showed great mobility and locomotion in liquid
medium. The larvae subjected to the highest concentrations of anacardic acid showed low resistance, lethargy
and immobility, with an overall mortality after 24 h of
exposure. By observing the tissue section, it was possible
to detect the disconnection of cells lining the basement
membrane and loss of intercellular junctions.
Passari et al.
833
Figure 4. Photomicrography of 3rd instar Aedes aegypti larvae digestive system treated with Anacardium occidentale
(Anacardic acid 0.01 mg mL-1. A) Transversal section of gastric caecum, nucleus (n), brush border (arrows), HE. 400X. B)
Longitudinal section of middle midgut, endoperitrophic space (ep), ectoperitrophic space (ecs), cellular secretion (cs), HE.
200x. C) Longitudinal section of posterior midgut, brush border (arrows), desquamation cell (dc), HE. 400x.
Figure 5. Photomicrography of Longitudinal sections from 3rd instar Aedes aegypti larvae digestive system treated with
Anacardium occidentale - Anacardic acid 0.1 mg mL-1 (A, B) and 1.0 mg mL-1 (C). A) Strangulation between the anterior and
middle midgut (arrow). HE. 200x. B) Stratification in the median midgut (est) desquamation cell (dc). HE. 400x. C)
Degeneration of the median midgut (d), remnants of the peritrophic matrix (small arrow). 400x. HE.
As for the mode of action of phenolic lipids against
larvaer A. aegypti, few studies have clarified the toxicity
mechanisms of these compounds in this organism. The
deleterious changes caused by anacardic acid were
observed in all three regions of the midgut of the larvae of
A. aegypti and this activity may be related to the chemical
structure of lipids phenolic. The aliphatic chain of
anacardic acid provides a hydrophobic nature, which
facilitates its permeation in the membrane of the cell wall
of the larva (lipoprotein membrane), which flows through
the apolar lipid bilayer of the group affecting the
permeability of the cell and within groups polar (phenolic
and carboxylic acid group) can act on the protein amino
acid residues of the organisms disabling them, as can be
observed in the changes described in Figures 3, 4 and 5,
this substance affect primarily the midgut epithelium, and
secondarily the gastric caeca and malpighian tubules,
successfully described histopathological alterations
showed that this substances affect primarily the midgut
epithelium, and secondarily the gastric caeca and
malpighian
tubules.
Successfully,
described
histopathological alterations after exposure of third-instar
larvae of A. aegypti to LCC. Larval death was observed
by Valotto et al. (2010), using catechin and tannin 0.037
-1
mg mL of Magonia pubescens on larvae of A. aegypti.
High cytoplasmic vacuolization, absence of boundaries
and formation of apical vesicles were seen. The epithelial
cells showed stratified, irregular nucleus and vacuoles.
Scudeler et al. (2014) define that the stratification and
transformation of a simple columnar epithelium into a
stratified epithelium, that is, new replacement of cell
layers showed that a sophisticated defense may occur to
replace the loss as a result of local lesions induced by
cells acid. Costa et al. (2012), in studies on A. aegypti
larvae exposed with methanolic extract of Annona
coriacea (Magnoliales: Annonaceae), described serious
histopathological changes, such as vacuolization of the
cytoplasm, hypertrophy of epithelial cells and their
nucleus, deterioration of the brush border, cell
disintegration and apical vesicles formation that released
834
Afr. J. Biotechnol.
their material in the intestinal lumen. In this work, we
observed the same changes caused by anacardic acid, a
phenolic lipid that constitutes the most of the liquid from
the bark of the cashew nut. The changes described in
this work are mainly caused due to a loss of control of the
ionic balance and water intake that is commonly reported
in treatments with oils, plant extracts and toxins (Scudeler
et al., 2014). The loss of the cytoplasm due to the release
of cytoplasmic protrusions may be indicative of a toxic
effect of anacardic acid in the columnar cells.
Conclusion
The LCC from A. occidentalle caused changes in the
midgut of A. aegypti larvae, triggering it irreversible
damage. In the light of the changes caused by anacardic
acid in the larvae, this product proved to be toxic and
potentially able to act as a larvicide and lethal action for
-1
90% of the population at a dose of 0.13 mg ml after 24
h exposure in vitro conditions.
Conflict of interests
The authors did not declare any conflict of interest.
REFERENCES
Asogwa EU, Mokwunye IU, Yahaya LE, Ajao AA (2007). Evaluation of
Cashew nut Shell liquid (CNSL) as a potential natural insecticide
against termites (Soldiers and Workers Castes). Res. J. Appl. Sci.
2(9):939-942.
Bessera EB, Fernandes CRM, Silva SÃO, Santos JW (2009). Efeitos da
temperatura no ciclo de vida, exigências térmicas e estimativas do
aumento de gerações anuais de Aedes aegypti (Diptera: Culicidae).
Iheringia Sér. Zool. 99 (2):142-148.
Costa MS, Pinheiro DO, Serrão JE, Pereira MJB (2012). Morphological
Changes in the Midgut of Aedes aegypti L. (Diptera: Culicidae)
Larvae Following Exposure to an Annona coriacea (Magnoliales:
Annonaceae) Extract. Neotrop. Entomol. 41:311-314.
Halstead SB (2007). Dengue. Lancet 370:1644-1652.
Laurens A, Fourneau C, Hocquemiller R, Cavé A, Bories C, Loiseau PM
(1997). Antivectorial Activities of Cashew Nut Shell Extracts from
Anacardium occidentale L. Phytother. Res. 11:145-146.
Lomonaco D, Santiago GMP, Ferreira YS, Arriaga AMC, Mazzetto SE,
Mele G, Vasapollo G (2009). Study of technical CNSL and its main
components as new green larvicides. Green Chem. 11:31-33.
Mazzetto SE, Lomonaco D, Mele G (2009). Óleo da castanha de caju:
oportunidades e desafios no contexto do desenvolvimento e
sustentabilidade industrial. Quim. Nova 32:732-741.
Mclaughlin JL, Chang C, Smith DI (1991). Bench-top bioassays for the
discovery of bioactive natural products: an update. In: ATTA-URRAHMAN (Ed.) Studies in Natural Products Chemistry. 9.
Amsterdam: Elsevier Science Publishers B.V. pp. 383-409.
Melo-Santos MAV, Varjal-Melo JJM, Araújo AP, Gomes TCS, Paiva
MHS, Regis LN, Furtado AF, Magalhaes T, Macoris MLG, Andrighetti
MTM, Ayres CFJ (2010). Resistance to the organophosphate
temephos: Mechanisms, evolution and reversion in an Aedes aegypti
laboratory strain from Brazil. Acta Trop. 113:180-189.
Mukhopadhyay AK, Hati AK, Tamizharasu W, Babu PS (2010).
Larvicidal properties of cashew nut shell liquid (Anacardium
occidentale L) on immature stages of two mosquito species. J. Vector
Borne Dis. 47: 257–260.
Oliveira MSC, Morais SM, Magalhães DV, Batista WP, Vieira EGP,
Craveiro AA, Manezes JESA, Carvalho AFU, Lima GPG (2011).
Antioxidant, larvicidal and antiacetylcholinesterase activities of
cashew nut shell liquid constituents. Acta Trop. 117: 165–170.
Porto KRA, Roel AR, Machado AA, Cardoso CAL, Severino E, Oliveira
JM (2013). Atividade inseticida do líquido da castanha de caju sobre
larvas de Aedes aegypti L., (1762) (Diptera: Culicidae). Rev. Bras.
Biocienc. 11(4):419-422.
Roel AR, Dourado D, Matias RC, Porto KRA, Bednaski AV, Costa RBM
(2010), The effect of Azadiracta indica oil on the midgut and the
development of Spodoptera frugiperda. Revista Brasileira de
Entomologia. Rev. Bras. Entomol. 54: 505 – 510.
Scudeler EL, Padovani CR, Santos DC (2014). Effects of neem oil
(Azadirachta indica A. Juss) on the replacement of the midgut
epithelium in the lacewing Ceraeochrysa claveri during larval-pupal
metamorphosis. Acta Histochem. 116:771-780.
Stasiuk M, Kozubel A (2010). Biological activity of phenolic lipids. Cell
Mol Life Sci 67: 841-860. Valotto CFB, Cavasin G, Silva HHG, Geris
R, Silva IG (2010). Alterações morfo-histológicas em larvas de Aedes
aegypti (Linna EUS, 1762) (Diptera, Culicidae) causadas pelo tanino
catéquico isolado da planta do cerrado Magonia pubescens
(Sapindaceae). Rev. Patol. Trop. 39: 309-321.
Wandscheer CB, Duque JE, Silva MAN da, Fukuyama Y, Wohlke JL,
Adelmann J, Fontana JD (2004). Larvicidal action of ethanolic
extracts from fruit endocarps of Melia azedarach and Azadirachta
indica against the dengue mosquito Aedes aegypti. Toxicon 44: 829835.
Vol. 14(9), pp. 835-842, 4 March, 2015
DOI: 10.5897/AJB2015.14403
Article Number: BCB227050967
ISSN 1684-5315
Copyright © 2015
Author(s) retain the copyright of this article
http://www.academicjournals.org/AJB
African Journal of Biotechnology
Full Length Research Paper
In vitro dilutions of thioridaxine with potential to
enhance antibiotic sensitivity in a multidrug resistant
Staphylococcus aureus uropathogen
Otajevwo, F. D.
Department of Microbiology and Biotechnology, Western Delta University, Oghara, Delta State, Nigeria.
Received 3 January, 2015; Accepted 19 February, 2015
This research effort seeks to use doses of thioridaxine to enhance antibiotic sensitivity in a multidrug
resistant (MDR) Staphylococcus aureus strain. Five axenic (pure) strains of S. aureus coded SA1 to SA5
were obtained from five infected midstream urine samples, inoculated on sterile cystine lactose
electrolyte deficient (CLED) agar and stocked on sterile nutrient agar slants at 4°C in a refrigerator.
Bacteria strains were sub-cultured on fresh sterile CLED agar and mannitol salt agar plates to confirm S.
aureus strains. Gram staining, catalase test and coagulase test were done on the resulting colonies to
further confirm the strains as S. aureus. Antibiotic susceptibility test was done by agar disc diffusion
method using sterile Mueller- Hinton agar plates before and after treatment with laboratory dilutions of
thioridaxine. S. aureus strains 1, 3 and 5 were multidrug resistant as they resisted 3 (37.5%), 3 (37.5%)
and 4 (50.0%) of the antibiotics used. The highest (11.8±1.4 mm) and least (0.8±10.0 mm) zones of
inhibition by all five strains were recorded for streptomycin and augmentin, respectively whereas, all
five uropathogen strains resisted cloxacillin, they were sensitive to gentamycin, cotrimoxazole,
chloramphenicol and streptomycin. After treatment with 2000 to 2240 ug/ml laboratory dilutions of
thioridaxine, ≤50.0% loss of resistance was recorded for each of all seven dilutions but only 2240 ug/ml
dilution recorded mean±S.E. loss of 56.2±17.8% for gentamycin, cotrimoxazole and streptomycin after
treatment of SA5 uropathogen. This was followed by resistance losses of 41.4±10.8 and 42.7±8.3%
induced by 2080 and 2200 ug/ml dilutions, respectively. Cumulative effect of all dilutions resulted in
40.0±8.2 and 40.5±17.1% borderline resistance losses to cotrimoxazole and chloramphenicol,
respectively. Minimum inhibitory concentration of chloramphenicol was lowered by 2080, 2160 and 2240
ug/ml dilutions of thioridazine by four-fold (7.5 ug), four-fold (7.5 ug) and two-fold (15 ug), respectively.
Upon this, the medical/chemotherapeutic implications of these findings are discussed.
Key words: In vitro, dilutions, thioridaxine, enhance, antibiotic, sensitivity, multidrug resistant Staphylococcus
aureus.
INTRODUCTION
Antibiotics resistance is not a new phenomenon.
However, the current magnitude and speed with which it
is developing is a cause for global concern (Namita et al.,
2012). According to WHO (2012), antimicrobial resistance is on the rise in Europe and all over the world with
gradual loss of first line antimicrobials. Epidemiological
studies have suggested that antibiotic resistance genes
emerge in microbial populations within five years of the
therapeutic introduction of an antibiotic (Chakrabarty et
al., 1990). Hence, numerous classes of antimicrobial agents
836
Afr. J. Biotechnol.
have become less effective as a result of the emergence
of antimicrobial resistance often as a result of the
selective pressure of their daily usage (Oskay et al.,
2009). This selective pressure has been attributed to
indiscriminate use of antibiotics, complex socio-economic
behavioral antecedents and dissemination of drugs
resistant pathogens in human medicine (Okeke et al.,
1999). Moreover, the disappointing lack of new antimicrobial agents has led to overuse of existing ones thus
leading to the emergence of multi-resistant pathogens
(McGowan, 2006). Therefore, as the proliferation of
multidrug resistant pathogens continue unavoidably
within and around us, it is important that their resistance
trend be put under check through intensive research and
antibiotic surveillance (Akortha and Filgona, 2009). The
primary causes of antibiotic resistance in bacteria are
mobile elements called plasmids and conjugative transposons. Plasmids are extra chromosomal DNA elements
that have the capacity to replicate independently of the
chromosome of the bacterial cell (Madigan et al., 2003).
Resistance plasmids or R plasmids code for enzymes
that can inactivate antibiotics, prevent the uptake of an
antibiotic or pump out the particular antibiotic (Neu,
1989). Other causes of antibiotic resistance are efflux
pumps, mutation, under dosage or use of drugs without
prescription (Amaral et al., 2013). Plasmids carry genes
some of which code for beta-lactamase or extended
spectrum beta lactamase which can inactivate or degrade
drugs thus rendering them ineffective (Amaral et al.,
2013).
Curing is the process of removing plasmids from a
bacterial cell (Trevors, 1986). The resulting bacteria then
become sensitive to the selective agent and it was initially
thought that this phenomenon would proffer solution in
controlling the development of antibiotic resistance in
formerly antibiotic susceptible bacteria. DNA intercalating
dyes (ethidium bromide), sodium dodecyl sulphate
(SDS), antibiotics, thymine starvation and elevated temperatures have been used as curing agents (Chakrabarty
et al., 1984; Gupta et al., 1980; Obaseki-Ebor, 1984;
Reddy et al., 1986). Novobiocin, ethidium bromide,
acriflavine, acridine orange, ascorbic acid and elevated
temperatures have been used as curing agents (Ramesh
et al., 2000). Physical treatments, chemical compounds
and growth conditions may increase the frequency of
elimination of drug resistant R-plasmids, resulting in
sensitive cells that were previously resistant to antibiotics
(Lakshmi et al., 1981). It has been reported that
phenothiazines have the ability to control overexpression
of efflux pump systems and thus are able to remove or
reduce antibiotic resistance (Viveiros et al., 2010; Amaral
et al., 2013). Mukherjee et al. (2012) reported the use of
1000 to 3000 ug/ml dilutions of a type of phenothiazine
and an anti-psychotic drug called thioridaxine to cure a
multidrug resistant strain of Pseudomonas aeruginosa.
Multidrug resistance is now common among familiar
pathogens such as Escherichia coli, Staphylococcus
aureus, Klebsiella pneumoniae, P. aeruginosa to mention
but a few (Nabeela et al., 2004). The enormous genetic
plasticity of the organism assists it to endlessly evolve
resistance mechanisms against existing antimicrobial
agents thus necessitating the need to control the spread
of resistant Staphylococcal isolates in hospitals and
health care settings (Gomber and Saxena, 2007).
Seventy percent to 90% of S. aureus strains
demonstrate resistance to the penicillins and aminopenicillins and hence, infections are often difficult to treat
because of widespread cross-resistance to aminoglycosides, macrolides, lincosamides, tetracyclines,
cephalosporins, carbapenems, beta-lactamase inhibitor
combinations, trimethoprim and sulphonamides (Nichols,
1999). While, vancomycin is often regarded as the last
line of defense against nosocomial and community based
S. aureus infections (Bhalakia, 2008), resistance has
been reported and there is a major concern that total
antibiotic resistant strains may emerge in the immediate
future (Diekema et al., 2001). Soonafter, the use of
penicillin, S. aureus was found to produce penicillinase
(beta-lactamase).
To overcome this situation, the antibiotic-methicillin was
used to replace penicillin and S. aureus strains resistant
to methicillin emerged very quickly (Woo et al., 2003).
This same pattern was also seen following the use of
vancomycin. Treatments that increase frequency of
elimination of plasmids will certainly enhance sensitivity
(effectiveness) of antibiotics in situ. There is no published
current work on use of laboratory dilutions of thioridaxine
in the treatment (curing) of a multidrug resistant S.
aureus uropathogen.
The focus of this work therefore, was the use of
laboratory dilutions of thioridaxine to enhance the
antibiotic sensitivity of multidrug resistant S. aureus
uropathogen with the following objectives: 1) Determine
the antibiograms of five selected S. aureus pure culture
strains obtained from cultures of midstream urine
samples after 37°C incubation for 24 h with the aim of
selecting a multi-antibiotic resistant strain; 2) determine
the antibiotic susceptibility profiles of a selected MDR S
aureus strain in terms of ≤50% resistance loss after
treatment with laboratory dilutions of thioridaxine (that is,
2000 to 2240 ug/ml); 3) show a summary of data of ≤50%
resistance loss by thioridaxine dilutions after treatment on
E-mail: [email protected], [email protected].
Author(s) agree that this article remains permanently open access under the terms of the Creative Commons Attribution License 4.0
International License
Abbreviations: MDR, Multidrug resistant; CLED, cystine lactose electrolyte deficient; SDS, sodium dodecyl sulphate.
Otajevwo
the MDR S. aureus strain; 4) determine thioridaxine
dilutions’ effect(s) on the minimum inhibitory concentration (MIC) of a selected antibiotic that recorded borderline
loss of resistance (that is, between 45 to 49% as
borderline to ≤ 50%).
MATERIALS AND METHODS
Sampling
Five pure (axenic) isolates (strains) of S. aureus were obtained from
24 h CLED agar plate cultures with appropriate labeling. The agar
plate medium used was one of several agar plates which had been
inoculated with freshly voided midstream urine samples by a
graduating student working on urinary tract infection in the
Microbiology and Biotechnology laboratory of Western Delta
University, Oghara. The status of the S. aureus isolates (strains)
was re-confirmed by aseptically inoculating representative colonies
on sterile Mannitol Salt agar plates. Inoculated plates were
incubated aerobically at 37°C for 24 h. Gram reaction, biochemical
and sugar fermentation tests by standard methods were then
carried out to identify the resulting colonies (Cowan and Steel,
1993). Catalase positive, coagulase positive, bright yellow smooth
gram positive cocci in clusters which were confirmatory of S. aureus
were then stocked on sterile nutrient agar slants and kept at 4°C in
the refrigerator after appropriate labeling for further use. The five
bacterial uropathogens were then subjected to antibiotic sensitivity
testing before treatment with laboratory dilutions of thioridaxine.
Antibiotic sensitivity testing
Antibiotic sensitivity testing was carried out on the pure culture
colonies of the five S. aureus strains using the agar disc diffusion
method on sterile Mueller-Hinton agar (MHA) plates (Bauer et al.,
1966). A loopful of each colony of the uropathogens was picked
aseptically using a flamed wire loop and placed in the centre of the
sterile MHA plates. This was then spread all over the plates
applying the caution of not touching the edges of the plates. The
seeded plates were allowed to stand for about 2 min to allow the
agar surface to dry. A pair of forceps was flamed and cooled and
used to pick an antibiotic multidisc (Abitek, Liverpool) containing
augmentin (30 ug), gentamicin (10 ug), erythromycin (5 ug),
tetracycline (25 ug), cotrimoxazole (25 ug), cloxacillin (5 ug),
chloramphenicol (30 ug) and streptomycin (10 ug). The discs were
placed at least 22.0 mm from each other and 14.0 mm from the
edge of the plates (Ochei and Kolkhatkar, 2008). Antibiotic discs
were selected on the basis of their clinical importance and efficacy
on various pathogenic strains of S. aureus. The seeded plates were
allowed to stand for 10 min before incubation (Mbata, 2007). At the
end of incubation, the diameters of the zones of inhibition from one
edge to the opposite were measured to the nearest millimeter using
a transparent ruler (Byron et al., 2003). Strains that showed
resistance against three antibiotics and above were termed multiple
drug resistant strains (Jan et al., 2004) and were noted and used
further.
Preparation of laboratory dilutions of thioridaxine
Thioridaxine (a phenothiazine also known as 2-methylmercapto-10(2-N-methyl-2-piperidyl-ethyl phenothiazine) dilutions of 2000 to
2240 ug/ml were chosen based on the lethal Dose-50 (LD50) of 956
to 1034 mg/kg administered orally on rats as reported by Barth et
al. (2006) and in line with a similar study carried out by Mukherjee
et al. (2011). Laboratory thioridaxine dilutions of 2000, 2040, 2080,
837
2120, 2160, 2200 and 2240 ug/ml were therefore prepared using
RV/O where stock or original concentration of thioridaxine used was
50 mg tablet (Southwood Pharmaceuticals, UK). The 50 mg tablet
was originally dissolved in 10 ml sterile water to give 5 mg/ml which
is equivalent to 5000 ug/ml. To obtain 2000 ug/ml dilution, 2 ml of
stock or original drug (5000 ug/ml thioridaxine) was mixed or diluted
with 3 ml sterile water. To obtain 2040 ug/ml dilution, 5.1 ml of stock
was mixed with 7.4 ml of sterile water. A mixture of 5.2 ml of stock
drug solution with 7.3 ml of sterile diluent resulted in a dilution of
2080 and 2120 ug/ml dilution was obtained by mixing 5.3 ml of
original drug solution with 7.2 ml of diluent (sterile water). To obtain
2160 ug/ml dilution, 5.4 ml stock drug solution was mixed with 7.1
ml of diluent, while a mixture of 1.1 ml of stock with 1.4 ml of diluent
gave a dilution of 2200 ug/ml. Lastly, 2240 ug/ml was obtained by
mixing 5.6 ml of stock with 6.9 ml of diluent.
Growing broth culture of MDR Staphylococcus aureus (SA5)
The stock culture of SA5 was selected from among the initial five
stocked strains. An inoculum of SA5 was aseptically picked from its
slant stock culture using flamed and cooled wire loop and
inoculated into 10 ml sterile Nutrient broth (LabM, UK). The
inoculated broth was incubated at 37°C for 18 h. The resulting
turbid broth culture was then diluted according to a modified
method of Shirtliff et al. (2006). Using a sterile pipette, 0.1 ml of
broth culture was mixed with 19.9 ml (1:200 dilution) of sterile
Nutrient broth. This was properly mixed and was used as working
inoculum and should contain 105 to 106 organisms and used within
30 min (Ochei and Kolhatkar, 2008).
Treatment of SA5 uropathogen with prepared thioridaxine
dilutions
The treatment of MDR S. aureus strain 5 with the prepared
thioridaxine dilutions was done according to a modified method by
Byron et al. (2003). Using a sterile pasteur pipette, 0.5 ml aliquot of
the diluted overnight broth culture of SA5 uropathogen was added to
4.5 ml sterile molten Nutrient agar (LabM, UK) and mixed. The
various prepared dilutions (one at a time) of thioridaxine were then
added in 0.5 ml volume. The set up for each dilution was then
poured on top of sterile hardened or set 2% Nutrient agar plates
and left to set. The same antibiotic multidiscs used before treatment
were then picked (using flamed and cooled pair of forceps) and
impregnated on the set agar overlay plates. Plates were incubated
at 37°C for 24 h. Measurement of diameter of zones of inhibition
was taken and recorded (NCCLS, 2000).
Determination of effect of thioridaxine dilutions treatment on
MIC of chloramphenicol
Serial doubling dilutions of chloramphenicol (using its MIC of 30 ug
as a basis) was carried out. Chloramphenicol was chosen for this
assay because it showed a mean ± S.E resistance loss of 40.5 ±
17.1 across all the dilutions (Table 3) and 45% is a borderline of
≤50.0% which is the benchmark for the purpose of this study. The
idea is that any thioridaxine dilution that can reduce the MIC may
enhance its sensitivity and therefore, loss of resistance is likely to
shore up from 45%. Sterile cotton wool plugged test tubes
numbering 11 (eleven) were set up on a test tube rack and labeled
1 to 11. Using a sterile pipette, 1 ml of sterile nutrient broth was
dispensed into tubes 2 to 7. Two milliliters of Nutrient broth was
dispensed into tube 8 as Nutrient broth control. Tubes 2 to 7 were
then labeled with chloramphenicol concentrations of 120, 60, 30,
15, 7.5, 3.75 and 1.88 ug/ml. A 250 mg capsule of chloramphenicol
838
Afr. J. Biotechnol.
Table 1. Sensitivity Profiles of five Staphylococcus aureus strains before treatment with laboratory dilutions of thioridaxine after
incubation at 37°C for 24 h.
Strain code
SA1
SA2
SA3
SA4
SA5
Mean±S.E
GEN
7.0
5.0
11.0
7.0
8.0
7.6±2.1
ERY
5.0
0.0
6.0
5.0
0.0
3.2±4.0
CXC
0.0
0.0
0.0
0.0
0.0
0.0
Antibiotic zones of inhibition (mm)
AUG
COT
CHL
0.0
9.0
5.0
4.0
8.0
6.0
0.0
5.0
4.0
0.0
6.0
7.0
0.0
5.0
6.0
0.8±10.0
6.6±1.5
5.6±0.8
TET
0.0
6.0
0.0
7.0
0.0
2.6±3.3
STR
10.0
10.0
13.0
12.0
14.0
11.8±1.4
GEN = Gentamicin; ERY = erythromycin; CXC = cloxacillin; AUG = augmentin; TET = tetracycline; CHL= chloramphenicol; COT =
cotrimoxazole; STR = streptomycin; SA1- SA5 = Staph aureus strains 1 to 5.
was dissolved in 10 ml of sterile water and diluted to 240 ug/ml
using RV/O in a sterile 200 ml transparent bottle. From this 240
ug/ml chloramphenicol preparation, 2 ml volume was pipetted into
tube 1. From tube 1, one milliliter was pipetted into tube 2 and
mixed and 1.0 ml was pipetted into tube 3 and mixed. From tube 3,
1.0 ml was pipetted into tube 4. Finally, 1.0 ml was pipetted into
tube 7, mixed and 1.0 ml was pipetted out and discarded. The
diluted S. aureus inoculum was then dispensed in 0.5 ml volume
into tubes 2 to 7. Into tube 10, two milliliters of the diluted broth
culture was dispensed. Into tube 9, two milliliters of the 240 ug/ml
chloramphenicol diluted drug was dispensed. The first dilution of
thioridaxine (2000 ug/ml) was then added (in 0.5 ml volume) to
each tube and the content of each tube was properly mixed. The
set up was repeated for each of the other dilutions of thioridaxine.
All tubes were incubated in a water bath at 37°C for 24 h. The MICs
as affected by each thioridaxine dilution were read and recorded.
RESULTS
Table 1 shows the antibiotic susceptibility pattern of S.
aureus strains 1-5 isolated from mid-stream urine
samples of which their sensitivity responses to
gentamicin, tetracycline, chloramphenicol, augmentin,
erythromycin, cloxacillin, cotrimoxazole and streptomycin
are shown. S. aureus strains 1 and 3 resisted three
antibiotics each (cloxacillin, tetracycline and augmentin),
SA2 strain resisted two drugs (erythromycin and cloxacillin)
while SA4 resisted two antibiotics which were cloxacillin
and augmentin. Only S. aureus strain 5 (SA5) resisted 4
(50.0%) antibiotics and these were erythromycin,
cloxacillin, augmentin and tetracycline. The highest
(11.8±1.4 mm) and least (0.8±10.0 mm) zones of
inhibition by all five strains were recorded for streptomycin
and augmentin, respectively. All the five S. aureus
uropathogens resisted cloxacillin. Because S. aureus
strain 5 resisted more than three antibiotics, it was
considered a multidrug resistant uropathogen and was
used further in the study.
Table 2 shows the sensitivity profile of SA5 (S. aureus
strain 5) after treatment with thioridaxine dilutions. The
uropathogen was resistant to erythromycin, tetracycline,
cloxacillin and augmentin. The uropathogen SA5 was
sensitive to gentamicin, cotrimoxazole, chloramphenicol,
and streptomycin with 8.0, 5.0, 6.0 and 14.0 mm zones of
inhibition, respectively (Table 1). Table 2 also shows data
of zones of inhibition of S. aureus strain 5 after treatment
with laboratory dilutions of thioridaxine. Zones of inhibition before and after treatment were also mathematically
computed to obtain ≤50.0% loss in resistance (that is,
improvement in sensitivity). Treatment with 2000 ug/ml
thioridaxine recorded a 60.0% loss of resistance to
cotrimoxazole.
Sensitivity improvement or resistance losses of 50.0
and 107.1% were recorded for chloramphenicol and
streptomycin, respectively, after treatment with 2040
ug/ml dilution of the chemical agent. After 2080 ug/ml
thioridaxine treatment, 80.0 and 85.7% resistance losses
were recorded for cotrimoxazole and streptomycin,
respectively. The same curing treatment resulted in a
less than 20% resistance loss to gentamycin and
chloramphenicol, respectively.
Resistance loss of 150.0% was recorded for
chloramphenicol after the uropathogen was treated with
2120 ug/ml dilution of thioridaxine whereas 80.0% loss of
resistance was recorded for cotrimoxazole after 2160
ug/ml thioridaxine treatment. For the same treatment,
less than 15.0% loss was recorded for streptomycin. After
2200 ug/ml treatment, 87.5 and 83.3% loss of resistance
were recorded for gentamycin and chloramphenicol,
respectively, while 20.0% and less than 10% losses were
recorded for cotrimoxazole and streptomycin, respectively. Lastly, resistance losses of 87.5, 60.0 and 78.5%
were recorded for gentamicin, cotrimoxazole and
streptomycin, respectively, after 2240 ug/ml thioridaxine
treatment. Table 3 is a summary of ≤50% loss of
antibiotic resistance after 2000 to 2240 ug/ml treatment
with thioridaxine laboratory dilutions. With regard to Table
1, only gentamicin, cotrimoxazole, chloramphenicol and
streptomycin recorded ≤50% loss in resistance. Only
thioridaxine dilution of 2240 ug/ml recorded mean ±S.E
loss of resistance for all the four antibiotics of
56.2±17.8%. Less than 45, 45, 40, 40 and 30% loss of
resistance were effected by 2200, 2080, 2040, 2120,
2160 and 2000 ug/ml laboratory dilutions of thioridaxine,
respectively, for all four antibiotics. All the dilutions put
together recorded mean ±S.E loss of resistance of
Otajevwo
839
Table 2. Thioridaxine dilutions that induced ≤50.0% loss in resistance after treatment on multidrug resistant SA 5 uropathogen.
Thioridaxine
dilutions ug/ml
2000
Selected antibiotics (% improvements in sensitivity)
Treatment
GEN
ERY
CXC
AUG
COT
8.0
0.0
0.0
0.0
5.0
Before
8.0
0.0
0.0
0.0
8.0
After
(60.0)*
(0.0)
(0.0)
(0.0)
(0.0)
CHL
6.0
6.0
(0.0)
TET
0.0
0.0
(0.0)
STR
14.0
14.0
(0.0)
2040
Before
After
8.0
8.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
5.0
(0.0)
6.0
9.0
(50.0)
0.0
0.0
(0.0)
14.0
29.0
(107.1)*
2080
Before
After
8.0
9.0
(12.5)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
9.0
(80.0)*
6.0
7.0
(16.7)
0.0
0.0
(0.0)
14.0
26.0
(85.7) *
2120
Before
After
8.0
9.0
(12.5)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
5.0
(0.0)
6.0
15.0
(150.0)*
0.0
0.0
(0.0)
14.0
15.0
(7.1)
2160
Before
After
8.0
8.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
9.0
(80.0)*
6.0
6.0
(0.0)
0.0
0.0
(0.0)
14.0
16.0
(14.1)
2200
Before
After
8.0
15.0
(87.5)*
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
6.0
(20.0)
6.0
11.0
(83.3)*
0.0
0.0
(0.0)
14.0
15.0
(7.1)
2240
Before
After
8.0
15.0
(87.5)*
0.0
0.0
(0.0)
0.0
0.0
(0.0)
0.0
0.0
(0.0)
5.0
8.0
(60.0)*
6.0
8.0
(33.3)
0.0
0.0
(0.0)
14.0
25.0
(78.5)*
*The values indicate the antibiotics to which the bacterial inoculum recorded equal to or more than 50% reduction in resistance after
treatment with the corresponding concentration or dilution of the curing agent-thioridaxine.
Table 3. Summary of ≤50% loss of resistance as induced by thioridaxine dilutions’ treatment on MDR
SA5 uropathogen.
Thioridaxine dilutions ug/ml
2000
2040
2080
2120
2160
2200
2240
Mean±S.E
Antibiotics whose resistance was reduced by ≤50.0%
GEN (%)
COT (%)
CHL (%)
STR (%)
Mean±S.E
0.0
60.0
0.0
0.0
15.0±8.4
0.0
0.0
50.0
107.1
39.3±12.1
41.4±10.8*
50.0
80.0
0.0
85.7
0.0
0.0
150.0
0.0
37.5±3.5
0.0
80.0
0.0
0.0
20.0±11.1
42.7±8.3*
87.5
0.0
83.3
0.0
56.2±17.8*
87.5
60.0
0.0
78.5
25.0±14.3 40.0±8.2* 40.5±17.1* 38.8±16.6
*The values indicate the antibiotics to which the bacterial inoculum recorded equal to or more than 50%
reduction in resistance after treatment with the corresponding concentration or dilution of the curing agentthioridaxine.
40.5±17.1, 40.0±8.2, 38.8±16.6 and 25.0±14.3% in that
descending order for chloramphenicol, cotrimoxazole,
streptomycin and gentamycin, respectively. This means
chloramphenicol and cotrimoxazole recorded borderline
loss of resistance as compared with the benchmark of
≤50%. Data on the effect of thioridaxine dilutions on the
minimum inhibitory concentration (MIC) of chloramphenicol
on the multidrug resistant S. aureus strain 5 uropathogen
are shown in Table 4.
At the end of 24 h incubation at 37°C of the
experimental set up, inoculum control tubes for all
thioridaxine dilutions (2000 to 2240 ug/ml) showed
turbidity (cloudiness) as expected. As expected also,
sterile broth control and drug control tubes remained
clear at the end of incubation. Laboratory dilutions of
2000, 2040, 2120l and 2200 ug/ml did not affect the
minimum inhibitory concentration (MIC) of chloramphenicol
as the MIC remained 30 ug. Reductions in MIC of
chloramphenicol were however effected by 2080, 2160
and 2240 ug/ml thioridaxine dilutions. Thioridaxine
dilutions of 2080 ug/ml and 2160 ug/ml reduced
chloramphenicol MIC to 7.5 ug each which is a four-fold
840
Afr. J. Biotechnol.
Table 4. The effect of thioridaxine dilutions on the minimum inhibitory concentration (MIC) of chloramphenicol on multidrug resistant
Staphylococcus aureus strain 5 uropathogen after 24 h incubation at 37°C.
Serial dilutions of chloramphenicol (ug/ml)
Thioridaxine
dilutions
(ug/ml)
New MIC after
thioridaxine
treatment
120.0
60.0
30.0
15.0
7.50
3.75
1.88
Inoculum
control
2000
2040
2080
2120
2160
2200
2240
No change
No change
7.5 ug (4-fold)
No change
7.5 ug (4-fold)
No change
15 ug (2-fold)
-
-
-
+
+
+
+
-
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
reduction, while 2240 ug/ml reduced the MIC to 15 ug (a
two-fold reduction).
DISCUSSION
This study has the underlining intent of making suggestions aimed at reclaiming some common old and not too
old drugs which are losing therapeutic usefulness owing
to ineffectiveness in terms of therapeutic outcome. The
alternative is to replace the old drugs with new ones but it
will be counter-productive because such new drugs may
be more costly, may be toxic (that is, may have more
adverse side effects), their use may need much longer
stay in the hospital (or longer duration of treatment) and
their use may require treatment in intensive care units.
Antibiotic susceptibility profiles of all five strains
(uropathogens) of S. aureus before thioridaxine treatment
in this study showed that the five uropathogen strains
were sensitive to gentamicin, cotrimoxazole, chloramphenicol and streptomycin with mean± SE zones of
inhibition of 7. 6 ± 2.1, 6.6 ± 1.5, 5.6 ± 0.8 and 11.8 ± 1.4
mm, respectively. The implication of this is that 4(50.0%)
of the antibiotics recorded positive reactions at the end of
incubation. Whereas, the five uropathogen strains were
resistant to cloxacillin, strains SA1 and SA3 resisted three
antibiotics each which were cloxacillin, tetracycline and
augmentin.
Strain SA2 resisted erythromycin and cloxacillin while
SA4 resisted cloxacillin and augmentin. The fact that SA5
strain resisted more than three antibiotics (that is,
erythromycin, cloxacillin, augmentin and tetracycline)
qualifies it as a multidrug organism (Jan et al., 2004;
Otajevwo, 2012). Strain SA5 was sensitive to gentamycin,
cotrimoxazole, chloramphenicol and streptomycin.
Findings suggest that infections or diseases caused by
MDR S. aureus strain 5 in the study environment and
perhaps in other environments can be treated
successfully
with
gentamicin/cotrimoxazole/
chloramphenicol/streptomycin (that is, any one of the
four) only or in synergistic combination a physician may
consider safe and potent. The privilege of choosing any
Sterile
broth control
-
Drug
control
-
of the four (except streptomycin perhaps) will be cheering
to low income patients in terms of cost and availability.
The almost total resistance recorded against augmentin
is worrisome because it is a drug that is used to treat a
good number of human diseases. Some authors have
also expressed similar worry over augmentin in terms of
antibiotic susceptibility (Oluremi et al., 2011; Otajevwo,
2012; Otajevwo, 2014). It was not clear whether the site
from where the pathogens were isolated had any direct or
indirect effect on the antibiograms of the strains as
recorded in this study. However, it may be possible that
pH changes or variation from site and presence /absence
of oxygen could affect the response of S. aureus (a
facultative aerobe) to relevant antibiotics it is exposed to
in vitro. The sensitivity profile obtained in this study
however, is subject to verification and confirmation by
other researchers.
The fact that each of the five strains was resistant to
two-four of the antibiotics used in this study may suggest
that very large population of S. aureus organisms have
been exposed to several antibiotics (Oluremi et al.,
2011). Thioridaxine laboratory dilutions of 2000, 2040,
2080, 2120, 2160, 2200 and 2240 ug/ml were used to
treat and cure five uropathogenic strains of S. aureus
with the intent of reducing their resistance significantly or
eliminating it completely. The loss of (≤50%) resistance
after treatment with the stated dilutions of thioridaxine
was used as the basis of establishing the curing effects of
these dilutions. The use of 50% and above loss in
resistance as a criterion to determine the extent of
plasmid curing was according to the scheme provided by
Akortha et al. (2011). Stanier et al. (1984) reported that
the elimination of plasmids by dyes and other natural
agents reflects the ability of such an agent to inhibit
plasmid replication at a concentration that does not affect
the chromosome. After treatment with 2000 to 2240 ug/ml
thioridaxine dilutions, S. aureus strain 5 still remained
completely resistant to erythromycin, cloxacillin,
augmentin and tetracycline. This could be due to the fact
that plasmids responsible for resistance to these drugs
may be chromosome- mediated or non- conjugative
plasmids (Akortha and Filgona, 2009). Many authors have
Otajevwo
profusely reported occurrence of multidrug resistant S.
aureus in their studies (Gales, 2000).
Thioridaxine dilution of 2000 ug/ml induced 60.0% loss
of resistance of the uropathogen to cotrimoxazole. Also,
only two antibiotics namely chloramphenicol and
streptomycin recorded 50.0 and 107.1% resistance
losses respectively after 2040 ug/ml thioridaxine
treatment (Tables 2 and 3). In a similar study, some
authors have used 2000 ug/ml thioridaxine dilution
treatment to induce loss of resistance (enhance antibiotic
sensitivity) in some multidrug resistant strains of
Pseudomonas aeruginosa and recorded elimination
(curing) of antibiotic resistance in thioridaxine treated
strains (Mukherjee et al., 2012). It was concluded in their
report that the antipsychotic drug-thioridaxine is a potent
agent able to eliminate drug resistance plasmids which
are much longer in size than the plasmids of other gram
negative bacteria (Mukherjee et al., 2012). From these
results, it seems thioridaxine dilution of 2240 ug/ml and
perhaps, 2080 or 2200 ug/ml may possess the capacity
to eliminate resistance put up by multidrug resistant
strains of S. aureus and therefore, could be administered
in the therapeutic control of various infections caused by
such bacteria. According to Mukherjee et al. (2012), the
simultaneous application of thioridaxine to patients may
open up a new arena of therapy. The simultaneous
application of thioridaxine may not only act as an
additional antibacterial agent but may also help to
eliminate the drug resistant plasmids from the infectious
bacterial cells (Spendler et al., 2006). Hence, patients
suffering from MDR S. aureus infections may be
administered thioridaxine at standard human doses
(using 2240 or 2080 or 2200 ug/ml as a basis) along with
antibiotics especially gentamicin, chloramphenicol,
cotrimoxazole or streptomycin.
Also in this study, sensitivity enhancement effect of
thioridaxine laboratory dilutions on the minimum inhibitory
concentration (MIC) of chloramphenicol as it affected
MDR S. aureus strain 5 uropathogen showed a four-fold
(7.5 ug), four-fold (7.5 ug) and two-fold (15 ug) reductions
in MIC of chloramphenicol as recorded for 2080, 2160
and 2240 ug/ml thioridaxine dilutions, respectively. Some
authors had reported similar findings on MDR S. aureus
strains (Otajevwo and Momoh, 2013) as well as on MDR
strains of Pseudomonas aeruginosa using acridine
orange (Otajevwo and Okungbowa, 2014). Otajevwo
(2012) reported similar results using ethidium bromide
dilutions on MDR strain of E. coli. A fast and accurate
determination of MIC can ensure optimal effective
treatment of patients while at the same time avoiding
over-prescription. This will save money for healthcare
providers as well as reduce development of resistance
(NCCLS, 2000; McGowan and Wise, 2001).
The MIC of chloramphenicol which is 30 ug (based on
long standing research) was reduced to 7.5 ug (four-fold
reduction), 7.5 ug (four-fold reduction) and 15 ug (twofold reduction) by thioridaxine laboratory dilutions of 2080,
841
2160 and 2240 ug/ml, respectively, as tested on multiple
resistant drug strain of S. aureus isolated from the urinary
tract of a patient.
According to Dimitru et al. (2006), there is a significant
correlation between MIC values and the inhibition zone
diameters obtained by a 30 ug disc. The lower the MIC
and the larger the zone of inhibition, the more susceptible
the microorganism is to the antimicro-bial agent and
conversely, the higher the MIC and smaller the zone of
inhibition, the more resistant the microorganism (Dimitru
et al., 2006).
The medical implication therefore of the four-fold, fourfold and two-fold reduction of chloramphenicol MIC by
thioridaxine dilutions of 2080, 2160 and 2240 ug/ml,
respectively, is that when doses of one of these dilutions
or a combination of any two are incorporated into the
manufacture of chloramphenicol or any other related
antibiotic and then administered to a patient diagnosed to
be suffering from a disease caused by MDR S. aureus
strain, a better result in terms of outcome (cure of the
disease) may be achieved as it will require four times its
concentration to function in vivo.
In a related work, Kohler (2010) showed that the
resistance of P. aeruginosa to tetracycline efflux was
reduced from MIC 0.032 to 0.004 ug/ml (an eight- fold
reduction) by treatment with phenothiazine. Crowle et al.
(1992) demonstrated that non- toxic concentrations of
phenothiazine in the lungs achieved complete elimination
of Mycobacterium tubercolosis. In a related study, some
workers had reported the capacity of an aqueous
methanolic plant- extract- epidiosbulbin- E- acetate (EEA)
to decrease the MIC of antibiotics against MDR bacteria
thus making antibiotic treatment more effective (Shiram
et al., 2008)
Conclusion
Thioridaxine laboratory dilution of 2040 ug/ml induced
≤50% resistance losses for gentamicin, cotrimoxazole,
chloramphenicol and streptomycin. Also, 2080, 2160 and
2240 ug/ml thioridaxine dilutions effected chloramphenicol
MIC reductions by four-fold, four-fold and two-fold,
respectively. Hence, patients suffering from MDR S.
aureus infections may be administered thioridaxine at
standard human doses (using 2080, 2160 and or 2240
ug/ml as a basis) along with any of the above antibiotics
(singly or in combination). It is hoped that this
simultaneous or part application of thioridaxine with
antibiotics will eliminate plasmids while enhancing the
penetration of antibiotics into pathogenic bacterial cells
especially those of MDR S. aureus. The likely effect of
this is that patient recovery will be facilitated and hospital
stay and hospital cost would be drastically reduced.
Conflict of interests
The author did not declare any conflict of interest.
842
Afr. J. Biotechnol.
REFERENCES
Akortha EE, Aluyi HAS, Enerijiofi KE (2011). Transfer of amoxicillin
resistance gene among bacteria isolates from sputum of pneumonia
patients attending the University of Benin Teaching Hospital, Benin
City, Nigeria. J. Med. Sci. 2(7):1003-1009.
Akortha EE, Filgona J (2009). Transfer of gentamicin resistance genes
among enterobacteriaceae isolated from the outpatients with urinary
tract infections attending three hospitals in Mubi, Adamawa State.
Sci. Res. Essay 4(8):745-752.
Amara L, Spendler G, Martins A, Molnar J (2013). Efflux pumps that
bestow multidrug resistance of pathogenic gram negative bacteria.
Biochem. Pharmacol. J. 2(3):119-121.
Barth VN, Charnet E, Martin LJ, Need AB (2006). Comparison of rat
dopamine D2 receptor occupancy for a series of anti-psychotic drugs
like thioridaxine. Life Sci., 78(26):3007-3019.
Bhalakia N (2008). Isolated and plasmid analysis of vancomycin
resistant Staph. aureus. J. Young Investigators. 18:1-5.
Bauer AW, Kirby WMM, Sherris JC, Turk M (1966). Antibiotic
susceptibility testing by a standardized single disc method.
Am.J.Clin. Pathol. 45:493-496.
Byron F, Brehm S, Eric AJ (2003). Sensitization of Staphylococcus
aureus and Escherichia coli to antibiotics by these sesquiterpenoids.
Antimicrob. Agents Chemother. 47(10):3357-3360.
Chakrabarthy PK, Mishra AK, Chakrabarti SK (1984). Loss of plasmidlike drug resistance after treatment with iodo-deoxyuridine. Indian J.
Expt. Biol. 22: 333-334.
Crowle AJ, Douvas SG, May MH (1992). Chlorpromazine: a drug
potentially useful for treating Mycobacterial infections. Chemotherapy
38:410-419.
Diekema DJ, Pfaller MA, Schmitz FJ (2001). Survey of infections due to
Staphylococcus spp: Frequency occurrence and antimicrobial
susceptibility of isolates collected in the United States, Canada, Latin
America, Europe and the Western Pacific region for the SENTRY
antimicrobial surveillance programme. Clin. Infect. Dis. 32(2):51145132.
Dimitru G, Poiata A, Tuchilus C, Buiuc D (2006). Correlation between
linezolid zone diameter and minimum inhibitory concentration valves
determined by regression analysis. Rev. Med. Chir. Soc.
110(4):1016-1025.
Gomber C, Saxena S (2007). Anti-Staphylococcal potential of
callistemon rigidus. Cent. Eur. J. Med. 2:79-88.
Gupta TD, Bandyopathy T, Dastidar SG, Bandopadhyay M, Mistra A,
Chakrabarty AN (1980). R- plasmids of Staphylococci and their
elimination by different agents. Indian J. Expt. Biol. 18:478-481.
Jan MB, John DT, Sentry P (2004). High prevalence of oxacillin
resistant Staph aureus isolates from hospitalized patients in AsiaPacific and South Africa: Results from SENTRY antimicrobial
surveillance program. 1998-1999. Antimicrob. Agent Chemother.
46:879-881.
Lakshmi VV, Padma S, Polasa H (1989). Loss of plasmid antibiotic
resistance in Escherichia coli on treatment with some compounds.
FEMS Microbiol. Letts. 57:275-278
Kohler NO (2010). Non- antibiotics Reverse Resistance of Bacteria to
Antibiotics in vivo. J. Antimicrob. Chemother. 24(5):751-754.
Madigan M, Martinko J, Parker J (2003). Brock Biology of
Microorganisms (10th edn). Prentice Hall, Upper Saddle River, NJ.,
USA. 500p.
Mbata TI (2007). Prevalence and antibiogram of UTI among prisons
Inmates in Nigeria Inter. J. Microbiol. 3(2):10-15.
McGowan JE (2006). Resistance in non-fermenting gram negative
bacteria: multidrug resistance to the maximum. Am. J. Infect. Control
34:29-37.
McGowan AP, Wise R (2001). Establishing MIC breakpoints and the
interpretation of in vitro susceptibility tests. J. Antimicrob. Chemother.
48:17-28.
Mukherjee S, Chaki S, Das S, Sen S, Datta SK, Dastidar SG (2011).
Distinct synergistic action of piperacillin and methylglyoxal against
Pseudomonas aeruginosa. Indian J. Exp. Biol. 49:447-551.
Mukherjee S, Chaki S, Barman S, Das H, Koley, Dastidar SG (2012).
Effective elimination of drug resistance genes in pathogenic
Pseudomonas aeruginosa by an antipsychotic agent–thioridaxine.
Curr. Res. Bacteriol. 5:36-41.
Namita J, Pushpa S, Lalit S (2012). Control of multidrug resistant
bacteria in a tertiary care hospital in India. Antimicrob. Resistance &
Infection Control. 1:23-30.
NCCLS (2000). Methods for dilution, Antimicrobial Susceptibility Tests
for bacteria that grow aerobically. Approved Standard (5th edition).
Wayne, PA, USA.
Neu HC (1989). Overview of mechanisms of bacterial resistance.
Diagnost. Microbiol. Infect. Dis. 12:109-116.
Obaseki-Ebor EE (1984). Rifampicin curing of plasmids in Escherichia
coli K12 rifampicin resistant host. J. Pharm. Pharmacol. 36: 467-470.
Ochei J, Kolhhatkar A (2008). Medical Laboratory: Theory and practice,
10th edition. New Delhi: Tata McGraw-Hill Publishing Company.
1338p.
Okeke IN, Lamikanra A, Edelman R (1999). Socio-economic and
behavioural factors leading to acquired bacterial resistance to
antibiotics in developing countries. Emerg. Infect. Dis. 5:18-27.
Oluremi BB, Idowu AO, Olaniyi JF (2011). Antibiotic susceptibility of
common bacterial pathogens in urinary tract infections in a Teaching
Hospital in Southwestern Nigeria. Afr. J. Microbiol. Res. 5(22):36583663.
Oskay M, Oskay D, Kalyoneu F (2009). Activity of some plant extracts
against multidrug resistant human pathogens. Iranian J. Pharm. Res.
8(4): 293-300.
Otajevwo FD, Momoh SA (2013). Resistance marker loss of multi-drug
resistant (MDR) Staphylococcus aureus strains after treatment with
dilutions of acridine orange. J. Med. Med. Sci. 2(2):43-62. ISSN:
2241-2328.
Otajevwo FD, Okungbowa A (2014). A study on resistance loss of
multidrug resistant (MDR) Pseudomonas aeruginosa strains after
treatment with dilutions of acrdine orange. Intl. J. Med. Med. Sci.
6(1):24-33.
Otajevwo FD. (2012). Sensitivity enhancement of multidrug resistant
urinary tract Escherichia coli isolate to some commonly used
Antibiotics after treatment with non-toxic laboratory concentrations of
homodium bromide. IOSR J. Pharm. 2(3): 540-568
Ramesh A, Halami PM, Chandrasekhar A (2000). Ascorbic acid induced
loss of a pediocin-encoding plasmid in Pediococcus acidilactici CFR
K7. World J. Microbiol. Bio. 16:695-697.
Reddy G, Shridhar P, Polasa H (1986). Elimination of Col. E1 (pBR322
and pBR329) plasmids in Escherichia coli on treatment with
hexamine ruthenium III chloride. Curr. Microbiol. 13: 243-246.
Shiram V, Jahagirdar S, Latha C, Kumar V, Puranik V, Rojatkar S
(2008). A potential plasmid curing agent, 8-epidiosbulbin E acetate
from Dioscorea bulbifera L against multidrug resistant bacteria. Intl.
J. Antimicrob. Agents. 32(5): 405-410
Stanier RY, Adelberg EA, Ingraham JL (1984). General Microbiology, 4th
edn. The Macmillan Press Ltd, Basingstoke London.
Trevors JT (1986). Plasmid curing in bacteria. FEMS Microbiol. Rev.
32(3):149-157.
Viveiros M, Jesus A, Brito M, Leandro C, Martins M. (2010). Inducement
and reversal of tetracycline resistance in Escherichia coli K12 and
expression of proton gradient-dependent multidrug efflux pumps
genes. Antimicrob. Agents Chemother. 49:3578-3582.
Woo PCY, Lau, SKP, Yeun KY (2003). Facilitation of horizontal transfer
of antimicrobial resistance by transformation of antibiotic-induced cell
wall- deficient bacteria. Med. Hypot. 61(4):503-508.
World Health Organization. (2012). Antimicrobial resistance in the
European Union and the World. Lecture delivered by Dr Margaret
Chan, Director-General of WHO at the Conference on combating
antimicrobial resistance: time for action. Copenhagen, Denmark,
March 14th, 2012.
African Journal of
Biotechnology
Related Journals Published by Academic Journals
Biotechnology and Molecular Biology Reviews
African Journal of Microbiology Research
African Journal of Biochemistry Research
African Journal of Environmental Science and
Technology
African Journal of Food Science
African Journal of Plant Science
Journal of Bioinformatics and Sequence Analysis
International Journal of Biodiversity and Conservation