1. No category

A
p
r
i
l
2
9
3
0
,
2
0
1
5
a
t
I
n
t
e
r
n
a
t
i
o
n
a
l
S
c
h
o
o
l
o
f
T
o
u
r
i
s
m,
S
u
r
a
t
t
h
a
n
i
R
a
j
a
b
h
a
t
U
n
i
v
e
r
s
i
t
y
,
S
a
mu
i
I
s
l
a
n
d
,
S
u
r
a
t
T
h
a
n
i
,
T
h
a
i
l
a
n
d
The Proceedings of
ASEAN Graduate Studies International Conference
2015
(AGSIC 2015)
April 29-30, 2015
International School of Tourism, Suratthani Rajabhat University
Organized by
Graduate School of Suratthani Rajabhat University, Surat Thani, Thailand
College of Graduate Studies & Teacher Education Research, Philippine
Normal University, Manila, Philippines
http://agsic.sru.ac.th/
© Suratthani Rajabhat University 2015
ISBN : 978-974-306-550-7
1
Contents
Copy Right
1
Contents
2
About the Conference
3
Message from the President of Suratthani Rajabhat University
4
Message from the Dean of the Graduate School, Suratthani Rajabhat University
5
Peer review
6
Keynote Speaker
Proceedings
7-13
14
-
Language Teaching and Learning
15-59
-
Business Administration
60-107
-
Curriculum and Educational Administration
108-159
-
Social Science and Environment Education
160-208
2
About the Conference
To initiate an academic platform for research sharing and collaboration among the academics
and students of graduate schools in ASEAN universities, Suratthani Rajabhat University and
Philippine Normal University have established a partnership to co-sponsor an International
Conference with the theme entitled: “Building ASEAN Collaborations to Promote
Interdisciplinary Research: Initiative for Research Consortium in ASEAN”.
The international conference will be held on April, 29-30, 2015, at the International School of
Tourism, Suratthani Rajabhat University, Samui Island, Surat Thani, Thailand.
This conference will serve as a podium for researchers, educators, and other participants to
contribute, learn, and exchange ideas and research findings on selected topics as specified in
the subtopics. The Graduate School of Suratthani Rajabhat University and the College of
Graduate Studies & Teacher Education Research of the Philippine Normal University are
pleased to invite researchers, educators and graduate students from all over the world to
present their researches or participate in this international conference at the beautiful, scenic,
and attractive Samui Island. All participants and distinguished guests will find and enjoy a
pleasant atmosphere to contribute and exchange their knowledge and expertise with regard
to interdisciplinary researches in the following topics:
 Science and Technology
 Culture, Education, and Language studies
 Social,Humanities and Liberal Arts
 Business and Management
 Tourism and Hospitality Industry
 Natural Resources and Environmental
Studies
It is expected that the contributions in the form of research, best practices, and posters from
presenters and participants will raise awareness, interests, and collaborative projects among
the academics, researchers, and students in ASEAN studies.
3
Message from the President of Suratthani Rajabhat University
As the ASEAN community commences, Suratthani Rajabhat University intends to become
one of the leading universities to serve and develop the local community. One way of
achieving such vision is through academic and profession collaboration with the allied
universities at both ASEAN and international level.
At present, Suratthani Rajabhat University has over sixty cooperative agreements with leading
universities in ASEAN member countries and over twenty countries around the world.
Over the approaching era, Suratthani Rajabhat University will assume a transformational
expedition in which the value and devotion of our staff, the local wisdoms, the use of
technology resources, and the resilient vision will not only advance ourselves but also help
the community and our partners to progress together with us.
Asst. Prof. Dr. PrayoteKupgarnjanagool
President
Suratthani Rajabhat University
4
Message from the Dean of the Graduate School, Suratthani Rajabhat University
We are proud to host the first ASEAN Graduate Studies International Conference (AGSIC) and
being the center for knowledge and research cooperation in the future. As the dean, I am
delighted to receive such great opportunity to work with valuable and acknowledged
academic staff, and local elites from our university, other universities, institutions, and our
local community. The work has been introducing me the insightful and resourceful
perspectives for the development of the Graduate School as well as the community. I truly
hope that we, scholars, will have a shared prospect and association in the near future in
order to academically and socio-culturally advance.
Dr. Puangpen Churintr
Dean, Faculty of Graduate School
5
Peer Review
List of Reviewers in ASEAN Graduate Studies International Conference (AGSIC)
April 29-30, 2015
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
Reviewers
Prof. Emerritus Dr.Suthep Chaovalit
Assoc. Prof. Dr.Syaharom
Assoc. Prof. Dr.Kowit Puang-ngam
Assoc. Prof. Dr.Thanasuwit Thabhiranrak
Assoc. Prof. Dr.Wirawan Chinviriyasit
Assoc. Prof. Dr.Ronnason Chinram
Assoc. Prof. Dr.Chirawat Nitchanet
Assoc. Prof. Dr.Panya Lertkrai
Assoc. Prof. Dr.Lertchai Sirichai
Assoc. Prof. Dr.Nattaya Piluntananon
Assoc. Prof. Dr.Sunthorn Bumrerraj
Asst. Prof. Dr.Sirichai Thamwanit
Asst. Prof. Dr.Pragasit Sitthitikul
Asst. Prof. Dr.Sivaporn Wangpipatwong
Asst. Prof. Dr.Rong Boonsuaykhwan
Asst. Prof. Dr.Saman Kaewwaiyut
Asst. Prof. Dr.Sompoet Panawas
Dr.Preedee Shoteshoung
Dr.Charinee Triwaranyu
Dr.Ananya Jarernpornnipat
21
22
23
24
25
26
Dr.Daravan Rongmuang
Dr.Supanrigar Watthanaboon
Dr.Parussaya Kiatkheeree
Dr.Kanokkan Kittichartchaowalit
Dr.Sirirat Choophan Atthaphonphiphat
Dr.Sonchai Jaiyan
University / Institute
Sukhothai Thammathirat Open Unviersity
Universiti Malaysia Perlis
Thammasart University
Suan Sanandha Rajabhat University
KingMongkut's University of Technology Thonburi
Prince of Songkla University
Suratthani Rajabhat University
Nakhon Si Thammarat Rajabhat University
Walailak University
Kasetsart University
Burapha University
Chulalongkorn University
Thammasat University
Bangkok University
Walailak University
Kasetsart University
Suan Dusit Rajabhat University
King Prajadhipok's Institute
Chulalongkorn University
KingMongkut's Institute of Technology
Ladkrabang
Boromarajonani College of Nursing Suratthani
Suratthani Rajabhat University
Suratthani Rajabhat University
Suratthani Rajabhat University
Suratthani Rajabhat University
Suratthani Rajabhat University
6
Keynote Speaker
7
Dr.Tanom Intarakumnerd
Education
Doctor of Education in Student Personnel and Guidance Education
Mississippi State University
Master of Education in Educational Psychology and Guidance
College of Education, Srinakharinwirot University
Master of Art in Industrial and Community Service
Eastern Kentucky University
Bachelor of Education in Secondary Education
College of Education, Srinakharinwirot University
Professional Training
Dr.Tanom Intarakumnerd, Ph.D. has completed many professional development courses
in various countries including for instance,
1997 Educational Visit to the United States of America for the Development
ofEducational Personnel Project
1992 Office of the Civil Service Commission’s 10thTop Executive Educational Program
in Educational Development in the United Stated of America and Canada
1981 Advance Research Methodology for Educational Projects, Macquarie
University, Australia
8
Professional Work and Contribution
Bureaucrat (selected positions)
2015
Chairman, ChiangmaiRajabhat University Board
2005-2013 Commissioner, National Higher Education Commission
2001-2002 Secretary of Rajabhat Institutes Council, Office of the RajabhatInstitutes
Council
1997-1998 Deputy Secretary of National Culture Commission Committee, Office of
the National Culture Commission
1994-1995 Deputy Director-General of Department of Teacher Education, Ministry of
Education
1985-1994 Director of Department of Teacher Education, Ministry of Education
1966-1969 Teacher of Thai language and Education, and a consultant of Student
Council, Nakornsrithammarat Normal School
International (selected positions)
- Training Director of the INNOTECH Centre, Regional Centre for Educational
Innovation and Technology (SEAMEO)
- Representative of Thailand to the UNESCO summit “Training for the Top
Executives of the Member Countries” in Bangkok
- Advisor of Teacher Training Program in Myanmar, UNESCO and UNPD
- Adjunct Professor,Western Carolina University, North Carolina, U.S.A.
9
Dr. Ester B. Ogena
Dr. Ester B. Ogena is the 10th President of the Philippine Normal University (PNU). She was
Director of the Science Education Institute of the Department of Science and Technology.
She holds a baccalaureate degree in Mathematics Education, Magna Cum Laude, from PNU
and earned her graduate degrees at the University of the Philippine (UP) specializing in
mathematics education for her masters and educational research and evaluation for her
PhD.
Dr. Ogena is an educator, researcher, writer, and editor. She made significant contributions in
the sectors of science and education and in human resource development that have lasting
impact for the country. For this, she has been recognized by various award giving bodies in
the Philippines and internationally.
Dr. Ogena sat in various agencies providing contribution to national development efforts,
among them are: Member of the International Council of Science Review Panel on Science
Education, Member of the Science and Technology Committee of the UNESCO National
Commission, Member of the Board of the College of Education at De La Salle University, and
Member of the Steering Committee of the K-12 Program of the Department of Education,
and others.
She was elected as Vice President of the National Research Council of the Philippines and
member of the editorial board of the Asia and the Pacific Collaborative Education Journal
(APCJ). Dr. Ogena has taught at UP College of Education, UP Open University and PNU.
With her innovative and pioneering leadership, she now serves as the Lead Shepherd of the
National Network of Normal Schools (3NS), the National Council President of the Association
of Southeast Asian Higher Institutions of Learning (ASAHIL) and the Chairperson of the ASEAN
Teacher Education Network (AsTEN).
10
Prof. Dr.Takeshi Matsuda
President, Kyoto University of Foreign Studies
Professor of American History (Ph.D. University of Wisconsin)
(Address)
6 KASAME-CHO, UKYO-KU, KYOTO, JAPAN 615-8558
Tel. 81-75-322-6710 Fax 81-75-322-6751
[email protected]
(Field of Competence)
U.S. History, History of American Foreign Relations, especially History of American-East Asian
Relations; U.S.-Japan Cultural Relations
(Recent Publications)
The Origins of Japan’s Dependency on the United States: US Soft Power Strategy (Taibei
Izon no Kigen) Tokyo: Iwanami Shoten, 2015
“Building the bilateral cultural-educational network” (Nichibei Anpotaisei wo sasaeru nichibei
bunnka-kyouiku nettowahku no kohchiku) H. Kan ed., The Cold War and Alliance (Reisen to
Dohmei) Kyoto: Shoraisha, 2014, 387-416.
“Cultural Cold War in Japan” Academic Bulletin, Kyoto University of Foreign Studies LXXX
2012, 15-43.
Making Japan of Which the Japanese Feel Proud as Global Citizens (Chikyujin toshite
Hokoreru Nihon wo Mezasite) Osaka: Osaka University Press, 2010
11
American Soft Power in Early Postwar Japan(Sengo nihon niokeru amerika no sofuto pawā)
Tokyo: Iwanami Shoten, 2008
Soft Power and Its Perils: U.S. Cultural Policy in Early Postwar Japan and Permanent
Dependency. Stanford, Calif.: Stanford University Press, 2007
(Translations)
Lloyd Gardner and Marilyn Young eds. The New American Empire.
Takeshi Matsuda et al. trans. Kyoto: Minerva shobō, 2007
Thomas J. McCormick, “American Hegemony and the Rhythms of Modern History,
1914-2000”『ヘゲモニー国家と世界システム』山川出版社,2002
(Occupation)
Professor of American History, Osaka School of International Public Policy,
Osaka University, October 2007—March 2010.
Trustee, Osaka University of Foreign Studies, 2004-2007
Vice-president, Osaka University of Foreign Studies, 2003-2007
Chairperson, Abe Fellowship Program Committee, Japan Foundation Center for Global
Partnership, Tokyo, Japan, 1997-98.
Member, Abe Fellowship Program Committee, Japan Foundation Center for Global
Partnership, Tokyo, Japan, 1992-98.
(Educational Background)
B.A. (1969) The University of Wisconsin-Madison, U.S. History;
B.A. (1970) Osaka University of Foreign Studies, English;
M.A. (1975) The University of Wisconsin-Madison, U.S. History;
Ph. D. (1979) The University of Wisconsin-Madison, U.S. History.
12
Dr. Zenaida Q. Reyes
Dr. Zenaida Q. Reyes is presently the Dean of the College of Graduate Studies and Teacher
Education Research of Philippine Normal University, the National Center for Teacher Education,
and formerly the Dean of the College of Arts and Social Sciences of the same university. Dr.
Reyes is also a full professor of Social Sciences, trainer in women studies, women’s rights,
human rights education, teaching social studies and social sciences, school leadership and
educational management, assessment and evaluation, and qualitative research. She has also
done researches and publications in the same areas. At present, Dr. Reyes is a member of the
Asian European Meeting (ASEM) Lifelong Learning Hub Research Network No. 4 with Aarhus
University, Denmark acting as the Secretariat. She was editorial consultant in integrating gender
core messages in teacher education, textbook evaluator, writer of Social Studies books and
articles for Elementary and Secondary school students and teachers and reviewer for the
Licensure Examination for Teachers. Occasionally, she was also invited by the Department of
Education, teacher education institutions and publishing houses as consultant and evaluator
for content and instructional design in Social Studies for basic and tertiary education.
Her academic background provided strong foundation for her professional career. Dr. Reyes
finished her Ph.D in Philippine Studies with specialization in Society and Culture at the Asian
Center, University of the Philippines; Master of Arts in Education in Educational Administration
at the Philippine Normal University; Bachelor of Science in Education major in Social Science,
Magna Cum Laude; and Postdoctoral Training in University Staff Development under the
German Development Foundation Scholarship at the University of Kassel, Witzenhausen,
Gemany.
13
Proceedings
14
Language Teaching and Learning
Research
ID
108
Name
Affiliation
Institution/
Title
Country
CAS
UNIQUENESS DIALECT MALAY PATTANI
IN ASEAN COMMUNITY
Hajah
Djusmaalinar
Prince of Songkhla
University
122
Nguyen
Thanh Huy
The Foreign
Languages and
Informatics Center,
Dong Thap
University
VIETNAM
THE BENEFITS OF VIOLET IN DESIGNING
LESSON PLANS AND EXERCISES FOR
TEACHING TOEIC AT DONG THAP
UNIVERSITY
125
Sitthichai
Sheewaroros
Humanities and
Social Sciences
Suratthani Rajabhat
University
THAILAND
THE DEVELOPMENT OF DAILY LIFE
LISTENING SKILL TRAINING PACKAGE OF
FIRST YEAR BUSINESS ENGLISH MAJOR
STUDENTS IN HUMANITIES AND SOCIAL
SCIENCES FACULTY SURATTHANI
RAJABHAT UNIVERSITY
138
John Carlos
S. Adversario
Philippine Normal
University, Manila
Tytana Colleges
PHILIPPINES SENIOR COLLEGE ESL STUDENTS'
READING COMPREHENSION LEVEL OF A
TECHNICAL TEXT
150
Angeline
Ibarra
Department of
Multilanguage
Program (MLP)
Suratpittaya School
THAILAND
154
Reynald M.
Cacho, Arnel
J. De Los
Reyes
Philippine Normal
University, Manila
Tytana Colleges
PHILIPPINES IT’S NOT JUST ENGLISH, IT’S
COMPLICATED: APPROACHING AT-RISK
COLLEGE STUDENTS
168
Supornphan
Konchiab
Massey University
NEW
ZEALAND
INTERGATING PROJECT BASED LEARNING
(PBL) IN DEVELOPING LANGUAGE SKILLS
INVESTIGATION OF COMMUNICATION
STRATEGIES USED BY THAI EFL
TOURISM STUDENTS THROUGH
MULTIPLE DATA COLLECTION METHODS
15
UNIQUENESS DIALECT MALAY PATTANI IN ASEAN COMMUNITY
HajahDjusmalinar
Faculty of Humanities and Social Sciences, Prince of Songkhla University
Abstract
Asian Community coming soon in years 2015th with Malay language elect as language
ASEAN. Malay language given side effect for Dialect of Malay Pattani; it is strong more in
the Thailand country. In southern border provinces of Thailand namely Pattani, Yala, and
Narathiwat, the majority of the population are Muslims Thai. In their daily life use code
switching in their speech, use both Malay and Thai in communication. Malay language for
them not problem because still maintain the use of their mother tongue and Thai language as a
national language. System word Malay language is not same between system word Thai
languages. They are not different vocabulary Thai and vocabulary Malay in speech. They are
direct used vocabulary Thai without to find equivalent word in Malay. This is an indication of
an ethnic language which has become a socio-culture.
Keywords: Muslim Thai, Malay Language, Thai Language, Dialect Malay Pattani
Introduction
Background
Language, culture and society are three components in interconnected. Language is a
tool, a culture is practiced with society every day, and society is users of the language and
cultureas practitioners. So, language and culture may change with the development society of
thinking people (Levi Strauss, 1961). Seeing background in Pattani, S. Thailand with especially
the namely samchangwatchaidenpaktaiare changed it.The society in here after development
with language and culture as to have its own identity. The identity language is Dialect of Malay
Pattani (DMP). It is the influence of the Thai language and Kelantan dialect.
Limitations of Problems
This research on focuses to the development, influence and vocabulary as identity
dialect of Malay Pattani.From the point one of 'development' will find that DMP speakers were
divided into three groups of speakers, point two of ‘influence’ while the effect associated with
educational speakers, and from point there of 'vocabulary' found that the vocabulary of a direct
loan from the Thai language unnoticed by the speaker.
Dialect of Malay Pattani: Identity speaker of South Thailand
Language is a communication tool used by speakers of the language. Speaker of the
language in southern Thailand use communication with Dialect of MalayPattani or DMP. DMP
is similar dialect to the state of Kelantan, Malaysia. This is because both the state near distance
and border. According Djusmalinar (2009) that speaker dialect of Malay Pattani (DMP) now
extant is divided into three generation. First generation is the oldest generation, second
generation is generation of teenager and third generation is children. The oldest generation
known with generation of parents. They of speakers stay in village and they have not been
affected education. Generally they are speaking full Malay or DMP. While the second
generation has been influence Thai education and they can speak double language. They can
code switching when speak. So the third generation is children with learning and education
Thai. They are not use well Thai language full because place school is village that used full
16
Malay language and vocabulary Thai not very much. FurthermoreWienreich (1953) dividing
this speaker dialect to speaker ordinate and sub-ordinate. Ordinate is a group of speaker can to
both languages, while the sub-ordinate only can one language. The case groupin southern
Thailand for ordinate is the second generation or generation teenagers because they are can use
two languages and used mix language when speak with friend.
The second generation can uses dual language because they are got formal Thailand
study from primary school until University. Now, used dual language in society like modern
status. Based on the observation of researches to the speakers found that speaker women more
uses Thai language than Malay language. Thai language used directly without selecting a
matching word in DMP with assumes that used vocabulary Thai easily understood when speaks
with partner.
As The following examples:
1. Communication in dormitory student out campus
Dah : SawasdeekhaLala.
Lala : SawasdeekhaduaiDah. Kun tham aria?
Dah : Dah,klamlang du run maitorosap.
Lala : Torosapkun run aria kna nee?
Dah : Kong can run Samsung.
Lala : Wan nee, Samsung le Apple mean kan.
From the example above discussion it was found that resident students or dormitory in
out campus when talking to her friend using full Thai language without the use vocabulary of
the Malay language. They argued friends will talk more easily understand what is discussed.
How men discussion?
Ali
: Wan buagapo?
Wan : Main torosop.
Ali
: Yihogapo?
Wan : YihoNokia.
Ali
: Geno takbelirunbaru?
Wan : Torosap nee juga dah molek.
Ali
: Bo mu yang duluko?
Wan : Yo la.
Group of men who were in the dormitory in out campus when talking more use of the
Malay language than Thai language. They are combining the use Thai language with Malay
language. Selection local language takes precedence over then of loan words. They better
understand where local words and loanwords.
2. Communication Theme of the Work
Sah
:Khit aria Na?
Husna : Nee, ko sop yang mai set.
Sah
: Ca…ca Na. Mai kriat.
Husna : Mai kriat. Ca…ca tham nee.
Kak Zuber ma wan nee.
Zuber : Ya, kanhariAhad.
Husna : Meraithi MO pit them?
Zuber : Belumsekarangsedangujian.
Sah
: Kak Zuber maikum sop?
Zuber : Jagajuga, tapibukanhariini.
Husna : Wan nee wangnah.
Zuber : Ya.
17
Their conversation was very pronounced three mutually maintain their identities. Both
teachers who speak Thai is Thai Muslims, while the other is the teachers who native speaker
Malay language. They can communicate with each other and understand each other well
contents of the conversation.If the above discussion emphasizes the teaching profession, how
the topic of conversation student who almost passed on the job? The following communications
obtained.
Lee
Amri
Lee
Amri
Lee
Amri
Lee
Amri
Lee
: Demo buatgapotu?
: Cari-carikerjani. Semester inikankitocop.
: Nakkerja di mano?
: Mano-manoboleh, asalsesuaidengankito.
: Abe Amrankato, kitongajiapobelumtentusesuaidengankerjokito.
: Ya, asal ado kaki, kitadapatjadi guru.
: ItujugaAbangAmrankato. Kita jangepilih-pilih.
: Geno Abe Amrankerjo di Bangkok?
: Kerjo di rumahtakdapat.
Discussion indicates that the teaching profession is the desire of every Thai Muslim
community. For them to be a teacher means to serve the nation and the state. They think to
retain mother tongue or DMP still be realized with the contribution through teaching
profession. Of the four examples above conversation can be concluded that the DMP has its
own language, still retains its identity but still receive outside influences from Thai language.
According Kridalaksana (2001: 179) emphasizes that language is a mental position or feelings
toward his own language or languages of others. Attitude is a manifestation of psychiatric
phenomenon can be seen in the actions and behavior. Attitudes toward language can be positive
and negative attitudes. There are three types of language attitudes, namely: (1) loyalty language
(language loyalty) that encourage people to maintain and prevent the influence of other
languages, (2) the pride of language pride) that encourage people to develop and use language
as a symbol of identity and unity of the society, (3) their awareness of language norms
(awareness of the norm) that encourages use of language norms premises (Garvin and Martiot,
1968). The third type of attitude languages including positive language attitudes.Judging from
the linguistic, Pattani Malay Dialect (DMP) in relation to Kelantan dialect in Malaysia. This is
evidenced by tone.
Melayu Baku
Dialek Kelantan
/makɛ/
/manɔ/
/gapɔ/
/genɔ/
makan
mana
apa
bagaimana
DMP
/makɛ/
/manɔ/
/gapɔ/
/genɔ/
In terms of the structure of the word, DMP more use of eka-syllable though the word is
derived from the dual syllable. It can be seen from the following example.
beri
duduk
nenek
sempat
> /wee/
> /duɂ/
> /ttoɁ/
>/dɛ/
18
There are also loan words from Thai language as follow:
Thai Language
torosap
yiho
cop
run
khit
pit them
etc
Conclusion
DMP is used in Thai south by Ordinate speakers generally use code switching or
indirect use of loan words in the Thai language. This is because the Thai language is the
language of the country and has been dominated by some people who are studying in
government schools or government. Sub-ordinates of speakers still use their mother tongue.
Both of these speakers have its identity as a sign of DMP.
References
Abdul, C. & Leonie, A. (2004). Sosiolinguistik: PerkenalanAwal. Jakarta: PT
AsadiRosdakarya.
DepartemenPendidikandanKebudayaan. (1991). KamusBesar Bahasa Indonesia. Jakarta,
BalaiPustaka.
DialekMelayuPatani:SatuTinjauan. Patani: JabatanBahasa-bahasaTimur,
FakultiKemanusiaandanKemasyarakatan, University SongklaNakarin, KampusPattani.
Djusmalinar. (2009). Majalah Dewan Bahasadalamartikel “Generasi Penutur Bahasa Melayu
di selatan Thai” edisiJulai 2009, halaman 32-34. Kuala Lumpur: Dewan
BahasadanPustaka.
Fishman, J. A. (1972). Language and Nationalism: Two Integrative Essays. Rowley, M. A:
Newbury House.
Halliday, M.A. K. (1972). “Language Function and Language Structure” in New Horizon of
Linguistic. London; Penguin Book.
Kridalaksana, H. (2001). Fungsi Bahasa dan Sikap Bahasa. Ende-Flores, Nusa Indah.
Kridalaksana, H. (2001). Kamus Linguistik. Jakarta, PT Gramedia Pustaka Utama.
Labov, W. (1994). Principilesog Linguistics Change. Oxford, Blackwell.
Sumarsono & Paina P. (2004). Sosiolonguistik. Yogyakarta, Pustaka Pelajar.
Tomas, L. & Shan, W. (2007). Bahasa, Masyarakat, dan Kekuasaan. Ter. Sunotodkk.
Yogyakarta, Pustaka Pelajar.
Trudgil, P. (1986). Dialect and Contact. Oxford: Basil Blackwell.
Waemaji, P. (1991). Long Consonants in PattaniMalay:the Result of World and Phrase
Shortening. MA Thesis. MahidolUniversity.RuslanUthai. (2005). Ciri-ciri Istimewa.
Wienreich, U. (1953). Languagein Contact: Findings and Problems. New York: Linguistics
Circle of New York.
19
THE BENEFITS OF VIOLET IN DESIGNING LESSON PLANS AND
EXERCISES FOR TEACHING TOEIC AT DONG THAP UNIVERSITY
Nguyen Thanh Huy
The Foreign Languages and Informatics Center, Dong Thap University
Abstract
This article mainly focuses on the benefits of Violet in designing lesson plans and
diversified exercises for students in the process of teaching TOEIC at Dong Thap University.
This program is applied not only help teachers create a lot of interesting lessons and useful
exercises but also help students be more active in studying English inside and outside
classroom. Also, it is about the reality of teaching and learning TOEIC at Dong Thap
University, the benefits as well as drawbacks teachers and students have met. To teachers, they
cannot provide students more useful exercises and knowledge because of the limited time and
the shortage of necessary teaching English programs.
Keywords: Violet, lesson plans, TOEIC
Introduction
Teaching and learning TOEIC play vital role to students at Dong Thap University
because this is one of the compulsory requirements for college and university students to get
graduation degree. Besides, TOEIC is also an important qualification to help students get good
jobs in the future.
In the process of teaching, teachers have designed many lesson plans which help
students feel more interested in learning as well as help them accomplish much knowledge and
necessary skills to get good results in TOEIC exams. Therefore, some effective programs have
been applied to enhance the quality of teaching and learning such as Hot Potatoes, TOEIC
Mastery. Especially, Violet is one of the most effective tools to design the lesson plans and
exercises for teaching TOEIC at Dong Thap University.
II. The advantages and disadvantages of teaching and learning TOEIC at Dong Thap
University
1. Advantages
Managers give students the best conditions to facilitate their self-studying TOEIC, such
as supplying free wi-fi, buying many kinds of TOEIC books for library and arranging rooms
for students to organize English learning activities in the evenings…Besides, the managers also
apply Learning Management System which consists of many useful exercises and practice tests
so that students can study at home and improve their knowledge and practicing skills.
Teachers play an important role in transferring useful skills, knowledge and techniques
to students, so they always adapt many kinds of materials and textbooks to create interesting
and diversified lessons for teaching in classroom. They also convey effective self-study
methods to help students’ self-study become more effective. In addition, teachers are being
created a lot of opportunities to improve teaching experiences by taking part in teaching
conferences as well as participating in teaching methodology classes organized by the Ministry
of Education and school’s managers. These are really good chances for teachers to share useful
20
teaching methods and skills with colleagues in the school and other teachers who come from
different universities in the country.
Students have made great effort to learn TOEIC because they have aware of the
importance role of learning this subject. Therefore, students have looked for different English
materials on the Internet and searched for learning websites to help them learn more useful
knowledge and practicing skills.
2. Disadvantages
Most of students were not aware of the important role of learning TOEIC, they only
spent little time and energy for studying and practicing necessary skills. Another reason, apart
from this, was that they were so busy with their major subjects.
It is very difficult for teachers to control all students because of large number of students
in each class. This is one of the biggest drawbacks which prevent teachers from helping weak
students. In fact, teachers can not give more exercises as well as knowledge to students because
the classroom time is rather short.
Teachers do not have time to design all lesson plans on computers and look for new
materials to give students. Besides, some programs are hard for teachers to design lesson plans
and exercises. These sometimes make students feel bored and passive when they learn TOEIC
in the classroom.
2. Benefits of Violet in designing lesson plans and exercises for teaching TOEIC
2.1. What is Violet?
Violet is the supportive software designing interesting electronic lesson plans, this
program can be used in different subjects for training purposes. This also support for e- learning
which are used popularly in many universities in Vietnam.
Violet is the only program in Vietnam which is certified SCORM standard by ADL (AntiDefamation League) organization. SCORM standard is the unique requirement for all
designing lesson plans software in Vietnam.
Here is Violet software interface
Picture 1: Violet interface
21
The program is designed with four main languages: Vietnamese, English, Japanese and
Netherlands. The users can flexibly in choosing appropriate language for designing their lesson
plans and exercises.
2.2. Benefits of Violet in designing lesson plans and exercises for teaching TOEIC
2.2.1. Benefits of Violet in designing TOEIC’s lesson plans
In teaching TOEIC, it is very important to design grammar exercises because it helps
students review and practice grammar structures which they have learned in high schools. In
fact, most of students mostly spend their time learning major subjects and they do not pay much
attention to learning English. It is very easy for students to forget many grammar structures as
well as necessary English knowledge. Therefore, teachers can design grammar lessons on
Violet so that students can review and practice basic grammar structures and well as increase
grammar knowledge. The picture below shows the grammar lesson designed for reviewing and
practicing basic grammar. The lesson includes grammar lesson which are useful for learning
TOEIC such as Tenses, Passive Voice, Infinitives and Gerunds, Conditional Sentences,
Comparatives and Superlatives, Relative Clauses, Modification, Indefinite Pronouns,
Conjunction and other important grammar structures. In each section, teachers can create its
own exercises and answer keys for each grammar point.
Picture 2. Grammar review and exercise for TOEIC designed by Violet
In the process of teaching TOEIC, teachers should design lesson plans coordinated with
some useful programs or software like Hot Potatoes, PowerPoint, Violet to make the lessons
more interested and effective. Moreover, this also motivates students in learning and focusing
on the lessons. The picture 3 shows the lesson plans of unit 10: HOUSING AND
ACCOMMODATION in TOEIC 2 textbook. Teachers have designed vocabulary review,
grammar lessons and games for teaching this lesson. More importantly, teachers can use this
software to design other English lessons in textbooks.
22
Picture 3. Lesson plan designed by Violet
In addition, there are many types of exercises which are used in TOEIC textbooks can
be designed with Violet, such as multiple choice, matching, short answer, True/False
statements, crosswords… Teachers can change interface and content of each module easily.
23
Picture 4. Multiple choice, matching and crossword exercise designed by Violet
Especially, teachers can use pictures, video files, flashes, writings, formulas to make
the lesson plans more variety. Besides, it is easy to select image effects, movable effects and
create connection between every parts of the lesson plans.
2.2.2. Benefits of Violet in designing TOEIC’ exercises
The TOEIC test is a multiple choice test that consists of 200 questions divided into 7
main parts:
- Part 1: Pictures Description
- Part 2: Questions and Responses
- Part 3: Short Conversations
- Part 4: Short talks
- Part 5: Incomplete Sentences
- Part 6: Text Completion
- Part 7: Reading Comprehension
It is easy for teachers to design exercises which support for these parts by using the
Violet. The pictures below show some types of TOEIC’ exercise teachers can make to help
students practice and review knowledge.
Picture 5. TOEIC test designed by Violet
24
2.2.3. How to use Violet with students
Violet is a very effective tool for designing lesson plans and exercises for teaching.
- Create various types of exercises: Teachers can create many types of exercises which
have pictures, sounds and videos added. Teachers can use these exercises directly on Violet
program or add-in PowerPoint’s background while teaching for students because this can help
teacher to link these exercise to other parts in a lesson.
- Vocabulary and grammar examples: Teachers can ask students to practice many
exercises which incorporate specific language grammar points or vocabulary.
- Combination with other software: Violet can combine easily with other software to
create effective lesson plans and exercises such as Sketchpad, Photoshop, Corel Draw, Word,
Excel... For example: teachers can draw pictures on Sketchpad and then put it in Violet or
teachers can create Word Art and Charts on Word and Excel before paste these parts into
Violet.
- Instruct students how to make their own knowledge revision: It is necessary for
students if they can learn how to create knowledge revision. They can create vocabulary banks
or grammar structure tables so that they can remember more effectively these knowledge in the
process of learning.
- Students created materials: students could find their own types of exercises and
design tasks or questions for other students in their class to answer. This not only help students
learn knowledge by themselves but this also enhance students’ interest and enthusiastic.
Conclusion
Violet can play relatively important role for teachers in designing lesson plans and
exercises for teaching TOEIC as well as other subjects. This is not only help English lessons
become more interesting but also provide students many useful information and exercises.
Teachers can create a large number of diversified exercises to attract student’s learning.
Especially, students themselves engage in studying English because they have many chances
to interact with modern technology instead of studying all the time with textbooks.
References
Website. https://www.pinterest.com/esheninger/web-2-0-tools-for-educators/. 25.4.2014.
Website. http://bachkim.vn/phan-mem-violet. 29.4.2014.
Website. http://sourceforge.net/projects/violet/. 1.5.2014.
25
THE DEVELOPMENT OF DAILY LIFE LISTENING SKILL TRAINING
PACKAGE OF FIRST YEAR BUSINESS ENGLISH MAJORSTUDENTS
INHUMANITIES AND SOCIAL SCIENCES FACULTY
SURATTHANI RAJABHAT UNIVERSITY
Sitthichai Sheewaroros
Humanities and Social Sciences, Suratthani Rajabhat University
Abstract
This Research aimed to develop and try out to check the quality of the training package
on Daily Life English Listening skill and to compare the ability of listening skill before and
after using the training package and to study the student’s satisfaction towards the package.
The sample were 53 first year students, first semester, academic year 2009, Business English
Major, Humanities and Social Sciences Suratthani Rajabhat University. The research tools
were 8 training packages: entitled: 1) “Meeting People”2) “People and Possessions”3) “Daily
life”4) “Time off”5)“Homes and shops” 6) “Good times, bad times”7) “Films, music, news
”and 8) “Let’s go away”,and the learning achievement test to check students' listening ability
before and after using the training package. It included the questionnaire to check the students’
satisfaction. The statistical used were percentage, mean, standard deviationand t-test of
Dependent Sample. The research results were:
1. The quality of the training package on Daily Life Listening Skill of First Year
Business English Major Studentswas efficient at 82.22/93.77, it was on standard ofE1/
E2at80/80.
2. The ability of listening skill of First Year Business English Major Studentsafter
learning by using the training package was higher than before statistically at .01. This showed
that the student gained good knowledge after using the training package on Daily Life Listening
Skill.
3.The satisfaction of First Year Business English Major Students towards the training
package was in the very high level. Most of the students satisfied with the training package and
it could be used in teaching to develop the listening skill.
Keywords: Daily Life, Listening Skill, Training Package
Introduction
At present English language was one among many language take important role in
communication as international language. It was important for Thai people to learn English
and get benefit of using it in communication, doing business, education, finding information,
and developing country. This included economy and political sciences in the country. As
globalization period people should gain ability of using language more than one language
especially people in education group both basic education and higher education. So to develop
the higher education curriculum, university set English language to be required subject and
selected subject for the students to lead them earn ability of using English as in listening
speaking reading and writing skills. Furthermore the student should have ability of
communication, find data and develop their ability of using English in their daily life.
26
Learning management in higher education, in integration for English language with 4
skills and using her in daily life should use many methods and let the learner use the language
in communication (Tubthong Kwangswas, 2549: 56). Listening skill was already used in
learning but to make student learned the real listening skill must be put away from the other
skills and by the way listening skill had already involved in other skill that was while teaching
context of language like stress words, level of sound, and rhythm of sentence. The method that
should separate from each other was listening for context and speaking for communication
(Sangvien Sariddikul, 2531: 57). This was good in apply to use in students daily life.
The listening skill was very first basic level in using language to be the tool for
communication with other. Students who were good in listening skill could develop their
speaking, reading and writing as well. Teachers took the important role to introduce the student
to the method to develop their listening skill and they needed to take a right method which fit
to the context (Uraiwan Konsiha, 2551: 24). Using training package was one among many
methods in teaching listening skill which lead to a good listening skill because training package
was one among the important methods in teaching as Suchada Tusaranon (2554 : 32) said that
the training package could help in develop students ability in language learning and skills
because the learner could practice and revise by themselves as much as they needed and it
could help the teacher by taking training package to be exercises in teaching and training
package could help teacher find student problems and way to solve the problems later.
According to the reason above researcher as a teacher of first year students’ bachelor
degree found the need to do this task inthe development of daily life listening skill of first year
Business English majorstudents inHumanities and Social Sciences Faculty Suratthani Rajabhat
University by using the training package that the researcher was made hoping it would be one
way to use in teaching and also it was the development of teaching quality which suited to Thai
qualification framework in higher education.
Objectives
1. To develop and find the quality of training package on Daily Life English Listening
skill of first year Business English majorstudents inHumanities and Social Sciences Faculty
Suratthani Rajabhat University.
2. To compare the listening ability before and after using training package on Daily Life
English Listening skill of first year Business English majorstudents.
3. To study the level of satisfaction on training package of first year Business English
majorstudents.
Research Methodology
Research methodology was as the following:
1. Select population and sample by Purposive Sampling methodology
2. Research tools were made by researcher as the following:
1) Daily life listening skill training package
2) Learning Achievement test on "Daily life listening skill training package".
3)Satisfaction questionnaire on "Daily life listening skill training package".
3. Created and checked quality of the tools by the way as the following:
1) Daily life listening skill training package, researcher studied and found out the
theory and connected researches before made the training package. After studied and found out
data, researcher created a book form and put document into a unit with analysis the data to
make training package. Finally researcher made evaluating package checking by 3 supervisors
to evaluate the training package according to the relationship rule.
27
2) For learning achievement test on the Daily life listening skill training package,
researcher managed as the following: studied English scope of the training package then
created the test checking by supervisors with testing Index of Item Objective Congruence. After
trying out the test with pararelled students then analyzed marks to check the difficulty,
discrimination,and reliability finally used the test with populations.
3) Satisfaction questionnaire on “Daily life listening skill training package" researcher
managed like this: first of all researchers studied the form and the way to create questionnaire
and created them. Later sent questionnaire to supervisors to check and used them with the
populations.
This research study was the way of using Daily life listening skill training packageas the
following:
1. Selected sample with Purposive Sampling
2. Researcher worked on it by using Daily life listening skill training package in 9 weeks
then used populations marks as they got while they studied at the end of each sections to check
it quality.When researcher finished using the Daily life listening skill training package he
checked learning achievement. Finally researcher checked and noted populations' marks to find
average of mark quality.
3. Populations completed Satisfaction questionnaire on “Daily life listening skill training
package" then checked average on it and compared them to the level as made.
Data analysis processed with computer program as the following:
1. Checked quality by using marks before and after learning process on "Daily life
listening skill training package" 8 packages to analyze with relationship rule between process
and result of 80/80
2. Used the mark from before and after learning achievement test on "Daily life listening
skill training package” to compare, find average, mean, and t-test on Dependent Sample.
3. Checked level Satisfaction on “Daily life listening skill training package".
4. Statistic used in this research
Researcher analyzed data by finding average marks of data, standard deviations,
difficulty and discrimination of the test,validity, reliability, and statistic to check mark average.
Results
From research result could be summarized. There were issues such as :
1. The result of creating "Daily life English listening skill training package" related to
curriculum in 2551 Business English MajorHumanities and Social Sciences Faculty Suratthani
Rajabhat University 8 packages which included instruction, learning objects, text, activities,
learning media and evaluation which included pre and post-test and advising after lessons.
Listening skill packages were 8 sets. For performance of English in daily life skill packages,
the result show that it was on the standard and proficient E1/E2 as 82.22/93.77
2. listening ability of 1st year Business English students major after learning listening
skill package were higher than before learning, statistically significant .01. This shown that
listening skill package that created could help students with listening skill more.
3. Overall satisfactions of students to Daily life English listening skill training package
were the highest level. When consider each part found that the part of after training was the
highest. Most of the student was satisfy with the training course and could use this to be their
tool in studying and it could lead the student getting better in their study.
28
Discussion
Researcher showed the result, of data analysis followed the research objectives as the
following:
Part 1
Result of creating and finding quality on "Daily life listening skill training package"
for 1st year Business English student follow the relationship rule between process
and result 80/80.
1. Finding efficiency of Daily life English listening training skill package
2. The result of creating "Daily life listening skill training package" related to
curriculum in 2551 Business English MajorHumanities and Social Sciences Faculty Suratthani
Rajabhat University 8 packages which included instruction, learning objects, text, activities,
learning media and evaluation which included pre and post-test and advising after lessons.
Researcher brought 8 packages of Daily life English listening training skill package that
rectified by the suggestion to test with 53 people from the example group, to found the
efficiency of the mark between pre-test and post-test to analyze efficiency with the relationship
between process and result 80/80 that shown the result on table 1.
Table 1
the efficiency of Daily life English listening training skill package.
Pre-test Mark
Post-test Mark
Average
E1
Mex
Average
E2
65.77
82.22
10
9.38
93.77
Mex
80
Quality
E1/E2
82.22/9.77
From table 1 showed that 53 1st year Business English major students on Daily life
English listening training skill package followed the criterion of relationship between process
and result 80/80 the efficiency E1/E2 equal to 82.222/93.77 as criterion that they specified E1/E2
equal to 80/80 when consider the average in percentage between study process with the training
skill package. Daily life English listening training skill package equal to 82.22 and the average
of percentage from the ability testing of post-test after they used Daily life English listening
training skill package equal to 93.77.
Part 2
The result of listening ability of 1st year Business English studentHumanities and
Social Sciences Faculty Suratthani Rajabhat University before and after using Daily
life listening skill training package.
The comparison result of the ability of 1st year students listening by using students pretest and post-test marks on Daily life English listening training skill package analyzing with ttest onDependent Samplesfound as on table 2.
Table 2 Comparison result on ability of 1st year students listening by using students pre-test
and post-test marks on Daily life English listening training skill package
Test
N
S.D.
t
df
Sig.

Pre-test
Post-test
53
53
7.45
9.38
1.90
0.79
-9.16
52
0.00**
** statistic significant .01
Table 2 This found that students post-test on Daily life English listening training skill
packagewas higher than pre-test by statistic significant .01. This shown that Daily life English
29
listening training skill packagewas qualify and It could helped students develop their listening
skill.
Part3
Students Satisfaction on "Daily life listening training skill package".
Satisfaction of students toward the use of "Daily life listening skill training
package".through sample group responding after practice "Daily life listening skill training
package" recorded and analyzed to determine the average and the standard deviation of satisfy.
The data showed in table 3.
Table3
Order
1
2
3
4
5
6
7
Students’ satisfaction on the training package
List
Before trained, you had listening skills.
After trained you had listening skills.
You understand listening skills package.
Contents of listening skills package could
developed.
You were satisfied with the structure of listening
skill package.
You got benefit from listening skill package
You had knowledge from listening skills
package.
total
x
4.02
4.70
4.62
4.49
S.D
0.54
0.54
0.62
0.58
Level of satisfy
high
highest
highest
high
4.66
0.55
highest
4.45
4.60
0.57
0.57
high
highest
4.51
0.56
highest
From table 3 found that students had complacency about using daily life English
listening training skill package was in the highest level. When considered each part found that,
the part of after training, there was in the highest level in listening skill from the highest average

at X = 4.70. Later the part of complacence in structure of daily life English listening training

skill package was X = 4.66.The part of understanding on daily life English listening training

skill package was X = 4.62. The part of knowledge from daily life English listening training

skill package was X = 4.60. The part of developing their listening skill of daily life English

listening training skill was X = 4.49. The part of information of daily life English listening

training skill package X = 4.45. The part of students pre-training, they commented that they

were the best for English listening skill X = 4.02. So, it shown that daily life English listening
training skill package, all most students were complacency, and could be effectively improve
listening English skill. So that, it made students got the highest ability in learning.
For teachers who want to train their students to use Learning package for listening
proficiency will increase or they will do well on listening exam. Learning package visuals,
regalia and authentic texts have used as aids in the classroom, and can have great value as an
integral part of English lessons. If teaching in an English as a foreign language country,
however, it is possible to go further, and make use of the outside world so that it becomes, as
it were, an extension of the classroom, where students are able to put into practice what they
have learned, and are taught how to make use of their surroundings as a source of
comprehensible input. We should definitely begin this process at lower levels, and expand it
30
as students advance in their learning. The bridges built between the classroom and the outside
world, and the more gradual transition to “post-classroom experience”, will not only make
language study more meaningful and motivating, but will stand the students in good stead when
it comes time for them to go forth as completely independent learners, without the support of
teachers, classmates or a language classroom. Furthermore language learning is multifaceted
(Nunan: 1987) and becoming increasingly important as globalization expands. As Russell D.
(2007) comments, accelerating international exchanges and interactions and opening
opportunities for people who know foreign languages.
It is also consistent with David Nunan (1991) defined the Communicative Language
Teaching (CLT) method with the following five principles:
1. An emphasis on learning to communicate through interaction in the target language.
2. The introduction of authentic texts into the learning situation.
3. The provision of opportunities for learners to focus, not only on language, but also
the learning process itself.
4. An enhancement of the learner’s own personal experience as important contributing
elements to classroom learning.
5. An attempt to link classroom language learning with language activities outside the
classroom (Nunan: 1991).
Recommendations
1. Added some context on listening to suit learner to help them in develop their listening
skill and other.
2. There should be continuously practices with the package still it could use in daily life.
3. This should be applying with listening training course to other skills for first year
students.
Acknowledgements
This study was supported by Suratthani Rajabhat University scholarship in 2009
academic year. I am grateful to the dean of Humanities and Social Science Faculty, Assistant
Professor Somsong Numnuan.
References
Fongsri, P. (2549). Classroom Research: Method and Action Technique. Bangkok: Printing.
Kobknasin, K. (2548). The Study of the Result from Teaching Method on Body Interactive
Learning to English Listening and Speaking Ability of Pratom 5 Student. Research
Master of Education Teaching and Curriculum major Nakonsawan Rajabhat
University.
MA, W.-X. (2011, July). Listening Teaching in the Context of Northwest University for
Nationalities. US-China Foreign Language, 9(7), pp. 450-455.
Nunan, D. (1991). Language teaching methodology : 9 textbook for teachers. Prentice Hall.
Nunan, D., Tyacke, M. & Walton, D. (1987). Philosophy and Guidelines for the Omani
English Language School Curriculum. Ministry of Education and Youth, Muscat,
Sultanate of Oman.
Piamsai, C. (2548). The Relation between Language Learning Method and the Ability of
English Listening with Computer Test Package for Thai Student bachelor degree
level. Doctor of Arts Research. English Language as International Language Major.
Julalongkon University.
31
Prasertsunton , V. (2548). Research Report on The Result of the Play Lesson Using to
Listening and Speaking Skills in English for Career 1. Chiangmai: Rajamongkol
Technology Institute Payab Campus.
Promvong, C.&Friends. (2540). Supplementary sheet on Media for Development Study
Education Major Sukothaithammatirat University. Nontaburi: Sukothaithammatirat
University Print House.
Russell, D. (2007). The language of business. UW. Business News Wire.
Srikramkran, R. (2544). English Language Teaching. 2nd Edition. Bangkok : Ramkamheng
University Print House.
Tsai, F-H. (2010). Integrating feature films with subtitles to enhance the listening
comprehension of students attending college in Taiwan. Ed.D. Theses, Alliant
International University, San Diego.
Vacca, J. A. L. (2003). Reading and Learning to Read. New York : Person Education.
Wallters, B. L. (2010). Improving listening skills in high-visual students with language
processing challenges. Ed.D. Theses, Saint Mary’s Collegeof California.
32
SENIOR COLLEGE ESL STUDENTS’ READING COMPREHENSION
LEVEL OF A TECHNICAL TEXT
John Carlos S. Adversario
Philippine Normal University, Manila Tytana Colleges
Abstract
This study aimed to determine the senior college ESL students’ reading comprehension
level of a technical text, to identify the effect of prior knowledge on students reading
comprehension, and to find out if there is a significant difference in the students’ prior
knowledge before and after reading the technical text.
This study is a quantitative type of research that used the pre-experimental method
using a technical text as a stimulus material. Forty (40) senior college Civil Engineering
students were used as samples for the study.
Major finding of the study showed that senior college ESL students still have
difficulties in reading a technical text even though the topic presented to them is related to their
field of study. However, it is also noted that the students’ prior knowledge increased as they
were exposed to the text, which led to a significant difference between the test scores.
The study concluded that a technical text appears difficult even for those who are
expected to have a good grasp about it. This could mainly be due that English is a second
language for the students, or that they need more exposure to the demands of their own
discipline.
Keywords: Reading, Reading Comprehension, Readability, Prior Knowledge, Technical
Text
Introduction
Reading has always been a tedious task for a number of individuals especially for young
learners who are exposed to different factors in their environment that may affect their attitude
and their level of comprehension or understanding a reading text. Further, the complexity of
the language especially when one has to use it for learning complex academic subjects has long
been recognized. Researchers concerned with the educational process and with the reading
process have investigated how these are influenced by educational, cognitive, psychological,
and cultural factors (Cummins, 1981; Collier, 1995; Pajares, 2003).
Of particular interest has been the ability to use language in school subject matter
learning termed as “Cognitive Academic Language Proficiency” (CALP), which is contrasted
with what Cummins called “Basic Interpersonal Communicative Skills” (BICS), characterizing
a more conversational language that is cognitively undemanding and embedded in context
(Pajares, 2003). Cummins (1985) in Diaz – Rico & Weed (2002) mentions that in relation to
BICS, CALP also represents a big importance in the student’s formal, academic learning
process. CALP is said to represent the entire system of thought that is needed in comprehension
and in learning. Both BICS and CALP play important roles in the recognition of the learners’
ability to learn in English as a Second Language (ESL) classroom.
To bridge the transition from the former to the latter, Common Underlying Proficiency
(CUP) is of prime importance in facilitating understanding of content and discipline-specific
language (Cummins, 1985).
33
Schema availability of the readers in relation to the text has long been claimed to have positive
correlation with comprehension. Consequently, some learners tend to understand more and
better than the others especially due to their familiarity with the language, content, and writing
conventions of a reading material. However, when a given text is highly technical, then perhaps
only those who are in the discipline would be able to grasp its intended meaning, since they are
supposed to have a more direct and more schemata available with which to aid their
comprehension. In an academic environment, this is normally measured through written exams.
Reading comprehension test has always been a part of any language examinations
especially in the tertiary level. Most if not all of the time, teachers and/or test constructors
choose any reading passages for testing with little or no considerations on the prior knowledge
required from the test takers to be able to pass it. This practice is true across levels, but it is
somehow more prevalent and more noticeably observed in so called “departmental
examinations” taken by college students regardless of their disciplines and specific fields of
specialization.
Assumedly, if a text is familiar to a particular discipline, the test will automatically be
biased for the students aligned to the discipline which will more likely help them answer the
questions more easily than those whose specialization is not the topic of the text. As a
consequence, they have the propensity to score higher and better.
Aside from this issue on generalizing a text no matter the fields of students’
specialization, there are still a lot of challenges that teachers and readers encounter. Reading
comprehension in English, may it be literary or technical, has always been an educational
problem, notwithstanding the fact that English and comprehension in this language are still the
best way for students who will soon become future professionals can to get access to the world
and gain the desired knowledge. Apparently, it is a must that students attain a certain level of
proficiency not only in their own field but also in the use of English and its comprehension as
applied in a very technical situation to have a good if not best comprehension of text written in
English is perhaps a vital skill for these students to function as future professionals in their own
fields. Unfortunately, reading comprehension has become a difficulty to many college students
especially in dealing with technical texts.
Hence, this study is undertaken to determine the reading comprehension level of senior
college ESL students of a technical text and identify the role of prior knowledge in facilitating
learning, the results of which can influence the selection of texts for exams given to college
students in various fields of specialization.
Objectives
1) To determine the role of prior knowledge in reading a technical text written in English
as a second language among college students;
2) To assess the reading comprehension level of college students prior to reading a
technical text;
3) To determine the students reading comprehension level after reading a technical text;
and
4) To find out if there is a significant difference between the pre and post test scores.
Research Methodology
This study is a quantitative type of research that used the pre-experimental method,
wherein one variable was manipulated while leaving the other one on its natural state. The
treatment then is employed on the manipulated variable making the difference becomes
evident.
34
The researcher used a case study as a stimulus material whose readability was checked
using Fry’s Readability Formula (McKenna, 2009) to assess the level of difficulty and to find
out whether the material is suited to the level of the readers.
It was taken from an internet source focused on civil engineering issues and challenges.
The text’s readability falls on the 17th level which is equivalent to fourth and fifth year college
level in the Philippines, appropriate for the level of the respondents. The text was then validated
by content experts who are civil engineers by profession and language experts who are English
language collegiate instructors. The topic of the reading text is on building construction titled
“Structural Assessment of an Existing Precast Concrete Superstructure for Change of Use”.
An anticipation guide by Herber (Buehl, 2000) was used in determining the prior
knowledge of learners before and after reading a technical text. This instrument forecasts the
major ideas of a text to find out agreement of knowledge between the text and the reader. The
anticipation guide was based on the stimulus material in which ten (10) statements were lifted
and paraphrased to present the text’s major concepts. These were arranged sequentially
according to the order of their appearance in the stimulus text (McKenna & Stahl, 2009).
Respondents were told to read each statement and to answer whether they agree or disagree
with it. This way, the statements correctly answered based on the stimulus were reflective of
adequate prior knowledge, whereas those incorrectly answered would reveal inadequacy or
absence of appropriate prior knowledge.
There were four phases followed for the data gathering of the study starting from the
identification of a stimulus material to its administration and interpretation to answer the
questions raised in the study.
Results/ Conclusion
Based on the study, the researcher’s findings are as follows:
1. Majority of the samples even though they are in the collegiate level still fall on the
borderline level of reading comprehension, and very few are in independent and instructional
reading level.
2. Students’ prior knowledge on their field increases as they expose themselves to
technical reading material related to their field of study.
3. A significant difference is seen in the pre- and post-reading test scores of the students
after even a brief exposure to a technical text related to their specialization.
Based on the findings, it can be concluded that:
1. Most college students hardly show mastery of the content of their chosen
specialization or field of discipline.
2. Exposure to a technical text even in just a short time allows for construction of
meaning which reinforces existing prior knowledge or provides input for learning through
accommodation. Prior knowledge plays an important role in the students’ understanding and
comprehension of a technical text. However, prior knowledge alone is insufficient to sustain
comprehension. The interplay of other factors aside from prior knowledge equips readers with
tools to facilitate understanding.
3. Discipline-related passages and selections for instruction and examinations affect
the meaning construction process of readers. Hence, no reading text is really fit for all and
therefore they cannot be used for all types of readers, specializations, and circumstances,
especially for college students who have already chosen a particular field of study.
35
Discussion
Objective 1: Assess prior knowledge before reading a technical text
The 10- item anticipation guide was administered to the respondents. The papers were
checked and the results became the basis for determining the comprehension level based on
Informal Reading Inventory (IRIs) criteria by McKenna and Stahl (2009) as shown below.
Table 1. Reading Comprehension Level
Level Score Description
Level
Score
INDEPENDENT
90 – 100 % comprehension
INSTRUCTIONAL
75 – 89 % comprehension
FRUSTRATION
Less than 50%
comprehension
Description
This is the level of supplementary
and independent reading. A learner
should be able to read the book at
home or school without aid. The
material causes no difficulty.
This is the teaching level. The
reading material must have been
challenging and not too difficult.
This is the lowest level of readability
even with a teacher support. The
material must have been too difficult
and frustrates the reader.
Table 1 shows the three levels of reading comprehension by McKenna and Stahl (2009).
The independent reading level is the highest level at which students can read fluently with good
comprehension without instructional assistance. The independent reading level is also known
as “free-reading level”. In the independent level, the students are expected to comprehend
within ninety percent to one hundred percent (90-100%) on his own, meaning that a reader
must be able to understand what he or she is reading even without the supervision of the teacher.
If the student or reader enjoys what he or she is reading it may be said that he or she is on the
independent level.
The instructional level on the other hand, is the level wherein students comprehend with
appropriate instructional support. Students who are on this level need the assistance of the
teacher for them to comprehend or understand what they are reading. If the students encounter
a lot of unfamiliar concepts and words, this means that his or her prior knowledge is also
limited.
The frustration level is the lowest level wherein even with instructional support the
reader fails to comprehend adequately. If the student finds the reading text too difficult even
with assistance he or she is on the frustration level, meaning the learner cannot find meaning
and relevance into what he/she is reading.
The fourth level which is not in the source cited is the borderline level, or the stage
when learners are neither in the instructional nor independent level, and there is still a chance
that they may step higher to instructional or fall to the frustration level. Barr, Bates, Blachowicz
et.al. (2007) state that students who are neither in the acceptable instructional level or
borderline level need to be helped through proper instruction and exposure to reading such as
peer or group reading, taped reading guides, or guided reading by the teacher to avoid their
going down to the frustration level.
36
However, in the collegiate level, borderline is a problem because the main focus of
students in this level of study is not on their general reading level but on their specific
discipline’s depth and breadth of content so that they can hurdle the major subjects in their
field. The researcher sees this as a problem for comprehension greatly matters in the cognitive
development and understanding especially in the major subjects offered to them.
The students should have attained a certain level of mastery of their specialization
considering the fact that they are already in the fourth year of their studies and nearing the
taking of national licensure examination.
Table 2. Reading Comprehension Level before Reading
Student
Number
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
RC Score
(/10)
8
9
8
7
6
6
7
7
8
7
7
5
5
9
7
6
7
5
5
5
Percentage%
RC Level
80%
90%
80%
70%
60%
60%
70%
70%
80%
70%
70%
50%
50%
90%
70%
60%
70%
50%
50%
50%
INS
IND
INS
*B
*B
*B
*B
*B
INS
*B
*B
*B
*B
IND
*B
*B
*B
*B
*B
*B
Student
Number
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
RC Score
(/10)
6
5
7
9
4
8
4
7
4
8
4
7
8
8
9
8
8
7
5
8
Percentage%
RC Level
60%
50%
70%
90%
40%
80%
40%
70%
40%
80%
40%
70%
80%
80%
90%
80%
80%
70%
50%
80%
*B
*B
*B
IND
FRU
INS
FRU
*B
FRU
INS
FRU
*B
INS
INS
IND
INS
INS
*B
*B
INS
Legend: IND- independent (90% and above); INS- instructional (75-89%);
FRU-frustration (less than 50%); B- borderline (50-74%)
Only 10% of the students were in the independent level in relation to the technical text,
a case study on strength of building materials, which was very much a part of their content and
discipline. It means that these students can read and understand a reading text with the
assistance of their instructor or teacher. However, with the demands in the collegiate teaching
and the expectation on the respondents’ adequacy of prior knowledge, this result was quite
surprising. Table 2 shows the pre-test reading comprehension level of 40 senior college
engineering student respondents of the study. Arranged from the highest reading level, 4 or
10% of the respondents were in the independent level (student number 2, 14, 24, and 35); 10
or 25% were in instructional level (student number 1, 3, 9, 26, 30, 33, 34, 36, 37, and 40);
another 4 or 10% were in frustration level (student number 25, 27, 29, and 31); and finally, 22
or 55% were in the borderline (the remaining student numbers).
From the data, it can be said that more than half of the students were in borderline, one
fourth was in instructional level, and only a few were in independent and frustration levels.
The borderline was highlighted because this level was not included in McKenna and
Stahl’s (2009) reading level; hence, this was added in this study to point out a difference with
that of frustration, although both of these are quite alarming in relation to the year level of the
respondents who were supposed to possess wide knowledge with respect to their chosen field.
37
Table 3. Comparison of Reading Levels before and after Reading the Technical Text
Reading
Comprehension
Pre-test Result and Percentage
Post-test Result and Percentage
Level
Independent
2
5%
4
10%
Instructional
4
10%
10
25%
Frustration
6
15%
1
2.5%
Borderline
28
70%
25
62.5%
TOTAL
40
100%
40
100%
Table 3 presents the comparison of the pretest and post test results and the percentage
equivalent. Whereas in the pre-reading there were only 5% of the students in the independent
level, it increased to 10% in the post-test, a result showing an improvement in comprehension
after they had been exposed to a technical text.
This was also true for those in the instructional level with only 10% of the students in
the pre-test, but it went up to 25% after reading. This indicated that reading served a facilitative
function in comprehension among those who apparently were proficient in reading.
There was also a positive result for those who were in the frustration level-15% in the
pre-test, but it was reduced to 2.5% in the post-test. It should be recalled that this level is the
lowest, where readers find a text very difficult that they could not read it on their own nor with
teacher assistance. This is not discounting the fact, though, that help is still in order for those
whose reading level does not meet expectation of their specialization. Instructional adjustments
and additional scaffolding could be planned before letting the students graduate and earn their
diploma as specialist in their own field.
For the borderline level of readers, there were 22 or 55% of the students in the pre-test,
but it increased to 25 or 62.5% in the post-test, a good indication of reading growth after a brief
exposure to a technical text, only 30 minutes maximum to process and facilitate understanding
of textual intents. But unfortunately, this case was not what it should be since the academic
level of the respondents were supposed to manifest content mastery prior to a few months
before graduation.
Considering all the limitations of data gathering for this study, it could be said that the
role of prior knowledge served readers in different and various ways such that it appears
difficult to make it the sole cause of comprehending or non-comprehending of the text,
particularly in the genre and the language of the stimulus material used.
It could be claimed though that the results seem to point out how prior knowledge tends
to aid proficient readers construct meaning from texts.
A closer look at the individual results of pre- and post-test could serve as cases for
understanding the nature and the role of prior knowledge specifically when processing a highly
technical text such as the one used in the study. It could be surmised that although general
reading strategies and metacognitive behaviors are utilized in every reading act, the processing
is to be adjusted depending on the text, context, and reader factors (Cook, 1986).
This is one lens to use in analyzing the changes of scores from pre- to post-test.
Objective 2: Find out the difference between the pre and post test scores.
To find out the significant difference in the before- and after-reading tests, the
researcher analyzed the data gathered using T – test for independent samples run with the SPSS
Computer software. Table 8 shows the results of the statistical treatment used.
38
Table 4 Paired Samples Statistics
Mean
N
Std.
Deviation
Std. Error
Mean
Before
6.1500
40
1.45972
.23080
After
6.7000
40
1.52248
.24073
Pair 1
Table 4 shows the difference of the scores before and after reading the text, where (N)
or 40 is the total number of sample. The before reading mean is 6.1500, while the post reading
mean is 6.7000, a value which is .5500 lower than the after reading mean. The standard
deviation before reading is 1.45972 and the post-reading standard deviation is 1.52248. The
standard error mean is .23080 for pre-reading and .24073 for the post-reading.
The numerical value gained from the statistical treatment applied in the data could be
interpreted descriptively as a big improvement in the post test after the samples have been
exposed to the stimulus material, a technical text in civil engineering in the form of case study.
Such improvement, however, needs to be further described to determine whether the
improvement was significant.
Table 5 reflects the correlation between the statements in the anticipation guide and the
technical text used as a stimulus material. Other information provided in table 9 shows the
significance level of difference between the two scores.
Table 5. Correlation and Significance Level of Difference
Test
N
Correlation
Sig.
before &
40
.482
.002
after
Table 5 shows that there is a .482 correlation between the two tests done. A significance
level of .002 was also recorded and proved that there was a significant relationship between
the reading text and tests administered. In statistics, the measure of significance should not be
higher than .5 to determine that there is a significant difference. Hence, it could be said that
there was a significant improvement in the after reading test from the pre – reading test based
on the significance level of .002 which is lower than .5.
Overall, this shows that students gained some understanding and this changed their
comprehension level after reading the text, despite the observation that when taken
individually, a more detailed picture could be inferred. This also shows that although majority
of them were on the borderline level, they could somehow find text congruence with their
existing schemata, though this might not be enough to fully comprehend a technical text written
in English, a second language among the respondents.
Pair 1
39
Recommendations
Based on the conclusions drawn, the following are recommended:
1. Conduct comparative study of two technical fields to see the difference between the
levels of the learners’ understanding based on their familiarity with content.
2. Triangulate the results of the study with an interview and case study to deepen the
understanding on prior knowledge and its role in processing technical texts.
3. Use other genre of technical texts such as abstract, scientific report, and journal
articles as stimulus materials to measure prior knowledge and depth of content knowledge in
specific disciplines.
4. Try other instruments to check comprehension level before and after reading.
5. Compare the processing of technical texts and academic expository texts to point out
strategies that help readers comprehend in both texts.
6. Use reading materials and tests that relate to the readers’ field of specialization to
avoid biases in results.
Acknowledgements
The researcher would like to thank Dr. Merry Ruth Gutierrez who served as the paper
adviser. Prof. Ma. Jhona B. Acuna for her support given to the researcher.The individuals who
served as validators of the instrument; Engr. Juan Carlo E. Bautista, Engr. Romeo A. David,
Prof. Augustus Ceasar B. Latosa, and Prof. Jamaine E. Evangelista.
The Philippine Normal University community for the knowledge imparted to the
researcher. Manila Tytana Colleges; Dean Lorna D. Tamboong and Prof. Ofelia M. Mutas for
the support and understanding.
The Civil Engineering students who played a vital role in the realization of this research.
The friends, and family of the researcher and his partner in life – JP.
Above all, to the Almighty Father for everything He has bestowed upon the researcher.
References
Barr, R., Bates, A., Blachowicz, C., et.al. (2007). Reading diagnosis for teachers:
An instructional approach. Boston, MA: Pearson Education.
Buehl, D. (2001). Classroom strategies for interactive learning. USA:
International Reading Association.
Cook, S. (1986). The interactive model of reading comprehension. Boston:
Allyn & Bacon.
Cummins, J. (1985). Language, power, and pedagogy: Bilingual children in the
crossfire. Clevedon: UK.
Diaz – Rico, L. & Weed, K. (2002). The crosscultural, language, and academic
development handbook: A complete K-12 reference guide. Boston, MA:
Allyn& Bacon.
McKenna, M. C. & Stahl, K. (2009).Assessment for reading instruction. New York:
Guilford Press.
Pajares, F. (2003).Current directions in self – efficacy research.Advances in
Motivation and Achievement,Vol. 10.
40
INTEGRATING PROJECT BASED LEARNING (PBL)
IN DEVELOPING LANGUAGE SKILLS
Angeline Ibarra
Department of Multilanguage Program (MLP) Suratpittaya School
Abstract
The importance of English as an international language is well known throughout the
world. The significance of the language has been further emphasized in South East Asia due to
the emergence of the ASEAN community. Different practices and methods for improving
English teaching and learning amongst teachers have been widely implemented across the
ASEAN nations. Project Based Learning (PBL) was integrated in English learning for
Mattayomsuksa 3 students in the Multilanguage Program (MLP) at Suratpittaya School
Thailand. The main aim of the study was to increase language ability as well as competency
regarding the BE.2551 curriculum through working on a project. Students were asked to choose
a project based on their interests in a supplementary course in English. Weekly assignments
were given and students were tasked on: researching, collecting information, planning, writing
up a report and preparing a final presentation. The course coordinator acted as a supervisor
while students also consulted mentors who were experts in a particular area. The project work
consisted of both individual and group tasks. Each group was given a weekly project chart that
tracked their progress over the duration of the project and was then monitored and assessed by
mentors and supervisors. Students were asked to provide details of their work along with their
working process. The final presentation is in the form of a report and an oral presentation. They
will include the results from the project work and will be graded according to the rubric score.
Throughout the project it was found that 80 percent of students showed significant
improvement of proficiency in English whilst their competency overall also improved. The
feedback survey obtained from students participating in the program revealed that a satisfactory
level of learning was acquired due to PBL process catered for their learning style. Results of
data analysis and teaching practice including students’ attitudes toward learning setting were
also discussed.
Keywords: PBL – Project Based Learning, English learning, language skill, competency
Introduction
The learning and teaching of a foreign language has been talked about for at least two
thousand years and the actual activity has probably been carried on for many millions more
(Dunkel, 1948). Even with all this combined experience, there is no set method for learning a
language. In the past century, many styles of teaching have emerged with debates raging across
the academic world as to which style is the most effective. This constant scrutiny of various
methods has led to them evolving and adapting. Methods of teaching that were once heralded
as key for appropriating a second language are now less popular or have fallen out of use
completely (Mukoroli, 2011).
41
It goes without saying that the vast amount of research done in the field of language
appropriation reflects the perceived importance of learning a second or foreign language
worldwide. Different practices and methods for improving English teaching and learning
amongst teachers have also been widely implemented across the ASEAN nations.
In Thailand, learning English as a foreign language has been highly recommended in
the Thai education system as it has become the de facto lingua franca of ASEAN (Kirkpatrick,
2010). It has been introduced with the aim of improving student competency to communicate
effectively in English so that Thais are well prepared for the ASEAN community.
The nature of learning styles in Thai classrooms is generally teacher-directed with
students becoming passive learners. The students quietly listen to their teachers, behave well
and follow their teachers’ instructions. This style of learning is influenced by Thai culture
which places importance on a social hierarchy (Prpic & Kanjanapanyakom, 2004). Students
can speak or ask only when they’re allowed (Noytim, 2006). Because of this, many learning
styles have been used to improve and increase the participation of Thai learners in the
classroom (Khamkhien, 2012).
In order to attempt to overcome the problems of learning English, classroom
participation and overall learning confidence, project-based learning (PBL) was implemented
as a new teaching method in this study. It focuses on how PBL can enhance the students’
English learning ability, attitude and self-confidence. When students choose their own areas of
interest, they put more effort on the task and enjoy doing it as well.
What is Project-Based Learning (PBL)?
PBL is not a new approach in education. It has been implemented in various disciplines
in the classroom and has been explained as a process of learning where students are responsible
for their own education (Solomon 2003). PBL was integrated into second language classrooms
to develop language skills, personality and global knowledge through project work. Project
work is driven by students’ need to develop their own tasks individually or in small groups.
This approach creates links between real-world language and the language used in text books.
Thus, PBL is a teaching method aimed at problem solving in a collaborative
environment over an extended period of time. It is a hands-on experience which starts from
driving questions or problems that creates activities and leads to meaningful products at the
end (Simpson, 2011).
This study presents the results of the PBL approach of teaching English as a second
language for Matthayom 3 (Grade 9) MLP students in English by an English foreign teacher.
The project ran for approximately 10 weeks including data collection, interviews, project
development and presentation of final project work. In addition, students’ attitudes towards
PBL were examined through self-reported questions.
Participants and Setting
Fifty-two Mattayom 3 (Grade 9) students studying in Multilanguage Program (MLP)
Suratpittaya School, Thailand participated in this study. All students had taken and passed two
foundation English years. The subject was taught in English in the second semester of the
academic year 2014-2015.
Multilanguage Program (MLP)
The main aim of MLP is to nurture students who are potentially interested in languages
and provide an opportunity for studying with native speakers. Students studying in this program
are exposed to three languages, i.e. Thai, English and Chinese that is integrated in learning
activities (Suratpittaya School, 2010).
42
Procedure
The time frame is for the duration of the second semester of the academic year 20142015 which consisted of 10 weeks. Each study period is 55 minutes. Students meet the teacher
for two study periods each week but they are free to do their projects anytime of the week.
Consultation time can be spent with either the mentors or the supervisor.
The supervisor is the subject teacher who monitors the progress of each
individual/group in the class. He/she evaluates the students’ performance and gives
recommendations on how to continue the project based on their weekly progress. The mentor
is chosen by each group; their decision is reflected by the field of interest their project is
focused on tackling. A mentor can be another teacher or other skilled professional. The
supervisor cannot act as a mentor to a group.
An introduction of PBL was given to the students before the start of the project.
Students were told to split themselves into groups consisting of 3- 4 students. Each group was
tasked to think of three different project ideas that interested them and to make that the core
focus of their project. These three ideas are then brought to the supervisor for consultation.
After consultation, they were to choose one project to take on for the whole term.
Students were assessed both as a group and individually. The group project encourages
all students to work together as a group and to learn from each other. Individual research lets
the students pursue their own personal subject of interest.
A group project folder was given to each group for them to write down their progress
and for the supervisor and mentors to comment and mark. Each student was also given a
research worksheet to do during the study period. During the lesson periods, each student does
individual research. They think of a question that they are interested in solving and then begin
research. These questions were then orally explained to the supervisor during exam/ evaluation.
Projects were assessed midway through the term with each group showing 50% of their
projects completed. Individual research was assessed by the supervisor with an oral
examination where students were asked to explain three different research answers and
elaborate on what they learned.
The final project was presented to the supervisor and mentors. Each group was
interviewed about what each student contributed to the project; how they were able to complete
their tasks and the things that they had learned.
Finally, a self-reported questionnaire with 10 items was distributed to investigate
students’ attitude towards PBL with an English foreign teacher.
Research Methodology
The research instruments used in this study were lesson plans, PBL work and evaluation
sheets, test items and self-reported questionnaires. Lesson plans included teaching materials
worksheets and an evaluation sheet. Finally, the five Likert scale self-reported questionnaire
with 10 items.
Data Collection
Four sources of data were collected in this study, they were: the group project work
score; the individual research work with oral examination score; the mentors’ comments and
marks; and the students’ attitudes survey.
Data Analysis
Students’ were given marks separately for their individual research and group work.
For the individual research, students were asked to orally elaborate on 6 out of 10 research
questions they came up with during the 10 week study period. Each question was worth 10
43
points and the supervisor awarded points according to these factors; use of English language,
clarity of information given and personal understanding of the topic.
Group project work was assessed according to these factors: research topic (20%);
creativity and use of skills (20%); use of language (20%); information/knowledge (20%) and
presentation of project (20%) with a total of 100%.
Student satisfaction questionnaires consisted of 10 items to be rated from 5 (highest) to
1 (lowest). These questionnaires were then quantitatively analyzed to get the overall
satisfaction rate.
Results
The results obtained in this study are comprised of three parts. The first part includes
the students’ oral examination score for their individual research. The second part is the group
project score after the final presentation. The final part was the result from the self-reported
questionnaire about students’ participation of PBL.
The individual research score showed that 49 out of 55 students were able to get 80%
or higher as their overall score. Only 6 students got lower than 80% but still above the passing
score of 50%. The highest score that a student got was 94 and the lowest score was 70.
All group project work has been completed and 8 out of 10 groups got an overall grade
of at least 85%. Two of the groups received 70% and 75% respectively. The group that achieved
the highest score was 93%.
The analysis of the students’ satisfaction questionnaire indicated that the students had
positive attitudes towards project based learning with a foreign English teacher. The average
rate of satisfaction was 4.10 out of 5.
Conclusion
This study investigated the use of project-based learning (PBL) in developing English
language skills. Fifty-two Mattayom 3 students (Grade 9) in the MLP program of Suratpittaya
School, Surathani, Thailand participated. Teaching materials and learning language used in this
study were prepared and conducted in English.
The results of this study showed a positive attitude and learning outcome of using PBL
in developingEnglish language skills. Students showed satisfactory performance in their
individual research and group project scores. However, there are also challenges in this kind of
learning method. First, the teacher/supervisor should be able to maintain and keep up with both
individual and group work progress. Students should also be provided with enough support
both from the supervisor and mentors to keep them from being lax with their work. This
learning method may also not perform well if the students are not keen on learning English.
Students need to be well disciplined, able to effectively manage their time and be able to work
well with their group mates. Individual research questions should also be checked by the
supervisor to ensure that students do not just copy each other’s work. Although all the signs
are promising, further research needs to be conducted in order to examine the effectiveness of
PBL as a tool for developing English language skills. This could be accomplished by using the
model in different areas of study and on different age groups. From our sample size we were
able to gather positive results, if this study was replicated on a broader scale, the results would
be useful in implementing PBL in more EFL classrooms.
Discussion
According to the results of this study, using PBL as a teaching method in learning and
developing English language skills is possible and successful. The results of this study showed
44
that students are well focused and pragmatic when researching a topic that they are interested
in learning.
It also presents a challenge to traditional teaching methods employed in Thai
classrooms and how student interests can be piqued by giving them the option to do something
that they are passionate about.
The results of the learning outcome showed that students were able to understand and
gain more knowledge and information about a certain topic when they personally look for the
answer and orally elaborate on the information. It also showed how students can go beyond
what the teacher asks and learn more information in the process.
Aside from the learning outcomes, the students’ attitude towards PBL was also
examined. It was found that generally, students thought this style of learning was fun, beneficial
and meaningful to them. This attitude was reflected in the positive rating of PBL. Technical
skills of students such as Photoshop editing, video editing and PowerPoint presentations were
utilized during project development. This enhances students’ ability to compete in the real
world. Students are also exposed to the language as the supervisor is using English as the
language of instruction and students are using it with their research and project work.
Acknowledgements
The author acknowledges the support of the Suratpittaya School staff as well as people
who helped make this project possible.
References
Dunkel, H. B. (1948). Second-Language Learning. Print.
Khamkhien, A. (2012). Proficiency, motivation, and classroom anxiety and their effects on
language learning strategies used by Thai EFL learners. Rangsit Journal of Arts and
Sciences. Rangsit University.
Kirkpatrick, A. (2010). English as a Lingua Franca in ASEAN: A Multilingual Model.
Hong Kong. Hong Kong University Press.
Mukoroli, J. (2011). Effective Vocabulary Teaching Strategies for the English for Academic
purposes in ESL Classroom. SIT Graduate Institute.
Noytim, U. (2006). The impact of the Internet on English Language: A case study at a Thai
Rajabhat University. University of Technology. Sydney.
Prpic, J. K. & Kanjanapanyakom, R. (2004). The impact of cultural values and norms on
higher education in Thailand. Herdsa Conference. Miri, Sarawak.
Simpson, J. (2011). Integrating project-based learning in an English language tourism
classroom in a Thai university institution. Australian Catholic University.
Solomon, G. (2003). Project-based learning : A primer. Technology and Learning.
Suratpittaya School. (2010). School Curriculum – MLP Program. Surat Thani, Thailand.
45
IT’S NOT JUST ENGLISH, IT’S COMPLICATED: APPROACHING
AT-RISK COLLEGE STUDENTS
1, 2
Reynald M. Cacho 1 and Arnel J. De Los Reyes 2
Philippine Normal University South Luzon Campus, Philippines
Abstract
This article reports an alternative assessment of at-risk college students’ second
language and academic literacy skills, and their awareness and experiences in learning English
as Second Language (ESL). Fifty-one freshmen grantees of the Expanded Students’ Grant-inAid of Poverty Alleviation (ESGPA-PA) in a state university from the Philippines participated
in the study. Results of summative academic literacy tests revealed that the students found
considerable level of difficulty in negotiating with meaning and form of college-level language
tasks. Problematique analysis of their journals suggests influential factors that could impact atrisk students’ success and failures in college language and literacy instruction. Implications for
approaching student-centered-campus-based English language remediation program are
advanced.
Keywords: at-risk college students, academic literacy, study skills, grammar, problematique
analysis
Introduction
Access to higher education is apparently within the reach by at-risk college students for
so many reasons or factors in a Philippine university. Keeping them away from insurmountable
failure and compensating or complementing their language competence deficiencies to make
them comparable to that of college level will remain to be a great challenge for universities or
colleges. As cited in the various studies (e.g. Brown, 2002, Curry, 2003; Curry, 2004;
Doloughan, 2001; Lee, 2011; Wallace 2007), academic literacy instruction—which connects
and aids learners to other university courses—not only focused on the linguistic competence,
reading comprehension, and study skills but also on the development of highly driven learners
who are responsible for their own learning, is gaining ground and attention; as a result, there
exist university programs meeting and sustaining the communicative demands of higher
education.
To widen the access to post-basic education, the Philippine government introduced and
implemented the Expanded Students’ Grant-in-Aid Program for Poverty Alleviation (ESGPPA). According to the Commission on Higher Education (2012), this program aims to
contribute to the national government’s thrusts in effectively addressing poverty alleviation by
increasing number of graduates in higher education among poor households. When financial
matters are taken care of, the main concern for ESGP-PA student grantees, other than their
physical and emotion well-being, is their mental capacity to hurdle the rigorous academic
works in college.In an article, Lei, Berger, Allen, Plummer, and Rosenberg (2010) observed
that college students learning English as their second language are faced with dilemmas
concerning reading, writing, speaking, and listening at the college level.
At-risk college students need to become successful readers. If they cannot perform well
in a simple reading activity, this may deter their learning in other areas. Benesch (1998)
perceived that many freshmen enter college only to struggle in certain linguistic and academic
activities such as reading critically, taking notes from readings and lectures, formulating
questions and writing logical essays. On the other hand, students who have different learning
46
orientation may face many academic challenges and failures, which more likely influence their
attitude toward learning (Curry 2004; Donnelly 1987; Leiet al. 2010; Lee 2011). Apparently,
they lack the necessary skills that warrant academic progression. They need sufficient
vocabulary in order to read independently. English Language Learner (ELL) not only take
English courses as prescribed in program but also attend content courses, like Math and
Science, which are all delivered in English—their second language.Curry (2004) added that
they should not only have the basic skills but they must also learn the technical practices of
academic reading, writing, and speaking that demonstrate college-level communication.
Instructors of the ESGP-PA students in a Philippine university, lament that, if not all,
majority of such students are considered at-risk of failing. Their low-test scores and poor
performance speak more of this unfavorable condition. They have struggled to survive for two
trimesters not to mention that four out of the fifty-eight grantees have already dropped. Other
than enrolling them in the prescribed courses, a state university with ESGP-PA students can
support such learners by implementing strategies and programs. Thus, this state university
offered a remedial program dubbed as ‘Tulay Pa-Normal’ (Bridge to College Education). This
bridging program spanned for two week covering one essential subject per day, of which the
researcher was assigned to handle a remediation session in English.After two trimesters of
studies in a university, it would be interesting and beneficial to determine the current
knowledge and skills level. This investigation is important in order to determine also the least
learned skills and concepts in English course and the awarenessissues toward learning English,
to address, if any, through strategic planning and implementation of future literacy remediation
and/or enrichment. For these reasons, the following questions were addressed:
1. How do at-risk college students perform in language test that covers reading
comprehension and study skills, and grammar? What are their least learned skills?
2. What are their common sentence-level writing errors?
3. What do their writing outputs say on theirattitude and experiences in learning
English?
Research Methodology
1. Design
After pondering deeply on the research objectives about examining the academic
literacy skills, grammatical competence, and awareness of at-risk college students with the aim
of enhancing the language remedial program of a Philippine university as its by-product, action
research design was determined to be very much appropriate.Becoming “persuasive and
authoritative”the action researcher/instructor has “identified data sources that provide
persuasive insights in the impact of program on student outcomes”(Mills 2000, p. 13).Patton
as cited in Griffee (2012) defines action research as aiming “at solving specific problems within
a program, organization, or community (Griffee 2012, p.157)”; this provides alternative
assessment of the knowledge gained by the at-risk college students after two trimesters of
language learning.
2. ESGP-PAAt-risk Students and Bridging Program
Field (1997) recommends that investigation at an action research level does not demand
huge group of participants but a small intact class can become the main focus. The at-risk
students, mentioned at the introductory part of this report, come from a Philippine university.
At the beginning of the first trimester, they were fifty-eight students who were able to avail the
national government’s ESGP-PA—primarily because they hailed from poor households who
rely on state financial aid to secure college education. Through the ESGP-PA, at-risk student
47
grantees receive monthly stipend, payment for matriculation fees, book and dormitory food
allowance while they are taking a university program (Commission on Higher Education 2012).
Almost all of them were considered the first family memberwho first entered college. For
apparent academic failures and weak coping mechanisms, four of them had dropped.To address
poor performance and glooming attrition, the remaining fifty-four students were required to
take the university’s remedial program, and which it wouldprepare them for the succeeding
trimesters. At the first remedial session in English subject under the 9-day bridging program—
dubbed as ‘Tulay Pa-Normal’ (Bridge to College Education) wherein each day is allotted to
specific subject area, data gathering was conducted.
3. Instruments
Action research advocates recommend many kinds of data gathering tools—which
include achievement test, field notes, report, journal and questionnaire to name a few (Field
1997; Griffee 2012; Mills 2000). To collect information about the reading comprehension,
study skills and grammatical competence of the at-risk students, a criterion-referencediagnostic test was employed. Moreover, this kind of testsevaluatespecific materials and skills
(Brown and Hudson 2002; Griffee 2012).Here, it is composed of two parts, of whichthe specific
skills and content coverage, and the number of items per area are found on Table 1 and 2in the
result section. Basically, part 1 consists of 35 items with multiple choice. It covers the basic
academic literacy skills for college students while the second part is composed of 65items
dealing with grammatical competence.
To triangulate the results of the language and literacy test, a clinical elicitation strategy
followed, “by asking research participants to produce some data which was then analyzed”
(Vasquez 2008, p. 136). In doing so, the researcher requested the students to write journal
composition about the topic“My Worst and Best Experiences in Leaning English”.Griffee
(2012) claims that students may suppress their ideas and feelings about classroom learning if
it is done in whole class;thus journal writing may give them the opportunityto share some
learning concerns with more confidence between the instructor and students. Such writing also
enriches the students’ desire to learn because it needs self-examination that also allows teacher
to deepen understanding (Genesse and Upshur, 1996) and be more sensitive to the needs of the
learners. Since this writing requires time, all students who took part in the initial testhanded
over their compositions the next day.
4.Ground Works andData Analyses
The English language and literacy test material were sampled on and covered the key
contents and references of the course English for Academic Purposes which the at-risk students
had just completedbefore the bridging program. Some items from various online and offline
resources were adopted, modified and/or tailored fit to connect with the learners cultural and
background experiences and orientation. The same test was piloted asfinal examination to
threeregular classes offreshmen not considered at risk. Results of the piloting show consistency
within the three groups of students.Compositions were then checked for sentence-level errors
and meaning evaluated. Hence, the triangulation of the data gathered from the test and error
analysis of the compositions were “attempted mainly for validating and strengthening the
interpretation”(Griffee 2012, p. 106); underlying patterns will more likely be unearthed with
less bias compared to just one measure.
Understanding the least learned skillsfrom the tests and occurrences of errors in the
compositiondictated getting the frequency count and percentage of correct responses and
sentence-level errors. Generally, language researchers regard frequency count as an objective
48
way of describing a composition.More than the forms are the meanings or messages of the
journals. To make sense insightfully of the ‘Best and Worst Experiences in English’ learning
entries, a problematique analysis (Librero, 1993) was then employed; recurring problems or
issues raised in the composition were analyzed focusing on the causes or symptoms of
problems and the presented in a problematique map.
Results and discussion
1. The need to address academic literacy
Table 1 presents the overwhelming results that could explain why fifty-onecollege
students were considered at risk of failing academic courses that demand extensive reading and
college-level writing outputs. The frequency of scores suggests that comprehending an English
academic text through writing an outlineand/or a summary would be the most difficult task for
these students; consequently, this confirms the dilemmas faced by the college students
concerning reading academic texts and college-level writing (Lei et al. 2010). Worth noticing
also was the fact that, in the absence of dictionaries, at-risk college students must learn to
optimize decoding context clues, connotation, and affixesin order to grasp the meaning of a
sentence or paragraph; doing so would become another challenge for them to grapple.
Similarly, it does not mean that when they are aware to some degree on the use of academic
referenceslike dictionaries, glossary, and the likes,they should become too dependent with
these materials, since there are times that such materials may not be available readily and/or
allowed to be used particularly during test taking.
Table 1: Frequency of Correct Responses in the Reading Comprehension and Study skills test
Number of
Frequency of correct
Competencies
Percentage
items
responses
1. Outlining
2. Identifying the topic sentence
3. Summarizing
4. Decoding context clues
5. Unlocking connotation
6. Analyzing expository text
7. Looking up denotation
8. Understanding affixes
9. Using academic references
N=51
3
3
3
4
3
5
3
5
6
35
39
39
42
56
42
92
63
110
149
632
25.49
25.49
27.45
27.45
27.45
36.08
41.18
43.14
48.69
33.60
2. The Grammar and Writing Dilemma
Aside from reading and study skills tests, in order for college students to progress in
their program, they must hurdle the language proficiency tests focusing on grammar and related
linguistic competence. Arranged from lowest down the highest percentage in Table 2, at-risk
students found ostensibly a great deal in negotiating with simple, progressive, past, future and
perfect aspects of the verbs, including changing direct speech to reported (vice versa), working
with phrases, and the notorious prepositions; subsequently the totality of responses supports
Al-Bayati’s (2013) previous findings that college students did find difficulty in the use of
English prepositions and phrases of which their first language could have played a vital role in
any misconception. At-risk college students, in addition, struggled considerably in classifying
the structure of sentence, dealing with the subject-verb agreement, and using correct cohesive
markers. If at-risk college students’ linguistic knowledge levels continue to fall short of what
49
is expected from them, they will more likely persist to remain at risk of failing course
requirements demanding a higher-education-level communication in English.
Table 2: Frequency of Correct Responses in the Grammar test of at-risk college students
Grammatical/Linguistic
Number of
Frequency of correct
Percentage
Forms
items
responses
1. Tense Aspect
7
98
27.45
2. Reported and direct
speech
6
86
28.10
3. Kinds of phrases
3
53
34.64
4. Verbal phrases
5
91
35.69
5. Prepositions
6
110
35.95
6. Structures of sentences
3
62
40.52
7. Subject-Verb Agreement
6
128
41.83
8. Transitional markers
4
93
45.59
9. Verb voices
8
210
51.47
10. Conjunctions
5
133
52.16
11. Kinds of questions
6
157
55.18
12. Relative pronoun
3
87
56.86
13. Conditional sentences
3
95
62.09
N = 51
65
1403
43.66
Undeniably, errors marked in the compositions of at-risk college students in Table 3
triangulated the data in Table 2 or vice versa.The frequency of sentence-level errors in verb
usage, tenses, capitalizations, phrase, spelling, punctuations and the likes, appears to be in
accord with the result of the grammar test; thus students who could not fully identify the correct
reported or direct speech in the test options, more likely could not grasp such in writing or the
other way around.Compared to the local setting, the occurring errors found in the students’
composition were also the common findings in Espada-Gustillo (2009) and Masangya and
Lozada (2009).Results of the tests and error analysis of students’ written work shows their least
learned skills and composition weaknesses although the organization of ideas in their journals
was not scrutinized. it could be inferred that English level competence of at-risk college
students could not be equated so far to college-level skills or communication; hence, to make
them free from getting at risk, enhanced remedial language program is urgently needed.
50
Table 3: Frequency of Linguistic Errors found in at-risk students’ composition
Percentage
Type of Error
Frequency
(%)
Verb Error
138
14.20
Capitalization
137
14.09
Omitted Words or Phrase
124
12.76
Spelling
112
11.52
Punctuation
79
8.13
Word form
59
6.07
Unnecessary Words or
58
5.97
Phrase
Word choice
49
5.04
Preposition
44
4.53
Run-ons
44
4.53
Fragments
35
3.60
Word Order
27
2.78
Pronoun
Noun Ending Error
Article/Determiner Error
TOTAL
25
22
19
972
2.57
2.26
1.95
100.00
Conclusion
Although items in the diagnostic tests were inexhaustive,resultssuggest that the students
found considerable level of difficulty in negotiating with meaning and form of college-level
communicative language and tasks; consequently, critical reading skills of outlining,
summarizing, identifying topic sentence, comprehending meaning of sentence to text level
were their least learned competencies. Grammar errors as triangulated by composition errors
on the sentence-level revealedthat the common errors in verb aspect and usage, punctuation,
spelling, phrases, word choice and form were the most prevalent language deficiencies. Based
on the problematique map, college students are perceived to be at risk when their confidence
is challenged or engaged with the thought of English as difficult subject, oral communication
fright, poor study habits, grammar knowledge deficits, high school frustrations, and
first/second language issues. On one hand,they signal optimism in language learning by seeing
themselves as actual college students sustained by state scholarship, connecting with peers,
getting personal on their language and topic, understanding the urgency to learn, relating with
previous successes, and practicing language inside and outside the university campus.For
future directions, more studies are encouraged to further support the claims and/or explore
other influential factors that would pave the way to improved performance in academic literacy
and second language learning. Granted that the generalizability of results is limited to the
participating at-risk college students and language program enhancement, its relatability in
some cases may contribute to the literature in approaching the issues concerning at-riskcollege
learners.
51
Recommendations
Figure 1 demonstrates the experiences and attitude of at-risk college students in
learning English. By framing a problematique map of the themes and insights of the students’
composition, incidents and influential factors of the problems in learning the target language
were recognized; included were the challenges they had encountered and what they felt about
them. Fifty-one short compositions were analyzed—ideas were coded and classified based on
their relationships. Notably, two dominant constructs emerged: low self-confidence and
optimistic views. These constructs aroused primarily because two contrasting perspectives
were solicited.
1. Charting Confidence Issues
The thought of English as a difficult course lingered on some students’ minds.
Generally, this thinking affects their attitude, and their attitude influences their actions. Student
(A) noted that “I don’t’ want to hear anymore English because I don’t understand it…I think
its hard.” In addition to this mindset was the fear to communicate orally for known reasons.
Student (B) narrated that “I wanted to join the discussion…I’m shy is wrong. My classmates
are laughing at my answers.”For some, pronunciation is a big issue. They are afraid of being
laughed at; hence this condition seems to aggravate as learning anxiety. Such anxiety may have
originated from past negative experiences. Another student (C) related high school moments.
“My high school teacher required me to express myself in the second language, I tried my best
but my best wasn’t enough…I failed.” This may explain why frustration is another factor
impedes and/or is part of learning. Ironically, they could not shy away to such language since
English is the language in almost all of their college courses. Thus, Al-Bustan and Al-Bustan
(2009) justify that when ESL students wanted to be quiet in group works; they would normally
get worried when they commit mistakes and they struggle to listen, read, speak and write in
English.
College courses normally involve long list of reading and writing requirements. Failure
to do one likely indicates poor reading and study habits. Student (D) and (E) shared such
shortcomings when (D) wrote, “I forget to submit an assignment…I want to cheating with my
classmate.” and (E) complained, “There are many reading works and hictic schedule.” Not
only had such words existed, but also majority still needed to work doubly hard on their
grammar which the test results disclosed. Student (F), interestingly, admitted his/her weakness
in grammar when (F) reasoned out, “I week in grammar…I don’t know it…” when F meantnot
being good at it.Moreover, college English course is challenge for most of them. Learning-ishard-because-it-is-not-my-mother-tonguenotion prevailed in their composition, of which may
be due to the fact that the primary language spoken at home is not English (Lee, 2011). The
same case is even true in student-to-student interactions. Once everything has been written or
said, it is always the morale or self-confidence of the students which is tested—to persevere in
the college program or be part of the dropout statistics.
52
Figure 1. SimplifiedProblematique map of at-risk college students’ awareness toward
developing English language competence
2. Making Best Opportunities
There are also opportunities which instructors can build on that could warrant a
successful college program experience. More than ever, at-risk ESGP-PA student grantees
were very much“thankful” for being given the chance to become college students which they
considered one of the best things—being first ever member of the family to enter college; this
very being strongly motivated them to pursue their dream of obtaining a college diploma.
Hence, they understood well that it would not be a walk in the park. The need to learn more
must be satisfied. Student (G) stated, “English is not a reason for me to stop…I like to learn
more the correct grammar, listening, speaking, reading, and writing.”Another student (H)
bragged, “It’s very easy. I just follow instructions.” For these students, doing things demands
practice. This was justified when a handful of them shared that they had done: talking in
English inside and outside the campus; writing good sentences; listening to English music; and
learning from mistakes, to cite a few.
Group activities are appreciated by at-risk college students and the results are
heartwarming. Student (I) hinted a favorable outcome—“I learn more, to collaborate to (with)
others.” Another student (J) led it with, “Group must be ‘kapit bisig’ (work as one) we must
succeed in all activities.”Moreover, college education is not just English course per se.
Learners like to communicate the second language in whatever content as much as possible.
Student (K) noted that, “…I read materials…I express what…I want to say.”One student (L)
enjoyed the personalized approach in English language; (L) delighted writing about “My
Idolized Person.”Building on what the students have—cultural orientation, language, ways,
interests, likes, etc. increases their connection or engagement with the language. After all, one
could express English in so many subject or contents. Finally,success may not always be driven
from failures; success in high school and previous experiences begets future success. It is
53
essential thatat-risk college students should not be at risk of losing the desire to learn. They
have abundance of it. Students will perform better in L2 if they demonstrate the desire to
learnEnglish (Fullan, M.G., Stiegelbauer, S. 1991). Their words of desire, happiness and Ican-learn attitude were almost present in their compositions. Unarguably, they remain
optimistic as far as their positive attitude is concerned.
Acknowledgements
The level of academic literacy and least learned skills or content in English language
combined with the useful insightsin keeping at-risk students confident and optimistic, suggest
necessary and concreteaction for the instructors and all concerned; hence there is a need for
concerted effort in remediation programming and differentiated mentoring. The current shortterm remediation session per subject area may be restructured to address the pressing needs
and/or academic deficiencies of at-risk college students, so they can be more prepared to the
progression of university courses. One way to do this is to regard all instructors as literacy
instructors. And more importantly, to approach such program in a way that learners’ desires,
interests, orientation, knowledge levels, and background are well accounted for. This may
sound long overdue,but regular evaluation and monitoring of program outcomes should still be
put in place; just like what this paper had sought initially to achieve.
References
Al-Bayati, W. A. T. (2013). Errors made by Iraqi EFL undergraduates in the use of
prepositions. Bulletin of the Transilvania University of Brasov, Series IV: Philology &
Cultural Studies, 6(1), 41-56.
Al-Bustan, S. A.& Al-Bustan, L. (2009). Investigating Students Attitudes and Preferences
towards Learning English at Kuwait University. College Student Journal, 43(2), 454463.
Assia, B.& Said, K. (2014). The impact of small group interaction on learners’ grammatical
accuracy achievement. International Journal of Research Studies in Language
Learning, 3(2), 85-100. http://dx.doi.org/10.5861/ijrsll.2013.511.
Benesch, S. (1988a). Linking content and language teachers: Collaboration across the
curriculum. In S. Benesch (Ed.), Ending remediation: Linking ESL and content in
higher education. Alexandria, VA: Teachers of English to Speakers of Other
Languages. 57-66.
Brown, H. D. (2002). Principles of language learning and teaching. Englewood Cliffs, NJ:
Prentice-Hall.
Canale, M.& Swain,M. (1980). Theoretical bases of communicative approaches to second
language teaching and testing. Applied linguistics. London, Longman.
Commission on Higher Education. (2012). Students’ Grants-in-Aid Program for Poverty
Alleviation (SGP-PA). Government Brochure. Quezon City, Philippines
Corder, S.P. (1974). Error Analysis, In Allen, J.L. P. & Corder, S.P. (1974). Techniques in
Applied Linguistics. Oxford: Oxford University Press.
Curry, M. J. (2003). Skills, Access, and "Basic Writing": A Community College Case Study
from the United States. Studies in the Education of Adults, 35(1), 5-18.
Curry, M. J. (2004). UCLA Community College Review: Academic Literacy for English
Language Learners. Community College Review, 32(2), 51-68.
Doloughan, F. (2001). Communication skills and the knowledge economy: language, literacy,
and the production of meaning. London: Institute of Education.
54
Donnelly, M. (1987). At-Risk Students. ERIC Clearinghouse on Educational Management.
Eugene, Oregon. http://www.ericdigests.org/pre-928/risk.htm.
Espada-Gustilo, L. (2009). Sentence-level Errors in ESL Writers’ Diagnostic Essays: What
students have achieved and what we can do. The Philippine ESL Journal, Volume 3,
108-126.
Field, J. (1997). Key concepts in ELT: Classroom research. English Language Teaching
Journal, 51(2), 192-193.
Fullan, M. G. & Stiegelbauer, S. (1991). The New Meaning of Educational Change. New
York: Teachers College Press.
Genesee, F.& Upshur, J. A. (1996), Classroom-based evaluation in second language
education. Cambridge: Cambridge University Press.
Griffee, D. T. (2012). An Introduction to Second Language Research Methods: Design and
Data. http://www.tesl-ej.org/wordpress/issues/volume16/ej64/ej64r3/.
Hernandez, P. (2011). College 101: Introducing At-Risk Students to Higher Education.
http://www.nea.org/assets/docs/2011TAHernandezFINAL.pdf.pdf.
Khansir, A. A. (2012). Error Analysis and Second Language Acquisition. Theory and
Practice in Language Studies, Vol 2, No 5 (2012), 1027-1032,
doi:10.4304/tpls.2.5.1027-1032.
Lee, M. E. (2011). How to Teach English to At-Risk College Students. Chronicle of Higher
Education, 57(28), A33.
Lei, S. A., Berger, A. M., Allen, B. M., Plummer, C. V.& Rosenberg, W. (2010). Strategies
for improving reading skills among ELL college students. Reading
Improvement, 47(2), 92-104.
Librero, F.R. (1993). Towards a methodology for problematique analysis: A Philippine
experience. Asian Journal of Communication, 3(1), 84-102.
Masangya, E. M. & Lozada, L. (2009). An Investigation on the Relationship between the
Language Exposures and Errors in English Essays of High School students.
Philippine ESL Journal, Volume 2. http://www.philippine-esljournal.com/index.php/2014-index/13-journals/2009/34-an-investigation-on-therelationship-between-the-language-exposures-and-errors-in-english-essays-of-highschool-students.
Mills, G. E. (2000). Action research: a guide for the teacher researcher (First Edition).
Merrill Prentice Hall: Upper Saddle River, NJ: USA.
Nezami, A. & Najafi, M. S. (2012). Common Error Types of Iranian Learners of English.
English Language Teaching. 5(3).
Nzama, M. V. (2010). Error Analysis: A study of Errors Committed by Isizulu Speaking
Learners of English in Selected Schools, Unpublished MA Dissertation, University of
Zululand.
Praise, S. & Meenakshi, K. (2015). The Importance of Grammar in Communication.
International Journal of Research Studies in Language Learning, 4(1), 97-101.
Sawalmeh, M. H. M. (2013). Error Analysis of Written English Essays: The case of students
of the Preparatory Year Program in Saudi Arabia. English for Specific Purposes
World, 14(40).
Vasquez, D. A. L. (2008). Error Analysis in a Written Composition. Profile Issues in
Teachers’ Professional Development.
Wallace, C. (2007). Vocabulary: The key to teaching English language learners to read.
Reading Improvement. 41 (1), 189-193.
55
INVESTIGATION OFCOMMUNICATION STRATEGIESUSED BY THAI
EFL TOURISM STUDENTS THROUGHMULTIPLE DATA COLLECTION
METHODS
SupornphanKonchiab
Massey University
Abstract
This presentation focuses on the utilisation of multiple data collection methods to elicit
students’ use of communication strategies (CSs) as parts of action research process, developing
the CS instruction for Thai EFL tourism students. These methods include 1) the pre- and postdescriptiontasks, 2) students’ self-report questionnaires, and 3) teaching journals. In this
presentation, the rationale for using multiple data collection methods to investigate the use of
communication strategies isaddressed andthe process of the classroom action research is
described, as the selected research strategy. Then, development and implementation of each
method are described, followed by the key findings and discussions. Finally, conclusions and
recommendations are made for teaching and researching communication strategies for Thai
EFL tourism students.
Keywords: communication strategies, tourism, multiple data collection methods
Introduction
Communication strategies (CSs) are regarded as language devices for solving
communication problems and enhance communication (Dörnyei& Scott, 1997). According to
A. D. Cohen and Dörnyei (2002), CSs are classified into four groups, including achievement
strategies (e.g., circumlocution and approximation) that help compensate for linguistic gaps.
Interactional strategies (e.g., asking for repetition and confirmation check) help establish
mutual understanding between the two interlocutors. Time stalling strategies (e.g., fillers and
repetitions) help keep the communication channel opens while reduction strategies (e.g., topic
avoidance and message abandonment) involve avoiding problematic messages and/or leaving
message unfinished. Based on these significant roles of CSs, many researchers suggest that
CSs could help increase ESL and EFL learners’ communicative competence and it is, therefore,
necessary to teach them to use CSs properly and effectively (Dörnyei, 1995; Færch& Kasper,
1983; Nakatani, 2005).
In terms of teaching CSs, it is important for teachers to systematically and consistently
investigate students’ use of CSs in order to identify needs to learn CSs, select key CSs to teach
to meet students’ needs, and examine the outcomes of teaching CSs (Konchiab, 2015). Many
research studies into teaching CSs used multiple methods to elicit CSsbecause such
triangulation appears to provide sufficient data related to students’ use of CSs based on
different perspectives.For example, apart from analysing transcription data of task performance
which is the most common method to elicit the actual use of CSs, Lam (2010) suggests that
retrospective interview after task performance helps elicit students’ thoughts and reasons for
employing particular CSs. Nakatani(2010) also recommends using self-report questionnaires
to elicit students’ awareness of CSs. In addition, in Thai EFL context, Prinyajarn and
Wannaruk, (2008) investigate the outcomes of teaching CSs, using pre- and post-tests, informal
interview, audio-recordings, questionnaires and classroom observation. Similarly, Kongsom
(2009) used pre- and post-speaking tasks, self-report strategy questionnaire, attitudinal
questionnaire, and retrospective protocols.Using such multiple methods is considered essential
56
to “obtain more accurate and valid data on learners’ cognitive process and strategy use”
(Nakatani, 2010, p. 117) and therefore, the focus of my research study for developing the CS
instruction for Thai EFL students in tourism.
Objectives
This paper reports and discusses three methods used for eliciting CSs, as part of my
classroom action research of developing the CS instruction to improve students’ oral
communication performance. These methods are (a) pre- and post- description tasks, (b) selfreport questionnaires, (c) teaching journals.
Research Methodology
The classroom action research, as the selected research strategy, was conducted with
24 fourth-year tourism students, who participated in different aspects of the voluntary short
course of the communication strategy. I played the teacher-researcher roles teaching them CSs
and investigating their use of CSs to help improve their oral communication performance.
Triangulation, asa key feature of action research (McNiff&Whitehead, 2002), was the
focus of the current study. The data were gathered from different sources (i.e., from a teacherresearcher, students, and an English speaking interlocutor), using different methods (i.e., preand post- description tasks, self-report questionnaires, and teaching journals), and at different
times (i.e., three phases of data collection and analysis).In this study, three phases of data
collection and analysis were ongoing and cyclical. Phase One involved the pre-assessment of
students’ use of CSs by using description tasks of Thai culture-specific situations and
terminology to collect students’ oral samples. The results from this process were then reflected
to identify needs to learn CSs and plan the CS instruction. Phase Two involved ongoing
assessments of students’ use of CSs from students’ self-report questionnaires and my teaching
journals. The results from this process were constantly reflected to evaluate the current lessons
and design the next lessons. Phase Three aimed to re-evaluate students’ oral performance by
using post-assessment tasks of describing Thai culture-specific situations and terminology.
Students’ oral samples of these tasks were collected and compared to those in the preassessment.
Conclusion, discussion, and recommendations
Using multiple data collection methods throughout the three phase of the current
classroom action researchis beneficial in many ways. They provided accurate and valid data
that enabled the teacher researcher to develop the CS instruction to meet the students’ needs
and evaluate the teaching outcomes.Firstly, in terms of developing the CS instruction, the
results from the pre-description tasks in Phase One, CSs used by students with different levels
of oral performance, suggestedstudents’initial needs to learn CSs, leading to primary decision
to select CSs to teach and plan how to teach them. Also, the results from students’ self-report
questionnaires and my teaching journals throughout the instructional periods in Phase two also
helped the teacher researcher identify ongoing needs to learn CSs and decided what to teach
and how to teach them. It can be said that these processes contributed to the CS instruction that
is contextually appropriate and effective to the Thai EFL students in tourism and support Goh’s
(2012) statement that teaching CSs should be contextually and culturally appropriate to the
particular group of students.
Secondly, in terms of the outcomes of teaching the CS lesson in relation to the success
of students’ learning of CSs, the comparison of thepre- and post-description tasks revealedthe
relationship between changes in using CSs after the CS instruction and improvements in
students’ oral communication. These results were supported by the data from students’ self-
57
report and my teaching journals revealing gradual changes in using CSs and improvement in
oral communication performance throughout the six CS lessons. It can be said thatthe
triangulation of the findings from different sources and perspectives across the three phases
helpedavoid obtaining subjective information (Stringer, 2007) and maintain the rigor of action
research (Piggot-Irvine, 2009).
Each data collection method used in this study had its strengths and weaknesses. The
pre- and post- description tasks were useful for CS elicitation because Thai culture-specific
situations and terminology are difficult to explain in English and often there is no equivalent
translation into English (Wongsawang, 2001). Particularly, describing these concepts to people
who had a different cultural background and knowledge should be sufficiently challenging to
promote the use of CSs (A. Kirkpatrick, 2010). However, this method can only elicit CSs that
were observable in the transcription data of students’ actual use of the language. The
retrospective interview is recommended after the pre- and post- description tasksfor an indepthdata such as internal and unobservable CSs (e.g., social affective strategies) and reasons
for using particular CSs.
Students’ self-report was a written questionnairethat helped collecting a lot of data a
short time (Dörnyei & Taguchi, 2010). Also, it was anonymous by using codes instead of
students’ names so that they could provide honest responses (Gall, Gall, & Borg, 2007).These
data representing students’ perspectives, combining with the data in my teaching journal, were
essential to support the decision making for ongoing assessment of students’ learning and
developing the CS lessons. However, the ranking questions provided a narrow range of
responses, leading to some difficulties in forming conclusions on students’ progress over time
(McKay, 2005). Likert-scale items would be more appropriate because they help summarise
the outcomes with the average response of each aspect investigated.
Writing teaching journals also provided evidence to capture classroom events and
observe students’ performance and CSs based on teacher’s perspectives as well as the English
speaking interlocutor, leading to the idea to plan the next CS lesson. As mentioned by Richard
and Farrell (2005), writing and reviewing teaching journals regularly enabled teachers to
improve their teaching practice. However, writing teaching journal was time-consuming, as
Farrell’s notes (2007), it required time for writing, reviewing, analysing, and interpreting data
on a regular basis to track changes in teaching and learning. Using the voice recording in place
of writing the teaching journals would help save more time and reduce the workload.
Acknowledgements
As this paper is a part of my Ph.D. thesis, I would like to thank my supervisors,
Professor James Chapman and Dr. Alyson McGee from Massey University, Palmerston North,
New Zealand, for their academic support and insightful feedback on the thesis. I am solely
responsible for any remaining errors and omissions in this paper.
References
Cohen, A. D.& Dörnyei, Z. (2002). Focus on the language learner: Motivation, styles, and
strategies. In N. Schmitt (Ed.), An introduction to applied linguistics (pp. 170-190).
New York: Oxford University Press.
Dörnyei, Z. (1995). On the teachability of communication strategies. TESOL Quarterly, 29,
55-85.
Dörnyei, Z.& Scott, M. L. (1997). Communication strategies in a second language:
Definitions and taxonomies. Language Learning, 47(1), 173-210.
58
Færch, C.& Kasper, G. (Eds.). (1983). Strategies in interlanguage communication. London:
Longman.
Gall, M. D., Gall, J. P.& Borg, W. R. (2007). Educational research: An introduction (8th
edition). Boston: Pearson/Allyn & Bacon.
Goh, C. C. M. (2012). Learner strategies. In A. Burns, & J. C. Richards (Eds.), The
Cambridge guide to pedagogy and practice in second language teaching (pp. 68-76).
New York: Cambridge University Press.
Konchiab, S. (2015). Development of communiation strategy instruction for a tourism
education programme in Thailand. (Unpublished doctoral dissertation, Massey
University, palmerston North).
Kongsom, T. (2009). The effects of teaching communication strategies to Thai learners of
English (Doctoral dissertation, University of Southampton). Retrieved from
http://eprints.soton.ac.uk/id/eprint/69653.
Lam, W. (2010). Implementing communication strategy instruction in the ESL oral
classroom: What do low-proficiency learners tell us? TESL Canada Journal, 27(2),
11-30.
McNiff, J.& Whitehead, J. (2002). Action research: Principles and practice (2nd edition).
London: Routledge.
Nakatani, Y. (2005). The effects of awareness-raising training on oral communication
strategy use. The Modern Language Journal, 89(1), 76-91. doi: 10.1111/j.00267902.2005.00266.
Nakatani, Y. (2006). Developing an oral communication strategy inventory. The Modern
Language Journal, 90(2), 151-168. doi: 10.1111/j.1540-4781.2006.00390.
Nakatani, Y. (2010). Identifying strategies that facilitate EFL learners' oral communication: A
classroom study using multiple data collection procedures. The Modern Language
Journal, 94(1), 116-136. doi: 10.1111/j.1540-4781.2009.00987.
Piggot-Irvine, E. (2009). Action research as an approach to development In E. Piggot-Irvine
(Ed.), Action research in practice (pp. 11-34). Wellington, New Zealand: NZCER
Press.
Prinyajarn, G.& Wannaruk, A. (2008). Communication strategies training for science and
technology graduate students. Suranaree Journal of Social and Science, 2(1), 17-32.
Richards, J. C.& Farrell, T. S. C. (2005). Professional development for language teachers:
Strategies for teacher learning. New York: Cambridge University Press.
Stringer, E. T. (2007). Action research in education. Columbus, OH: Pearson Prentice Hall.
Wongsawang, P. (2001). Culture-specific notions in L2 communication strategies. Second
Language Studies, 19(2), 111-135.
59
Business Administration
Research
ID
109
Name
Affiliation
Ihwanna As'ad
School of
Computing,
University Utara
Malaysia
112
Khoirul Aswar
113
Sambas Ade
Kesuma
118
Lidya Primta
Surbakti
124
Pariwat
Somnuek
Faculty of
Economics,
University of
Pembangunan
Nasional "Veteran"
Jakarta
Accounting
Departement,
University of
Sumatera Utara
Faculty of
Economics,
University of
Pembangunan
Nasional "Veteran"
Jakarta
Faculty of Liberal
Arts, Ubon
Ratchathani
University
167
Hermann
Gruenwald
169
Sirirat
Chuanprasit
Burapha University
International
College (BUUIC)
Bangsaen
Student in Master of
Business
Administration of
Suratthani Rajabhat
University
Institution/
Title
Country
CAS
MANAGEMENT STRATEGIC PROCESS
(ENVIRONMENT SCANNING) THE
IMPLEMENTATION OF USO IN
INDONESIA AND USP IN MALASIA
(COMPARATIVE STUDY)
CAS
THE RELATIONSHIP OF JOB
SATISFACTION, LEADERSHIP STYLE,
LOCUS OF CONTROL AND
ORGANIZATIONAL COMMITMENT TO
AUDIT QUALITY
CAS
CAS
THAILAND
THAILAND
THAILAND
THE INTERNAL AUDIT ROLE AND IT
SOPHISTICATED IN IMPROVING THE IT
SUCCESS AT PUBLIC UNVERSITIES IN
INDONESIA
EFFECT OF FINANCIAL CONDITION,
GROWTH COMPANIES, COMPANY SIZE
OF GOING CONCERN AUDIT OPINION
THE POTENTIAL OF TOURISM LOGISTICS
SERVICE BUSINESS IN THE BORDER AREA
OF CHONG ANMA CHECKPOINT, CHONG
SA-NGAM CHECKPOINT AND CHONG
JOM CHECKPOINT FOR PREPARING AND
INCREASING THE COMPETITIVE
EFFICIENCY AMONG THE ASEAN
OPERATIONAL RISK MANAGEMENT AND
SUPPLY CHAIN RISK MANAGEMENT
(SCRM) LOGISTICS MANANGEMENT
STUDENTS' PERCEPTIONS
RECOGNITION OF THE MARKETING
FACTORS IN THE PERCEPTION OF
SERVICE QUALITY OF TMB BANK PUBLIC
COMPANY LIMITED, SURAT THANI,
PROVINCE, THAILAND
60
MANAGEMENT STRATEGIC PROCESS
(ENVIRONMENTAL SCANNING)THE IMPLEMENTATION OF USO
IN INDONESIA AND USP IN MALAYSIA (COMPARATIVE STUDY)
Ihwana As’ad1and Khairudin Kasiran 2
1, 2
School of Computing, University Utara Malaysia
Abstract
One of the management strategic according to Wheelen and Hunger (2006) is the
environmental scanning. This paper will discuss about the environment scanning, both internal
and external environmental in the implementation of Universal Service Obligation (USO) in
Indonesia and the implementation of Universal Service Provision (USP) in Malaysia. This
study aims to determine the extent of environmental scanning process influenced the
implementation of USO and USP in Indonesia and Malaysia. Data sources from both countries
gained through institutions which apply USP in Indonesia, namely Ministry of Communication
and Information technology, in this case Balai Penyedia dan Pengelola Pembiayaan
Telekomunikasi dan Informatika (BPPPTI), while institution in Malaysia is Suruhanjaya
Komunikasi dan Multimedia Malaysia (SKMM). This study uses qualitative methods of
content analysis to analyze all the data that has been obtained, then the data analysis result is
classified by similarities and differences in the two countries. From the obtained results of the
study concluded that the implementation of USO and USP in Indonesia and Malaysia in the
management strategic process, particularly the environmental scanning both internal or
external environmental in some cases have significant similarities and differences.
Keywords: universal service obligation, universal service provision, environmental scanning
Introduction
Universal Service Obligation (USO) and the Universal Service Provision (USP) is one
of the program designed by the International Telecommunication Union (ITU) to address the
telecommunication gap between urban and rural areas. USO and USP are derived from the
term Universal Service and Universal Access. Universal Service can be meaning that every
home in the country has a telephone connection, usually fixed telephone. But this can be only
related for developed countries, thus the term Universal Access occurs and can be reached and
more in line with practices in developing countries. Universal access can be meaning that
everyone in a community should be able to access to the public telephone. Universal Access
can usually be obtained through a public telephone, telephone kiosk or similar kiosks,
multipurpose community centers, and various forms of similar facilities (Huntley, 2004;
Gautier & Wauthy, 2012; Xavier, 2008; Alleman, Rappoport, & Banerjee, 2010; Bautista,
2002; Richardson, 2002; Benjamin & Dahms, 1999; Jayakar & Sawhney, 2003; Intelecon,
2009; ITU, 1998).
In the developing countries, universal access and universal service usually applies at
the same time, and therefore they use the term universal access to services. For example, the
first developing countries usually focused primarily on the universal access as the most
appropriate target. However, since the use of mobile phone services grow wider, many
61
developing countries are now changing the universal service targets for urban areas and more
focus on the telephone and the Internet in the lack access areas. So their policy is no longer just
focus on universal access alone but on both (Oestman & Dymond, 2008).
Objectives
USO and USP is part of the Information and Communication Technologies (ICT). ICT
is one of the indicator whether or not the development of technology and information for the
country including the development of USO or USP. Based on ITU press announcement as of
March 2, 2009, the ITU in collaboration with the World bank, and Infodev (Institute who
compiled Regulation Toolkit for UA and Universal Service Funding), Indonesian ICT ranked
in 108 out of 154 countries under Gabon and above Botswana, this growth index Indonesia
position in the medium category (there are 4 categories: high, upper, middle, and bottom).
Meanwhile Malaysia as a country that implements the USP almost simultaneously so far much
different which is ranked in 34 positions.
Therefore, in this study will be reviewing the subject matter to try to compare the
implementation strategy of USO in Indonesia and USP in Malaysia, because both countries are
members of ASEAN countries which have similar geographical and cultural and also natural
resources. This problem focuses around why the implementation of USO in Indonesia lags
compared with USP implementation in Malaysia. Based on the above issues, this study aims
to: identify the factors that affect the implementation of USO in Indonesia and USP in
Malaysia, and explored the implementation of management strategy of the USO in Indonesia
and USP in Malaysia.
Research Methodology
This study uses content analysis. Content analysis method is a method used either
qualitative or quantitative data and inductive or deductive (Mayring, 2000; Elo & Kyngäs,
2008). Content analysis is a research method that is focused on the actual content, this tool is
used to determine the presence of certain words, for example, concepts, themes, phrases,
character, or phrase in the text or set the text and to measure objectively. Text can be defined
broadly as books, book chapters, essays, interviews, discussions, newspaper headlines and
articles, historical documents, speeches, conversations, advertising, theater, informal
conversation or really any occurrence of communicative language (Palmquist, 1980; Janowitz,
1968; Elo & Kyngäs, 2008; Mayring, 2000; Hsieh & Shannon, 2005).
Results/ Conclusion
In implementing the strategy of an activity, the most important thing is paying attention
for the environment, both internal and external environment. According to Abdullah (2011) the
failure of the institution to get a clear picture of the both environment will result in a failure to
operate to achieve the objectives of the institution. Both of these environments will become a
strength, opportunities, challenges and threats for the implementation of the strategy itself.
Thus in the implementation of the USO in Indonesia and USP in Malaysia, the less important
matter before formulating strategy is to consider both internal and external environment.
Factors that influence from the environmental management strategies standpoint,
particularly in observation, both internal and external environment as follows:
1. The internal environment. The internal environment consists of structure, culture and
resource agencies. This third variable internal environment of both countries Indonesia and
Malaysia stated in the state document and form the basis for managing the USO and USP in
each country. In Indonesia, it’s stipulated in the Minister Regulation and has been amended
62
three times since the implementation of the USO began, while in Malaysia contained in the
Communications and Multimedia Act 588 of 1998 and became a reference since the beginning
of the implementation until now. The change of regulation that underlying the implementation
of USO in Indonesia is already have significant differences to the USP in Malaysia, not
including the structure, culture and resource agencies. This will affect the structure, culture and
resources of the institution itself, and also will affect the results of the implementation itself,
because any regulatory changes will take some time to do a re-socialization, in addition it will
cost much budget in order to set new rules. However these changes have a good impact as well,
because the changes in regulation will notice to any developments that occurred. In addition,
all three variables are set provisions of the organizational and technical work of USO and USP
in each country. The next difference is, the technical agency implementing USO in Indonesia
and USP in Malaysia. In Indonesia, the technical implementing USO is technically the
government and implemented by the Ministry of Communications and Information
Technology through the Balai Penyediadan Pengelola Pembiayaan Telekomunikasi
danInformatika, while in Malaysia is a government partner institution named Suruhanjaya
Komunikasidan Multimedia Malaysia which has power to supervise and oversee all activities
communication and multimedia in Malaysia. This implementing difference will affect every
program and implementation in the field, in terms of the independence, the implementation of
USO in Indonesia is dependent on the government, while at USP in Malaysia is more
independent, so it will affect every outcome of the implementation.
2. The external environment. The external environment is composed of several
variables, namely the industrial environment and social environment. Both of these external
environments are each composed of variables. The social environment consists of economic,
technology, politic and law, and social culture while the industrial environment is composed
of government, local communities, costumers and all the elements that directly affect the
organization.
a. Economy. Indonesia's economic strength is based on the biggest occupational are,
namely agriculture, fisheries, forestry, mining, industry and tourism. While the strength of the
Malaysian economy experienced a shift of paradigm from an economy reliant on agriculture
and primary commodities to an economy based on industry, refers to the export which driven
by high-tech industry, knowledge-based and capital initiative. In terms of economic forces is
appear to have a significant difference between the strength economy of Indonesia and the
strength economy of Malaysia, this will affect the income of the people that will affect the
implementation of the USO itself, because the higher the income of society, the higher the
opportunity to us telecommunications.
b. Technology. The strength of technology in Indonesia has a role to improve the
quality of life and welfare of the community, improve the nation's competitiveness,
strengthening national unity, make transparent government, and improve national identity at
international level. While the power of technology in Malaysia is one of the Nine Strategic
Challenge Insight 2020 science and technology ability. Science and technology ability is to
make Malaysia as a society that is based on progressive science and technology, i.e. inventive
and farsighted people, who not only use technology but also contributes to the development of
science and technology that will come. Technological strength between Indonesia and
Malaysia has fundamental differences, namely Indonesia with a very broad role while Malaysia
is very specific technological strength and direction.
c. Law and Politics. The force of law and politics in Indonesia somewhat influenced
by the Dutch colonialism and based on the principles that interrelated and mutually supportive,
which are, the rule of law, constitutional principles and democratic principles. Meanwhile, the
63
force of law and politics in Malaysia based on parliamentary democratic system under King
parliamentary administrative with Seri PadukaBaginda Yang DiPertuanAgong as the Chairman
of the State, and the Guild system. Legal and political force between Indonesia and Malaysia
are very different therefore produce different legal and political also policies as well.
d. Social cultures. Social strength of Indonesian culture is strongly influenced by the
multicultural of culture because geographically separate from Sabang to Merauke, and consists
of islands both large and small, and this condition raises motto “Unity in Diversity”. The base
idea of Indonesian social culture formulated as a socio-cultural values, social order, and code
of conduct of human behavior is a manifestation of the work, taste and creativity in the life of
society, nation and state, based on Pancasila and the Constitution of 1945. While the strength
of the social culture of Malaysia established basic social and different cultures. Basic social
Malaysia is one of the basic social developments based on pure values and increased human
ability to achieve equality and social stability, national defense and social welfare which
advanced and steady. While the basic culture of Malaysia is a whole way of human life, which
was instrumental in the country development process where the personality of Malaysia should
be fostered in the efforts undertaken towards improving the socioeconomic and political
development. From text above it is clear the differences in the strength of the social culture of
Indonesia and Malaysia. Indonesia emphasize the importance of national unity that stretches
from Sabang to Merauke, which consists of various ethnic and cultural as well as religion and
faith, while Malaysia stressed the importance of basic social and basic cultural as a means of
to achieve the social welfare to improving the socio-economic and political development.
e. Government. In the Constitutions of 1945 stated Indonesia is a unitary state of a
republic and the president of the Republic of Indonesia as the holder of the power of
government. While in Malaysia governance system there are three main bodies that have
powers, duties, and their respective roles. The three main areas that are the Legislature, the
Government, and the Judiciary.
f. Local community. Local communities in Indonesia consists of various tribes and
cultures that live in groups and spread from Sabang to Merauke, whether they live in remote
areas, as well as those living in the border areas that poor in economy. While the local
community in Malaysia consists of several kinds of indigenous tribes and live in groups
scattered in West Malaysia and modern communities doing activities together in work and
managing the business, such as FELDA, Felcra and others. The strength of local communities
in Indonesia and Malaysia is almost the same, that is composed of several indigenous tribes
and live in groups both in rural areas and in remote areas, only in Malaysia already has a modern
local communities that live in groups and work and strive together in group.
g. Customers. As already explained at the beginning that the Indonesian population is
approximately 242.3 million people, who live in urban areas and the remaining approximately
44.6 million inhabitants live in rural and remote areas. If the USO customer is assumed the
Indonesian population living in rural and remote areas, it can be said that the USO customers
is higher than the total number of Indonesian population. While Malaysia's population is
approximately 28.9 million, who live in cities around 7.29 million people and the rest live in
the countryside. The big difference in population between Indonesia and Malaysia are very
large, led to the development of telecommunications in Indonesia is slower than Malaysia. But
the fact is, this actually an opportunity for Indonesia to develop more advanced
telecommunications because there are still many unserved customers.
Based on some of the above explanation both internal and external environment, it can
be drawn a conclusion that there are some differences in the underlying implementation of
management strategy of the USO in Indonesia USP in Malaysia. The difference from the
64
environment observation will affect the next management strategy process formulation of the
problem.
Discussion
Given this environment observation is very important and will affect the next process,
it is necessary to note to all the variables of environmental monitoring both internal and external
environment. The previous section has discussed about the comparison of the variables
involved. Based on this comparison, there are several things that need to be discussed, namely:
1. The internal environment. The internal environment of implementation of USO in
Indonesia, which consists of the structure, culture and resource, is very different from the
implementation of USP in Malaysia. These differences will affect the results in each country.
In Malaysia, the implementation of the USP carried out by an independent agency that regulates
all telecommunications activities, especially the implementation of USP. This independence
gives the authority and responsibility to manage and finance programs implementation of USP,
while in Indonesia all the implementation of USO dependent on the government because party
in control is the government, so that the implementation of the USO is not independent.
2. The external environment. In the external environment is composed of social
environment and industrial environment. In which the social environment consists of economy,
technology, politic and legal, and social culture, while the industry environment consists of
government, local communities and customers. All of these factors are have significant
differences between the implementation of USO in Indonesia and USP in Malaysia. Starting
from the economic factor, a consideration factor which will affect the ability for purchasing
power; technological factors will affect the ability of service providers to prepare which to be
adjusted to the ability for purchasing power of public; political and legal factors as well as
socio-cultural factors will affect all subsequent processes. So is the factor of government, local
communities and customers as opportunities to carry out the implementation of the USO and
USP are very different between Indonesia and Malaysia.
Based on this environment observation, can be concluded that one of the factors that
led to the difference in rank or position of the Malaysian ICT higher than Indonesia is the
difference in the internal environment and the external environment to the two countries.
Recommendations
Indonesia can reach the top positions in the ranking of ICT if considering to the
beginning process of the management strategy which is environment observation.
Environmental observation should be used as a basis in preparing the next process, thus this
process will be considered more properly and carefully.
References
Abdullah, H. H. (2011). Pengurusan Strategik Konsep dan Kes. Malaysia: Pearson Prentice
Hall.
Alleman, J., Rappoport, P.& Banerjee, A. (2010). Universal service: A new definition?
Telecommunications Policy, 34(1-2), 86–91. doi:10.1016/j.telpol.2009.11.009.
Bautista, M. F. (2002). Universal Service in Times of Reform: Affordability and
Accessibility of Telecommunication Service in Latin America. In Communications
Policy and Information Technology Promises, Problems, Prospects, pp. 347–382.
65
Benjamin, P.& Dahms, M. (1999). Background paper on universal service and universal
access issues. … , Johannesburg, Last Seen at …, (June 1999). Retrieved from
http://www.elmayorportaldegerencia.com/Documentos/Telecomunicaciones/[PD]
Documentos - Servicio y acceso universal.pdf.
Bowman, C. (1998). Strategy in Practice. London: Prentice Hall Europe.
Elo, S.& Kyngäs, H. (2008). The qualitative content analysis process. Journal of Advanced
Nursing, 62(1), 107–15. doi:10.1111/j.1365-2648.2007.04569.x.
Gautier, A.& Wauthy, X. (2012). Competitively neutral universal service obligations.
Information Economics and Policy, 24, 254–261.
doi:10.1016/j.infoecopol.2012.04.001.
Gunawan, V. A. (2006). Evaluasi Pelaksanaan Universal Service Obligation (USO) Tahun
2004 Di Provinsi Jawa Tengah.
Hsieh, H.F.& Shannon, S. E. (2005). Three approaches to qualitative content analysis.
Qualitative Health Research, 15(9), 1277–88. doi:10.1177/1049732305276687.
Huntley, J. (2004). Universal Service, the Internet and the Access Deficit. SCRIPT-Ed, 1(2),
301–334. doi:10.2966/scrip.010204.301.
Intelecon. (2009). Universal Access and Service Funds. Inteleconresearch.com. Retrieved
January 20, 2010, from
http://www.inteleconresearch.com/pages/documents/UASFFunds2009updateOct2009.pdf.
ITU. (1998). Methodological note on universal service obligations, 2(October), 1–9.
Janowitz, M. (1968). Constribution to Content Analysis. The Public Opinion Quarterly,
32(4), pp. 646–658.
Jayakar, K. P.& Sawhney, H. (2003). Universal service beyond established practice to
possibility space. In Telecommunication Polic Research Conference.
Mayring, P. (2000). Qualitative Content Analysis. FORUM : QUALITATIVE SOCIAL
RESEARCH SOZIALFORSCHUNG, 1(June).
McKean, D. (2009). Fast Track to Success Starategy. Harlow, England: Pearson Education
Limited.
Norton, B. & Irving, R. (2002). Strategy in a Week. Oxon: Hodder Arnold.
Oestman, S.& Dymond, A. (2008). Universal Access and Service. Retrieved from
www.ictregulationtoolkit.org/en/Document.3606.pdf?.
Palmquist, M. (1980). Content Analysis.
http://www.colostate.edu/Depts/WritingCenter/references/research/content/page2.htm.
Richardson, D. (2002). Towards Universal Telecom Access for Rural and Remote
Communities.
Wheelen, T. L. & Hunger, J. D. (2006). Startegic Management and Bussiness Policy (10th
edition). New Jesley: Pearson Prentice Hall.
Xavier, P. (2008). From universal service to universal network access? Info, 10(5/6), 20–32.
doi:10.1108/14636690810904689.
66
THE RELATIONSHIP OF JOB SATISFACTION, LEADERSHIP STYLE,
LOCUS OF CONTROL AND ORGANIZATIONAL COMMITMENT
TO AUDIT QUALITY
Khoirul Aswar
Faculty of Economics, University of Pembangunan Nasional "Veteran" Jakarta
Abstract
The purpose of this research are shown relationshipof job satisfaction, leadership style,
locus of control andorganizational commitmentto audit quality. The unit of analysisare
auditorswhoworkedatBPKofficeby
usingnon-probabilitysampling
with
purposive
samplingtechnique.Processed datain this studyisprimary dataofquestionnairesorquestions
posed toBPK auditorswere 140respondents. The tools of analyze is part analysis
withPLS(Partial Least Squere) 2.0.The resultson this reseach and hypothesis testing showthat
Job satisfaction positively related to organizational commitment, leadership styleis positively
related toorganizational commitment, locus of control negative related with organization
commitment,organizational commitment is positivelyrelated toauditquality.
Keywords: Job Satisfaction, leadership style,Locus of Control, Organization commitment,
Audit quality
Introduction
Implementation of accountability principle in the public sector is closely related to the
role of auditors in order to provide reasonable assurance on the fairness financial information
of the governments disclosed to the public. The auditor is meant here is that government
auditors in this case to examine the roles and responsibilities of the management of finance
state are at the Supreme Audit Agency (BPK) based on Law No. 15 of 2006. In performing its
duties, the BPK is also supported by several laws in the framework of the implementation of
public accountability as Act No. 17 of 2003 on Finance State and Law No. 15 of 2004 on
Management and Financial Accountability and Regulation No. 1 of 2007 on State Audit
Standards.BPK audit includes examining the scope for financial management and
responsibility of the state which is examination of financial, inspectionperformance and
examination with a specific purpose. In addition to the BPK, the examination of the
management and financial responsibility of the state is also carried out by the Finance and
Development Supervisory Agency (BPKP) as an internal auditor of government. This is stated
in the vision BPKP i.e Auditor President responsive, interactive, and reliable to realize the
quality of financial accountability state. With the examination performed by the BPK and the
BPKP expected that people can find out how the actual implementation of the State's financial
management. In order for these objectives to be achieved, the audit carried out either by the
BPK and BPKP to be really good quality.
Donnelly et al (2003a) conducted research on the factors that contribute to the
acceptance of dysfunctional behavior. The results showed that the auditors who receive
dysfunctional behaviors tend to have an external locus of control, reported levels of personal
performance lower and indicated their intention to stop working is higher. Research Donnelly
et al (2003b) also conducted a study of the auditor's acceptance of dysfunctional behavior by
examining factors locus of control, the position of auditor in public accounting firm and
Organizational Commitment as antecedents’ acceptance auditor dysfunctional behavior. The
67
results show that the locus of control has a direct influence on the acceptance of dysfunctional
behavior. Locus of control also affects the acceptance of dysfunctional behavior through
organizational commitment. Individuals with an external locus of control have lower
organizational commitment and organizational commitment associated with a lower likelihood
of higher dysfunctional behavior. In addition, the auditor with a lower position in a public
accounting firm is more likely to accept the audit dysfunctional behavior.
In addition to personal Fator, a factor which is also influenced by situational factor is
job satisfaction. Gunlu et al. (2009), the research found a positive relationship between job
satisfaction and organizational commitment. Naderi (2011), in his study found a significant
positive correlation between job satisfaction and organizational commitment. Silva (2006)
found a significant relationship between job satisfaction and organizational commitment. At
the time of a person's job satisfaction increases, then at the same time will also increase
organizational commitment.This research attempts to develop a research conducted by
Donnelly et al (2003b) by replacing the variable positions into job satisfaction and leadership
style. The selection of the variables of job satisfaction and leadership style to replace the
variable position of the results of previous studies due to the important role of job satisfaction
and leadership style to the behavior of its members during the audit. Expected with good
leadership style will reduce the level of deviation from the audit team members that will
produce a quality audit. Thus, this study tried to see how the relationship between job
satisfaction, leadership style, locus of control and organizational commitment and leadership
style in organizations to audit quality on government auditors.
Objectives
The purpose of this study was to provide empirical evidence for the public sector audit
regarding:
1) The relationship between job satisfaction and organizational commitment
2) The relationship between leadership style and organizational commitment
3) The relationship between locus of control and organizational commitment
4) The relationship between organizational commitment and audit quality
Research Metholodogy
The object of this research is the auditor who works at the Supreme Audit Agency
(BPK). What is auditor meant here is BPK employees who have been with the Functional
Auditor (JFA), was placed on the technical unit and has been doing the examination. The
samples in this study are 140 respondents with using non-probability sampling method with
purposive sampling technique.
Job satisfaction, is a reflection of a person's attitudes and behavior towards his job.
That is the extent to which people feel positive or negative about the intrinsic and extrinsic
aspects of a job (Furnham et al. 2009). Job satisfaction was measured by using the dimensions
in the adaptation of Azeem (2010) using a questionnaire developed from the Minnesota
Satisfaction Questionnaire.
Leadership style, which is how a leader to influence subordinates to perform a certain
action. This variable has two dimensions, namely the consideration and initiating structure
were measured using an instrument developed by the Ohio State University is the Leader
Behavior Description Questionnaire (LBDQ) which has been used by Prat and Jiambalvo
(1982).
Locus of Control, the perceptions of the success or failure for any actions taken in his
life. The perception of individuals associated with external factors such as fate, fortune, power
boss and work environment and also connected with individual internal factors include the
68
ability to work and work -related measures of success and failure of the individual work. This
variable was measured by using the Work Locus of Control Scale (WLCs) developed by
Spector (1982), which consists of 16 questions. The instrument used in this study was adopted
from research Donnelly et al (2003a).
Organizational Commitment, namely identification, loyalty and involvement shown
by employees against the organization or unit within the organization. (Gibson et al. 2009).
This variable was measured by using an instrument Three Component Model developed by
Meyer and Alen (1990), which consists of affective commitment, continuous commitment and
normative commitment.
Audit Quality Government, namely the perception of preparers of financial
statements. The instrument used is instrument that has been used Behn, Carcello, Hermanson
& Hermanson, et.al. (1997).
Results/Conclusion
In addition to test discriminant validity, PLS also requires the convergent validity of
the test. The criteria used to determine the convergent validity is to look at the value AVE and
Communality which should be above 0.5 (Jogiyanto, 2009). According to the table 1 below,
note that the value AVE and Communality each variable has met the above criteria, ie 0.5.
Table 1Result convergent validity test
Variabel
AVE
Job Satisfaction
0,594328
Leadership Style
0,537793
Locus of Control
0,512843
Organizational Commitment
0,547044
Communality
0,594328
0,537793
0,512843
0,547043
Reliability testing is done by looking at the value of Cronbach’s Alpha and composite
reliability. A variable or construct said to be reliable if it gives the value of Cronbach's Alpha
(α) greater than 0.60 and composite reliability values above 0.7 (Jogiyanto, 2009). The results
of the reliability test can be seen in the following table:
Variabel
Job Satisfaction
Leadership style
Locus of Control
Organizational Commitment
Table 2Result of reability test
Cronbach’s Alpha
0,830
0,949
0,893
0,611
Composite Reliability
0,880
0,954
0,912
0,780
Uji Hipotesis dengan Partial Least Square (PLS)
Testing this hypothesis using PLS Version 2.0. The criteria used in measuring
supporting hypothesis are to look at the ratio of the value of the T-table and T-statistics. If the
value of T-statistics is higher than the value of the T-table means that the hypothesis is
supported. For the 95 percent confidence level (alpha 5 percent), the value of the T-table for a
two-tailed hypothesis (two-tailed) was ≥ 1.96 and for a one-tailed hypothesis (one-tailed ) was
≥ 1.64 (Jogiyanto, 2009). The supporting size hypothesis used in this research is to use the
value of the T- table two-tailed hypothesis (two-tailed) is ≥ 1.96. The test results can be seen
in the following:
69
JS  OC
Table 3Path Coefficients (Mean, STDEV, T-Values)
Original
Sample
Standard
Standard
Sample (O) Mean (M)
Deviation
Error
(STDEV)
(STERR)
0,394052
0,417387
0,105244
0,105244
T Statistics
(|O/STERR|)
3,744182
LS  OC
0,230745
0,240598
0,098430
0,098430
2,344262
LOC  OC
OC  AQ
-0,299936
0,566189
-0,300026
0,568973
0,139685
0,064388
0,139685
0,064388
2,147236
8,793422
First Hypothesis Testing
Test results using the PLS in Table 3 shows that the value of T statistics of job
satisfaction on organizational commitment is 3.744182, so it can be said that job satisfaction is
related to organizational commitment. In addition, the original sample showed that the
relationship between job satisfaction and organizational commitment was positively
characterized by the value of 0.394052. Thus, the hypothesis that job satisfaction is positively
related to organizational commitment statistically supported so that it can be concluded that the
more satisfied a person to work the more committed to the organization.
Second hypothesis testing
From the test results shown in Table 3, it is seen that the value of T statistics of
leadership style on organizational commitment is 2.344262, so it can be said that the leadership
style associated with organizational commitment. In addition, the original sample showed that
the relationship of leadership style and organizational commitment was positively
characterized by the value of 0.230745. Thus, the hypothesis that the leadership style was
positively related to organizational commitment statistically supported, so it can be concluded
that the better of leadership style of the team leader, the higher the government's commitment
to the BPK auditors.
Third Hypothesis Testing
Test results using the PLS in Table 3 shows that the value of T statistics of external
locus of control variables on organizational commitment is 2.147236, so it can be said that the
external locus of control associated with organizational commitment. In addition, the original
sample showed that the relationship between locus of control and organizational commitment
is negatively characterized by the value of -0.299936. Thus, the hypothesis that external locus
of control is negatively related to organizational commitment statistically supported, so it can
be concluded that the more external locus of control a person, the lower a person's commitment
to the organization of the work, which in this case is the BPK.
Fourth Hypothesis Testing
Test results using the PLS in Table 3 shows that the value of T statistics of
organization's commitment to audit quality is 8.793422, so it can be said that the organization
commitment related to audit quality. In addition, the original sample showed that the
relationship of organizational commitment and positive audit quality is characterized by the
value of 0.566189. Thus, the hypothesis that organizational commitment is positively related
to audit quality statistically supported, so it can be concluded that the higher organizational
commitment by government auditors, the higher the quality of audits that will be generated.
70
Discussion
The relationship between job satisfaction and organizational commitment
The results show that the presence of positive and significant relationship between job
satisfaction on organizational commitment. Job satisfaction was measured with the work itself,
pay, supervision, promotion and labor relations. The results of the assessment, the work
presented in accordance with the areas of expertise, given the chance to develop themselves,
and had relations with other family who will be able to increase the job satisfaction that feels
better to remain in the organization to spend his career. These results are consistent with the
results of Naderi (2011) in his research found a positive and significant relationship between
job satisfaction and organizational commitment. Various dimensions of job satisfaction, such
as satisfaction with salary, will be a co-worker satisfaction, leadership and supervision of the
work itself is needed by workers to meet their basic needs. When they met the needs of their
organization's level of commitment will be high.
The relationship between leadership style and organizational commitment
The results show that the leadership style is positively related to organizational
commitment. These results support the research conducted by Dale and Fox (2008) which
showed that that leadership style both consideration and initiating structure has a positive
relationship with organizational commitment. It can be concluded that the leader has a very
important role in directing subordinates to be aligned with an organization that can help leaders
as representatives of the organization to achieve organizational goals that have been set. Team
leader with good leadership style by considering the closeness of the relationship and mutual
trust with its members as well as providing employment structure for its members tend to
improve the commitment of its members to the organization.
The relationship between external locus of control and organizational commitment
The results show that external locus of control is negatively related to organizational
commitment. This is consistent with previous studies by Donnelly et al (2003a, 2003b), which
implies that external locus of control have a lower level of commitment than internal locus of
control. Referring to the previous studies on the characteristics of individuals with an internal
locus of control and external, showed that individuals with an internal locus of control,
motivation, performance and higher job satisfaction is accompanied by greater opportunities
like get it and increased salary and position better than external, internal then will be happy in
the organization, resulting in them more likely to survive in the organization and further
demonstrate its commitment. Thus, it can be concluded that the more external locus of control,
someone will get low individual commitment is particularly committed to the organization for
which he worked. Or in other words that the government auditor with external locus of control
characteristics have low commitment to the organization.
The relationship between organizational commitment and audit quality
The results show that organizational commitment is positively related to audit quality.
These results support the research conducted by Lord and Dezoort (2001) in Setiawan (2005)
that the auditor with high organizational commitment will be possible to maintain the quality
of the audit. In other words, government auditors who have high organizational commitment
will tend to perform best efforts during the audit so that the resulting quality audits. This is
done because of a commitment to the organization indicated by; (1) a strong desire to remain
as members of a particular organization, (2) the desire to strive to suit the organization, and (3)
certain beliefs and acceptance of the values and goals of the organization (Luthans, 2005).
71
Recommendations
In order for this study can be used as a reference for future studies, the researchers gave
some advice that can be considered in the framework of the improvement and development of
further research, which include: further research should be able to consider the timing of the
audit of the BPK so that the sample obtained is not limited or in a small amount of research in
order to obtain a better result. The development of further research can be done by adding other
variables related to personal characteristics such as self-efficacy.
References
Anari, N. & Nahid. (2012). Teachers: emotional intelligence, job satisfaction, and
organizational commitment, Vol. 24, Issue 4. pp. 256-269.
Boles, J., Madupalli, R., Rutherford, B.& Wood, J. A.(2007). The relationship of facets of
salesperson job satisfaction with affective organizational commitment. Journal of
Business & Industrial Marketing, Vol. 22, Issue 5. pp. 311-321.
Coleman, D. F., Irving, G. P. & Cooper, C. L. (1999). Another look at the locus of controlorganizational commitment relationship: It depends on the form of commitment.
Journal of Organizational Behavior 20, pp. 995-1001.
Dale, K.& Fox, M. L. (2008). Leadership style and organizational commitment: Mediating
effect of role stress. Journal of Managerial Issues, Vol. XX, No. 1, pp. 109-130.
Donnelly, D. P., Quirin, J. J. & O’Bryan, D. (2003a). Auditor acceptance of dysfunctional
audit behavior: An explanatory model using auditor’s personal characteristics.
Behavioral Research in Accounting, Vol. 15, pp.87-110.
Donnelly, D. P., Quirin, J. J. & O’Bryan, D. (2003b). Attitudes toward dysfunctional audit
behavior: The effect of locus of control, organizational commitment and position.
The Journal of Applied Business Research, Vol. 19, No.1, pp.95-107.
Ghozali, I. (2008). Structural equation modelling: Metode alternatif dengan partial least
square. Edisi 2. Semarang: Badan Penerbit Universitas Diponegoro.
Gibson, L. (2009). Organizations: behavior, structure, process. 13th edition. McGraw-Hill.
Gunlu, E., Aksarayli, M., Perçin, S.& Nilüfer.(2010). Job satisfaction and organizational
commitment of hotel managers in Turkey.International Journal of Contemporary
Hospitality Management, Vol. 22, Issue 5. pp. 693-717.
Hanggana, S. (2003). Pengaruh gaya kepemimpinan transformasional senior auditor terhadap
komitmen organisasional, perilaku extrarole dan kinerja asisten auditor. Tesis Magister
Sains FEB UGM, Yogyakarta.
Jiambalvo, J.& Pratt, J. (1982). Task complexity and leadership effectiveness in CPA
firms.The Accounting Review, Vol. 57, No. 4, pp. 734-750.
Jogiyanto, M. (2009). Konsep dan Aplikasi PLS (Partial Least Square) untuk Penelitian
Empiris. BPFE Yogyakarta.
Kinicki, A. J.& Vecchio,R. P.(1994). Influences on the quality of supervisor-subordinate
relations: The role of time-pressure. Organizational Commitment and Locus of Control.
Journal of Organizational Behavior, Vol. 15, pp. 75-82.
Kreitner, R. & Kinicki, A. (2008). Organizational Behavior. 8th edition. McGraw-Hill.
Luthans, F. (2005). Organizational Behavior. 10th edition. McGraw-Hill Companies.
Meyer, J. P.& Allen,N. J. (1990). The measurement and antecedent of affective, continuance
and normative commitment to the organization. Journal of Occupational Psychology
63, pp. 1-18.
72
Sekaran, U. (2006). Research methods for business. 4thedition. Jakarta: Salemba Empat.
Setiawan, S. (2005). Determinan dan konsekuensi perilaku disfungsional auditor. Tesis
Magister Sains FEB UGM Yogyakarta.
Trisnaningsih, S. (2007). Independensi auditor dan komitmen organisasi sebagai mediasi
pengaruh pemahaman good governance, gaya kepemimpinan dan budaya organisasi
terhadap kinerja auditor. SNA X Makassar, AMKP-02.
Wang, X. (2007). Learning, job satisfaction and commitment: an empirical study of
organizations in china, Vol. 1, No. 3. pp. 167-179.
73
THE INTERNAL AUDIT ROLEAND IT SOPHISTICATED
IN IMPROVING THE IT SUCCESS AT PUBLIC UNIVERSITIES
IN INDONESIA
Sambas Ade Kesuma 1 and Risanty2
1, 2
Accounting Department, University of Sumatera Utara
Abstract
Informationsystemsandinformation technology are a strategic tool in an effort to
improve the performance of an organization.As a pioneer of higher-education organizations,
public university in Indonesia is a key player in an effort to educate the intellectual life of the
nation and become a superior generation as well. Through the synergy of IS and IT, public
universities will be able to improve the capabilities and service quality to the communities.
Similarly, the role of internal audit and IT sophisticated became one of the major factors in
increasing the IT success in public universities in Indonesia.
Keywords: internal audit role, IT Sophistication, IT success, publicuniversity
Introduction
An information system (IS) is a strategic tool for most organizations and become one
of the core resources that will play an important role in the market competition. The effective
use of IS will enable the organization to survive and controlled the market or, on the contrary,
will throw out of the market competition. IS researcherhad agreed that the combination of IS
and information technology (IT) will improve the competitiveness of an organization.
Public universities in Indonesia are the leading pillar of higher education in creating
and building the quality resources needed by the country and their environment. Modern
paradigm in higher education requires quality and relevance; quality is the critical focus in the
development of higher education, where the quality of the education system will improve the
competitiveness of the nation. Quality covers all operational aspects of the organization of
universities, namely, the education and research aspects, institutional aspects, financial aspects
and technological aspects. Meanwhile, the relevance is all the efforts made to generate the best
output in accordance with the objectives established by the government.
To increase the quality of higher education, each public university in Indonesia requires
IT assistance.With the IT support, public universities will be able to process operational
activities more effectively, started from recruitment of students, lecturers and staff
management, through the management of financial information that will reported to the
government. Surya (2013) stated that the development of IT sophistication in public
universitieshas now reached a one step ahead, where it can function as a strategic enabler in
improving organizational performance. IT is used as an information system, that is, Academic
Information Systems (AIS) and Management Information System (MIS), thatis an important
IT tool that should exist in every university organizational structure, particularly to reduce the
complexity of the activities that should be handled. Indrajit (2006) also added, IT in education
institutions serves as a tool or infrastructure for implementation of learning activities. This is
74
also related to the increasing number of lecturers using various IT tools to help them explain
the existing teaching materials in several visual or multimedia illustrations.
Currently, the use of IT in the public universities is feasible; however, in line with the
rapid development of IT will also have negative impacts on the organization itself. Based on
previous research, it was clear that the public universities in Indonesia, not managing IT by
using the Best-Practice standards as commonly used in the industrial world. This leads to the
average IT management in public universities in Indonesia is still low, which can result in
increased inefficiencies in the use of IT, improvidence of IT investment, significant disruption
of the IT operation and so on (Surya, 2013). Moreover, the lack of internal audit role or usually
referred as an internal audit unit in public universities in the monitoring and evaluation of the
operational implementation at state universities are still ineffective, it is also associated with
the limited capabilities of the individual or the number of internal auditors who have the skills
and a good knowledge of IT. Issues related to IT quality by each public university is also
crucial. The spread and use of IT infrastructure at public universities is still limited to a standard
infrastructure, the quality of the hardware has a relatively modest and limited capacity, the use
of software (both financial and accounting software and database software) are also limited,
even some universities still use the common office software packages to record daily
transactions. This has led to several public universities, especially those in remote areas of
Indonesia will be lagging behind other state universities.
PublicUniversitiesin Indonesia
The state universities originated from the Dutch colonial period. At that period, the
colonial government providesa number of facilities for the people, that is education. With these
programs, several schools were established, as well as some universities based in Batavia
(Jakarta), Bandung and Surabaya. During this period, the focus of the school or university is
still confined to the health study (medical), technology and agriculture.Forthe past few decades,
higher education in Indonesia became the center of study for students from neighboring
countries such as Malaysia, Thailand and Singapore, who wish to pursue higher education in
Indonesia. Many students from the neighboring country were studied at several major
universities in Indonesia. Unfortunately, in current days, a lot more Indonesian students
studying in Malaysia and Singapore as compared to Malaysia and Singapore's students
studying in Indonesia (Marhum, 2009).In 2014, Indonesia has more than 60 public universities
spread throughout Indonesia. The detail list of public universities will show in table 1.
75
Table 1. List of Public Universities in 2014
No
Province
Public university
No.
Province
Public university
1
Aceh
Universitas Syiah Kuala
31
East Java
UIN Sunan Ampel Surabaya
2
Aceh
Universitas Malikussaleh
32
East Java
UIN Malik Ibrahim Malang
3
Bali
Universitas Udayana
33
West Kalimantan
Universitas Tanjungpura
4
Bali
Universitas Pendidikan Ganesha
34
South Kalimantan
5
Banten
35
Central Kalimantan
6
Bengkulu
Universitas Sultan Ageng
Tirtayasa
Universitas Bengkulu
Universitas Lambung
Mangkurat
Universitas Palangkaraya
36
East Kalimantan
Universitas Mulawarman
7
Yogyakarta
Universitas Gadjah Mada
37
East Kalimantan
Universitas Borneo Tarakan
8
Yogyakarta
Universitas Negeri Yogyakarta
38
Bangka Belitung
Universitas Bangka Belitung
9
Yogyakarta
Uin Sunan Kalijaga Yogyakarta
39
Riau
10
Jakarta
Universitas Indonesia
40
Lampung
Universitas Maritim Raja
Ali Haji
Universitas Lampung
11
Jakarta
Universitas Negeri Jakarta
41
Maluku
Universitas Pattimura
12
Jakarta
UIN Syarif Hidayatullah Jakarta
42
North Maluku
Universitas Khairun
13
Gorontalo
Universitas Negeri Gorontalo
43
West Nusa Tenggara
Universitas Mataram
14
Jambi
Universitas Jambi
44
East Nusa Tenggara
Universitas Nusa Cendana
15
West Java
Institut Pertanian Bogor
45
Papua
Universitas Cenderawasih
16
West Java
Institut Teknologi Bandung
46
Papua
17
West Java
Universitas Padjadjaran
47
West Papua
Universitas Musamus
Merauke
Universitas Negeri Papua
18
West Java
48
Riau
Universitas Riau
19
West Java
49
Riau
20
Central Java
Universitas Pendidikan
Indonesia
UIN Sunan Gunung Djati
Bandung
Universitas Diponegoro
50
South Sulawesi
UIN Sultan Syarif Kasim
Riau
Universitas Hasanuddin
21
Central Java
Universitas Negeri Semarang
51
South Sulawesi
Universitas Negeri Makassar
22
Central Java
Universitas Jenderal Soedirman
52
South Sulawesi
23
Central Java
Universitas Sebelas Maret
53
Central Sulawesi
UIN Sultan Alauddin
Makassar
Universitas Tadulako
24
East Java
Universitas Airlangga
54
Central Sulawesi
Universitas Haluoleo
25
East Java
55
North Sulawesi
Universitas Sam Ratulangi
26
East Java
Institut Teknologi Sepuluh
Nopember
Universitas Negeri Surabaya
56
North Sulawesi
Universitas Negeri Manado
27
East Java
Universitas Trunojoyo Madura
57
West Sumatera
Universitas Andalas
28
East Java
Universitas Brawijaya
58
West Sumatera
Universitas Negeri Padang
29
East Java
Universitas Negeri Malang
59
South Sumatera
Universitas Sriwijaya
30
East Java
Universitas Jember
60
North Sumatera
Universitas Sumatera Utara
61
North Sumatera
Universitas Negeri Medan
Source: SNMPTN (2014).
There are several arguments and discussion about the development of higher education
in Indonesia such as the issue of higher-education quality, a polemic about teaching university
76
vs research university, and the issue of the autonomy university as the implementation of PP
No. 61 of 1999 (Marhum, 2009).
The Internal Audit Role in Public Universities.
The role and functions of the internal audit are one of the important components in
supporting the implementation of an organization's operations. According to the Institute of
Internal auditors (IIA), Internal audit is an independent, objective assurance and consulting
activity designed to add value and improve an organization's operations. It helps an
organization accomplish its objectives by bringing a systematic, disciplined approach to
evaluate and improve the effectiveness of risk management, control, and governance processes
(Boynton, 2005). From these statements, can be found that the main role of internal audit is to
assist and provide value added to the organization. Hermanson, et al (2008), emphasized that
internal auditors are experts in governance, risk management and internal control. Internal
Audit attempts to improve the organization's operations and to reduce the possibility of risks,
including unreliable financial reporting. Internal auditors also assist management in designing
and maintaining effective internal control structure. The internal auditor is responsible for
assessing the adequacy and effectiveness of each control system as well, which will provide a
quality assurance and integrity of the financial reporting process.
Based on research conducted by Indonesian Securities and Exchange Commission
(BAPEPAM) in 2006 indicated that the internal audit function in Indonesia is still considered
inadequate. The ineffectiveness of internal control in Indonesia, especially in the university
environment as evidenced by the emergence of corruption allegations. During the year 2012,
at least five universities allegedly involved in the fraud. Nevertheless, it is still anallegation
that the principle of the presumption of innocence must be established. Fraud case that occurred
in the university environment can be anticipated earlier by university leaders, by identifying
the types of fraud so that can know symptoms that may occur after the action (Dewi and
Apandi, 2012).
IT SophisticationinPublic Universities.
In the computerized circumstances, IT functioned is the key platform for most of the
other system components depend. According to Alexander et al. (2010), several previous
Researcherssuch as Cheney and Dickson (1982) and Nolan (1973) claimed, IT sophistication
appearedforefficiencybusiness systems analysis of computer resources, generally accepted
guidelines for using computers, and return on investments following computer installations.
Pare and Sicotte (2001) defined IT sophistication as the maturity and diversity of technological
hardware and software used to support implementation of an IS.
IT Success in Public Universities
The development of IT process is expected to improve organizational performance.
Thus, it will indicate that if the IT efficiently and satisfy the user, then IT will successfully
implement. However, Cronk & Fitzgerald (2002) asserted that evaluatingtheIT success is not
aneasy task, because the system is complicated, and have been multidimensional. IT factors
will dramatically develop with a various of new facility and capabilities. Seddon et al. (2002)
also highlighted that IS assessment willbe shifted from the technical or financial perspective to
a business-oriented. Consequently,itismore difficult to evaluate IT now than in the past as there
are additionally intangible benefits to consider.
77
Public universities require IT support, from data processing with the use within
administrative services, with a variety of activities from new admissions, lectures, tuition
payment, examination, through the financial reporting to the government.A lot of benefits
derived from the use of IT in support of administrative services as described earlier, the
capacity of IT will result more accurate and timely process. In those capacities, and added with
the use of interconnected networks, technology, IT will provide the value added to the
university.
The success of IT application in public universities currently varied; private university
is still better to the use of IT in order to increase their value added and competitiveness. This
is apparent in the award ceremony by PT. Telkom in the Telkom Smart Campus Award
(TeSCA) - The ICT's Smartest Campus 2013 event. Several private universities dominate the
top 10 rankings in the awarding ceremony. Respectively, the University of Indonesia (UI) as
the winner of the ICT's Smartest Campus in 2013, the next position is Gunadarma University,
Institute of Technology Bandung, Padjadjaran University, Airlangga University, STMIK
AMIKOM Yogyakarta, Universitas Bina Nusantara, Universitas Komputer Indonesia, Gadjah
Mada University and Universitas Kristen Duta Wacana. This is proved that, private universities
more capable to take the advantage of IT to compete with public universities.
Supangkat and Ari (2006) argue that the implementation of IT in the several public
universities in Indonesia still under development and has different characteristics with
universities in other countries, that is: IT development is still driven vendor/product base, both
for the development of infrastructure, hardware and software, management commitment
merely awareness, but not with a clear action plan; The lack of procedures'controls in the
implementation of IT, ineffective of human-resource planning and management, The lack of
funding and financial planning, and lack of awareness for the sharing of information and
documentation. The characteristics mentioned above can be used as a guide in determining the
internal processes needed by the organization in achieving IT objectives.
Conclusion
The IT success in public universities, generally is below the universities in developed
countries, although there are several public universities are already well-established and
excellent in the application of IT.The IT Sophisticatedusedinpublicuniversityenvironmentsin
order toimprovetheoperational organization is still ineffective, both the capability and quality.
The use of hardware, softwareandothertechnologyarestillpartialandlimited only to help resolve
the daily tasks and not for the integration of the whole IS. Meanwhile, the role of internal
auditors in the public universities to conduct monitoring and risk assessment has not been fully
effective; it is characterized by several cases of alleged corruption.Furthermore, every
respective public universities are expected to recruit tthe best internal auditors who have the
best capability and knowledge in the IT, hence the role of the internal auditor can be optimized
and capable of encouraging the successful implementation of IT. From the brief discussion
earlier, the government of Indonesia through the Ministry of Education and particular
stakeholders to focus and prioritize the improvement of the quality of higher education with
the use of IT. In addition, audits and evaluation should be done on an ongoing basis at the
university to anticipate the possibility of fraud.
78
References
Alexander, G. L., Madsen, R.&Wakefield, D. (2010). A regional assessment of
informationtechnologysophisticationin Missouri Nursing Homes. Policy, Politics&
Nursing Practice. 20(10), 1–12.
Arens, A. A., Elder, R. J., &Beasley, M. S. (2012). Auditingandassuranceservices:
Anintegrated approach.14thedition. Pearson Prentice Hall.
Boynton, W. C. (2005). Modern auditing: Assurance services and the integrity of financial
reporting. Wiley.
Cronk, M. C.& Fitzgerald, E. P. (2002). Constructing a theory of IS business value from
theliterature. Electronic Journal of Business Research Methods, 1(1), 11-17.
Dewi, R. &Apandi, N. N. (2012). Gejala fraud dan peran auditor internal dalam pendeteksian
fraud di lingkungan perguruan tinggi (studi kualitatif). Prosiding Simposium Nasional
Akuntansi. Vol. 15.
Fernandez, A.&Faraon, L. (2008). An IT governanceframework for universitiesin Spain.
http://www.gti4u.es. Accessed on March, 2014.
Hermanson, D. R., Ivancevich, D. M.&Ivancevich, S. H. (2008). Building aneffective internal
audit function: Learningfrom SOX section 404. Review of Business. 2, 28.
Indrajit, E. (2008).Mengukur tingkat kematangan pemanfataan teknologi informasi institusi
pendidikan (suatu pendekatan kesiapan pemegang kepentingan/stakeholder), STMKB
Perbanas, Jakarta.
Marhum, M. (2009). prospek pendidikan tinggi di
indonesia.http://pendidikantinggi.blogspot.com/2009/05/prospek-pendidikan-tinggi-diindonesia.html. Accessed on March, 2014.
Pare, G.& Sicotte, C. (2001). Information technology sophistication in health care: An
instrument validation study among Canadian hospitals. International Journal of Medical
Informatics, 63, 205-223.
SNPTN. (2014). Daftar PTN SNMPTN 2014.
http://www.snmptn.ac.id/ptn.html. Accessed on April, 2014.
Supangkat, S. H.&Ari, I. M. J. (2006). Pengembangan metode pengukuran sistem TI (Kasus
perguruan tinggi di Indonesia). National Conference on Information Technology
&Communication for Indonesia Proceeding.
Surya, R. T. (2013). Audit tata kelola TI SIM perguruan tinggi menggunakan
bestpracticeCOBIT Versi 5. http://m.kompasiana.com/post/read/559794/1/audit-tatakelola-ti-sim-perguruan-tinggi-menggunakan-best-practice-cobit.html. Accessed on
March, 2014.
79
EFFECT OF FINANCIAL CONDITION, GROWTH COMPANIES,
COMPANY SIZE OF GOING CONCERN AUDIT OPINION
Lidya Primta Surbakti
Faculty of Economics, University of Pembangunan Nasional "Veteran" Jakarta
Abstract
This study was conducted to test Effect Financial Condition, Growth Company, and
Company Size Audit Opinion Going Against Concern on manufacturing companies in
Indonesia Stock Exchange in the period 2011-2012. The population in this study contained a
manufacturing number of 131 company in Indonesia Stock Exchange in the period 2011-2012.
The Data obtained from published financial statements of the company. Obtained a total sample
of 67 companies. The analysis technique used is logistic regression and hypothesis testing using
simultaneous tests and partial test with a confidence level of 5% . The results showed that the
financial condition of a significant negatif effect on Going Concern Audit Opinion. Other
variables Company Growth and company Size has no effect on Going Concern Audit Opinion.
We suggest to investors in the Indonesia stock exchange to pay attention to other factors that
affect the going concern in making their investment decisions. Financial Condition variable in
this study is the variable most significance negatif effect on Going Concern Audit Opinion
addressed from pasrial test has significance as big as 0,001.
Keywords: Financial Condition, Growth, Company Size
Introduction
Going concern is the survival of a business entity. The survival of the entity is used as
assumptions in the financial reporting as far as not proven the existence of information that
shows just the opposite. Typically, the information is significantly contrary to the assumption
survival entity is associated with the entity's inability to meet its obligations at maturity without
selling most of the assets to outside parties through regular business, restructuring debt, repair
operation imposed from outside, and similar activities another IAPI (PSA number 30).
Going concern audit opinion is an audit opinion with an explanatory paragraph
regarding the auditor's judgment that there is an inability or significant uncertainty over the
viability of the company to run its operations in the future.
The number of cases of manipulation of financial data is done by the company in
Indonesia there are cases involve Kimia Farma company, Bank Lippo and Kereta Api
Indonesia Company. Case Kimia Farma Tbk. The case was the discovery of the following
things. In the framework of the restructuring of Kimia Farma company, Ludovicus Sensi
Wondabio HTM as partners of the firm given the task to audit the financial statements of Kimia
Farma Company for a period of five months ended May 31, 2002, find and report any errors in
the inventory valuation of goods and services and recording errors sales for the years ended
31st December 2001. Then followed the news in the daily Kontan stating that the ministry of
BUMN decided termination of the divestment of state-owned shares in Kimia Farma company
after seeing the indication inflate profits in the financial statements in the first semester of
2002.Based on the results of Bapepam obtained evidence as follows: There is a misstatement
in the financial statements of Kimia Farma company, while the impact of these errors resulted
in overstated earnings in net income for the year ended December 31, 2001 amounted to USD
32.7 billion, which is 2.3% of the sales, and 24.7% of the net profit of Kimia Farma company.
80
In addition, there are also errors in units of raw material industry, such errors overstated in:
industrial units of raw materials, such errors overstated the sales of 2.7 billion, unit Large
Pharmacy (PBF), the error in the form overstated the inventory of 8.1 billion Rupiah. Errors
such as overstated the sales of 10.7 billion Rupiah.
The presentation of mistakes made by the board of directors from 1998 until June 2002
by way of: create two different inventory price lists each issued on February 1, 2002 and
February 3, 2002, both of which are master price that has been authorized by the authorities,
namely Production Director of Kimia Farma company. Master price February 3, 2002 is a
master price as adjusted value (mark-up) and serve as the basis of determining the value of
inventory at the distribution Kimia Farma company December 31, 2001. Doing double
counting on the sale of the units and the PBF raw materials unit. Double counting is done on
units that are not sampled by the accountant.
Based on the description of the actions taken byKimia Farma company violates
Bapepam Regulation No. VIII.G.7 financial statement presentation guidelines. Based on the
investigation has been conducted, it is evident that the accountants who audit the financial
statements as of December 31, 2001 Kimia Farma company has conducted audit procedures
including sampling audit procedures that have been set in SPAP and did not find any element
of intent to help the management of Kimia Farma company to inflate profits. However, the
audit process does not detect the presence of a mark – up profit by Kimia Farma company.
http://www.bapepam.go.id/old/old/news/Des2002/PR_27_12_2002.PDF.
In the case that the auditor should express whether the client company will be able to
survive. Although the auditor is not responsible for the survival of a company but in auditing
survival auditor needs to be taken into consideration in giving opinions. Financial condition of
the company describes the level of actual corporate health. (Ramadhany, 2004). McKeown et.
al (1991) in Santosa and Wedari (2007) states that the condition of the company disturbed or
deteriorate the more likely the company received a going concern audit opinion. In contrast to
companies that have never experienced financial difficulties the auditor has not been issued a
going concern audit opinion.The growth of the company can be seen from how well the
company is maintaining its economic position in the industrial and overall economic activity.
(Setyarno et al, 2006). Companies that have high earnings growth are likely to have a
reasonable statement. So the potential to get a good opinion will be big. Santosa, Wedari (2007)
explains that the size of the company is variable to measure how large or small companies.
Despite its small size it is a very small chance to get going concern audit opinion.
Objectives
Associated with the importance of going concern opinion issued by the auditor, the
auditor shall be responsible for the company's going concern reveal actual conditions. There
are several factors that can be studied as factors that affect the going concern audit opinion,
namely: the financial condition of the company, Company Growth, Size Company. This study
aimed to examine the effect of financial conditions, the growth of the company, the size of the
company to the going-concern audit opinion.
Research Methodology
Population and Sampling Techniques
Population which is the object of this research is manufacturing companies listed in
Indonesia Stock Exchange (IDX) during the second period is from 2011 to 2012. Sampling was
done by using purposive
81
Sampling
The sample selection criteria are as follows: Companies listed on the Indonesia Stock
Exchange during the study period 2011 to 2012 and there were in the process of delisting and
/ or new listing in manufacturing .The present period financial statements in units of currency.
The Company uses financial statements for the period December 31.
Operational Definition of Variables
Concern is going audit opinion the auditor's opinion is responsible for evaluating
whether there is substantial doubt on the entity's ability to maintain its viability in reasonable
time period, not more than one year from the date of the financial statements being audited
IAPI (PSA 30: 341.1). Going Concern Audit Opinion measured using Variable Dummy.
Whereabout going-concern audit opinion was given a value of 1, while the non-going concern
audit opinion was given a value of 0. Financial condition of the company is the soundness of
the company, which can be seen from the financial statements, the financial statements of a
company is an interpretation of the financial condition of a company during a certain period,
so that the function of the financial statements so plays a very important in making a decision.
Financial Condition variables in this study are proxied by using the Altman model (ZScore) 1968.
Z = 1.2X1 + 1.4X2 + 3.3X3 + 0.6X4 + 1.0X5
Variable Growth Company uses the ratio of sales growth.
Sales Growth = (Net Sales t-Sales Net t-1) / (Net Sales t-1)
Firm size is variable to measure how large or small companies. This variable is
calculated by using the natural logarithm of total assets.
Techniques Analysis Data
The data required in this research is secondary data. Secondary data is data that is
derived from the audited financial statements of companies listed on the Indonesia Stock
Exchange (IDX) obtained by accessing websitewww.idx.co.id.
Mechanical Analysis and Testing Hypotheses
In conducting the analysis and hypothesis testing, the procedures performed aided by
using a computer program that IBM SPSS 21 (Statistical Product and Service Solution) and
Microsoft Excel 2007. The data was processed in this study, by using descriptive statistical
method (hypothesis testing).
Results / Conclusion
Table 1 Opinion Audit Going Concern Frequency
Frequency Percent Valid Percent Cumulative Percent
Audit Going
120
89,6
89,6
89,6
ConcernNon Opinion
Audit Going
14
10,4
10,4
100,0
ConcernOpinion
Total
134
100,0
100,0
Data analysis techniques used in this research is descriptive statistics and hypothesis
testing. Descriptive statistics present an overall picture of the samples collected on the variables
in the study. While the hypothesis test is done to decide whether to accept or reject the
hypothesis about the population parameters. From Table 1 shows that of the 134 existing data,
as many as 10.4% or 14 sample received an audit opinion going concern, while not receiving
going concern audit opinion as much as 89.6% or 120 sample.
82
Table 2 Financial Condition
Case Processing Summary
N
Marginal
Percentage
Bankrupt
26
19.4%
Financial Condition
Gray Area 29
21.6%
Health
79
59.0%
Valid
134
100.0%
Missing
0
Total
134
From Table 2 it can be seen that there are 134 samples from the amount of research
data with the level of Financial Condition which can be seen from the table that has a value of
Financial Condition 1 Condition Bankrupt Financial experiencing as much as 26 research data,
which has a value of 2 Financial Condition Gray Area experienced as 29 Data research and
value 3 has experienced a Healthy Financial Condition as many as 79 research data. This shows
that the company’s financial condition more healthy then it is likely the company is able to
continue the company’s survival.
Table 3 Descriptive Statistic
N
Minimum Maximum Mean
Growth
Size
Valid N (listwise)
134
134
134
-1,00
11,95
Std.
Deviation
11,64 ,2442 1,37214
30,50 24,0017 4,95793
Table 3 Indicates that the average value of the variable Company Growth was measured
by using a sales growth from last year to a year now. From the table shows that the growth of
the company has an average value of 0.2442 with a standard deviation value of 1.37214 This
shows the distance between the minimum value and a maximum value of 11.64 -1.00 too far,
large standard deviation indicates that the level of research data is quite low which means that
on average it cannot show the true value of the data. Their value -1.00 derived from KMI Wire
Company and Cable Company decreased net sales, it is very much different from the previous
year’s net sales value and the maximum value of 11.64 Lion Metal Works Company has
increased from the previous year 2011 to 2012 amount 414.285.432. These increases have sales
performance improvement management in improving the company’s operations in particular
in sales.Company size average value reached 24.0017 with a standard deviation value of
4.95793. Small standard deviation indicates that the data rate is high enough. This is evidenced
by a distance of 11.95 minimum values and a maximum value of 30.50. the existence of a
minimum value of 11.95 which is derived from Sepatu Bata Tbk Company in 2011 and the
maximum value is derived from Indomobil Sukses Internasioanal Tbk Company in 2012 had
total assets of Rp17.577.664.024.361. From the available data it can be seen that the average
firm size is almost the same sample of companies belonging to large companies.
83
Data Analysis and Hypothesis Testing
Test Multicoloniarity
Model
1
Table 4 Multicoloniarity
Collinearity Statistics
Tolerance
VIF
(Constant)
Financial condition
Growth
Size
,983
,998
,981
1,017
1,002
1,019
Multicolinearity test results above it can be seen that the value of VIF all independent
variables have a value less than 10, while for all the Tolerance value of the independent variable
value is greater than 0.10. Based on these results, it can be said that the value of the regression
is not the case study moltikoleneritas between independent variables.
Test the Overall Model (Overall Model Fit Test)
Table 5Hosmer and Lemeshow Test
Step
1
Chi-square
8,115
df
8
Sig.
,422
From Table 5 Chi-square value of 8.115 with 0.422 signifikan amount of value. From these
results it appears that greater than 0.05 (0.422 > 0.05) then it shows the model is able to predict
the value of observations or models can be said to be acceptable because it fits with the
observation data.
Testing the coefficient of determination
Step
1
Table 6 Model Summary
-2 Log likelihood
Cox & Snell R Square Nagelkerke R Square
a
72,412
,121
,248
Based on Table 6 shows that the magnitude of the coefficient of determination indicated
by the value Nogelkerke’s R square of 0.248. This shows that the independent variable in this
study is the financial condition, growth of the Company, the Company may explain the size of
the dependent variable (going concern audit opinion) by 24.8%, the remaining 75.2% is
explained by other variables not examined in the study.
Testing Simultaneously (Omnibus test of the model coefficient)
Step1
Table 7 Omnibus Tests of Model Coefficients
Chi-square
df
Step
17,317
3
Block
17,317
3
Model
17,317
3
Sig.
,001
,001
,001
84
Based 7 table above shows the results that are Simultaneous Financial Condition,
Growth Company, Company Size Matter to Going Concern Audit Opinion. It is seen from the
results of the chi-square of 17,317 for significant level of 5% or 0.05 with 3 degrees of freedom
obtained by chi-square = 7.814 0:05 tables. Then the results of chi-square obtained by 17.317>
7.814 chi-square table. This shows that the test results simultaneously variables Financial
Condition, Company Growth, Size effect on the Company's Audit Opinion Going Concern.
Partial testing
Table 8 Variables in the Equation
B
S.E. Wald Df Sig. Exp(B)
Step 1a
Financial
condition
Growth
Size
Constant
1,315 ,384 11,735
1
,001
,268
-,219 ,364 ,363
,084 ,079 1,122
2,173 ,491
1,523
1
1
,547 ,803
,289 1,087
1
,483
,218
From the table above shows that 8 Financial Condition significant because the
significant value of 0.001 <0.05, then it can be concluded that the financial condition of a
significant effect on Going Concern Audit Opinion.Company growth is not significant due to
the significant value of 0.547 > 0.05 then it can be concluded that the growth of the Company
has no significant effect on Going Concern Audit Opinion. Company size is not significant due
to the significant value of 0.289 > 0.05 then it can be concluded that company size no
significant effect on Going Concern Audit Opinion.
Logistic Regression Models
Regression models were created and presented as follows:
LnGC / (1-GC) = - 1,523-1,315KK-0,219PP + 0,084UP
From the above equation it can be seen that the constants of-1.523 states that if the independent
variables namely Financial Condition, Growth Company, and Company Size value is 0 then it
is likely the company will get a Going Concern Audit Opinion of Financial 1,523.Kondisi has
a regression coefficient of -1.315 Financial Condition experience decline it will raise the value
of going Concern Audit Opinion of 1,315. Company growth has a regression coefficient of 0.219 stated that the Company has decreased the growth will increase the value of Going
Concern Audit Opinion 0.219 Firm size has a regression coefficient of 0.084 states that the size
of the company has increased it will lower the value of Going Concern Audit Opinion of 0.084
Conclusion
This study examines the influence of Financial Condition, Growth Company, Company
Size Audit Opinion Going Against Concernpada companies listed in Indonesia Stock Exchange
(IDX) during 2011 to 2012 analysis was performed using SPSS Statistics program IMB
20.Berdasarkan if the test results can be concluded as follows: Financial Condition significant
negative effect on the Company's audit Opinion Going Concern.Pertumbuhan no significant
negative effect on the Company's audit Opinion Going Concern.Ukuran no significant positive
effect on the going concern audit opinion. Based Negelkerke's R square of 0.248. This shows
that the independent variable in this study is the financial condition, growth of the Company,
85
the Company may explain the size of the dependent variable (going concern audit opinion) by
24.8%, the remaining 75.2% is explained by other variables not examined in the study.
Discussion
Financial conditions in proksikan with almant z-score. Hypothesis testing for the
financial condition variable results showed significant negative effect on Going Concern Audit
Opinion. Financial condition of the company describes the level of health in reality.This proves
condition of financial ratios that can provide an indication that the financial condition of the
company in good health or in a bad state. Healthy perusaahaan have propitabilitas large and
tend to have a reasonable financial statements so that the potential to get a good audit opinion
greater. Companies that have a good financial condition, the auditor will not issue a going
concern audit opinion.Growth companies that proxy on sales. Testing growth hypothesis for
company growth variables showed no significant effect of negative results on Going Concern
Audit Opinion. Companies that have reported earnings tend to have a reasonable, so the
potential to get a good opinion (non-going concern audit opinion) will be greater, the higher
the company's growth will be smaller probability of receiving going concern audit opinion.The
results of the study provide evidence that firm size does not affect the going concern audit
opinion on these results supported the research object of most of the companies belonging to
large-sized companies with total assets of unequal magnitude, i.e. there is a very large and there
are average-sized. So in this case proved although the company is small does not guarantee that
the company gets going concern audit opinion.
Recommendations
Suggestions are based on the limitations and the results of research for future research
include: Future studies may add other variables that affect the going concern audit opinion that
the amount of debt levels, the level of liquidity of a company. Future research may add a sample
of all companies listed in stock exchanged with a longer observation period.
References
Agoes, S. (2012). Auditing. Jakarta: Salemba Empat.
Alman, H. (2000). Corporate Financial Distress and Bankruptcy.
Constantinides, S. (2007). An examination of the potential impact of risk on viability
assessments for financially distressed firms: the case of professional user groups of
company accounts.Asian Academy of Management Journal, Vol. 12, No. 1, 35-50.
Elder, et al (2011). Audit and assurance services. Jakarta: Salemba Empat.
Ghozali, I. (2011). Applications multivariate analysis with SPSS 19. IMB program
Semarang: Publisher Agency Diponegoro University.
Griffin, R.W. & Ebert, R. J. (2007). Business (8thedition). Jakarta: Erlangga.
Harahap, S. S. (2011). Analysis of crisis financial statements. Jakarta: PT. Raja Grafindo
Persada.
Harahap, S. S. (2012). Accounting Theory. Jakarta: Rajawali Press.
Haron, H. (2009). Factors influencing auditors going concern opinion. Asian Academy of
Management Journal, Vol. 14, No. 1, 1-19.
Indonesian Institute of Public Accountancy. (2011). Accepted accounting standards. Jakarta:
Salemba Empat.
Januarti, I. & Fitrianasari, E. (2008). Ratio analysis financial and non financial ratios
affecting auditors in providing going concern audit opinion on the auditee. Maksi
Journal Vol 8 No.1.
86
Kartika, A. (2012). Effect of financial condition and non financial against acceptance going
concern opinion on manufacturing company in IDX. Vol 1. No. 1. Dynamics, Finance
and banking.
Kasmir. (2011). Financial Statement Analysis. Jakarta: Rajawali Press.
Law of the Republic of Indonesia No. 20 of 2008 on Micro, Small, and Medium
2012.Jakarta.
Purba, M. (2006). Going concern assumption: implications accounting & auditing judging
from prinsif accounting and law No. 37 Year 2011. Jakarta: PT. Natha Gemilang.
Rahayu, S. (2009). Factors affecting acceptance of going concern audit opinion in public
manufacturing company. Accounting Studies Volume.4 No2.
Santosa, A. D.&Wedari, L. K. (2007). Analysis of factors affecting revenue trends going
concern audit opinion. JAAI Volume 11 No. 2. Semarang.
Setyarno, E. B. (2006). Effect of audit quality, the company's financial condition, the
previous year's audit opinion, the growth of the company on the Going-concern.
National Simposisum Accounting IX. Palembang.
Sitanggang, J.P. (2012). Financial management company. Jakarta: Mitra Wacana Media.
Sudarano, A. N. M. (2012). Influence analysis of financial ratios and non financial factors
against acceptance going concern audit opinion. Journal of Accounting Volume1,
nomor2, Pages 1-13. Semarang.
87
THE POTENTIAL OF TOURISM LOGISTICS SERVICE BUSINESS
IN THE BORDER AREA OF CHONG ANMA CHECKPOINT,
CHONG SA-NGAM CHECKPOINT AND CHONG JOM CHECKPOINT
FOR PREPARING AND INCREASING THE COMPETITIVE EFFICIENCY
AMONG THE ASEAN
Pariwat Somnuek 1, Suwaphat Srigongsaeng 2, Trakarn Thanompan 3 and Surasak Witoon 4
1, 2, 3, 4
Faculty of Liberal Arts, Ubon Ratchathani University
Abstract
This study focused on the appropriate guidelines of tourism logistics service business
in the border area of Thailand for preparing and increasing the competitive efficiency among
the ASEAN and aimed to find a comparative business potential between the opinions of tourists
and villagers towards tourism logistic services in the Thailand borders of Chong Anma, Chong
Sa-Ngam, and Chong Jom. Survey questionnaires, Situation Analysis, TOWS Matrix and focus
group discussion were applied for data collection. Furthermore, descriptive analysis and
statistics such as arithmetic mean and standard deviation were employed of data analysis. The
study findings were revealed as follows: It was noticed that the potential was presented in the
medium level. Comparatively, the business efficiency, in the customers’ opinions, found in
Chong Anma and Chong Sa-Ngam was more than the villagers’ rating while the villagers rated
more potential on Chong Jom than the customers. The entrepreneurs of the three borders were
satisfied with their turnovers. Recommendations for the potential development in the three
border areas included (1) a development promotion on the border tourism destinations and
foreigners’ investment on accommodations, restaurants, and transportations, (2) an
establishment of business networks between Thailand and Cambodia for preparing for the AEC
era, and (3) an enhancement of new tourism destinations in Thailand borders and Cambodia
along with a cooperation of entrepreneurs in the both countries. The development would lead
to increased visitors, a coalition of security offices in the two countries, and a good image on
tourism security in the areas.
Keywords: Business potential on tourism logistic services / Preparation of AEC and
enhancement of competitive advantages among ASEAN countries /
Appropriate potential development
Introduction
Logistic service business was quite significant to the development of Thailand
economic and ASEAN countries, especially for ASEAN Economic Community (AEC) era.
The business was also interesting as it focused on groups of worldwide middle class people, as
a main target. Asia Pacific region was served as the biggest business volume with its continued
business volume growth, considering the market value of 23% in 2009 and 54% in 2020. The
market value was likely to 66% and 59% of all market expenses in 2030. In Thailand,
specifically in northeastern region, the tourism logistic services were unceasingly enhanced,
particularly for land transportations from the central area to the northeastern area. The
transportation route was connected between Thailand and Cambodia border crossing points,
Chong Jom Checkpoint in Kab Choeng district in the province of Surin in Thailand and
Osmach Checkpoint in Somrong district in Udon Meechai province of Cambodia. The route
was important for tourism industry and product transportations to neighboring countries.
88
According to Office of Commercial Affairs of Surin (2012), Thailand-Cambodia border trade
in 2011 valued 638 millions THB, consisting of 604 of exportation and 34 of importation, with
a total of 563 millions of its trade balance. It was expected to be over 700 millions of the
balance of trade in 2011, by exporting gasoline, beer, whisky, fruit juice, cement, energy drink,
carbonated beverage, vegetable oil, and tile. Meanwhile, some imported products were potato,
used bicycle, used textile, clothes, varieties of plants, and others.
Although a high worth of its border trade was demonstrated, problems concerning some
facility limitations in the tourism logistics services were determined. For the financial flow, it
was indicated that money exchange services were inconvenient and there was not enough
financial service centers available for tourists. In relations to the information flow, information
of border crossing along with tourism attractions and products were inappropriate provided.
Regarding the physical flow, tourism service availability, accessibility, time, customer care,
comfort, safety, environmental friendliness, tourist attraction, walking street, and tourism
happiness had to be focused on. Therefore, the study of tourism logistics in the border region
was valuable to compare the potential of the border trade in attitudes of customers and villagers,
analyze service conditions, and find guidelines of business potential development, leading to
the preparation for AEC era and enhancement of the business competitive advantages among
ASEAN countries. In this study, the tourism logistics concept of Lumsdon and Page (2004),
framing eight perspectives of tourist transportation appeared in the book of Tourism and
Transport, was applied. The objectives of the study were (1) a comparative analysis of the
logistics services in Chong Anma, Chong Sa-ngam, and Chong Jom checkpoints in views of
tourists and villagers, (2) an analysis of service conditions among entrepreneurs around the
three border checkpoints, and (3) recommendations for appropriate business potential
enhancement.
Research Methodology
1. Population and sampling
The sample representatives in this study were villagers chosen from the selected
community sectors, Thai tourists, and entrepreneur representatives of tourism logistics
services.
1.1 Sampling of villagers and Thai tourists
The samples related to the logistic services in the lower northeastern region and
Cambodia was employed by Stratified Random Sampling, consisting of the following
perspectives:
A. Community sectors included the villagers who ever used the services in the three
borders and lived in (1) Dan subdistrict in Kab Choeng, Surin, (2) Prai Patana subdistrict in
Phu Sing, Sisaket, and (3) Song subdistrict in Nam Yuen, Ubon Ratchathani. A total of 600
villagers, 200 a subdistrict, were elected and Taro Yamane (Yamane, 1967) was used for its
sample size calculation.
B. Thai tourist samples were clients who ever used the services in the three border
areas such as accommodations, restaurants, and transportation services. A total of 600 tourists,
200 a border, were chosen and Taro Yamane (Yamane, 1967) was applied for the sample size
calculation.
89
1.2 Sampling of entrepreneur of tourism logistic services
The samples were selected by Non-probability Sampling with Purposive Sampling,
divided into three groups: buses and rental cars, restaurants, and accommodations. A total
sample size was 15 derived from three samples a group.
2. Research Instruments
Survey questionnaires related to an examination of logistic business potential levels
provided for customers were employed, while Semi-structured Interview was used for the three
groups of entrepreneurs were used for data collection. The questionnaires with five Likert
rating scales consisted of Financial Flow, Information Flow, and Physical Flow. Also, contexts
of tourism logistic services were stated such as Availability, Accessibility, Information, Time,
Customer Care, Comfort, Safety, Environmental Friendliness, Tourist Attraction, Street Walk,
Business Location, and Tourism Happiness. The average potential scores, low to high ordering
scores, would be used for data analysis. Additionally, SWOT Analysis, TOWS Matrix drawn
from Focus Group among several government sectors, such as provincial office of commercial
affairs, immigration bureau, provincial office of tourism and sports, and some private sectors,
such as the provincial chamber of commerce, the federation of industry, and the provincial
tourism association. In this study, Validity and Reliability of the questionnaires were tested as
follows:
1. Content Validity and Wording of such questionnaires were examined by specialists
before data collection.
2. The examined questionnaires were then applied for a pre-test examination in order
to test its difficulty and investigate whether questions were consistent with the assigned
objectives. Statistical Package of Social Sciences (SPSS for Windows), Cronbach’s Alpha, and
Alpha Coefficient were employed for its reliability as Nunnally (1978) stated that if Alpha
Coefficient appeared to be greater than or equal to 0.7, such questionnaires, involving
exploratory research studies, would be greatly trustworthy.
3. Data Analysis
For questionnaires, statistics comprising of Frequency, Percentage, Average, and
Standard Deviation (SD) were used for a comparative analysis of the business potential among
the entrepreneurs and the collected interview data was analyzed by Descriptive Analysis. Later,
Focus Group was established for SWOT Analysis and TOWS Matrix to come up with
guidelines of appropriate business potential development.
Conclusionand Discussion
1. Entrepreneur preparation of AEC
The findings indicated that the entrepreneurs were well-prepared for the regional
economic integration by 2015, corresponding to Choksuchart (2010) who stated that the trader
adaptation could erase or at least alleviate negative outcomes in upcoming prospects.
Cooperation among ASEAN countries such as trade diversion, production, and ventures in
agricultures, industries, services, free transfers of skillful labors, and management of tariff
barriers. The entrepreneurs, especially small and medium enterprises (SMEs), had to learn and
ASEAN marketing conditions and develops tourism products meeting substantially customer
needs, together with a deep study of new business competitors, resulting in competitive
advantages. Significantly, language communication skills of ASEAN countries, especially
Khmer, were needed for the three business performances. Another urgent factor was an
advancement of integrated transportation standards, beneficial for all stake holders. It was
90
found that the findings were in line with Department of Industrial Promotion (2007), indicating
that a good entrepreneur could adapt their characteristics consistent with environmental
contexts and held a self-confidence in a business competitiveness. The findings were also
corresponding to Howkins (2001), like a Say’s Original Model Entrepreneur, stating that a
well-prepared entrepreneur gave an importance on maximum profits and benefits derived from
gained resources, used for productions and services to meet a wide variety of customers’ needs,
while a creative entrepreneur would apply a creative thinking, as a valuable asset, to establish
their business sustainability.
2. Business potential development among entrepreneurs of ASEAN countries,
especially Cambodian entrepreneurs
The business potential development among the entrepreneurs was consistent with The
Eleventh National Economic and Social Development Plan, demonstrating that personnel
enhancement in terms of transportation and logistics services, international communications,
and dexterous logistics management could encourage them to connect a total supply chain of
both domestic and international logistics. Thai SMEs entrepreneurs had to be trained about
business development and application of infrastructure combining to business regions and
export routes, culminating in international business potential among entrepreneurs. As
previously mentioned, stake holders, both government and private sectors, had to develop the
business treats, exceptionally transportation, public utility, security, tourist service, and
intercultural communications including ASEAN languages. The findings were consistent with
Rothwell (2005) stating that human resources management was relevant to all stakeholders in
an organization aiming to maintain its business competitive opportunities. The findings were
also in line with Choksuchat (2010) indicating that Thai entrepreneurs, as a key role for
Thailand economic development, had to adapt themselves and held up-to-date information for
a business sustainability. Moreover, the results were corresponding to Department of Industrial
Promotion (2007) that the entrepreneurs had to apply Blue Ocean Approaches to create
Alliance Business for Win-win Situation. At the same time, business cooperation as a tourism
logistics association, product quality improvement, product cost reduction, and customer
relationship management had to be focused on.
Recommendations
The management of Financial Flow, Information Flow, Physical Flow should be
applied for strategic development determination. The findings were beneficial for Department
of Business Development, Ministry of Commerce in order to establish value added and pricing
for tourism products. The results were also advantageous for travel agents to develop tourism
products and destinations such as cultural, natural, and historical destinations located in the
areas. The findings might be profitable for international and Thai tourists in monitoring tourism
activities and policies of both government offices and private sectors. For further studies,
impacts of tourism management among ASEAN Countries towards ways of villagers’ life
should be conducted. Importantly, participatory action research among government offices,
private sectors, tourism education institutes, and villagers should be emphasized by a
combination the findings in evaluating, monitoring, and checking of tourism activities.
91
References
Choksuchart, T. (2010). Potential of ASEAN Countries and Adaptation of Thai
Entrepreneurs(Master’s Thesis). Bangkok, Huachiew Chalermprakiet University.
Department of Industry Promotion, 2007. Being a Good Entrepreneur. Retrieved from
http://www.dip.go.th.
Howkins, J. (2001). The Creative Economy: How People Make Money from Ideas. Penguin.
Lumsdon, L.& Page, S. (2004). Tourism and Transport: Issues and Agenda for the New
Millennium. London: Elsevier.
Nunually. J. (1978). Psychometric Theory. 2nd edition. New York, McGraw-Hill.
Office of Commercial Affairs Surin. 2012. Border Trade Statistics and Neighboring
Countries of Surin. Surin, Office of Commercial Affairs Surin.
Patarachok, N. (2012). Mitrphol Group and SCG Logistics Management Company Limited
Mutually Pushed Forward Logistics Enhancement in China.Retrieved from
http://www.matichon.co.th/news.
Rothwell, W, J. (2005). Effective Succession Planning.AMACOM Div American Mgmt.
Sudcharee, T. (2006). Business Research: Research Practices beyond Textbooks (Master’s
Thesis). Faculty of Business Administration and Management, Ubon Rajabhat
University.
Yamane, T. (1967). Elementary Sampling Theory. USA, Prentice Hall.
92
OPERATIONAL RISK MANAGEMENT AND
SUPPLY CHAIN RISK MANAGEMENT (SCRM)
LOGISTICS MANAGEMENT STUDENTS' PERCEPTIONS
Hermann Gruenwald
Burapha University International College (BUUIC) Bangsaen
Abstract
Operational Risk Management (ORM) is a subset of Enterprise Risk Management
(ERM) which applies to any enterprise private or government, for profit or nonprofit, small or
large. Operational risk management (ORM) plays a special role in the banking and financial
industry where operational risk is defined by Basel II to include the risk of loss resulting from
inadequate or failed internal process and systems, human factors or external events, this type
of risk does not include market risk. In logistics the term ORM is defined as a continual cyclic
process which includes risk assessment, risk decision making and implementation of risk
controls which result in acceptance, mitigation or avoidance of risk. In the logistics industry
we usually focus on Supply Chain Risk Management (SCRM). SCRM deals with everyday
risks and unusual risks that affect the supply chain. In any industry risks cannot always be
avoided, frequently risks are out of our control as in the case of natural disasters. Natural
disasters include events such as heavy rains which lead to floods, wind storms, snow storms,
ice, mud slides, earthquakes, tsunami, volcano eruptions many of these events result in fires.
Man-made disasters on the other side range from accidents of all kind, car, truck, train, airplane
crashes, nuclear incidents, piracy, hijackings, terrorist acts, geopolitical events, unrests, riots,
civil war and war with various weapons of mass destruction to white color, financial crimes,
commodity manipulations, to spread of disease and epidemics. Where possible risks can be
avoided or mitigated. The impact of risks on the supply chain can be reduced in terms of degree
and velocity. This paper looks at the general aptitude of logistics management students in terms
of risk and danger. How much risks do logistics management students accept and expose
themselves to in their private lives and in the work place? Are logistics professionals/students
by nature risk takers? Are they willing to accept higher risks in their personal and professional
lives? How do they deal with daily risks such as accidents? How well do they feel prepared to
deal with supply chain operational accidents, catastrophes and strategic uncertainties? What
are the lessons learned and industry best practices when it comes to supply chain risk
management (SCRM) and operational risk management (ORM)? This quantitative study used
an on-line research instrument designed by the principal investigator (PI) to look at logistics
management students and their aptitude towards risk from a personal and professional
perspective.
Keywords: Basel II, Disaster Preparedness, Logistics Management (LM), Business
Continuity Planning (BCP), Enterprise Risk Management (ERM), Operational
Risk Management (ORM), Supply Chain Risk Management (SCRM)
Introduction
The logistics profession is one that has great risk both in terms of the supply chain and
for the people who are involved in it on a professional level. But how are these risks perceived
by the logistics professionals themselves. Are logistics professionals different from other
professionals in term of risk acceptance? What type of students like to study logistics? Are
93
logistics professionals embracing risk and danger? Supply Chain risk management deals with
the everyday and unusual risk in the logistics business. The goal is to keep the global supply
chain as uninterrupted as possible, or to mitigate the risks of the interruptions which are often
out of the control of the logistics professionals. The global supply chain is exposed to more
possible interruptions as the supply chain gets more involved and interwoven and with the
length and complexity of the supply chain the exposure is increased. The interconnectivity of
the global supply chain makes the supply chain itself more vulnerable to interruptions and more
fragile. But there are ways to deal with risk. One way of dealing with risks are to avoid them.
This is easier said than done, because one first has to take a look at the various types of supply
chain risks, which include both man-made and natural risks (Johnson, 2001). Natural risks
include natural disasters, such as heavy rains, floods, earthquakes, winds, hurricanes, tornados,
winter storms, ice and snow, volcano eruptions and tsunamis. The natural disaster may trigger
other events such as fires and flooding. At the same time rain may lead to aqua planning, which
again may lead to traffic accident. So natural disasters can lead or contribute to man-made
disasters. Man-made disasters, include traffic accidents of all kinds, from car and train to plane
crashes and sinking of ships, to protests, riots, civil unrest, war which again may cause fires
and destruction as well as loss of live, down to piracy, hijacking kidnapping of key executives
and terrorist acts of all kinds which may including bombings which in terms may lead to the
destruction of warehouse content or shipments (Brindley, 2004). These acts can interrupt
supply chains, or make transportation more costly as transport through areas of political crisis
as in the case of the Middle East, which in terms can lead to blockades which may reduce the
flow of natural resources such as oil, which in term leads to shortage of a commodity and the
increase of price. Prices can also be indirectly influenced through the manipulation of
commodities and monetary currencies. The fluctuation in the exchange rate is a business risk,
which can lead to great losses depending in what currency the contract was based upon. Based
on the types of interruption there are different ways to deal with risk, in the case of exchange
rates there may be financial hedging strategies applied to supply chain risk management. Other
risks may easily be avoided, such as flooding the name of the game in flooding is simply higher
elevations, when you build in a country like Holland where much of the land is below sea level
no one had to be surprised with flooding. The same holds true for flooding through tsunami,
there is no ocean front property in Arizona, so tsunami is not a risk that has to be dealt with,
but building in high elevations of Colorado one has to deal with avalanches of snow. Mudslides
on the other side are a common occurrence in California but despite all the disasters which hit
California in the past like wild fires and smog people still build there and want to live there on
property which slowly falls into the ocean. Some risks can be mitigated or limited, more
advanced construction methods such as fireproofing and sprinkler systems make the effects of
possible fires less drastic. Other risks can be simply avoided by changes in risky behavior.
Risky behavior can be the cause of disaster in the case of truck drivers who drive under the
influence (DUI) of alcohol or drugs. Drug testing may discourage drivers from engaging in this
risky behavior. Another way of limiting exposure are back-up plans, if one supplier cannot
deliver out of own fault or due to natural disasters a second source at a different location may
still be able to deliver the same or equal goods. If oil from the Middle East can not be delivered
due to boycotts, oil from the North Sea may still be available, or alternative energy sources
such as wind and solar energy may be used where possible. Logistics professionals are not
facing disasters and risks helpless, they are trained to use various structured risk and business
continuity management processes and follow general frame works of risk management which
starts with sharing, transferring reducing and avoiding risks. Risks have to be identified,
assessed and analyzed. In the past too often individuals and companies did not want to face the
94
risk and lived in denial, and even when an event happened wanted to cover it up like the case
of the Union Carbide chemical factory accident in Bhopal India on December 3, 1984 where
more than 2,000 people died immediately and an estimated 8,000 died within two weeks of the
event and approximately 16,000 more have died from disease related to the incident which was
said to be caused by sabotage. The real problem which makes the disaster still a text book case
thirty years later was how the event was handled (Deloach, 2000). In recent days we recall the
Malaysian Airline flight MH370 which disappeared with an ever changing story line, where
today’s typical first answer is terrorism. Over weeks the story changed from where the pilots
were either terrorist or heroes in the entire plot. The loss of passenger planes has a direct impact
on the supply chain as most airlines operate a mixed fleet of cargo and passenger service. The
search for the aircraft actually focused on wooden pallets which were in the cargo hole and
hoped to be found floating in the ocean. This is a good example of today’s complex supply
chain risk management network and interwoven relations. The disaster itself was not the
disaster but the way it was handled became a disaster. Norrman and Lindroth back in 2004
developed a framework that can be applied to supply chain risk management (SCRM), it looks
at the types of risks, from operational accidents, to operational catastrophes or disasters (manmade or natural), and strategic uncertainties. On the business continuity management side it
reaches from risk identification and analysis to risk assessment and risk management. The unit
of analysis in supply chain risk management (SCRM) can be a single logistics activity,
company logistics or the entire supply chain or the global supply chain network as a whole.
Reaching from a micro view to a macro view of supply chain risk management; and from an
inside to an outside look at parts or the entire global supply chain. The risk matrix depicted
below looks at the likelihood of an event and its consequences, this universal model applies to
any type of risk in any context from personal to professional from ORM to SCRM.
Figure 1. Risk Matrix - Likelyhood and Consequences
95
Figure 2. COSO Enterprise Risk Management- Integrated Framework. 2004.
COSO (Committee of Sponsoring Organizations of the Treadway Commission)
Research Methodology
Survey Instrument
The researcher developed his own survey instrument using a five point likert scale to
measure the responses which were gathered using an on-line survey. The Burapha University
Moodle based e-learning system was used to administrate the survey to logistics management
students. The survey instrument was created in English language. The survey instrument used
self-reported data regarding the perception of the individual logistics students along the
spectrum associated with risk and risk aversion and general attitude towards danger and
certainty, uncertainty, safety and security, in one’s personal life and the same in the context of
the young logistics profession.
Sample Preparation
The convenience sample was selected from Burapha University, Bangsaen, Chonburi,
Thailand students, namely students who studied at the Burapha University International
College and declared logistics management as their major. Of the 47 Thai participants 30 (64%)
were female, while 16 (36%) were male. The students ranged in age from 19 to 24 while the
majority of the students were between 20 and 21 years old, with the oldest being 24 years of
age. This was a convenience sample which is representative of junior undergraduate logistics
management students in English language programs in Thailand. The sample may not represent
typical Thai students in Thai logistics programs, as these students come from a different socio
economic class. The ratio of male/female students is typical for Thai universities in general and
logistics management programs specifically.
96
Table 1. Participants' Age Distribution
Participants
Age
19
20
21
22
23
24
Table 2. Participants' Gender Distribution
Male
Male
16/47
36%
R. Counts
2/47
18/47
24/47
1/47
1/47
1/47
R.%
(4%)
(38%)
(51%)
(2%)
(2%)
(2%)
Female
30/47
Female (%)
(64%)
Results
The results of this study can be divided into the following categories which relate to the
aptitude of Thai logistics students towards danger and risk and the management of risk in their
personal lives as well in their professional lives. It places the participants in context with supply
chain risk management (SCRM) and operational risk management (ORM) as they relate to the
logistics industry in general.
Danger
The large majority of participants try to avoid danger and one third are neutral in terms
of danger only six percent of the students like to live dangerously. Despite their tendency not
to seek danger the participants choose to study logistics management. So there appears to be
no relationship between being afraid of danger and studying logistics. The fear of danger does
not stop the students from studying logistics. This may be true as the students in their early
stage of study are not familiar with the dangers associated with logistics, and have a false
picture of what logistics is all about. It is also a question of fit in relation of the students and
their major and on what factors the decision to study logistics is based upon, often students like
to study a subject but do not like in to work in the subject area.
Table 3. Danger
Danger
R.
Counts
very afraid - hate danger
afraid - avoid danger
Neutral
not afraid - danger is ok
love danger and live dangerously
8/47
20/47
15/47
2/47
1/47
%
Disc.
R.% Correct SD
Index
Facility
(17%)
2
0 -0.033
(43%)
(32%)
(4%)
(2%)
Disc.
Coeff.
-0.028
Risk
Less than two third of the participants (57%) try to avoid risk in their personal lives,
and roughly one third is neutral in terms of risk and 10% feel risk is ok and accept risk in their
lives. The feeling about taking on risks did not stop the participants from joining the logistics
profession in the future and being engaged in the logistics industry. The question again is the
understanding of the participants of the logistics profession and the appropriate fit of students
for the logistics program or the logistics profession in the long term. It also would be interesting
97
to determine how the appetite for risk changes with working in the profession, and risk
acceptance with age. Maybe with experience people accept more risks in their profession.
Table 4. Risk
Risk
hate risk
avoid risk
neutral
risk is ok
love risk
R.
Counts
R.%
9/47
18/47
15/47
5/47
0/47
(19%)
(38%)
(32%)
(11%)
(0%)
%
Correct
Facility
0
SD
Disc.
Index
Disc.
Coeff.
0
0
-999
Logistics Profession & Risk
When asked about their perception of the logistics profession as a whole, two third of
the students found that logistics is a riskier or much riskier profession than other professions,
apparently the students are aware of the dangers involved in the logistics business both from a
personal stand point as well as from an industry standpoints. Logistics professionals put
themselves into harm’s way, 64% saw that logistics is a risky profession in many aspects.
Roughly one third (30%) considered logistics as neutral in terms of risks and potential harm
and only six percent saw no risk or no risk at all in the logistics profession. These responses
measure the perception of the students at the time and may be more based on theoretical than
practical knowledge and were measured prior to a supply chain risk management course.
Table 5. Risk and the Logistics Profession
Logistics Profession
& Risk
much riskier
Riskier
Neutral
no risk
Not at all risky
R.
Counts
17/47
13/47
14/47
2/47
1/47
%
R.% Correct SD
Facility
(36%)
30
0
(28%)
(30%)
(4%)
(2%)
Disc.
Index
Disc.
Coeff.
-0.033
0.417
Natural Risks
In Thailand Floods are seen as the greatest natural risks. This may be due to the recent
experiences with floods in the recent past and explanation why floods are still fresh on the mind
and an ever present danger. But earthquakes are seen as greater risks than tsunamis, even so
the tsunami experiences may be closer to the local respondents. Ice and snows were seen as
zero risk as they don’t occur in their native surroundings, so it is clear that the respondents
reached back on their personal experience and what is relevant to them, in their geographic and
cultural context, and think rather locally than globally for the supply chain as a whole. Some
of these risks may not fit in their existing framework (Lindroth & Norrman, 2004), ice and
snow is something Thai respondents can not relate as they never experienced them personally
in Thailand. But shipments from or to Thailand may be held up in the global supply chain due
to ice and snow in Europe or the USA, despite the severe winter storms and their media
coverage there is little recollection by the participants.
98
Table 6. Natural Risks
Natural Risks
Flood
Earthquake
Tsunami
Volcano Eruption
Hurricane
Storms
Tornado
Ice
Snow
R.
Counts
R.%
14/47
10/47
9/47
5/47
3/47
2/47
2/47
0/47
0/47
(30%)
(21%)
(19%)
(11%)
(6%)
(4%)
(4%)
(0%)
(0%)
%
Correct
Facility
30
SD
Disc.
Index
Disc.
Coeff.
0
-0.167
0.171
Man-Made Risks
By far war (36%) is seen as the biggest man-made risk. Maybe it is because the fear of
armed conflicts among the respondents is bigger than the fear of a traffic accident. While traffic
accidents are on second place with 15% of the respondents followed by terrorism with 13%
and weapons of mass destruction with (9%). It is interesting that terrorism and traffic accidents
are seen almost at the same level. While work related accidents, fire and theft are rated even
lower than nuclear accidents and piracy. Maybe there was no clear understanding of what was
meant by geopolitical events, decease and epidemics therefore no responses to those types of
man-made risks.
Table 7. Man-Made Risks
Man-Made Risks
War
Traffic Accidents
Terrorism
Weapons of Mass
Destruction
Nuclear Accident
Piracy
Civil unrest
Fire
Work related accidents
Theft
Geopolitical Events
Decease/Epidemics
R.
Counts
R.%
17/47
7/47
6/47
4/47
(36%)
(15%)
(13%)
(9%)
3/47
3/47
2/47
2/47
2/47
1/47
0/47
0/47
(6%)
(6%)
(4%)
(4%)
(4%)
(2%)
(0%)
(0%)
%
Correct
Facility
4
S
D
Disc.
Index
Disc.
Coeff.
0
-0.067
-0.04
Operational Risks
Natural disasters are seen in short distance as operational risks more than man-made
disasters, while financial and currency exchange risks are seen as less obvious supply chain
risks by the participants, this may due to the lack of personal exposure in these areas and
inexperience. Financial and currency risk rank almost the same and appear to be seen as almost
99
identical in the mind of the respondents. Maybe the less transparent nature of these types of
risks have them categorized lower, than some of the more obvious risks especially as faced in
major man-made or natural disasters, with greater awareness in the public mind due to more
intensive media coverage and more vivant images than those associated with white color crimes
and risks.
Table 8. Operational Risks
Operational Risks
Human
Procedural
Systems
External
R.
Counts
16/47
13/47
9/47
8/47
%
R.% Correct SD
Facility
(34%)
17
0
(28%)
(19%)
(17%)
Disc.
Index
Disc.
Coif.
-0.033
0.333
Conclusion
This study looked at operational risk management (ORM) and supply chain risk
management (SCRM) and the perception of danger and risk of logistics management students
in their personal and professional lives. In conclusion future logistics professionals may be
afraid of danger and avoid risks in their personal lives but they are aware that logistics is a
profession with greater exposure to risks than some other professions. But operational risk
management (ORM) and supply chain risk management (SCRM) procedures allow them to
deal with and mitigate risks in the supply chain which they may face on a daily basis as well
as in extraordinary times. In general the global supply chain is getting more interconnected and
more risky while the global diversity and potential for multiple sourcing offers a way to
mitigate certain types of risks. Enterprise risk management (ERM) and business continuity
planning certainly offers ways for logistics professionals to deal with the risks of the logistics
industry, and prepare them to face the challenges operational and other risks by applying the
principals of key risk indicators (KRI), loss data management (LDM) and risk control self
assessment (RCSA).
100
Figure 3. Operational Risk Management Framework and Cycle
Discussion
The finding of this study clearly show that there is close relationship between the
acceptance and risk and danger in one’s personal live. And the participants also realize that the
logistics industry is a risky business and has greater risks than some other industries and trades.
Natural risk rank higher than man-made risks. The focus on man-made risk related to conflict
is of interest, while transportation is seen as one of the greatest contributing factors to the risks
in the logistics business. The financial and hidden risks as the word indicates were less obvious
to the respondents. The consequences for the supply chain were on the operational level and
less on the strategic level. With the continuous globalization of the business environment the
complexity and velocity of business increases (Cachon, 2002). The global supply chain is at
the same time getting shorter between producer and consumer while it is getting more
interwoven and develops itself into a net consistent of many individual supply chains. This
101
network of supply chains offer substitutes which may be shorter in terms of number of links
but longer in terms of distance from producers in one part of the world to consumers in other
parts of the world. Today's and tomorrows logistics professionals have to be keenly aware of
the supply chain risk management concepts and how to apply them in the local and personal
context, based on industry best practices and risk sharing (Lindroth, 2001).
The global supply chain is no longer a single supply chain but interwoven mash made out of
individual supply chains which results in a net of supply chains. We therefore should change
the term from supply chain to supply net, as in network but truly on a graphical level it results
in a net of chains which are made up of various length and thicknesses of chains in an
interwoven net that at the same time results in a safety net for the various industries. The author
therefore would like to coin he term Supply Net (SN) instead of Supply Chain (SC). This
becomes the safety net for the global supply chain. The critical links in this net are the logistics
professionals who manage the supply chain and it ordinary and extraordinary risks on a daily
24/7 global basis in a local context. We have to think globally and act locally as supply chain
professionals with international industry standards. We have to be proactive and anticipate
potential interruptions of the supply chain before they occur (Smeltzer & Siferd 1998). There
needs to be a greater linkage between strategic performance and risk management practices
(Wieland & Wallenburg 2012) within this framework a global approach to supply risk
management as to be developed based on the principals established by earlier research some
discussed by Jüttner, U., Peck, H., Christopher, M. (2002). The recommendation is to follow
up this study at a later point of time to see how the logistics professionals have changed their
perception over time with increased exposure to the logistics industry. A comparative study
with students from other ASEAN countries could be fruitful.
Figure 4. Individual Risk and Danger Zones
Acknowledgements
The author would like toacknowledge the contributions of the participants of the
research study and want to thank them for their time and effort, without their responses this
study would not have been possible. He also would like to thank the Burapha University
International College (BUUIC) for its support in the dissemination of the knowledge gained in
the study and its continued effort to create an environment conducive for research.
102
References
Blanchard, D. (2010). Supply Chain Management Best Practices, 2nd edition, John Wiley &
Sons
Brindley, C. (Ed.) (2004). Supply Chain Risk. Aldershot: Ashgate.
Cachon, G. (2002). Supply Chain Coordination with Contracts, The Wharton School of
Business, University of Pennsylvania, Philadelphia, PA,.
Deloach, J. W. (2000). Enterprise-wide Risk Management. Strategies for Linking Risk and
Opportunities, Financial Times/Prentice-Hall, London.
Jobst, A. (2007). Constraints of Consistent Risk Measurement and Regulation: Data
Collection and Loss Reporting. Journal of Financial Regulation and Compliance.
Johnson, M. E. (2001). "Learning from toys: lessons in managing supply chain risk from the
toy industry", California Management Review, Vol. 43 No. 3, pp. 106-24.
Jüttner, U., Peck, H. & Christopher, M. (2002). "Supply chain risk management: outlining an
agenda for future research", in Griffiths, J., Hewitt, F., Ireland, P. (Eds), Proceedings
of the Logistics Research Network 7th Annual Conference, pp. 443-50.
Kildow, B. (2011). A Supply Chain Management Guide to Business ContinuityHardcover–
January 12, 2011 Amacom Publisher.
Lambert, D. (2008). Supply Chain Management: Processes, Partnerships, Performance, 3 rd
edition, 2008.
Lindroth, R. & Norrman, A. (2001). “Supply chain risks and risk sharing instruments – an
illustration from the telecommunication industry”, Proceedings of the Logistics
Research Network 6th Annual Conference, Heriot-Watt University, 13-14 September,
pp. 297-307.
Lindroth, R. & Norrman, A. (2004). "Supply Chain Risk Management Framework" - Chapter
2 in Brindley, C. (Ed.) Supply Chain Risk. Aldershot: Ashgate.
Lynch, G. (2009). Single Point of Failure: The 10 Essential Laws of Supply Chain
RiskManagementHardcover, John Wiley & Sons.
Smeltzer, L. R. & Siferd, S. P. (1998). "Proactive supply management: the management of
risk", International Journal of Purchasing and Materials Management, Vol. 34 No. 1,
pp. 38-45.
Trent, R. & Llewellyn, R. (2009). Managing Global Supply and Risk: Best Practices, Concepts,
and Strategies. Ross Publications.
Water, D. (2007). Supply Chain Risk Management: Vulnerability and Resilience in Logistics2nd
edition. Kogan Page, London.
Wieland, A. & Wallenburg, C. M. (2012). Dealing with supply chain risks: Linking risk
management practices and strategies to performance. International Journal of Physical
Distribution & Logistics Management, 42(10).
Zsidisin, G. & Ritchie, B. Ed. (2009). Supply Chain Risk: A Handbook of Assessment,
Management, and Performance (International Series in Operations Research &
Management Science) Springer Verlag, Berlin Germany.
103
RECOGNITION OF THE MARKETING FACTORS IN THE PERCEPTION
OF SERVICE QUALITY OF TMB BANK PUBLIC COMPANY LIMITED,
SURAT THANI, PROVINCE, THAILAND
Sirirat Chuanprasit 1, Puangpen Churintr 2, Siyathorn Khunon 3
Master of Business Administration of Suratthani Rajabhat University
Abstracts
This research aims to study the perception of the marketing and the perception of
service quality of TMB Bank in the province of Surat Thani for the customer service users. The
objectives of the research are to analyze the factors of the service user, to determine the
relationship of the recognition in marketing of the bank with the perceived quality of service
of TMB Bank, Surat Thani. To study the feedback from customers who use the service on the
marketing and the service quality of the bank in Surat Thani. For example, customer banking
users as individuals and corporation of 384 sample customer banking users as individuals and
entities using the questionnaire scale 5 levels. The statistics used in this study were frequency,
percentage, mean and standard deviation.
Keywords: TMB, service quality, marketing
Introduction
TMB bank under operators Financial Institution Act and the Securities Exchange Act
of 2535 (as amended), Offer a variety of products and services that meet the financial needs of
customers because the Bank is a customer-centric organization and the bank has focused on
understanding the needs of their customers very seriously.
Surat Thani is located in the south of Thailand. There were 9 branches of the TMB
Bank that, the bank's policies focus on providing services to the satisfaction of the customer,
being able to compete with other banks and implementation of a strategy by offering products
and services and other factors. At results in a sense of the quality of the bank's services in the
client's perspective changed.
Client’ peruption may be positive or negative Theufore, factor to client’ pucephion
factor that should be studied. Currently, there are changes in cliemt’ pucephion behave of
various factors. For example, condition or location may cause to customers’ expectation and to
provide customers with the confidence to market factors that banks offer to enhance the quality
of service.
The researchers study the recognition factors of marketing with the perception of the
service quality of TMB bank, Ltd. (Thailand) in the province of Surat Thani, There are several
factors, which will be affects the perceived quality of the bank's services. In order to know
what will reflect the needs of the customer, to the bank. So, the bank can be used to guide the
planning of the service and meet the needs of customers who use their services appropriately
and effectively. To engender the loyalty to the bank, make a difference to their competitors and
can be result in the growth and profitability of the bank. Furthermore the Bank’s benefit can be
involved or interested when the bank improves customer service.
104
Objectives
1. To study the perception of the marketing of Banks and the service user in Surat Thani.
2. To study the perception of service quality and customer service of TMB Bank in
Surat Thani.
3. To compare the perception of the marketing, and analyze the factor of the service
user of Banks in Surat Thani.
4. To study the relationship of the recognition of the marketing and the perceived
service quality of TMB Bank in Surat Thani.
5. To study the suggestion from customers who use the service in the marketing and
service quality of TMB Bank in Surat Thani.
Scope of Research
Scope of content
This research by analyzing the content of the study of the relationship between the
perception of customer marketing factors on the service quality of TMB Bank Public Company
Limited in Surat Thani into 2 parts: 1) the marketing and 2) the service quality of TMB Bank
Public Company Limited in Surat Thani.
Demographic boundaries
The population in this research is customers in Surat Thani, both as individuals and
entities.
The sample used in this research, bank service user as well as individuals and entities
of the study was used to determine the average user population (Population Mean, μ) and an
unknown number of people. The confidence level of 95% and acceptable tolerances of 5% of
the total of 384 samples (Tanin Sinjaru. 2555 : 46), to cover all branches of the bank. The
researchers did not use probability sampling. (Tanin Sinjaru. 2013 : 46) using purposive
sampling (Purposive Sampling) by determining the number of samples in order to have equal
numbers of each branch. The samples in the total are 43 per 384 people.
The variable scope Includes, :
1. Independent variables
1.1 Use of the bank service user's in Surat Thani, including the type of account
transactions and the branches.
1.2 The perception of the marketing of the Bank. The factors include the product,
price, distribution, promotion, personnel, physical and service processes.
2. The dependent variable is the perception of service quality, which includes
appearance, reliability, customer response, confidence and customer care.
The conceptual framework
The concepts and theories related to the marketing mix and quality of service and
related research. The analysis of the research to determine the framework of the research as
follows.
Independent variables
Dependent Variable
105
Factors of Use
 Account type
 Transaction of Use
 Branch
Recognition of the
marketing factors
 Product
 Price
 The distribution
 Promotion and Marketing
 Personnel
 Physical
 The service processes
Perceived quality of service.
 Appearance
 Reliability
 Customer response
 Confidence
 Customer care
Figure 1. The framework of the research.
The instruments used in research
This study uses a questionnaire is developed from the study of research documents and
to improve the query's own research, the researcher created a questionnaire to 1 set of 4 pant.
The following details.
The first factor is the nature of the respondents’ use of closed questions (Closed - End
Questionnaire) type check list (Check List) contains accounts, transaction types of services and
the branches.
Part 2 is a question about the recognition of the marketing mix of TMB Bank Public
Company Limited in Surat Thani, include 7 questions factors which consists of the product,
price, distribution, promotion, personnel, physical and cognitive provider with a question
valuation 30 questions. The criteria awareness of Likert (Likert) 5 levels (Thanin Sinjaru. 2013:
75).
Part 3 is a question about the perception of the service quality of TMB Bank (Public)
in Surat Thani, include five questions are, appearance, reliability, customer response,
confidence and customer care for a total of 26 questions on the evaluation questions. The
criteria awareness of Likert (Likert) 5 levels (Thanin Sinjaru. 2012: 75) as follows.
Part 4 is an issue / recommendations to the marketing and quality of service as an open-ended
question (Open and Ended Questionnaire) so the answer can be a problem offer guidance on
various issues.
Data Collection
The analysis, follow these steps.
1. The draft questionnaire submitted to the thesis advisor to review the revised and
updated to suit the objectives of the research.
2. The questionnaire offers to 5 experts to verify its validity and content validity
(Content Validity) using the index consistency between questions on the purpose (Index of
106
Item Objective Congruence: IOC) to get value from 0.5 to show that the recruitment exam
questions that is available (Somchai Vorakitkasemsakun. 2011 : 269).
3. Improve the experts recommend then try out with non-bank customer in Surat Thani
about 30 sets before collecting data. The formula for the confidence, coefficient alpha (Alpha
Coefficients) of Cronbach (Sunee Longprasert. 2004: 184) to obtain the confidence of more
than 0.75.
4. Improve the complete query and collect the following information.
The statistics used to analyze the data.
Data analysis in this research was based on the analysis of statistical data were used in
the analysis below.
1. The data were analyzed using the services of the respondents by using frequency and
percentage.
2. Analysis of the recognition factor of marketing and service quality of TMB Bank,
Ltd. (Thailand) in Surat Thani, using the mean (  ) and the standard deviation (S.D.)
3. Compare the recognition factors of marketing of TMB Bank (Public) by using
information of the respondents. For this type of account statistics t - test and other data using
statistical F - test were analyzed using One-Way ANOVA (Analysis of Variance) and compare
the different pairs using Scheffe'.
4. The relationship between the recognition of bank marketing factors to comment on
the service quality of TMB Bank (Public) in Surat Thani. This relationship between variables
Interval scale to measure the degree to which the statistics of the Pearson correlation coefficient
(Pearson's Product Moment).
5. Analyzes problems and make suggestions to the marketing and quality of service.
Open-ended questions are used to analyze the content and then summed up in frequency and
percentage in descending order from most to least.
6. The level of statistical significance in this research was 0.05 and 0.01.
References
Chaisompon, C. (2007). The services market. Bangkok: ED length.
Chattayapron, S. (2006). The management and marketing services. Bangkok: ED length.
Kotler, P. & Armstrong, G. (1996). Principles of Marketing (7th edition). Englewood Cliffs,
New Jersey: Prentice-Hall.
Pavin, V. (2012). Service marketing factors affecting consumers in the district town Chiang
Mai to buy car alarm. Master of Business Administration Graduate School, CMU.
Tanin, S. (2012). Research and statistical analysis with SPSS and AMOS. Publication 13.
Bangkok: Business Partnership in R & D.
107
Curriculum and Educational Administration
Research
ID
102
Name
Affiliation
Institution/
Title
Country
CAS
THE USE OF PERSONAS IN THE DESIGN
OF AN ASSISTIVE COURSEWARE FOR
HEARING - IMPAIRED (AC4HI)
POLYTECHNIC STUDENTS
Sharifah
Nadiya Syed
Yahya
Jamalullaill
Politeknik Tuanku
Syed Sirajuddin,
Perlis
134
Belinda R.
Valaquio
College of Education PHILIPPINES STUDENT TEACHERS ENHANCEMENT
University of San
PROGRAM (STEP): A JOURNEY OF
Agustin
TEACHING AND LEARNING
146
Supaluck
Wannuch
Suratpittaya School
SuratThani
THAILAND
INSTRUCTIONAL MODEL BASED ON
COMMUNICATIVE APPROACH BRAINBASED LEARNING PRINCIPLES AND
ACTIVE LEARNING TO ENHANCE
SECONDARY STUDENTS’
COMMUNICATIVE COMPETENCE
108
THE USE OF PERSONAS IN THE DESIGN OF AN ASSISTIVE
COURSEWARE FOR HEARING - IMPAIRED (AC4HI)
POLYTECHNIC STUDENTS
Sharifah Nadiya Syed Yahya Jamalullaillˡ,
Sobihatun Nur Abdul Salam²and Ariffin Abdul Mutalib3
1
Politeknik Tuanku Syed Sirajuddin, Perlis 2, 3 Universiti Utara Malaysia
Abstract
Improved design development education courseware for hearing-impaired students
growing in the market throughout the year. But unfortunately most of the software is not much
help in giving exposure holistic learning support. This occurs because, less emphasis on the
needs of interface design courseware for these students. Furthermore the development of a less
serious emphasis on the needs of the multimedia components makes it increasingly difficult
design requirements. Studies to meet the actual needs of hearing-impaired students. This is
very important to maintain education for these students even in demanding conditions.
Therefore, a study to meet their needs have been conducted on the study respondents. Thus,
researchers have produced a video entitled Assistive Courseware for Hearing - Impaired
(AC4HI) for polytechnic students, by syllabus Eastern Cuisine. This video will design by using
requirements from the design personas in AC4HI. Aims to meet the needs of hearing - impaired
students more productive in their studies.
Keywords: Personas Design, Sign Languages, Polytechnic Students, Video Learning,
Hearing-Impaired
Introduction
To improve computer skills in digital learning among hearing-impaired students, design
personas should be highlighted as it is able to meet the diverse needs of solutions for digital
learning in them. (Yeh, Yun - Lung Lin, Chih - Ching Yeh, Lai, & Chi - Nung Chu, 2012. This
study discusses the need for designing a courseware named Assistive Courseware for Hearing
- Impaired (AC4HI). This courseware will be developed to support learning in the classroom
for hearing-impaired students through requirements cited in this phase personas. So design
these forms will be carried out according to student use of this hearing problem, so that they
can participate in the digital learning.
Problem Statement
In this era of technology, there are various types of courseware in the market, especially
for those with hearing problem. But unfortunately not all courseware can be used optimally by
this group as it does not meet the needs of their lack of belonging. The cause of this group felt
unhappy in their learning sessions (Ariffin, 2009). Therefore personas are one way to overcome
this problem.
109
Objectives
The main objective of this study was to identify the requirement for developing
courseware design for Assistive Hearing - Impaired students in polytechnics. While the sub
objectives are;
1) To determine the characteristics of the needs of multimedia components and the
general needs of hearing-impaired students in polytechnics.
2) To know the types of learning styles for hearing-impaired students in polytechnic.
Research Methodology
Personas Design
There are two classes selected in the design of these personas, (1) Main of Personas and
(2) User Personas. Main Persona class consists of academic coordinators, interpreters’ women
and men. While Class User Personas consists of 10 student respondents hearing-impaired
students known as 'subjects'. Figure 1 shows the class and type of user personas involved
throughout this study.
Academic Coordinator
Female
Interpreters
Main
Personas
Male
m Interpreters
Academic staff
User Personas
s
R1
R2
R3
R4
R5
R6
R7
R8
R9
Subject
Figure 1 : Main and User Personas
Design of Main Personas
Personas study was conducted by semi-structured interviews with the involvement of
four respondents who are content experts. They are, (R1) a coordinator for hearing-impaired
students academic, (R2) the academic staff who teach one subject this hearing-impaired
students, subject Malay Languages, and (R3 and R4) two sign language interpreters. An
interview between researchers and experts who have much experience in this field carried out
for two days, at different times and locations. In the semi-structured interview, there are 15
110
items that have been questioned by the respondent. At the conclusion at the end of the
interview, the researcher has managed to gather all the findings as support for research, in Table
1 as a requirement of the main personas.
Design of User Personas
User personas design by conducted with ten students interviewed hearing-impaired
students, as respondents. This process is necessary to understand the characteristics of their
needs and requirements, so that the courseware to be developed that meet the needs of students
and the level of this hearing-impaired students. In this phase, the researcher evaluated by using
two different prototypes namely (i) Video Lessons Eastern Cuisine, (ii) Islamic Education
Courseware hearing-impaired students, (KOSPIT). Both coursewares tested for comparative
assessment will be made by students of the two types of requirements for different learning
approaches, learning video and interactive courseware. The findings summarized in Table 1.
Findings
Table 1 is a summary of the findings of the personas that have been carried out.
Table 1 : Findings of the personas
Component
Requirement of Hearing-Impaired students to Develop AC4HI
by Personas Process
● MainPersonas (Interviews Semi Structures Session)
Personas
Process
Figure 2 : Researcher with the Academic Coordinator
Figure 3 : Researcher with Academic Staff
● User Personas (Session Interviews Group)
111
Component
Requirement of Hearing-Impaired students to Develop AC4HI
by Personas Process
Figure 4 : Researcher with subject
Identity
Type of
● Students Special Certificate Hotel Catering, second semester
● Polytechnic Tuanku Syed Sirajuddin, Arau, Perlis
● Hearing-impaired students
● There is a student who facing multi uncertainties can other efforts also
● Aged 18-30 years
● The subjects were students from the Special Education in SPM
● Hearing-Impaired
Disability
Status
● Fulltime polytechnic students with hearing problems
● Use Observations
● Interview Semi Structure
● Getting to know the need for component-component and types of
Objective
learning styles among hearing impaired students in polytechnic.
● Half of the subjects were not have experience in use of a computer
Knowledge
before this in high school.
and
● There are some subjects that are not able to read fluently and write
Experience
fluently.
● Not able to master a language that has a high level.
● Should use simple language in the most concise and
Language
understandable.
● There may be a lot of meaning full are not suitable.
Features
● Do not be too long.
Contents
Needs
● Establish a structured.
Multimedia
Background ● Not too bright to interfere with student focus.
Components
● Not colored.
Color
and General
● There should be a title for each page and new topic.
Purposes
● There should be a button and complete icon for every
section.
Navigation
● Each icon, menu and link to each topics and new title
must be linear.
Technique
112
Component
Relationship
Requirement of Hearing-Impaired students to Develop AC4HI
by Personas Process
● Choose texts format the easy to read because the
subjects most have problems in learning rear hearing
problem.
● Do not use a graphical representation for a text.
● Develop appropriate text structure and do not be too
hard and long.
● Identify topics and elements another text structure.
Text
● Use a paragraph style entertainment most simple and
easy to understand.
● Text size can not be too small because subject entirely
dependent eyesight
● The color of the text are also not suitable light and only
need to use one color
● Do not conform any text animation.
● Graphics should be prepared with a clear and concise to
be easily understood.
● The size must be large and not too small.
● It is better to provide zoom technique for each chart.
Graphics
● Using a text alternative support for graphics difficult
understood.
● Color graphics can not be too bright because this allows
students to focus resources misses.
● The graphics are not too many.
● Not suitable if it is too long.
● Make sure the video in a clear and bright.
● Its size is not too small.
● Have a movement that is easily understood.
Video
● Do not put too much video.
● Video recorded is not too fast.
● Includes clear video interface.
● The subject has a weak memory.
● Difficult to memorize.
● Thinking that hard in term.
● Very creative.
● So depending on which group they have a problem as
Learning
well.
Styles
● A learning style is shaped group learning
● Too few subjects were able to individual learning
emphasizes intrapersonal intelligence.
● The subject has a tendency high visual intelligence.
● Node for each hyperlink is not too much.
● Main Persona
- Consisting Of Academic Coordinator, Women and men interpreter, and
an academic staff who are directly involved with the subject.
● Users Personas
113
Component
Attitude
and
Motivation
Requirement of Hearing-Impaired students to Develop AC4HI
by Personas Process
- Consisting Of 10 subjects were similar to the respondents of the survey.
● The subject is so motivated to learn with both types of software
● Difficult to follow the instructions that many
● Like in praise
● Poor memorize and recall
●Difficult to control
Problem
Figure 5: Learning Without Interpreters.
Figure 6: Giving Directions Without Interpreters.
Conclusion
By using the information in the persona results, this study supports the understanding
of the designer in designing courseware developed wanting more effectively. This study can
also bring awareness to the use of personas in assistive technology for hearing-impaired
students. The results of this study contribute to the understanding of the requirement to design
appropriate educational software for disabilities student especially hearing-impaired students.
References
Ariffin, A. M. (2009). Conceptual design of reality learning media (RLM) model based on
entertaining and fun constructs. (Doctoral dissertation, Universiti Utara Malaysia,
2009). Retrieved from http://etd.uum.edu.my/1521/.
Cooper, A. (1999). The inmates are running the asylum. Indianapolis: Sams.
Kozar, T., Miaskiewicz, K. & Kozar, A. (2011). Personas and user-centered design: How can
personas benefit product design processes. Design Studies, 32 (5), pp. 417-430.
Yeh, Y. M., Yun-Lung, L., Chih-Ching Yeh, Y., Lai, F. & Chi-Nung Chu, T. H. (2012).
E-Learning Services for Persons with Disabilities on a Web- Accessibility E-learning
Platform in Taiwan. In International conference Linz, 11-13 July 2012, pp. 123-129.
114
STUDENT TEACHERS ENHANCEMENT PROGRAM (STEP):
A JOURNEY OF TEACHING AND LEARNING
Belinda R. Valaquio1and Frank S. Emboltura2
1, 2
College of Education, University of San Agustin, Philippines
Abstract
Practice Teaching is an integral component of teacher preparation that served as an
important link between theory and practice (Ngwaru, 2013). This paper evaluates the
experiences of student teachers and other stakeholders of the University of San Agustin –
College of Education that developed the Student Teachers Enhancement Program (STEP) to
enhance the competencies of student teachers. The main research question is: “What reforms
does the implementation of STEP have on student teacher training and education?”
Specifically, the study investigated: a) The innovative practices of STEP; b) The experiences
of student teachers, mentor-teachers, and university supervisors in the STEP; c) The influence
and effect of STEP in the over-all teaching and learning process. A case study approach was
used in order to evaluate the program’s process of enhancing student teachers competencies
and its implications on stakeholders. Triangulation of questionnaires, focus groups, semistructure interviews and observations were specifically used for gathering relevant data. A
thematic analysis was used within an interpretative approach of hermeneutic phenomenology.
Through this research three areas were revealed: Offering a diverse program model for a
student teaching program; the use of innovative approaches in the program management; and
the changes brought about by valuing teaching as a noble profession based on the premise of
adhering to the diversities of our 21st century learners. The results of the study led to the
conclusion that there were several challenges faced in improving student teachers competencies
and that some of the challenges could be mitigated by the adoption of critical pedagogies.
Keywords:Teacher education, student teachers, programs
Introduction
As candidates enter educator preparation programs to prepare for a career in teaching
or leading schools, they should begin a journey of continuous improvement during which the
sophistication of their skills and strategies, application of their knowledge of content and
student cognitive development, use of data to drive instruction, and knowledge of their
communities grow over time (Council of Chief State School Officers, 2012). Studies of
educator preparation programs revealed that there is tremendous variability among programs.
The readiness of candidates to enter classrooms and schools varies from program to program
in different countries. These varieties of routes and programs through which teachers enter
classrooms and principals enter schools have different requirements for coursework and
clinical practice and set different standards for quality. Basil (1996) claimed that developing
good and effective teachers who possess the pedagogical skills requires long and tedious hard
work. He further pointed out that the honing student teachers as they develop the teaching craft,
starts from the very first encounter in actual teaching of the student teachers. Thus, the process
of pre-service training and the learning that goes with it play pivotal roles in teacher
preparation.
Practice teaching occupies a key position in the program of teacher education. It is a
culminating experience in teacher preparation. It provides opportunity to beginning teachers to
115
become socialized into the profession (Furlong, Hirst & Pocklington, 1988). Outgoing
popularity and centrality of practice teaching is an important contributing factor towards the
quality of the teacher education program. During practice teaching, working with students in
schools provides a high degree of emotional involvement of a mostly positive nature. Student
teachers feel themselves grow through experience and they begin to link to a culture of
teaching. During practice teaching, they feel engaged, challenged, and even empowered
(Trowbridge & Bybee, 1994).
Today's classroom teachers must be as versatile in determining the most appropriate
methodologies as they are pedagogically aware in responding to the needs of an ethnically,
linguistically, and socially diverse population in preparation for a world in which the ability to
read is non-negotiable. The classroom teacher should possess an extensive knowledge of the
pedagogical process that presumes a conceptual understanding of the discipline (Rogers,
Marshall, & Tyson, 2006). Yet, recent research has affirmed the perception that colleges of
education have been remiss in providing teacher candidates with the requisite foundational
knowledge and skills of classroom instruction and has produced teachers who are ill-equipped
to take their places as teachers in the field (Walsh, Glaser & Wilcox, 2006).
Practice Teaching in the Philippines
In 2004, the Commission on Higher Education (CHED) required the implementation of
a new curriculum in 2005/2006 with the issuance of the Revised Policies and Standards for
Undergraduate Teacher Education Curriculum (CHED Memorandum Order #30, series 2004).
This included a 6 to12 week student teaching requirement. Student teaching includes both onand off-campus components (Tatto, M. T., Peck, R., Schwille, J., Bankov, K., Senk, S. L.,
Rodriguez, M., Ingvarson, L., Reckase, M.& Rowley, G., 2012). A number of terms such as
practice teaching, student teaching, teaching practice, field studies, in-field experience, and
school based experience or internship are used to refer to this activity (Experiential Learning
Courses Handbook, 2007). The term, “practice teaching”, embraces all the learning experiences
of student teachers in schools (Ashraf, 1999). Practice teaching is the name of the preparation
of student teachers for teaching by practical training. It is the practical use of teaching methods,
teaching strategies, teaching principles, teaching techniques and practical training and practice
/ exercise of different activities of daily school life.
Pre-service preparation of teachers in the Philippines for the primary and secondary
education sectors is a very important function and responsibility that has been assigned to
higher education institutions. All efforts to improve the quality of education in the Philippines
are dependent on the pre-service of teachers who are properly prepared to undertake the various
important roles and functions. As such, it is of utmost importance that the highest standards are
set in defining the objectives, components, and processes of the pre-service education
curriculum (Experiential Learning Courses Handbook, 2007). One very important aspect of
pre-service education is the student teaching component of the teacher education curriculum.
This component is considered by many as the primary exit evaluation of student teachers’
competencies. It is during this period where the would-be teachers apply the theories and
concepts they have learned in their curriculum especially the methods and strategies courses.
It is at this stage where would-be teachers face and resolve various problems and challenges
which would enable them to meet the requirements of the teaching profession (Pagaduan,
2009).
STEP Program in the University of San Agustin-College of Education
In 2007, the College of Education of the University of San Agustin launched the Student
Teachers Enhancement Program (STEP) with the Licensure Exam for Teachers Operations
(LET Ops) (University of San Agustin, College of Education, 2015). These programs were
116
aligned with Revised Policies and Standards for Undergraduate Teacher Education Curriculum
(CHED Memorandum Order #30, series 2004) to enhance the quality of teacher education and
training of the university. Specifically, STEP will mold the Augustinian educator who will be:
(a) Facilitator – who develops students’ abilities to think, solve problems, communicate and
collaborate with colleagues; (b) Learner-centered Practitioner – who creates nurturing learning
climates, respects diverse learners’ perspectives and enables students to develop as selfsufficient individuals; (c) Reflective Decision-maker – who designs instruction to enhance
students’ self-actualizing behaviors; (d) Lifelong Learner – who continuously evaluates his/her
professional performance and engages in continuous professional development; (e) Action
Researcher – who continuously assesses students’ performance, communicates results to
students and others, and uses the findings to improve the teaching/learning process; and (d)
Leader and Change Agent – who collaborates with all constituents to enhance the authentic
educational experience of all learners.
The STEP major activities are chronologically arranged to address the gradual
progression and transition of student teachers. These activities are, as arranged in order:
orientation, class observation, initial demo-teaching (demo-teaching festival), endorsement and
actual practice teaching (in and off-campus with orientation per school by the school principal
and mentor-teachers), STEP refresher seminars/workshops, final demo-teaching (in the field),
culminating activity (with showcase of best practices per school), and portfolio presentation
and assessment. These are done with appropriate collaboration among the university
supervisor, with the school principal and mentor-teachers.
Theoretical Framework and Research Problem
This study is anchored on the theory “learning to teach” of Feiman-Nemser (2001). The
theorist advocates conceptualizing teacher development as a professional learning continuum
that extends from initial preparation into the early years of teaching. Further, Feiman-Nemser
(2001) argues that learning to teach is a complex, lengthy undertaking that requires coherent
and connected learning opportunities that link initial preparation to new teacher induction and
new teacher induction to continuing professional development. A key strand in the ‘learning to
teach’ theory considers teacher professional development in terms of developmental stages.
This conceptualized teacher growth as a progression through a series of phases in a relatively
deterministic manner, the assumption being that the stages are sequential and hierarchical and
that each subsequent stage is more complex and more desirable than the preceding stages
(Richardson & Placier, 2001).
This paper evaluates the experiences of student teachers and other stakeholders of the
University of San Agustin – College of Education that developed the Student Teachers
Enhancement Program (STEP) to enhance the competencies of student teachers. The main
research question is: “What reforms does the implementation of STEP have on student teacher
training and education?” Specifically, the study investigated: a) The innovative practices of
STEP; b) The experiences of student teachers, mentor-teachers and university educators in the
STEP; c) The influence and effect of STEP in the over-all teaching and learning process.
Research Methodology
Multiple case study method was used in this study. A multiple case study method is
defined as prolonged observations over time in a natural setting within a bounded system. The
observational method is the chosen method to understand another culture whereas, the case
study is used to contribute to our knowledge of individual, group, organizational, social,
political, and related phenomena (Yin, 2003). Using the case study method allowed for
117
exploration of actions and events over the participants over the prolonged number of time in
the natural setting; providing a deeper understanding of their student teaching life.
Participants and Cases
The participants of this study were the present and former stakeholders of the STEP
program. The cases include: (a) six student teachers who are currently enrolled in the course
Practice Teacher (Prac 12) for academic year 2014-2015; (b) three alumni who are professional
and practicing teachers and were recipients of STEP; (c) three mentor-teachers and one school
principal who are currently and constantly serving as cooperating teachers and school principal;
and (d) two practice/student teaching supervisors. The partakers were purposively chosen for
the study for the reason that they are particularly useful in the context of the study and are the
major stakeholders are who are involved in designing, giving, receiving, or administering the
program being deliberated (Given, 2008).
Data Collection Procedures and Analysis
In-depth and semi-structured interviews with study participants, on-site observations,
focus group discussions, document and archival exploration were used during the span of the
student teaching period to craft communal and substantive accounts grounded on the stories of
those who are deeply involved in the STEP program. Qualitative analysis was comprised of
the analysis of similarities and differences, coding and categorizing, and constant comparison
(Lunenberg & Irby, 2008). Creswell (2007) divided data analysis in an ethnographic case study
into five parts: 1) data managing, 2) coding and developing themes, 3) describing, 4)
interpreting, and 5) representing. The researchers engaged in the process of moving in analytic
circles that spiral upward, in a process that allowed them to produce a continually more detailed
analysis. The researchers entered with data as text and exited with an account or narrative
(Creswell, 2007). This analytic process contrasts with the more linear line of reasoning found
in quantitative analysis.
Results and Discussion
A variety of data were collected and analyzed to address the research questions. The
data analysis was conducted using triangulation of the in-depth and semi-structured interviews
with study participants, on-site observations, focus group discussions, document and archival
exploration documents. The following section will identify themes based in the specific
research questions and across cases:
The innovative practices of STEP. This study found that some specific practices that
are included in the STEP played a critical role in assisting student teachers’ transition to
teaching and development as teachers in the following practices.
“The demo-teaching festival is indeed a worthwhile activity to help us, mentor-teachers,
assess the strengths and weaknesses of the incoming student teachers so that we can
address their needs in the teaching field.” – Mentor-Teacher
“Selected Cooperating School”
The professional culture of the school was a key influence on the professional
development of the student teachers. All of the cooperating schools have distinct characteristics
and culture; one is inclusive while the others have multiple special programs. All of them were
duly accredited. These schools encouraged and facilitated the development of positive collegial
relationships and student-centered philosophy. These peculiar culture could be remarkably
observed at the level of classroom teaching and/or the whole school, but their effect was to help
student teachers fit in and become part of the culture. This, in turn, influenced student teachers
perception about teaching that will propel them in their future teaching endeavours.
118
“Resource Persons”
One of the best features identified in the STEP practices is the STEP refresher
seminars/workshops/for a. Resource persons were invited to facilitate the particular activity.
These resource persons included the alumni who are not only experts in their field but are also
active practitioners and specialists on the educational field and on the topic they are invited to
facilitate. The participants unanimously expressed that this greatly helped the student teachers
in developing their competencies towards teaching.
“Demo-Teaching Festival”
This theme is highly recommendable in accordance to the participants’ responses.
Demo-teaching festival is a collaborative activity organized by the College of Education
through the university supervisors for the student teachers with the support of the mentorteachers and cooperating school principals. With mentor-teachers acting as critic during the
simulated demo-teaching, this activity boosted the morale and confidence of students’ teachers
in their teaching skills before rendering actual teaching in their respective cooperating schools.
The experiences of student teachers, mentor-teachers, students and university
educators in the STEP. This research found that worthwhile experiences gained in the STEP
was critical to the professional development among the stakeholders or participants; there was
variability in their experiences that were dependent with their roles in the program and that
these differences in their experiences are major factors in honing as mentors and student
teachers.
“As I experience the STEP, it defines my priorities in life became more defined. I began
to question myself, am I for teaching? It even dawned on me if which comes first…
money (salary) or my students?” – BSEd student teacher
“Reality Bites”
This theme was professed to be acute to participants’ planning and training as
stakeholders in the STEP process. The data discovered that as a consequence of the STEP the
participants learned that there was a mismatch between “what is taught” and the realities of
teaching. Two accompanying factors were the stress that they experienced when they first
started teaching for student teachers and the beginning phase of mentoring for the mentorteachers including other factors related to understanding the size and scope of the job of being
a student teacher and mentor-teacher/supervisor. The participants’ STEP experiences have
enabled them to gain a realistic understanding of what a teacher had to do to set up a class from
scratch and how to mold beginning teachers considering the full range and complexity of their
work demands and responsibilities.
“Addressing Diversities”
School cultures did encourage constructive and mutual interactions. Thus, participants
developed to respect everyone’s personality. Furthermore, participants stressed that this feature
impacted their work and how they viewed themselves and their students. They experienced
both formal and informal opportunities to interact with each other acutely aware of their roles
thus resulting to opportunities for relationship building in becoming part of the team. This also
influenced their dealings with their everyday interfaces with other people indirectly involved
in the STEP activities.
“Mentor-Teacher, Student Teachers and University Supervisors Collaboration:
Plays an Important Role”
Becoming a member of the school’s professional community was a key task faced by
the student teachers. As perceived by the participants, the ease or difficulty of becoming part
119
of the school culture/system was associated to proper collaboration between the university and
the cooperating school. Collaborative work cultures expedited the development of cordial and
formal, social and professional relationships and dealings, which enabled the participants to
learn from each other performing their varied roles in the STEP process which makes them as
one team.
“Children and Student Teachers as Teachers”
The students whom student teachers taught and student teachers also played a
substantial role in their perception of themselves as student teachers, mentor teachers and
university supervisors. While the mentees were consistently viewed as learners or apprentices
in this study, it was found out that they also acted as teachers or mentors. There is a sense of
reciprocity among the roles of the participants during the STEP progression. This
transformation is one meaningful aspect the participants have reiterated and that as they became
more self-assured and calm with their roles, they progressed from being a “controlling teacher”
to become an “open teacher”.
The influence and effect of STEP in the over-all teaching and learning process.
Although participants stated that, generally, the STEP had great influence in their professional
and student lives, the following themes show that the STEP had noteworthy effects in terms of
facilitating teaching and learning process.
“Most of my students shared to me that the STEP experiences they have improved
their skills in teaching and it is an arena wherein they can really put into practice the
knowledge they have learned in school.” – University Supervisor
“Journey towards Professionalism”
The participants believed that the more they developed professional relationships with
colleagues, the more self-assured they became and the more they participated in collective and
school events. The cumulative impact to participants was in the advancement of their
professional lives as teachers and student teachers.
“Bridging the Gap between Theory and Practice”
There is a general understanding among participants that the STEP had connected
practical experience with academic content. The participants cited frequently that having the
STEP have enriched their learning because they had the opportunity to reflect, compare,
connect, and apply what is being learned in theory to the actual setting. During the STEP,
student teachers have the best opportunities to make connections from theory-based courses
into actual school settings. Mentor-teachers, university supervisors and cooperating school
principal have also the break to apply proper mentoring theories learned in higher or graduate
education.
Conclusion and Recommendations
In this study, the voices of major stakeholders of the STEP are significantly reflected
yet these expressions (and reserves) can be easily parodied through contextual suitability.
Nevertheless, the research findings suggested that STEP is one of the most influential aspects
of the four-year teacher education and training curriculum of the University of San Agustin –
College of Education. The more opportunity there is for this program, the more fulfilled
participants are within the program. However, the outcomes of this study acknowledged that it
was not one element, but a number of elements and the dynamics between these elements which
impacted the participants’ professional growth over time as well as influenced their outlooks
of teaching and themselves as teachers.Though clearly that among participants, transitory
120
adjustments were experienced, collectively, a novel viewpoint has been interwoven out of their
shared experiences. It is a viewpoint wherein knowledge making and transmitting were
considered superficial but a paradigm of learning through teaching and teaching through
learning were highlighted. Additionally, although participants generally viewed STEP as being
helpful, they also recognized the challenges they had encountered. As a result of that vital
recognition, new meaning and perspective were given to the sphere of their journey towards
professional teaching, mentoring, and collaborating. In this way, STEP stakeholders were
formed and transformed so that they may be able to fulfil their roles as expected in an
exemplary manner.
With these, the following recommendations were postulated: (a) during orientation
session, stakeholders together with parents need to understand their roles and the expectations
for the STEP; (b) continuous and communal support of the STEP is highly encouraged, support
from the University, College of Education family and cooperating schools; (c) replication of
this type of study to ensure quality pre-service teacher training; and (d) since this is the first
study regarding STEP, it is highly recommended that the results should be emphasized in
practice and stakeholders should continually improve from the outcomes of the program.
References
Ashraf, M. (1999). Dictionary of primary education. New Delhi: A.P.H. Publishing
Corporation.
Basil, V. B. (1996). Student teaching in state colleges and universities in the Cordillera
Administrative Region, 1995-1996. Unpublished Masters Thesis. Baguio Central
University, Baguio City.
Commission on Higher Education (CHED). (2015, February 13). 2004 CHED Memorandum
Orders, Revised Policies and Standards for Undergraduate Teacher Education
Curriculum. Retrieved from:
http://www.ched.gov.ph//wp-content/uploads/2013/07/CMO-No.30-s2004.pdf.
Council of Chief State School Officers. (2012). Our responsibility, our promise:
Transforming educator preparation and entry into the profession. Washington, DC:
Council of Chief State School Officers.
Creswell, J.W. (2007). Qualitative inquiry and research design: Choosing among five
traditions (2ndedition). Thousand Oaks, CA: Sage Publications.
Feiman-Nemser, S. (2001). From Preparation to Practice: Designing a continuum to
strengthen and sustain teaching. Teachers College Record, 103(6), 1013-1055.
Furlong, V.J., Hirst, P.U. & Pocklington, K. (1988). Initial teacher training and the role of the
school. Philadelphia: Open University Press.
Given, L. M. (Ed.). (2008). The sage encyclopedia of qualitative research methods (Vol.2, pp.
697‐698). Thousand Oaks, CA : Sage.
Lunenburg, F. C.& Irby, B. J. (2008). Writing a successful thesis or dissertation: Tips and
strategies for students in the social and behavioral sciences. Thousand Oaks, CA:
Corwin Press.
Pagaduan, C. P. (2009). Academic performance in selected field study courses and off
campus teaching competence of pre-service teachers. University of the Cordilleras
Research Journal. Retrieved from
http://www.eisrjc.com/documents/Academic_Performance_In_Selected_Field_Study_
1325667177.pdf.
121
Richardson, V.& Placier, P. (2001). Handbook of research on teaching (4th edition).
Washington, D.C: American Educational Research Association.
Rogers, T., Marshall, E.& Tyson, C. A. (2006). Dialogic narratives of literacy, teaching, and
schooling: Preparing literacy teachers for diverse settings. Reading Research
Quarterly, 41(2), 202-224.
Tatto, M. T., Peck, R., Schwille, J., Bankov, K., Senk, S. L., Rodriguez, M., Ingvarson, L.,
Reckase, M.& Rowley, G. (2012). Policy, practice, and readiness to teach primary
and secondary mathematics in 17 countries: Findings from the IEA teacher education
and development study in mathematics (TEDS-M). Amsterdam, The Netherlands:
International Association for the Evaluation of Educational Achievement (IEA).
Teacher Education Council, Department of Education, Commission on Higher Education.
(2007). Experiential learning courses handbook. Phil: Authors.
Trowbridge, L. W.& Bybee, R. W. (1996). Teaching secondary school science: Strategies for
developing scientific literacy. Englewood Cliffs, NJ: Prentice Hall.
University of San Agustin, College of Education. (2015, February 13). College of Education
History in a Nutshell. Retrieved from University of San Agustin Official website:
http://www.usa.edu.ph/index.php/2014-05-30-15-15-11/college-of-education.
Walsh, K., Glaser, D. & Wilcox, D. D. (2006). What education schools aren’t teaching about
reading and what elementary teachers aren’t learning. National Council on Teacher
Quality. Retrieved from http://www.nctq.org/p/docs/nctq_reading_study_app.pdf.
Yin, R. K. (2003). Case study research: Design and methods (3rd edition). Thousand Oaks,
CA: Sage Publications.
122
INSTRUCTIONAL MODEL BASED ON COMMUNICATIVE APPROACH,
BRAIN-BASED LEARNING PRINCIPLES AND ACTIVE LEARNING
TO ENHANCE SECONDARY STUDENTS’
COMMUNICATIVECOMPETENCE
Supaluck Wannuch
Suratpittaya School SuratThani
Abstract
The purpose of this research was to develop the English listening and speaking skills
instructional model based on Communicative Approach, Brain-Based Learning Principles and
Active Learning to enhance students’ communicative competence. The specific purposes were
to try out and examine the results of using this model with 45 Mattayom 4 Suratpittaya School’
upper secondary students. The results were as follows: 1) the developed model consisted of 5
components; principles, objectives, contents, learning process, assessment and evaluation. The
quality of the model checked by the experts was good. The results of the experiment showed
that the learning and teaching through the activities following the stage was smooth. 2) the
students’ achievement after the intervention was significantly higher than before at .05.
Keywords: Instructional Model, Brain-based learning, Active learning
Introduction
It is undeniable that the world is getting smaller due to the influence of technology
that appears to connect people all around the globe. Hence understanding what is going on in
the wider world today is likely to become more and more necessary. It has been proven that
English as an international language has become crucially important for communication among
different groups of communities around the world in various aspects such as education and
economics. Therefore English as a world language is very important.
At present learning foreign languages is very important and essential in daily life as
foreign languages serve as an important tool for communication, education and seeking
knowledge, as well as creating understanding of cultures and visions of the world community.
Foreign languages also enable learners to become aware of the diversity of cultures and
viewpoints in the world community, an aspect that is conducive to friendship and cooperation
with other countries. Learning different languages other than the learner’s own has many
advantages. Firstly, it contributes to learners’ development by giving learners better
understanding of themselves and others. Secondly, learners are able to learn and naturally
understand differences of languages and cultures. Furthermore, learners are able to appreciate
other customs, traditions, and ways of thinking, norms of society, economies, politics and the
administration of other countries. Most of all, they will eventually be able to use foreign
languages for communication and will have more access to bodies of knowledge while having
vision in leading their livelihoods.
It is to be noted that the foreign language constituting basic learning content that is prescribed
for the entire basic education core curriculum is English, while other foreign languages, e.g.,
French, German, Chinese and other languages of neighboring countries are left to the discretion
of educational institutions to prepare courses and provide learning management as appropriate
123
(Ministry of Education, 2011). Effective Communicative Language Teaching is a developing
process that aims to improve all four skills in learning English: listening, speaking, reading and
writing. Among these skills, listening and speaking are considered to be mainly important and
essential for daily life communication.
According to researchers and their experiences in teaching English at secondary
school level, problems in listening and speaking are mainly due to limited vocabulary, lack of
creative thinking and practicing as well as the large size of classrooms (Gail, 2004).
It is clearly seen that teaching and learning go hand in hand. The teacher teaches while
the learners learn, hence the teaching-learning process mutually takes place at the same time.
Listening and speaking are considered the most difficult skill for Thai students and it
is also difficult to learn due to limited vocabulary, lack of brainstorming and creative thinking
in learner’s aspect, and also because of the large size of classes. As Gail noted, a group of not
more than 20 students is suitable and small enough for teachers to check, correct and train them
effectively (Gail, 2004). Several methods have been developed for effective English teaching.
Communicative approach is one of the popular methods. The 3 steps – presentation, practice
and production ofcommunicative approach is that focusing on students’ practice using the
target language fluency in different situations but without strict correction grammar. I tried to
create and develop “A Listening and Speaking English Skills Instructional Model Based on
Communicative Approach, Brain-Based Learning Principle and Active Learning to Enhance
Students’ Communicative Competence”.
Research Methodology
This section includes instruments, participants and population as well as sampling of
the study. The procedure, data collection and data analysis will respectively also be addressed.
Instruments – Listening and Speaking lesson plans, each of them two hours long in
which the steps of listening - speaking English teaching were apparent up to the Instructional
Model Based on Communicative Approach, Brain-Based Learning Principles and Active
Learning to Enhance Students’ communicative Competence.
- The Oral English situation test and the listening-speaking rubric assessment were used
for validity of the scoring system (Jacobs, 1981:105, Aree Predegul, 2011).
- Questionnaires and interviews at the end of the session were available.
Participants and populations – 45 Mattayomsuksa 4 students from Suratpittaya
School in Surat Thani were the participants in this study. These students were enrolled in the
Thematic English course in the academic year 2014.
Procedure – listening-speaking is a certain unit of the Thematic English course,
however the listening-speaking section is generally integrated with the other skills in each unit.
This study used a pretest and posttest to compare pattern design. The activities were outlined
step by step of Instructional Model Based on Communicative Approach Brain-Based Learning
Principles and Active Learningaccording to group, and peer tasks so students were able to
think, share their ideas and check on each other’s work while the teachers’ observed, listeningspeaking assessment was continued during their tasks. Questionnaires and interviews were also
provided. The results were used to describe the learners’ listening-speaking English abilities.
Questionnaires and interviews were used to gather data about the profile of their responses.
Data collection – Data sources included the score from the pre and post listeningspeaking oral situation tests as well as questionnaires and interviews at the end of the listening-
124
speaking section. Furthermore, the progress of learners’ listening-speaking abilities was
assessed according to seven components – pronunciation, vocabulary, language use of
grammar, appropriate language function and situation, related dialogue meaning analysis,
communicative strategy and the fluency – during the learning process of the listening-speaking
section.
Data analysis - Mean and standard deviation were used to determine the learners’
communicative competence and the t-test was used to determine the significant difference in
listening-speaking ability before and after using the model. Self-reported questionnaires with
a five-point Likert rating scale were used to examine learners’ perceptions.
Results
The results showed that 1)it was found that the prominence of communicative approach
is that focusing on students’ practice using the target language fluency in different situations
but without strict correction of grammar.It was found that the brain–based learning principles
are suitable of developing communicative competence because students learn through activities
that they can acquire the language with different perceptions. Students can study language
content while using it by linking prior knowledge with the new. They can improve how they
learn by reflecting and evaluating their own learning. Moreover, it’s the students’ responsibility
to learn actively by audio visual acting and through participating in learning activities and also
their experiences are also suitable for developing communicative competence. The developed
model consisted of 5 components : principles, objectives, contents, learning process,
assessment and evaluation. The quality of the model checked by the experts was good. The
results of the experiment showed that the learning and teaching through the activities following
the stage was smooth. 2) The students’ communicative competence after the intervention was
significantly higher than before at .05.
Discussion
According to the results found in this study, students’ communicative competence after
the intervention was significantly higher due to the clear procedures or steps of the Model.
Activating and preparing from their background knowledge, the memorization of graphic
summary records and the teacher’s feedback were used to guide them to think throughout the
process, from the beginning to end of each task. The integrated communicative approach,
brain-based principle and active learning are actually not only helpful for students’ conceptual
thinking but are also useful for clear listening-speaking, moreover, according to brain-based
principle and active learning, real situation language practicing will lead to improved longterm memory and sustainable memorization.
References
Alta Language Services, Inc. (2005). Language teaching. Retrieved September 24, 2014.
From : http://www.altalang.om/training/LanguageTrainingmethods.htm.
Ausubel, D. (1963). Ausubel’s Theory [Online]. Retrieved September 24, 2014.From:
http://www.tip.psychology.ort/ausubel.html.
______. (2010). Bloom’s Taxonomy [Online]. Retrieved September 24, 2014. From :
http://www.oaks.nvg.org/taxonomy-bloom.html.
Chew, P. G. (2005). Change and comtinity : English language teaching in Singapore.Retrieved
December 24, 2009. From : http://www.asian-efl-journal.com/march-05-pc.php.
125
Clark, J.L. D. (1979). Direct versus semi-direct tests of speaking ability. In E.J.Briere and F.
B. Hinofotis (Eds.), Concepts in language testing : Some recent studies (pp. 35-49).
Washington, D.D.: TESOL.
Clemons, S. (2004). Brain-Based Learning : Possible Implications for Online Instruction.
Retrieved September 2, 2014.From
:http://www.findarticles.com/p/articles/mi/m4467/is754/ai64059320.
Dimond, M. (1998). Brain-based learning. Retrieved October 2, 2014. From :
http://www.thailearn.net/student/bbl.
Drake, E. (2000). Some Guide for Active Learning in the College. Retrieved September
3,2014. From :http://www.edcu.drake.edu/roming/activing.html.
Eckstein, J., Marquardt, K. & Voler, M. (2001). Patterns for experiential learning. Retrieved
September 3, 2014. From :
http://www.pedagogicalpatterns.org/current/experientiallearning.pdf.
Ferris, D. (1998). Students’ Views of Academic Aural/Oral Skills : A Comparative Needs
Analysis. TESOL Quarterly, 32(2), 289-318.
Finocchiaro, M. (1989). The functional_notional approach : From theory to practice. New
York : Oxford University Press.
Flavell, J. (1979). Metacognition. Theories of learning in Educational Psychology[online
Serial]. Retrieved May 15, 2014. From : http://www.lifecercles-inc.com.
Fosnot, C. (1992). Constructing Constructivism. In T. M. Duffy (Ed.), Constructivism and
theTechnology of instruction (pp. 167-181). New Jersey : Lawrence Erlbaum
Associates.
Gail, E.T. (2004). Teaching Writing Balancing Process and Product. California, USA.
Galloway, A. (1993). Communicative Language Teaching. Retrieved May 15, 2014. From:
http://www.coe.sdu.edu/eet/Article/comlanguageteach/start.html.
Hatice, B. (2003). An investigation of students’ attitudes towards brain-based applications in
English compositions skills II course : A case study. Thesis M.A., Middle East
Technical University.
Jensen, E. (2004). Brain-based learning. CA: Brain Store.
Johnson, D., Johnson, R. & Holubec, E. (1994). The new circles of learning : Cooperation in
the classroom and school. Alexandria, VA : Association of Supervision and
Curriculum Development.
Jonassen, D.H. (1992). Evaluating constructivist learning. In T.M.Duffy (Ed.),
Constructivism and the technology of instruction (pp.137-147). New Jersey :
Lawrence Erlbaum Associates Publishers.
Joyce, B. & Weil, M. (1996). Models of teaching (5thEdition). Boston : Allyn and Bacon.
Joyce, B., Weil, M. & Calhoun, E. (2000). Modesl of teaching (6th Edition). Boston : Allyn
and Bacon.
Kangan, S. (1997). Cooperative learning. San Clemente, CA : Kagan Cooperative.
Klausmeier, H. (1986). Learning and Human Ability Education and Psychology. New York :
Harper and Brother.
Knowles, L. (2008). A brain-based theory of language acquisition : RHR. Retrieved May 5,
2014. From : http://www.languagemagazine.com.
Nunan, D. (2002). Designing tasks for the communicative classroom. Cambridge :
Cambridge University Press.
Spears, A. & Leslie, W. (2006). Brain-based learning. Retrieved September 13, 2014.From:
http://www.cainelearning.com/principles.html.
126
Stephen. B. R. (2014). Overcoming common problems related to communicative
methodology.Retrieved March 19, 2014. From : http://iteslj.org/Techniques/RyanCommunicative.html.
University of Nebraska at Omaha. (2006). A brain-based approach to teaching English as a
second language. Retrieved May 28, 2014. From:
http://www.developingtachers.com/articles_tchtraining/brain5_tanju.htm.
Widdowson, H. G. (1972). Explorations in applied linguistics. Oxford : Oxford University
Press.
Yoon, K. (2004). CLT Theories and Practices in EFL Curricular. Retrieved September 23,
2014. From : http://www/asian-efl-journal.com/September-04-yke.php.
Zhenhui, R. (1999.) Communicative Competence. Retrieved September 23, 2014. From:
http://www/asian-efl-journal.com/September-04-yke.php.
127
Curriculum and Educational Administration (Cont.)
Research
ID
105
Name
Abdul Haris
Affiliation
College of Arts and
Sciences - Universiti
Utara Malaysia
(UUM)
Institution/
Title
Country
CAS
TEACHER QUALITY IN INDONESIA: THE
IMPLEMENTATION OF EDUCATION
CURRICULUM (PRELIMINARY REVIEW)
107
Fadhilah Razali College of Art and
Sciences – Universiti
Utara Malaysia
136
Salubsri
Charoenwet
152
Roel V. Avila & Philippine Normal
Edgardo S.
University, South
Villaseñor
Luzon Campus
PHILIPPINES DETERMINING THE BEST PREDICTIORS
OF A PHILIPPINE UNIVERSITY NEW
GRADUATES’ PERFORMANCES IN THE
LICENSURE EXAMINATION FOR
TEACHERS (LET): TOWARDS REVIEW
PROGRAM INTERVENTIONS
130
Eden V.
Evangelista
PHILIPPINES RELATING TEACHING STYLES AND
LEARNING STYLES WITH PERFORMANCE
IN BIOLOGY
Suratpittaya School
SuratThani
Philippine Normal
University
CAS
THE TEACHERS UNDERSTANDING ON
2013 CURRICULUM IN APPLYING
LEARNING MODEL ON SMKN 3 BANDA
ACEH
THAILAND
LEARNING OUTCOMES AND STUDENTS'
PERCEPTION TOWARD EDMODO
LEARNING PLATFORM
128
TEACHER QUALITY IN INDONESIA: THE IMPLEMENTATION OF
EDUCATION CURRICULUM (PRELIMINARY REVIEW)
Abdul Haris
College of Artsand Sciences - Universiti Utara Malaysia (UUM)
Abstract
This study aims to observe the teacher quality in Indonesia in the implementation of the
curriculum, the quality of teacher’s generally has to be improved or increased. Teacher’s
quality in Indonesia relatively lowers level of academic qualification to compare other
countries. In addition, this some implications and recommendation based of the study were
presented in an effort to improve the quality of teacher. To increase the teacher quality through
recommendations for future research to private and government. For instance, to keep the
quality of teacher, the teacher always; progress in developing teacher quality, developing
quality standard, and keep continuous teacher quality development.
Keywords: Teacher, Quality,Implementation, curriculum
Introduction
The National Education Standard Boards (BNSP) was established in 2005 by regulation
19/2005 to set national education standards. The achievement of eight National Education
Standards, achieving the Nation Education Standards will improve the quality of education and
education outcomes for all students. Teachers, principles, supervisors and education personnel
are required to implement curriculum activities and programs to achieve the eight National
Education standards and report their progress in achieving the National Education Standard
Teacher. The person who has high enrolls in education or teaching learning process. The
teacher quality is needed for all teachers to hold their task in implement of education
curriculum.
The quality of teacher’s generally has to be improved or increased. Upgrade training
pathways are needed for the teacher. Those are full University attendance to complete
additional academic. Distance learning pathway through the Open University (Universitas
Terbuka), attendance at courses conducted by the national P4TK and conducted through
provincial LPMP, traditionally, has a significant role in teacher training. Teacher quality is
needed in implementation of education curriculum, teacher quality of education quality, teacher
quality able to improve and increase education.
Teacher’s education history in Indonesia can be tracked by 5 periods: (1) during Dutch
colonial era, (2) 3.5 years under Japanese occupation in World War II, (3) After Independence
as the Republic of Indonesia which was recognized as the old order during Soekarno
government, ended in 1965, (4) During “New Order” of Suharto government and (5) The era
of reformation. The development of teachers education (TE) in each era are different, in the
format, institution, orientation which is depending on the political and cultural and
development of interest during each time.
Objectives
The purpose of thisstudywere:
To know contribution of teacher quality at school in Indonesia education curriculum
implementation.
129
Research Methodology
The Teacher’sQuality
Ministry of education state that in the reform education era, state that all in school
teachers to have at least 4 years post secondary diploma (D4/S1). Some teacher training was
conducted by institution such as PPG (Program PelatihanGuru), institution offering this
training standard by government and graduates usually meet standard of quality. So, the low
quality of teacher can be attributed to the national teacher training system. Either teacher’s with
lower ability offer lack the ability or motivation to upgrade improve or increase their quality
skill and qualifications. Failure to improve the quality and qualifications will have an adverse
effect on the quality of teaching, curriculum implementation and ultimately on student learning
outcomes. Ministry of National Education (2012), indicate that teacher’s quality in Indonesia
relatively lower level of academic qualification compare than other countries/neighbouring
nations. The teacher’s examination score were low in subject that was going to be required to
teach in curriculum implementation.
Teacher quality is defined as teachers engaging in education tasks, with certain
characteristics, and being able qualified to conduct teaching and learning activities process,
arousing students’ interest in learning, and enhancing students’ learning achievements. Ko,
H.Y (2003) believed that teacher quality is a general term for teacher cultivation, professional
qualification and abilities. Peng, S.M (1999) believed the content of teacher quality can be
categorized into: (a) Personality and (b) Professional subject accomplishment. (c) Common
quality, (d) Professional knowledge and abilities, (e) Professional beliefs and attitude.
Horn & Sanders, Wright (1997). Summarizing the results from documentary analysis,
it is concluded that, in this research, teacher quality should cover: (a) professional competence,
(b) personality, (c) teacher-student interaction and (d) student problem handling, (e)
Performance responsibility.
TeacherQuality on StudentAchievement
The McKinsey report Barber M (2001) identified teacher quality as being crucial to
high quality education. They cite at least three separate studies Sanders & Rivers (1996)
Haycock (2001) Wright, Horn, and Sanders (1997) that showed a direct relationship between
teacher quality and student achievement. Interviews with head teachers of schools in topperforming education systems revealed that much of the wide variations in classroom learning
were a function of teacher quality. Other studies, notably those by the World Bank and DarlingHammond (2006) have identified teacher preparation and development as a critical dimension
in improving teacher quality.
For many years, teacher has debated which school variables influence pupil’s
accomplishment in curriculum implementation. As policymakers become more involved in
school reform, this question takes on new importance since their many initiatives rely on
presumed relationships between various education-related factors and learning outcomes.
Some research has suggested that a teacher brings big influence to bring a student’s
achievement that is independent of his background and general social context” teacher
variables may play an important role in what learning student. The quality of teachers is related
to improvements in students’ performance. Teacher effects appear to be additive and
cumulative, and generally not compensatory. The study aimed at determining the contribution
of teacher quality for school in Indonesia a way that the generalization could be drawn from
the data analysis of the study.
Curriculum of Development
Curriculum of the teaching material is aimed no other than to achieve the goal of
learning. As a means of achieving the goal implementation of curriculum is developed on
130
different approaches. According to Ornstein and Hunkins (2009) implementation of curriculum
is developed from some factors:
1. Behavioural approach; is views that curriculum is a plan sometimes called blueprint
or document. Goals and objectives are specified, content and activities are sequences on the
basis of terminated objective, and learning outcome is evaluated in relation on the final goals
and objectives.
2. Academic approach; is which addresses more on the development of subject matters
and pedagogical.
3. Humanistic approach; is this approach pays attention to the personal and social
aspect of curriculum and instruction. Subject matters artistic, physical and culture aspects as
well as the need for self-actualization among learners become important part of learning. This
approach also deals with valuing, freedom and personal fulfillment, ego identity, and
psychological health (Schneider&Bugental, 2001).
Element of Teaching
According to Varron (2011), to learning the teacher the main role in the teaching
learning process. In concern to the educational process, he/she is regarded as the prime mover.
Their one who facilities the whole process of learning, direct its flow and serves as main control
of the teaching learning process. Varron (2011) state that “teaching and learning involve the
process of transferring knowledge from the one who is giving to the one who is receiving.” He
identifies three teaching and learning elements which according to him are essential to make
teaching and learning possible. Without them, the teaching, learning process will not exist.
These elements are the teacher, the learners as well as the good learning environment. It is
being considered that the learning process takes place only when a relationship is established
among them.
According to Gu (2005), States that teaching represents the four critical elements of a
profession described, knowledge base, resources, condition of practice, and quality control.
Teachers seem the posses the key characteristic of professionals who are 'equipped through
specified and prolonged preparation to use validated practices and to apply them emotional
intelligence.
Teacher expectation
Murphy (1993), mention, the research has shown that because teacher have not
expected very much from them, many students have nor learnt very much. It is therefore
important to motivate and encourage youngsters and require them to master a body of
knowledge and skills that they will need if they are going succeed in the new world order. If
standard are not raised, reform will have no purpose, particularly as students will move out into
a world of determined, well educated competitors.
The Stage of Teacher
According to Sudarfiana (2013), the role of professionalism teacher in education is
needed, Base on the International Standard of Teaching Frame, particular implementation of
education curriculum system identifies four stages, are:
1) Graduate teacher: Teachers beginning their teaching career
2) Professional competence: Teachers that have demonstrated successful teaching
experiences
3) Professional accomplishment: Highly accomplished and successful practitioners
4) Professional leadership: Teacher that has a record of outstanding teaching and is
committed to enhancing the quality of teaching and learning.
131
Conclusion
Quality teacher (TQ) is blended from different approaches included proportionally from
behaviour, skills, attitudes, cognitive, and humanism views of learning. Behaviour, believes
learning is affective when teaching is structured for the teachers to feel reinforced about the
success. Cognitive assures that learning is to happen because the teachers have inner potential
to manipulate every stimulus and a scheme for further knowledge. Attitudes, admits learning
deals with psychological response, positively or negatively, to such circumstances. These
views inspire a teacher to enhance the students’ behaviour models and strategy.
These problems might inhibit the academic achievement of teaching and learning
subject. Some researchers have been performed and indicated the positive outcome. However,
those researchers did not answer the expected from this current study being investigated.
Discussion
Based on National Education Standard government Regulation No. 19/2005,
curriculum implementations consist of:
Graduate quality standard, learning content standard, learning process standard, teacher
and education personnel standard, equipment and infrastructure standard, cost and finance
standard, and education assessment and education standard. According to teacher and
education personnel standard quality teacher must be continuous quality development.
Recommendations
To keep the quality of teacher in curriculum implementation, the teacher always:
1) Progress in developing quality and professional
2) Developing quality standard
3) Keep continuous quality development
References
Christy, W. N. (2012).Indonesian teachers score low on competency test: Big surprise?
www.detik.com.
Darling-Hammond, L. (2006). Constructing 21st-century teacher education. Journal of teacher education, Vol. 57, No. 3,
May/June 2006.
Haycock, K. (2001). Closing the achievement gap. Educational Leadership.
http://vvfww.ascd.org/readiagroom/edleâd/0103/ haycock.
Jalal, F. (2011).Vice minister of national education republic of Indonesia, ensuring equity in
education: Indonesian case.
Kementerian, P. N. (2012), Sertifikasi Guru Dalam Jabatan Tahun 2012.
BadanPengembanganSumberDayaManusiaPendidakandanPenjamin Mutu Pendidikan,
KementerianPendidikandanKebudayaan. Jakarta.
Ko, H. Y. (2003). A study of the construction of quality management system for elementary
and secondary school teachers in Taiwan. Unpublished master thesis, Institute of
Education of National Sun Yat-sen University, Taiwan.
Murphy, J. (1993). What’sin? And what’sout?American educationinthenineties. In PhiDelta
Kappa.
Ornstein, A.& Hunkins, F. (2009). Curriculum: Fondation, priciples and issues. USA: Person
Education Inc.
Peng, S. M. (1999). Basic quality standards and teacher cultivation for junior high school and
elementary school teachers. Teacher Quality and Evaluation Seminar, Department of
Education of National Kaohsiung Normal University, Taiwan.
132
Sanders, W. L.& Rivers, J.C. (1996). Cumulative and residual effects of teachers on future
student academic achievement. Research Progress Report. Knoxville: University of
Tennessee Value-Added Research and Assessment Centre.
Schneider, K. & Bugental, J. (2001). The handbook of humanistic psychology. California: age
Publication, Inc.
Sudarfiana. (2013). The role of professionalism teacher in education is needed. Proceeding
1stInternational Conference of Western Sulawesi University: Faculty of Social and
Political Science International Relation Department.
Varron. (2011).The elements of the teaching and learning
process.http://expertscolumn.com/content/element teaching and learning.
Wright, S. P., Horn, S. P. & Sanders, W. L. (1997). Teacher and classroom context effects
onstudent achievement: implications for teacher evaluation. Journal of Personnel
Evaluation in Education, 11(1), 57-67.
133
THE TEACHERS UNDERSTANDING ON 2013 CURRICULUM
IN APPLYING LEARNING MODEL ON SMKN 3 BANDA ACEH
Fadhilah Razali 1, Nurahimah Mohd Yusoff 2 and Rafisah Osman 3
1, 2, 3
College of ArtandSciences –UniversitiUtara Malaysia
Abstract
A plan or a pattern that is used as a guideline is a model of learning. Models of learning
refer to the learning approach used, for example in the management of class, the levels of
learning activities, and learning purposes. Models of learning refers to learning approaches that
will be used including the purposes of teaching, levels of learning activity, learning, and
classroom management. The learning activities conducted by the teacher to achieve the
effective and efficient, the teachers can use learning models in the learning process. Learning
model is a plan or pattern that can be used by the teacher in the classroom, the learning model
is the general pattern of learning behavior in achieving the expected learning in the
implementation of the curriculum in 2013. In order to establish an effective implementation of
the 2013 curriculum and teachers' understanding it should be reviewed using learning models
in SMKN 3 Banda Aceh. This study used a qualitative research case study approach, this
method aim to identify teachers' understanding of 2013 curriculum implementation
inVocational School (SMKN 3) Banda Aceh, purposive sampling used as the sampling method.
The respondents consisted of the principals, the teacher, staff, and student of SMKN 3 Banda
Aceh. Data collected by observation, interviews, document analysis. Data analysis on this study
used content analysis, the validity and reliability data implemented based on specific criteria,
as for the criteria used to verify that the data is done through credibility, transfer ability, depend
ability and confirm ability.
Keywords: The teacher understanding, curriculum implementation, learning model
Introduction
Curriculum 2013 in Indonesia created by each set or department of education and
school authority office under the coordination and supervision of education officers / officials
of the Religious department, curriculum 2013 is curriculum that its operations was developed
and implemented by the education department or school. Thus, this curriculum 2013 should be
prepared by the education department, then the implementation should involve teachers as well
as possible.Curriculum 2013 implementationin Indonesia's education system is not just the
exchange of curriculum, but is expected to change for the better in the Indonesian education
system. Curriculum 2013 implementation is also expected to achieve the learning objectives,
because the implementation of the new curriculum 2013 is expected to be a change in concepts,
methods, and strategies in the teaching of teachers. Another reason of developing curriculum
2013 is for elementary, junior high school, senior high school, and vocational school in
Indonesia is due to the prevailing curriculum, which is overcrowded and inefficient, many
materials are only burden the students and are not widely used in real life.
Curriculum 2013 is an increase in the competence-oriented attitude, skills, and
knowledge. According to the Department of Education (2013), the distinction of the old and
134
new curriculum is: the curriculum in 2006, has not been fully competency-based, competency
not describe a holistic manner, the domain of attitudes, knowledge and attitudes. Some
competencies are required as character education has not been accommodated in the
curriculum, and the curriculum in 2006 has not been sensitive towards social change. While
the Curriculum 2013 requires the addition of school hours. Changes in thelearningprocess
ofstudentstold ' to ' learnertofindout.Curriculum 2013 is as held in the school curriculum, the
National Curriculum of Indonesia is implemented by teachers. Mulyasa (2008) stated heyday
curriculum is determined by the teacher and Professor, because both of them are the ones that
define and drive the various dimensions of school expectations. This opinion is found to be
true also, due to the curriculum implementation in essense is the learning and teaching process,
which are the realization of a curriculum that has been designed and implemented.
Implementation of curriculum 2013 will manifest in the learning process so as to see the
impression of its implementation in the field is to look at the implementation of the process of
learning and teaching or learning activity which is essentially how the message and content of
the curriculum can be delivered to students. It is aligned with the opinion of Hasan (1984) that
stated implementation of the curriculum is an attempt to realize the curriculum is written into
reality.
According to Rusman (2009), the implementation of the curriculum is a form of
actualization of the curriculum that has been designed. The form of implementation of the
curriculum is that teachers do learning activities with students to achieve a predetermined
curriculum. Triumph of truth curriculum will be determined by the implementation of the
curriculum (learning) that is not in accordance with the design of the curriculum, so that would
lead to lack of achievement of objectives or competencies thathavebeen
set.Halaheadededucationproposed by UNESCO as learning to know, learning to do, learn to be
yourself, and learn to live in unity (learning to live together). Therefore, the implementation of
the curriculum should be controlled in a professional, effective and efficient, which refers to
the four elements and is consistent with the curriculum design which has awoken, so tattoos
cognitive, affective and real psychomotor in guidance (destination) can be realized through the
implementation of thecurriculum.A curriculumisexpected to lay the foundation, content and be
guide for the development of the learner at its optimum capability consistent with the purposes
of students, parents and the community (stakeholders). Teachers as curriculum implementers
who act as designers, implementers, and activatior in actual curriculum. Thus, the teacher is
the key holder and glory implementing curriculum, learning in the classroom is the place to
implement and test the curriculum. The undestanding of teachers upon the curriculum are tested
in the form of deeds that will be realized in the form of a real curriculum.Accordingto Hasan
(1984), there are several factors that affect the implementation of the curriculum, namely the
characteristics of curriculum, curriculum implementation strategy, valuation characteristics,
teacher knowledge of curriculum, attitudes toward the curriculum, and directing skills.
Meanwhile, according to Rusman (2009), there are five elements that affect the implementation
of the curriculum as follows: Professors support, support from colleague of teachers, students
support, parents support, and support from within the teacher itself is the main element.
In connection with the implementation of the curriculum in 2013 were built by the
development oriented personality (humanistic curriculum), which is oriented towards the
curriculum to life and the nature of work (reconstruction of social and technological).
135
Humanistic curriculum can be implemented in early education principles. Furthermore, the
curriculum is oriented to nature and nature of work, namely social reconstruction curriculum
and technology, combined with academic subject curriculum may be used in the mid and late
elementary education.
Implementation of curriculumdevelopment should put student creativity mastery over the
material. In this case, the student is as a subject in the learning process. Communication in
learning so that learning takes place it is necessary to develop cognitive thinking ability of
students to develop not only a mastery of the material. Moreover, learning should be woken up
thinking with an emphasis on students’ activity to analyze, seek understanding of the object,
thus forming new knowledge within the learner. Therefore, learning not only gives edicts, but
rather embodies surrounding that allows students to think creatively, critically and form of
knowledge.
According Syaodih (2001), the triumph of the curriculum relies heavily on teachers,
their shape or design as well as any curriculum can be implemented by the teacher if the teacher
has a curriculum interfaith understanding. Basic of curriculum if the teacher has the ability,
passion and dedication, the result will be better than the design of the curriculum, which cooked
up well, but the ability, low teacher morale and dedication. Educational resources such as
boarding another party organization, tools, infrastructures, surrounding are also a key
educational triumph. Thus, the teacher is the key to the triumph of curriculum implementation.
By costs, tools, limited infrastructure, creative teachers and dedicated, can develop activities,
programs and innovative learning tools.
To realize the implementation of the curriculum 2013 as learning systems that support
the system by those who reside and operate this system should also be deployed to thinking,
where the work is carried out by teachers and professors, if not done maximumly, will affect
the overall education system. It is very important, embed pattern of thought within the teachers
and professors because of those directly involved in the implementation of the curriculum 2013
subjects.
Understanding of teachers in the implementation of curriculum 2013
Teachers are the forefront of creating human resource qualities, as through a learning
process of teachers dealing directly with students in the classroom. In the hands of the student
teachers will be generated either quality of skilled, academic, emotional maturity and spiritual
morals. Therefore, it is required teachers who have high dedicatio, has eligibility, have
competence in carrying out professional dutie. Teachers need help to improve their skill for
face new challenges as curriculum implementers (Nurahimah & Rafisah, 2001).
Facing global era full of competition and uncertainty, requiring teachers visionary and
capable of managing the process of learning and teaching in an effective and innovative, is also
required changes in strategy learning model in such a way to provide pleasant conditions for
teachers and students. Something that is known by the term "quantum learning" and "teaching
quantum" in fact is developing a model of effective teaching and learning strategies in a
pleasant atmosphere.
The main task of the teacher is to educate, supervise students, instruct, train, guide and
evaluate the school. Nurahimah & Rafisah (2010) in his study states: teachers in schools is an
important asset in the national mission of education to deliver instruction more effectively so
as to be directed towards the creation of a world-class human capital.
136
The teaching profession is a specialized field of work carried out on the following
principles: a commitment to improving the quality of education, faith, piety and good character,
competencies required in accordance with the terms of reference, has the talent, passion,
enthusiasm and idealism, academic qualifications and background educational background
appropriate to the job, have the opportunity to continuously expand the profession of lifelong
learning, have responsibility for the performance of professionalism, a professional
organization that has the power to set things related to teacher professionalism job, income
determined in accordance with performance, with guaranteed protection of the law and perform
the duties of his profession (Kunandar, 2007).
Development or expansion of the teaching profession through the development of the
profession of lecturer held democratically committed themselves to upholding human rights,
religious values, cultural values, diversity of race fairness, not discrimination, and the code of
ethics of the profession (Law Number 14 Year 2005 concerning teacher and lecturer).
A teacher in carrying out its role as an instructor or things that teachers do is: able to
organize the teaching program for a specific time on a continuous basis. Preparing teaching
and learning & teaching activities planned for each study material will be taught in connection
with the use of a particular method. Setting tools can help learning activities & implementation
of effective teaching. Plan and provide an accurate assessment tool. Setting matters relating to
education is a school program. For example, instructional programs and teaching petukangan
fashion. Classroom setting conducive to learning. Set according to the student's seat capacity
and physical condition as well as the students focus on their studies.
The curriculum is expected to be implemented effectively and to improve the quality
of learning, teachers need to love teaching as a profession, like what is taught, understand and
master the basic competencies and other competencies that have to do with good,
understanding students, using different methods of teaching, follow recent developments, the
completion of the learning process, connect past experience with the competencies to
bedeveloped (Mulyasa, 2007).In therole of teachers in curriculum implementation activities
learning and teaching is a facilitator, the teacher claimed to have the attitude and confidence to
defend not excessive, so over hearing students, innovative ideas and creative students,
relationship with students more enhanced level of attention, can receive good comment positive
or negative and fault tolerance that made the students.
The successful implementation of the curriculum is determined by factors such as
teachers, when teachers do not perform a good job despite the good conditions of education,
the implementation of the curriculum (learning) is not satisfactory. The task of teachers and
head teachers not only teach only in school, as someone involved in the implementation of the
curriculum, teachers are required to have a broad understanding of and insight in the theory
and practice of, such as: have an understanding of the use of learning models.
Learning Models
Joice & Well (1980) stated that to choose a suitable and efficient learning can be done
by the teacher to achieve the purpose of learning, learning models can be used as patterns,
depiction of the activities of teachers and students in creating a learning environment called
learning patterns. Activities performed by teachers and students can be explained in learning
patterns. With this model of learning is a learning activity designed or constructed
withspecificlearningpatterns.A designor a pattern which is used as a guide to be regarded as a
137
model of learning. The learning model is referring to the learning approach used, for example
in the management class, the stages of learning activities, and learning goals (Arends, 1997).
Models of learning refers to learning approaches will be used including teaching objectives,
stages of learning activities, learning and management class.
In learning activities undertaken by teachers to achieve goals effectively and
memorable, the teacher may use instructional models in the learning process. The learning
model is a design or pattern that may be used by teachers in the classroom, learning model is a
general pattern of learning behavior in achieving the expected learning objectives to guide
lesson (Trianto, 2011).Using a learning model can help the teacher to have satisfaction in
teaching, understanding the teacher in using learning models indicate teachers have a certain
style of teaching. The results of the study showed that teachers have higher job satisfaction
does not feel overly stressed his deep using a particular teaching style, is precisely that the
teacher will have a commitment to the college profesion (Noriah, 2003).
Conclusion
The Glory of the implementation of the curriculum is determined by factors of teachers,
if teachers do not do their job properly in spite of the good condition of education, the
implementation of the curriculum (learning) is not satisfactory. The task of teachers and
professors not only teach only in school, as someone who is involved in the implementation of
the curriculum, teachers are required to have a broad understanding and knowledge in theory
and practical namely, such as: to have understanding in the use of learning models on
implementingCurriculum 2013.In theimplementation of the curriculum in 2013 at SMKN 3
Banda Aceh, to achieve the goals of teachers are expected to have an understanding in using
the leaning models, so that teachers can apply classroom learning process according to the
material being taught, on the other hand the use of learning models. It can known levels of
ability of teachers to implement the curriculum 2013 as designed.
References
Arends, R. (2008). Learning to teach. NewYork: McGraw-HillCompanies.
Departemen Pendidikan Nasional. (2008). Model-model pembelajaran SMK. Jakarta:
Direktorat Pembinaan Sekolah Menengah Kejuruan.
Enco, M. (2007). Kurikulum tingkat satuan pendidikan sebuah panduan praktis. Bandung:
Remaja Rosdakarya.
Enco, M. (2008). Pelaksanaan kurikulum tingkat satuan pendidikan. Jakarta: PT. Bumi
Aksara.
Hamid, H. (1984). An evaluation of the general senior secondary social studies curriculum
implementationin Bandung Municipality.Ph.D. Thesis. Sidney: Macquarie University.
Ishak, N. M. & Mohammad, N. S. (2003). Kesan interaksi antara gaya pertautan, gaya
pengajaran dan komitmen terhadap profesyen keguruan. Jurnal Pendidikan. 28. UKM
Bangi Selangor. DE. Malaysia.
Joyce, B. & Weil, M. (1980). Model of teaching englewood cliffts. NJ: Prentice-HallInc.
Kunandar. (2007). Guru profesional dan pelaksanaan KTSP. Jakarta: PT. Rajawali Persada.
Rusman. (2009). Manajemen kurikulum. Jakarta: PT. Raja Grafindo Persada.
Syaodih, S. N. (2004). Pengembangan kurikulum teori dan praktek. Bandung: Remaja
Rosdakarya.
138
Trianto. (2011). Model pembelajaran terpadu. Jakarta: PT. Bumi Aksara.
Yusoff, N. M., &Osman, R. (2001). Penyeliaan Pengajaran. Pusat sumber pendidikan Negeri
Kedah Darul Aman. Jurnal Wawasan. 15(2) Desember 2001.
Yusoff, N. M., &Osman, R. (2010). Hubungan kualiti penyeliaan pengajaran dan
pembelajaran di bilik darjah dengan efikasi guru. Journal of Educators and Education.
25, 53-71. Asia fasifik.
139
LEARNING OUTCOMES AND STUDENTS’ PERCEPTION TOWARD
EDMODO LEARNING PLATFORM
Salubsri Charoenwet
Suratpittaya School SuratThani
Abstract
An online application Edmodo was used to activate supplementary learning for Thai
students in a biology class. Learning community in Edmodo social network was established
based on computer-supported collaborative learning (CSCL) platform where students can share
their ideas, following up with class assignments and take provided quizzes. The aim of this
study was to investigate the learning outcomes and students’ perception toward learning
setting. Participants were Grade 12 students and the learning content was Biodiversity.
Students were to attend face to face traditional class and sign up for extra online activity.
Assignments and quizzes were supplemented for students to catch up with the contents via
online Edmodo network. Students were required to work collaboratively on the assignments,
take quizzes and the unit test. Online scores as well as paper based score were collected and
analyzed. Self- reported survey questionnaire was administered at the end of the unit to
examine perception of students participating in learning network. The statistical analysis
revealed that learning outcomes of students participating in online collaborative network
significantly improved while students showed positive perception towards the learning
platform.
Keywords: Edmodo, CSCL, Learning network, Learning outcomes, Students’ perception
Introduction
The development of advanced information and communication technologies (ICT) has
led to computer application in education such as e-mail, chat room, video conference,
discussion forum and learning management system. These technologies become potentially
useful tools to enhance effective learning environment for students while the benefits of ICT
in moderating positive effects on students’ learning have also been regularly reported.Current
applications such as gadgets compatible with smart phones are developed to support trendy life
style for daily use. Likewise, these applications are also available and become potential tool
for educational purposes. And hence learning can occur anytime anywhere.
A new concept of learning is recognized by researchers and theorists that learning is
not only cognitive but also a social cultural and interpersonal constructive process. Instructional
strategies such as collaborative learning are increasingly used in educational setting to create
interaction among students. In a collaborative learning environment, students work together in
groups, exchange ideas and share experiences to achieve group solutions for complex
problems, hence build up knowledge. Obviously, positive effects of collaborative learning have
been well documented by researchers that it enhances students’ cognitive performance and
stimulates students to engage in knowledge construction. The process of collaboration can be
effectively accelerated by the use of technology.
A combination of ICT application and collaborative learning results in a new field of
educational design; computer-supported collaborative learning (CSCL) which deals with issues
concerning collaboration, learning processes, and the use of computer-mediated
communication (CMC). The primary aim of CSCL is to provide an environment that supports
collaboration between students and enhance learning processes. CSCL offers specific tools that
140
facilitate sharing of information and ideas, as well as the distribution of expertise among group
members. When students collaborate in a CSCL setting, they use an application to
communicate with group members in form of synchronous; a chat facility and video
conferencing, or asynchronous; a discussion forum and e-mail.
Research involving implementing of CSCL in educational setting has been increasingly
paid attention to in recent years. The findings indicate that CSCL environments offer a medium
for classroom discussion that possibly facilitates participation and social interaction among
students, hence providing more effective interaction and participation than in traditional
classroom setting. Several studies have reported the benefits of CSCL in facilitating task
oriented and reflective activity, complex reasoning and argumentation, critical thinking and
authentic proof activity.
The potential of learning via computer is greatly improved when social media like
Facebook and Twitter were used as communicating channel amongst users. These types of
social network simply allow people to connect with others for general purposes i.e. sharing
information. In an educational setting, appropriate use of these tools can encourage
collaboration, sharing of resources, transmitting new ideas, and the virtual expansion of
classroom walls. The website edmodo.com was created in 2008 by Nic Borg and Jeff
O'Hara especially for educational purposes. The goal of Edmodo is to help educators harness
the power of social media to allow easy customization of the classroom. Edmodo is used by
approximately 32 million people including teachers, educators and students around the world
in various fields of subjects and learners’ grades. The main objective of Edmodo network is
about teaching and learning amongst students and teachers. Besides, sharing ideas in teaching
methodology, materials as well as collaboration is also encouraged for network members.
Unlike other social media community, Edmodo generally focuses on helping teachers and
educators along with learners to manage their own strategies in working online regarding the
tasks. Most teachers find Edomodo useful and challenging for outside classroom activities to
help students learned regardless of space and time constraints. Moreover, different versions of
Edmodo application are also available to be downloaded for small gadgets i.e. smart phone,
tablet and other hand devices. That makes the possibility of accessing virtual classroom even
greater and hence, positively affects the learning outcomes of students in the learning network.
This study reports results of the investigation into CSCL setting under Edmodo learning
network and its effect on learning performance and perception of students participating in the
network activities. Learning performance of students participating in Edmodo learning network
was determined by test scores on the unit of Biodiversity whereas students’ perception was
examined through self-reported survey questionnaires.
Research Methodology
Participants and setting
117 of Grades 12 students in biology class from Suratpittaya secondary schools in
Thailand took part as distributed learners in Edmodo learning network. The main objective of
learning was about Biodiversity. The resources and learning materials, assignments quizzes as
well as tests were available on provided learning platform and communication among
participants was facilitated through instruction under Edmodo network system. While students
were engaged in learning activities, the development of network was monitored through
participation and collaboration among participants. Pretest and posttest were used for data
analysis to determine students’ learning outcomes. The results from self-reported survey
questionnaires were investigated to examine students’ perception.
141
Procedure and task
Students participating in the learning procedure were required to sign up for online
virtual classroom on the website: http:///www.edmodo.com.Registered students were then
divided into small groups, with the selected head of each group. They were also required to
study the manual of network protocols and were anticipated to regulate their own strategies of
learning in each session. Leaning activities included three main sessions i.e. lectures,
assignments and quizzes. Students were to follow up lecture notes with power point slides and
also to collaborate on given assignments. After that the unit test was administered to evaluate
students’ learning performance.
During the learning process, students were encouraged to contact the teacher as well as
other network members for sharing ideas and catching up with tasks and quizzes. Basically,
students worked both in group and individually. The group task resulted from learning
activities were uploaded and shared for constructive comments. Prior to the beginning of online
learning students were asked to take the pretest and later, after the program ended, the posttest
was similarly carried out. Self-reported survey questionnaires were also distributed by the end
of learning activities in Edmodo network to examine students’ perception.
Measure and Data analysis
The unit test of Biodiversity was done prior to and after the end of learning session. A selfreported survey questionnaire with 5-points Likert scale was used to examine students’ perception. The
questionnaire consisted of 16 items in two sessions i.e. learning platform and learning environment,
adapted from the studies of Tseng, Chiang & Hsu, (2008), Liaw et al. with Cronbach α 0.93. Pretest
and posttest results from unit test and the posttest of students’ perception questionnaires were
quantitatively analyzed using SPSS version 15 software.
Results
1) The unit test score analysis
Table 1 Pretest and posttest mean score of the unit test
Score
Pretest
Posttest
Mean (60)
35.09
48.73
Percentage
58.43
81.23
Table 2 T-test analysis of pretest and posttest mean score of the unit test
Score
Pretest
Posttest
Mean
35.09
48.73
S.D.
7.19
5.90
13.51*
P< 0.05
The average percentage retest and posttest score were presented in Table 1 with the
percentage of 58.43 for the pretest and 81.23 for the posttest. The results from paired sample ttest of SPSS analysis show that the posttest mean score of the unit test is significantly higher
than the pretest mean score t(117)=13.51, p<0.05 with the mean score of pretest and posttest
35.09 (SD=7.19) and 48.73 (SD=5.90) respectively as shown in Table 2.
142
2) Students’ self-reported questionnaire analysis
Table 3Students’ perceptiontoward participating in Edmodo learning network
No.
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
Items
The network system is suitable for learning
The platform is user friendly
Edmodois suitable for different learning styles
Students like to learning via Edmodo
Satisfaction and realization of benefits gained
The program is good for cooperative learning
Students can share ideas working with others
Edmodo supports group learning
Communicating with others help students to learn
There is a sense of belonging in a group
Edmodo induces autonomous learning
Activities help students feel as a part of the group
Increasing of problem solving skill
Students are motivated to learn via Edmodo
Edmodo helps students to improve thinking skill
Learning is an integration of various set of skills
Mean
Mean
4.10
3.78
4.08
3.78
3.90
3.88
3.80
4.08
4.15
4.28
3.93
4.25
3.75
3.60
3.75
4.20
3.95
SD
1.02
0.75
0.91
0.65
0.72
0.78
0.65
0.83
0.88
0.99
0.80
0.99
0.78
0.68
0.96
1.00
0.82
The results of self-reported survey questionnaire from the studied group are presented
in Table 3. Over all mean score of students’ perception is 3.95 (SD=0.82).
Discussion
Results of from statistical analysis indicate positive effect of learning on students’
performance. The findings are in accordance with previous studies reported by teachers who
implemented using Edmodo in the classroom for online or blended learning. Edmodo was used
as learning tool to engage grade 6 students in a writing class to improve students’ achievement.
It is found that students who participated in Edmodo initially scored higher and it also showed
positive effect of Edmodo not only on students’ achievement but also on learning engagement
and students’ behavior. Similar findings are reported in researches conducted by Penwell.
Edmodo is a free online learning management system that provides a private virtual
space for students and teachers to share and discuss text, images, audio, and video. It has
become a popular platform used in primary and secondary schools as well as universities.
Edmodo network is an initial place where class activity takes place. It is also assumed that if
students are able to sign in and participate in Edmodo learning network, they have the digital
literacy skills necessary for the 21 century learning competency as required in National
Standard.
A significant aspect to this application is the establishment of student collaboration in
the network learning community. Edmodo is recommended as an advantageous tool for specific
kinds of writing tasks to allow students to interact and this sort of personal interaction with
literary texts encourages discussion and feedback from fellow students as well as from the
teachers. Besides, discussion among group members facilitated by text and social interaction
can increase comprehension, thinking skills and self-directed response of students participating
in the social network. Students from studied groups perceive the learning platform in Edmodo
social network with positive effect i.e. the average score of 3.95. Overall mean score of
143
students’ perception in a study conducted by Tseng et al. is 3.89. Generally students’ perception
obtained from students participating in learning activities in this study, is considered satisfying.
Edmodo is a simple, easy-to-use, multi-platform learning management system that
provides useful tools for students and teachers to interact online outside of class. It is accessible
via web browser and/or a free smartphone application (iOS and Android). The user interface,
common to all platforms, is simple and intuitive—similar to that of social networking sites
such as Facebook. Edmodo is also a safe way for teachers and students to use Internet in their
classrooms. One reason that possibly leads to positive effect students’ perception is due to
friendly features of human-computer interface based on well-established network system with
actively updated information. These Webpage features are in accordance with TAMTechnology Accepted Model and hence cause perceive of usefulness among users.
In summary, the investigation into Edmodo learning network provides initial
information regarding effect of learning platform and students’ perception to some extent.
Although learning process in this network is group collaboration, the effectiveness of
collaborative process resulted from enriched learning setting is apparently observed in an
individual through learning outcomes and their perception. Further studies are essential to
reveal more about the effect of social interaction in other aspects in order that the effectiveness
of learning process in CSCL environment is possibly established.
References
Cohen, A. & Scardamalia, M. (1998). Discourse about ideas: monitoring and regulating in
face-to-face and computer-mediated environments, Interactive Learning
Environments, pp.93-113.
Davis,F., Bagozzi, R.& Warsaw, P. (1989). User acceptance of computer technology: a
comparison of two theoretical models.Management Science, pp. 983-1003.
Edmodo. (2014). Retrieved March 8, 2014, fromhttp://www.edmodo.com.
Fletcher-Flinn, C. & Gravatt, B. (1995). The efficacy of computer assisted instruction (CAI):
a meta-analysis, Journal of Educational Computing Research, pp.219–241.
Kreijns, K., Kirschner, P. & Jochems, W. (2003). Identifying the pitfalls for social interaction
in computer-supported collaborative learning environments: a review of the research,
Computers in Human Behavior, pp. 335–353.
Liaw, S., Huang, H. & Chen, G. (2007). Surveying instructor and learner attitudes toward elearning, Computer & Education, pp. 1066-1080.
Lipponen, L., Rahikainn, M.,Lallimo, J. &Hakkarainen, K. (2003). Patterns of participation
and discourse in elementary students' computer-supported collaborative learning,
Learning and Instruction, pp. 487-509, 2003.
Luechefeld,S. (2013).The use of edmodo will increase students’ achievement by increasing
student engagement and decreasing negative behaviors.Retrieved March 18, 2014,
from http://prezi.com/pqbl4xzhi72_/are-action-research-project/.
Ministry of Education. Basic Education 2551,2008.
Öner, D. (2008). Supporting students’ participation in authentic proof activities in computer
supported collaborative learning (CSCL) environments, International Journal of
Computer-Supported Collaborative Learning, pp. 343-359.
Penwell, T. (2011). The Impact of an Educational Social Network (Edmodo) On The
Learning Community Retrieved March 8, 2014, from http://edu316-324306spr11.wikispaces.com/.
Salomon, G. & Perkins, D. (1998). Individual and social aspects of learning, Review of
research in education, pp. 1–24.
144
Stahl, G. (2004). Building collaborative knowing: Elements of a social theory of CSCL ‘What
we know about CSCL, and implementing it in higher education?, pp. 53–85.
Sweeney, S.M. (2010). Writing for the instant messaging and text messaging generation:
using new literacies to support writing instruction. Journal of Adolescent &Adult
Literacy, 54(2), 121-130.
Tseng, K., Chiang, F. & Hsu, W. (2008). Interactive processes and learning attitudes in a
web-based problem-based learning (PBL) platform, Computers in Human Behavior,
pp. 940-955
Wallace, R., Pearman, C., Hail, C. & Hurst, B. (2007). Writing for comprehension. Reading
Horizons, 48(1), 41-56
145
DETERMINING THE BEST PREDICTORS OF A PHILIPPINE
UNIVERSITY NEW GRADUATES’ PERFORMANCES IN
THE LICENSURE EXAMINATION FOR TEACHERS (LET):
TOWARDS REVIEW PROGRAM INTERVENTIONS
Roel V. Avila 1and Edgardo S. Villaseñor 2
1, 2
Philippine Normal University South Luzon Campus, Lopez, Quezon
Abstract
This research investigation focuses on determining the best predictors of a Philippine
university graduates’ performances in the Licensure Examination for Teachers (LET) that aims
to advance review program interventions. Using the descriptive-comparative-correlational and
qualitative methods, this study counted on scholastic records of the passers of LET 2012, 2013
and 2014 and the data from the faculty with the aid of data-gathering and interview guides.
This research found that LET results significantly correlate with the results of each of the
predictors; the best predictor was the Pre-Board (2012-2014) whose respective means were
nearest to the LET means, their values of z were closest and the values of r were highest; the
existing programs related to the given predictors were independent of the LET Review
Program; the interventions were concerned with faculty teaching effectiveness, faculty’s and
students’ preferred teaching/review strategy, and the review program itself. After triangulating
the data from multiple sources, conclusions include: the new graduates’ recorded LET
performances were very much higher than the national passing rate for the last three years;
there is a strong correlation between the LET results and the given predictors; the ranking of
the results of those tests showed that the said tests were predictive of the LET results with the
Pre-Board emerging as the best predictor; there were existing programs related to the review
but they lacked cohesion and concentration; the faculty’s perceived teaching effectiveness,
thefaculty’s and the students’ commonly preferred teaching/LET review strategies, and the
existing LET review programs were the considerations of the interventions applied to the
predictors yetthe foci of interventions were disconnected. Recommendations toward raising
students’ academic performance are forwarded.
Keywords: Licensure Examination for Teachers; Graduates’ Performance; Review Program
Interventions
Introduction
Ushering hopefuls into the threshold of pedagogy entails foresight. It is because the
new teachers shall do the same when their turn comes. Pedagogy ensures the educational
qualifications of the students and future professionals as benchmarked to global standards
(Manzala, 2013). Producing globally competitive teachers out of rural kids is not impossibility.
The Ministries of Education in Southeast Asia have tried to bring improvement and change in
teacher education that will enable more creative learning and innovative teaching (PascuaValenzuela, 2013), and thereby produce teachers of international calibre. And before effecting
creative learning and innovative teaching, entering into the portico of pedagogy comes first.
146
Teacher Education Institutions (TEIs) want improvement of institutional LET
performances based on legal mandate and societal expectations. Passing the LETis mandated
by Republic Act 7836 or Philippine Teachers Professionalization Act of 1994.
Leaders of TEIs continually assess the LET performances of their graduates (Pasumbal
& Salvacion, 2004; Lozarita, Acledan, & Flores, 2009; Garcia, 2013; Espino, Roman &
Magno, 2011) in order to answer the question of quality. The TEIs’ dilemma is rooted on what
Ibe (1995) revealed, “majority of students who expressed preference to teaching belonged to
the lowest 30 percentiles”. Real change begins when mentors transform these rural kids into
globally competitive teachers.
The LET aptly measures teachers’ theoretical competence, regardless of whether the
teachers rose from the nadir of academically disadvantaged society or not. “Theory of Teacher
Competence, the ability, over time, to relate oneself both to the expectancies and demands of
society, as well as to one’s own qualifications or conditions” as Garbarino & Scott (2014)
expounded, can fortify the academic foundation based on the foreknowledge of future
performances.
The PNU Research Agenda 2013-2015, in its Key Research Topics, includes LET as
predictor of teaching performance. This study aims to complement by reversing the process.
Like teaching performance, other predictors of LET results have been parts of the
academic programs of TEIs for years. The predictors’ potentials are waiting to be tapped to
give the faculty and the students the leeway to examine the interventions. With LET having its
predictors, this study postulates that the interventions to be made can narrow down the gap
between the LET result and its predictive valuations. Communicating results to other teachertraining institutions here and abroad is already an evidence of effecting change in teacher
education to enable more creative learning and innovative teaching. Hence, this study was
conceptualized.
Objectives
This study wanted to determine the best LET predictors as the foci of program
interventions for the benefit of the new graduates of PNU South Luzon Campus.
Specifically, it sought answers to the following questions:
1) What are the subjects’ corresponding performances during the September 2012,
September 2013, and August 2014 LET vis-à-vis the national passing rate?
2) Does LET result significantly correlate with each of the following predictors:
a. College Grade Point Average (GPA),
b. Leaving Examination (LE), and
c. Pre-Board (PB)?
3) Which among the given variables is the best predictor of the subjects’ LET
performances?
4) What are the existing programs related to the enumerated LET predictors?
5) What interventions may be applied to the predictors considering:
a. Faculty’s perceived teaching effectiveness,
b. Faculty’s and students’ commonly preferred teaching/LET review strategies,
c. The existing LET review program?
Hypotheses
The researchers hypothesized that:
1) LET results significantly correlate with each of the given predictors.
147
2) The Pre-Board, having the highest predictive value, is the best LET predictor.
Intervention
s
Social
Cognitive
Theory
(Bandura,
1986)
Grade
Point Ave.
Leaving
Exam
Pre-Board
Teacher
Competenc
e
(Garbarino
& Scott,
1992)
LET
Predictors
Improved LET Performances
Figure 1. The Theoretical Paradigm
Research Methodology
Using the descriptive-comparative-correlational and qualitative methods, this study
counted on the scholastic records of the passers of LET 2012-2014 and the data from the
faculty, the students, and the alumni with the aid of data-gathering, interview and focus group
discussion (FGD) guides.
Sources of Data
The data were based on the Grade-Point Averages (GPAs) of 65 out of 126 passers, 66
out of 109 passers, and 89 out of 170 passers from 2012, 2013, and 2014 Batches of BEED
graduates, respectively. The subjects were randomly selected using the odd-even scheme. The
subjects’ results of Leaving Examination and Pre-Board, along with GPAs were placed side by
side with their LET performances (provided by the PRC) with focus on General Education and
Professional Education components. The researchers triangulated the qualitative data from the
faculty, the selected students, and the alumni.
Instruments
The research instruments included the 1) Data-Gathering Guide, 2) Interview Guide,
and 3) Focus Group Discussion Guide, using the revised version of (Ochave & Suatengco,
2007).
Data Gathering Procedure
As to the GPA data, the researchers requested for the soft copy of the Transcripts of
Records from the Office of the University Registrar. The Leaving Examination and the PreBoard data were provided by the LET coordinator. The faculty members gave the qualitative
data during the Faculty Opening Conference while the graduates yielded data on the teaching
strategies and LET programs through individual interviews either face-to-face (individual and
148
focus group discussions) or via social media. Upon formal request, the Philippine Regulation
Commission (PRC) shared the researchers the LET results.
Results and Discussion
1) Subjects’ LET performances. In 2012 (September), 126 out of 150 LET-takers or
84% passed the examination, much higher than the national passing rate of 49.29%. In 2013
(September), 109 out of 134 examinees or 81.34% successfully passed and three of them made
it to the top ten, two of them were 6th placer and one was 10th placer. PRC registered 31.18%
as the national passing rate. In 2014 (August), 170 or 84.47% of the new BEED graduates were
proclaimed new teachers while the national passing rate was 35.74%. This was highlighted by
one of them who landed to the top 6. Table 1 contains all these data showing how PNU SL
performance fared with the national passing rate.
Table 1. LET Performances of the PNU-SL New Graduates in the Last Three Years
Batch
No. of
PNU-SL
National Difference Interp.
PNU-SL
Institutional Performance
Passing
LET
Rate
Passers
2012
126
84%
49.29%
34.71%
MH
2013
109
81.34% plus two 6th placers; one 10th placer
31.18%
50.16%
VMH
2014
170
84.47% plus one 6th placer
35.74%
48.73%
VMH
Average 83.27%
38.74%
44.53%
VMH
Legend: Difference of +0.01% to 20.00% = Moderately Higher (MoH); 20.01% to 40.00% (MuH) =
Much Higher; 40.01% or above = Very Much Higher (VMH)
The national passing rate has become a point of reference for the TEIs as they strive to
surpass it every year (Pasumbal & Salvacion, 2004; Bilbao & Dequilla, 2013; Obra, 2013). In
the case of PNU SL Campus, its average of 83.27% for three years has consistently surpassed
the average national passing rate of 38.74%. The difference of 44.53% means that the students
had recorded LET performances very much higher than the national passing rate for the last
three years. Having four of its graduates making it to the top ten is an indicator of academic
excellence.
2) Relations between LET Results and Predictors. The data show that the respective
LET results significantly correlate with the GPA of Batch 2012 (r = 0.57), Batch 2013 (r =
0.63), and Batch 2014 (r = 0.68), respectively; the same LET results significantly correlate with
the Leaving Examination (LE) taken by Batch 2012 (r = 0.50), Batch 2013 (r = 0.72), and Batch
2014 (r = 0.76), respectively; and such LET results significantly correlate with the Pre-Board
results, for Batch 2012 (r = 0.55), Batch 2013 (r = 0.78), and Batch 2014 (r = 0.79),
respectively. Such relations are shown in Table 2.
149
Table 2. Correlation with LET Results and the Predictors in the Last 3 Years
PREDICTOR
2012
Mean
87
79
73
79
76
79
R
Int.
2013
Mean
88
79
73
79
75
79
r
Int
2014
Mean
88
80
72
80
76
80
r
Int
Ave Over-all
r
Int.
0.63
SR
GPA
0.57
MR
0.63
SR
0.68
SR
LET
(t=5.55)
(t=6.51)
(t=8.65)
LE
0.50
MR
0.72
SR
0.76
SR 0.66
SR
LET
(t=5.20)
(t=8.27)
(t=10.87)
PB
0.55
MR
0.78
SR
0.79
SR 0.71
SR
LET
(t=5.29)
(t=9.89)
(t=11.99)
Ave. r
0.54
MR
0.71
SR
0.74
SR 0.66
SR
Legend: GPA=Grade-Point Average; LET=Licensure Examination for Teachers; PB=Pre-Board;
r=Relationship (Pearson); t=t-test (used to check r’s significance); Int. =Interpretation; MR=Moderate
Relationship; SR=Strong Relationship; Ave. r=Average Relationship
The average r for the GPA (0.63), LE (0.66), and PB (0.71) and the average r for 2012
predictors (0.54), 2013 predictors (0.71), and 2014 predictors (0.74) both yielded the average
of 0.66 which is qualitatively interpreted as Strong Relationship. The data concurred with the
findings of Arenillo & Arenillo (2008) “Results indicated that respondents manifested better
performance in pre-service education compared to their performance in LET. Analysis of data
further showed that the performance in pre-service education of respondents was significantly
correlated with their performance in LET in terms of general education and professional
education.” Lozarita, Acledan, & Flores (2009) agreed that academic achievement has a
significant relationship to LET performance. There is a strong correlation between the LET
results and the predictors during the past three consecutive years.
3) Best LET Predictors. Pre-Board consistently registered the means closest to the
LET means for three consecutive years (with the computed z of -7.43, -7.62, and -8.85) for
2012, 2013, and 2014, respectively. Ranked second is the Leaving Examination with the zof 17.16, -15.30, and -26.82. The Grade Point Average is ranked last with the z 35.84 for 2012,
39.61 for 2013, 46.98 for 2014. The same pattern was notable on the predictive value with the
PB garnering the highest predictive potential (+4, +4, +3). The Leaving Examination was
ranked second with the following predictive values: +8, +6, and +8. The GPA was ranked last
with -8, -9, and -8.
The means of all predictors during the last three years significantly differ with their
respective LET means. The goal of PNU-SL now is to narrow down those gaps until their
means meet at the space LET, made here as assumed mean and being the litmus test of
performance, occupies. Garcia (2013) found out that “Academic performance (grade average)
of examinees gives no assurance (not a determinant) on passing PRC (LET) examination.”
GPA is a predictor but not a determinant. The predictive value works on this wise, say, Student
A who belongs to Batch 2014, had registered the following performances: GPA = 89, LE = 72,
PB = 75. In order to predict her LET Result, any of these three may be used, as: GPA = 89 – 8
= 81%; LE = 72 + 8 =80%; PB = 75 + 4 = 79%. In this example, Pre-Board, with its predictive
value of +4, got it right because Student A really got the LET Rating of 79%. Here is the
summary table of the predictors’ predictive values by year.
150
Table 3a presents the data as bases of determining the best predictor of the subjects’
performances in the licensure examination.
Table 3a. The Best Predictor of the Subjects’ LET Performances
Year
2012
2013
Predictor &
LET (Mean)
PB = 76
LET = 79
LE = 73
LET = 79
GPA = 87
LET = 79
PB = 75
LET = 79
LE = 73
LET = 79
GPA = 88
LET = 79
Difference
(z)
-7.43
Int.
Rank
Int.
Rank
1
Predictive
Value
+4
Significant
HP
1
-17.16
Significant
2
+8
MP
2
35.84
Significant
3
-8
MP
3
-7.62
Significant
1
+4
HP
1
-15.30
Significant
2
+6
MP
2
39.61
Significant
3
-9
MP
3
2014
PB = 76
-8.85
Significant
1
+3
HP
1
LET = 80
LE = 72
-26.82
Significant
2
+8
MP
2
LET = 80
GPA = 88
46.98
Significant
3
-8
MP
3
LET = 80
Legend: z=computed z; Int. =Interpretation; PB=Pre-Board; LE=Leaving Examination; GPA=GradePoint Average; HP=Highly Predictive; MP=Moderately Predictive
Table 3b records the predictors’ predictive values by year with focus on the LET
components for Bachelor of Elementary Education (BEED).
Table 3b. Predictors’ Predictive Values by Year with Focus on LET Components for BEED
Year
Predictive Value
PB
LE
GPA
GE
PE
AVE
GE
PE
AVE
GE
PE
AVE
2012
7
2
4
9
8
8
-7
-8
-8
2013
6
2
4
3
8
6
-9
-9
-9
2014
4
2
3
7
8
8
-8
-8
-8
Total
17
6
11
19
24
22
-24
-25
-25
Average
+6
+2
+4
+6
+8
+7
-8
-8
-8
Legend: GPA=Grade Point Average; LE=Leaving Examination; PB=Pre-Board; GE=General
Education; PE=Professional Education; AVE=Average
The study of Marpa & Guanzon (2014) yielded the same result, though they only
included PNUAT as a predictor along with GPA which, they found, both significantly predict
performance of graduates in the LET. In the present study, Pre-Board is much better than GPA
as predictor.
151
As to the GPA, the General Education and the Professional Education courses can
evenly predict the LET results, with -8 (Moderately Predictive) as the subtrahend and the GPA
as the minuend. In the case of the Leaving Examination (LE), the GE has higher predictive
value (+6) compared to PE’s predictive value (+8). Considered better predictor compared to
GPA, LE has the value of +7. In the Pre-Board (PB), Professional Education (PE) can highly
predict LET results (+2) compared to General Education (GE) which has the value of +6
(Moderately Predictive). Their average (+4) is highly predictive enough of the LET results.
4) Existing Programs Related to the LET Predictors. As to Second Semester/Third
Trimester, 2014-2015, the existing programs related to the given LET predictors are: 1)
Homeroom/SG-Based; 2) Faculty-Initiated/Research-Enhanced; 3) Online Review; 4)
Organization-Based Academic Competitions; 5) Leaving Examination; 6) Summer LET
Review with Pre-Board. Table 4 presents the brief description of each existing program.
Table 4. The Existing LET Review Programs Related to the Given Predictors
Predictor
1.Grade Point
Average
Existing LET Review
Program
1a. Homeroom/SGBased
1b. Faculty-Initiated/
Research-Enhanced
1c. Online
2.Leaving
Examination
3.Pre-Board
1d. Organization-Based
Academic Competitions/
2. Leaving Examination
3a. Summer LET
Review
3b. Top The Test (T3)
3c. Top The Test: PNU
SL Experience
Brief Description
A continuing program of the Student Government in
coordination with Homeroom Classes held every
Wednesday afternoon
Integrating LET review in academic lessons including
research courses.
Creation of fb/Edmodo accounts; use of social media;
membership to online review groups; use of downloadable
LET review materials
Using potential LET items during Quiz Bee Tilts
(Individual and Group)
Given by the LET Coordinator after the Final Examination
and after the Internship Program
The most comprehensive and rigid LET Review Activity
held during Summer (May/April) for the fresh graduates
culminating into the Pre-Board Examination
T3 is only given to 2-3 privileged graduates; An annual
program of the PNU system that gathers the best new
graduates to a secluded but conducive place
A review offered only to the 25 to 30 academically-inclined
students who are facilitated by 2 or 3 graduates using the
materials from the T3.
The enumeration of the LET review programs and their descriptions revealed that these
programs were not under an umbrella program, rather, they are sporadic, thereby lacking
cohesion. These programs, likewise, need periodic assessments.
5) Interventions on LET Preparations. The inputs given by both the faculty, the
students, and the alumni of PNU SL Campus are categorized in terms of the type of the
predictors. Such inputs comprise the interventions addressed to each predictor.
a. Interventions on Faculty’s perceived teaching effectiveness. Included in the
faculty’s perception were the variables perceived to be affecting teaching effectiveness, faculty
self-rating, and their perceived best LET predictors. Table 5 contains the interventions on the
faculty’s perceived teaching effectiveness.
152
Quality of high school education ideally blends with students’ uniqueness to rise above
societal expectations. These past three years, a new pattern has emerged that the type of school
does not influence the institutional performance of TEIs in terms of passing percentage in LET
(Obra, 2013). Notable is the inclusion of a remarkable number of graduates from provincial
tertiary schools and campuses in the top ten (PRC, 2013). This claim favors student’s
uniqueness and personal efforts. For the PNUSL faculty, teaching effectiveness overshadows
student’s personal efforts.
Table 5a. Interventions on the Faculty’s Perceived Teaching Effectiveness
Faculty’s Perceived Teaching Effectiveness
a. Variables Perceived as
.Quality of High School Education
Affecting Teaching
.Student’s Uniqueness
Effectiveness
.Teaching Experiences
.Subjects Taught by Specialists
.Teaching Strategies Faculty Utilize
.Students’ Preferred Teaching Strategies
Intervention
Development of a
Rubric for
Quantification
b. Faculty Self-Rating
Very Satisfactory
Making it ‘Excellent’
c. Perceived Best LET
Predictor
First Three Predictors:
1. Mentors’ Teaching Effectiveness
2. Students’ Personal Efforts
3. Grade Point Average
To connect GPA to
LE and PB
What the mentors must do is to do away with the mismatch between professors’
instructional methodology and students’ preferences (Ochave & Suatengco, 2007). This
strengthens the claim that GPA is one of the best predictors and substantiates the Theory of
Teacher Competence by Garbarino & Scott (2014). Espino, Roman, & Magno (2011)
emphasized that performance in the licensure examination was related to teaching
performance. Teaching effectiveness affects the GPA. Leaving Exam and Pre-Board are
outgrowth of College Grade Point Average.
b. Interventions on Faculty’s and Students’ Preferred Teaching/LET Review
Strategies. Faculty members enjoyed utilizing the hybrid of teaching strategies such as
Cooperative Learning, Open Discussion, and Lecture. Learners chose to work in groups and
enjoyed Group Presentation, Group Activity, and Open Discussions. The alumni still savoured
Cooperative Learning, Collaborative Learning, and Group Rationalization. The meeting of the
faculty, students, and alumni on the common ground insofar as the preference of teaching
strategies is made here as an intervention.
The learners reject lecture as the lone teaching strategy. They want interaction and
group work. Bandura (1986), explaining his Social Cognitive Theory, describes human as
dynamic, information processing, problem-solving, and above all, social organisms. He
elaborated, “Whether we learn from direct experience or from vicarious experience, most of
our learning usually involves other people in a social setting. It is on the basis of our
observations and interactions with other people that our cognitions, including our standards for
performance and for moral judgment, are developed.”
The value of lecture has been proven for many years. Used before the right group at the
right time, lecture yields the desired results as the mentors perceive. On the part of the students,
however, much learning occurs in group work. Thus, the apt intervention is the synthesis of the
153
two: for the faculty members to bend forward to consider the nature of the young, and for the
learners to bend backward to understand the wisdom of the old.
Table 5b.Interventions on Faculty’s and Students’ Commonly Preferred Teaching/LET
Review Strategies
Faculty’s Preferred
Teaching Strategies
Triangulated Data
First Three Strategies:
1. Cooperative Learning
2. Open Discussion
3. Lecture
Faculty Sharing:
“How shall PNUSL
improve its LET
performances?”
First Three Suggestions:
.Intensive Review
.LET Review Integration in Academic Sessions
.Adopt LET format in written examinations
Students’ Preferred
Teaching Strategies
First Three Strategies:
1. Group Presentation
2. Group Activity
3. Open Discussion
Focus Group
Discussion: “How
else do you want to
be taught? Why?”
First Three Answers:
.Group Presentation = I learned with the group as group
output serves indicator.
.Group Activity = It allows cooperative learning and
strengthens students’ relationship.
.Open Discussion = I consider interaction as precious
moments while ideas continually flow.
First Three Strategies:
1. Cooperative Learning
2. Collaborative Learning
3. Group Rationalization
Alumni’s Preferred
LET Review
Strategies
Interview with
Select Alumni:
“What LET review
strategy did you
prefer and how did it
contribute to your
success in LET?”
Intervention
Faculty
members
encouraged to
bend forward
to consider the
nature of the
young
Learners shall
be told to
bend backward
to understand
the wisdom of
the old
First Three Common Ideas:
*Cooperative Learning = easy understanding of some points
and ideas when working with colleagues
*Collaborative Learning = companionsto agree with and
discuss on want to understand.
*Group Rationalization = sharing of own understanding and
prior knowledge.
c. Interventions on the Existing LET Review Programs. The existing LET review
programs, as grouped according to the predictors, are given corresponding interventions in
Table 5c. The major intervention here is making all existing review programs as parts of the
bigger and encompassing program. All these interventions are geared toward the
institutionalization of LER review activities.
The GPA received much focus both from the faculty and the students. Pascua & Navalta
(2011) stressed that “the higher the grade point average of the graduate, the higher was the
expected performance in the LET”.
Teacher-training institutions aim for the improvement of the technological, content,
pedagogical, and knowledge (TPCK) aspects of learners. Interventions as identified above are
154
geared toward the TPCK enhancements. Due to the challenging nature of passing on to the
students the complex art of pedagogy, innovative educators have identified the conditions of
technology integration within the context of teacher training programs of higher education
institutions (Glifonea & Mayani, 2010). For the same goal, Bilbao & Dequilla (2013) even
thought of setting up a web portal “whose platform was utilized for the Online LET Review”
as the manifestation of the interface of technology in education.
Table 5c. Interventions on the Existing LET Review Programs
Predictor
1.Grade
Point
Average
2.Leaving
Examination
3.Pre-Board
Existing LET
Review Program
1a.
Homeroom/SGBased
Intervention
* To cascade the program through the Office of Student
Services
*To use validated assessment tools
1b. Faculty*To integrate review in the syllabi and to utilize teaching
Initiated/ Research- strategy commonly preferred by both the faculty and the
Enhanced
students
*To align most research activities and outputs to the academic
needs of the students
1c. Online
*To make online as part of the bigger program to complement
the face-to-face learning delivery mode
1d. Organization*To ensure that questions included in the academic
Based Academic
competitions are potential LET items facilitated by elite
Competitions
groups.
2. Leaving
*To give exit examination to every year level before the end
Examination
of each school year.
(Exit Examination) *To implement a bridging program for those who will perform
poorly in the exit exam.
3a. Summer LET
*To strictly monitor attendance and participation
Review
*To employ cooperative learning as a dominant strategy
3b. Top The Test
*To quantify and qualify the academic records and
(T3)
preparations of the chosen persons
3c. Final Coaching *To involve, as the resources permit, more participants
*To include Final Coaching among the sources of research
baseline data
All these interventions are geared towards the improvements of the College Grade Point
Averages to effect the Leaving Examinations and the Pre-Board Exams and to eventually pass
the teacher licensure examination.
Conclusion
Based on the research findings, the following conclusions are posited:
1) The new graduates’ recorded LET performances were very much higher than the
national passing rate for the last three years.
2) There is a strong correlation between the LET results and the given predictors during
the past three consecutive years. The alternative hypothesis was accepted.
155
3) The Pre-Board was highly predictive of the LET results. With Leaving Examination
and Grade Point Average as ranked second and third, respectively, the Pre-Board was the best
LET predictor. The alternative hypothesis was accepted.
4) There were existing programs related to the review but they lacked cohesion and
concentration.
5) The faculty’s perceived teaching effectiveness, the faculty’s and the students’
commonly preferred teaching/LET review strategies, and the existing LET review programs
were the considerations of the interventions applied to the predictors yet the foci of old
interventions were disconnected.
Recommendations
Based on the conclusions postulated, the following recommendations are advanced:
1) Incentives shall be continually offered to the passers and the topnotch examinees.
2) The concerned departments shall monitor the academic performances and drumbeat
on using the available predictors to maintain their strengths and strengthen their weaknesses.
3) Since the Pre-Board and the Leaving Examination belong to the best predictors, they
have to be evolved and enhanced based on the contents and level of difficulty of the actual
LET. The computed GPA and the results of Leaving Examination shall gauge the intervention
during the Summer LET Review through the Pre-Board results.
4) The University-wide LET Review program shall be presented to and approved by
the faculty council. The same shall be cascaded to all internal stakeholders for adjustment and
re-alignment of all existing programs.
5) For the interventions to be effective, observing the following may help:
a. Include in the plan a whole-year round calendar of activities and Gantt Chart.
b. Teaching strategies that enhance cooperation and collaboration among the
students shall be reflected in the course syllabi and in the review plan of the faculty.
c. Assessment tools shall be evolved via researcher investigations in order to
monitor the entirety of the program implementation and the range of its improvements.
References
Arenillo, S. A. & Arenillo, M. T. (2008).Pre-service education and performances in teacher
licensure examination among graduates of Mindoro State College of Agriculture and
Technology. Retrieved December 30, 2014, from
http://philair.ph/publication/index.php/jpair/article/view/63.
Bandura, A. (1986). Social Learning Theory. Retrieved December 29, 2015, from
http://www.learning-theories.com/social-learning-theory-bandura.html.
Bilbao, P. P. & Dequilla, M. C. A. (2013). LET-ing through SOF. SONS, NET: Online
review for prospective Philippine teachers. National Network of Normal Schools,
1(1), 21.
Espino, N. N., Roman, M. F. V.& Magno, G. C. (2011). Academic performance licensure
examination for teachers results from 2004-2008 and work performance of bsed
graduates: An analysis. Retrieved December 30, 2014, from
http://www.bpsu.edu.ph/home/index.php?option=com/.
Garbarino & Scott. (2014). Theory of teacher competence. Retrieved December 29, 2014,
from http: www.ipkl.gu.sc/english/.
156
Garcia, G. C. (2013). Academic performance as determinant to pass the Licensure
Examination for Teachers. Retrieved December 30, 2014, from
http://www.philair.ph/publication/index.php/irj/article/view/258.
Ibe, M. D. (2003). Teacher Education: Its implications to basic education. Ateneo de Naga
University, Naga City. Retrieved January 19, 2015, from http:www.adnu.edu.ph.
Inquirer.net. (2012). Results of teachers licensure exams released. Retrieved November 26,
2012, from http://newsinfo.inquirer.net/313563/results-of-teachers-licensure-examsreleased.
Lozarita, M., Acledan, M.&Flores, D. (2009). Academic achievement and performance in
licensure examination of UM education graduates. Retrieved December 30, 2014,
from
http://ejournals.ph/index.php?journal=UMRJ&page=article&op=viewArticle&path%
5B%5D=3829.
Manzala, T. R. (2013). 24th oath taking ceremonies of professional teachers. PRC-BPT
Program, 24(1), 3.
Marpa, E. P. & Guanzon, D. T. P. (2014). Philippine Normal University Admission Test and
College Grade Point Average as Predictors of Licensure Examination for Teachers.
Retrieved December 30, 2014, from http://www.researchgate.net/publication/.
Obra, M. R. (2013). Compliance status to CHED policies and standards on teacher education
and institutional performance of teacher education institutions (TEIs) in Region IX,
Mindanao-Philippines. National Network of Normal Schools, 1(1), 18-19.
Ochave, J. A. & Suatengco, R. (2007). College Students’ Preferred Professors’ Instructional
Methodologies: Cohort Revalidation. The Normal Lights, 2(1), 23-46.
Pascua, J. B. & Navalta, J. D. (2011). Determinants of L.E.T. performance of the teacher
education graduates in a state university. Retrieved December 30, 2014, from
www.eisrjc.com/
Pascua-Valenzuela, E.A. (2013). Innovations in teacher education in Southeast Asia. National
Network of Normal Schools, 1(1), 11.
Pasumbal, R. V. & Salvacion, M. M. (2004). Licensure examination for teachers (LET)
performance of graduates of MSEUF College of Education 1997-2002: An
assessment. MSEUF Research Studies, 6(1), 73-84.
Professional Regulation Commission. (2013). September 2013 results of Licensure
Examination for Teachers released in forty (40) working days. Retrieved November
23, 2013, from http://www.prc.gov.ph/news/?id=641.
Professional Regulation Commission – Bureau of Professional Teachers (2013). 24th oath
taking ceremonies of professional teachers. PRC-BPT Program, 24(1), 3.
Professional Regulation Commission. (2014). PRC releases LET Results August 17, 2014
teachers board exam. Retrieved August 18, 2014, from
http://www.prcboardnews.com/2014/08/prc-releases-let-results-august-17-2014teachers-board-exam.html.
Republic Act 7836 or Philippine Professionalization Act of 1994.
157
RELATING TEACHING STYLES AND LEARNING STYLES WITH
PERFORMANCE IN BIOLOGY
Virgil Duad 1, Eden V. Evangelista 2 and Raquel A. Gonzales 3
1, 2, 3
Philippine Normal University, Manila
Abstract
This research investigated the dominant teaching style of teachers and learning styles
of Biology students of Bacoor National High School, Cavite, Philippines using the descriptive
survey causal-comparative approach. Teachers and students were purposively selected as
respondents of the study. Two instruments were used to gather data: Learning Style Checklist
and the Teaching Style Checklist. Performance in science was determined through the use of
the quarterly examinations and the National Achievement Test (NAT) science raw scores. The
relationship between performance and teaching/learning styles was established using the
correlation ratio.
The findings of the study revealed that: (1) Majority of the teacher-respondents had
formal authority dominant teaching style. (2) On student responses to learning style; 35.83%
had visual, 34.17% were auditory, and 30.00% of the respondents had kinesthetic learning
style. The students’ level of performance in the quarterly examinations all fall within the
“average mastery” level of verbal interpretation.
The comparison of performance between teaching and learning styles showed that: (1)
teaching styles have significant effect on students’ quarterly examinations, NAT and composite
scores. (2) learning styles have no significant effect on students’ performance and (3) optimum
teaching–learning style combination based on composite performance revealed that facilitator
teaching style is best matched with a students’ kinesthetic learning style. The demonstrator
style is clearly matched with visual learning style. Facilitator and delegator teaching styles had
a great match with kinesthetic learners. However, auditory learning style had no specific match
although the results showed an average performance. Among the learning styles, only
kinesthetic learning style had multiple optimum- teaching combinations.
Keywords: teaching and learning styles, performance
Introduction
This research investigated the dominant learning style of students and teaching style of
biology teachers of Bacoor National High School. A total of eight (8) teachers and one hundred
twenty (120) students were purposively selected as respondents of the study.
Research Methodology
The research design employed in this study is the descriptive survey causal-comparative
approach. Two different data collection instruments were used to gather data. These are the
Learning Style Checklist and the Teaching Style Checklist, both modified and expert- validated
to determine learning styles and teaching styles of the respondents, respectively. Performance
in science was determined through the use of the quarterly examinations and the National
Achievement Test (NAT) science raw scores. Objectivity in data analysis and presentation
were ensured with the use of the descriptive and inferential statistical tools. The teaching styles,
learning styles, and science performance were determined with the use of percentage frequency
158
distributions and the usual descriptive statistical measures; namely: arithmetic mean, mode,
standard deviation, and the percentage coefficient of variation. Significant differences among
the performance of groups were established using the multivariate analysis of covariance
(MANCOVA). The relationship between performance and teaching/learning styles was
established using the correlation ratio.
Results and Discussion
The findings of the study revealed that: (1) Majority of the teacher-respondents had
formal authority dominant teaching style. (2)Forty-three (35.83%) of the one hundred-twenty
respondents had visual learning style. Forty-one (34.17%) were auditory, and thirty–six
(30.00%) respondents had kinesthetic learning style.(3)The students’ level of performance in
the quarterly examinations has a mean score of 32.65; NAT sub-test mean score of 34.32, and
composite scores of 33.49 that all fall within the “average mastery” level of verbal
interpretation.
The comparison of performance between teaching and learning styles using
MANCOVA showed that: (1) teaching styles have significant effect on students’ quarterly
examinations, NAT and composite scores. The computed F– values were 47.07, 21.42 and
40.71, respectively with degrees of freedom, 3 and 107. All the obtained values are significant
at 0.05 alpha level.(2)learning styles have no significant effect on students’ performance with
the computed F–values for the quarterly examinations of (0.77), NAT (2.48), and composite
(1.32), with 2 and 107 degrees of freedom. These obtained values are considered not significant
at 0.05 alpha level. (3) optimum teaching–learning style combination based on composite
performance revealed that facilitator teaching style is best matched with a students’ kinesthetic
learning style (31.97).
Conclusion
The demonstrator style is clearly matched with visual learning style. Facilitator and
delegator teaching styles had a great match with kinesthetic learners. However, auditory
learning style had no specific match although the results showed an average performance.
Among the learning styles, only kinesthetic learning style had multiple optimum- teaching
combinations. It can be noted also that a delegator teacher can have a positive effect on
kinesthetic learner’s composite performance in science.
The correlation ratio analysis showed that among the variables, teaching styles have
caused an effect on students’ science performance. These obtained values all had “high
significant relationship”.
Recommendations
The study recommends requiring the teachers to adopt flexible, dynamic, and diverse
science teaching strategies to increase students’ achievement. The delegator teaching style,
being the best style, must be considered in designing curriculum plans and in implementing
strategies to help students develop autonomy in learning. Biology teachers should make use
of technology to vary modes of learning and to foster better achievement in science. They
should develop learning activities that will make science learning interesting and enjoyable.
Administrators should design a program that will expose students to different science
activities and to apply what has been learned.
159
Social Science and Environment Education
Research
Name
ID
114
Satria Indra
Kesuma
Affiliation
Government and
International Studies,
Universiti Utara
Malaysia
College of Law,
Government and
International Studies,
Universiti Utara
Malaysia
Philippine Normal
University-Mindanao,
Prosperidad, Agusan
del Sur
116
Sitti Aisyah
Sulaiman
128
Arlan S.
Ravanera
129
Pajaree
Thongsanit
170
Prathueang
Srilamontri
139
Nattaphop
Noothuan
Faculty of
Engineering, Naresuan
University,
Phitsanulok
Student in Master of
Public Administration
of Suratthani Rajabhat
Universtity
Chulalongkorn
University, Bangkok
166
Pitchayanan
Kamsaeng
Chulalongkorn
University, Bangkok
Institution/
Title
Country
CAS
LEGAL PROTECTION FOR THE
INDONESIAN DOMESTIC WORKERS IN
MALASIA
CAS
ISLAM IN KAJANG : A STUDY ON THE
IMPLEMENTATION OF PATUNTUNG
BELIEF IN THE AMMATOWA MODERN
COMMUNITY
PHILIPPINES INDIGENOUS KNOWLEDGE ON NATURAL
DISASTERS AND SURVIVAL STRATEGIES
AMONG THE RIVERINE MANOBO AND
HIGHLAND HIGAONON IN AGUSAN DEL
SUR, PHILIPPINES
THAILAND EFFICIENCY OF CONSTALK AND SNAKE
PLANTS ABSORB CARBON DIOXIDE IN
OFFICES
THAILAND
THAILAND
THAILAND
THE NEEDS DEVELOPMENT OF
CREWMEN SKILL IN PATROL BOATS OF
SUB-DIVISION 6, MARINE POLICE
DIVISION
GENE EXPRESSION ANALYSIS OF
MELANIZATION INHIBITION PROTEIN
(MIP) GENE FROM BLACK TIGER SHRIMP
PENAEUS MONODON
CLONING AND EXPRESSION OF ANTILIPOPOLYSACCHARIDE FACTOR
ISOFORM 6 (ALFPM6) FROM BLACK
TIGER SHRIMP, PENAEUS MONODON
160
LEGAL PROTECTION FOR THE INDONESIAN DOMESTIC WORKERS
IN MALAYSIA
Satria Indra Kesuma
College of Law, Government and International Studies, Universiti Utara Malaysia
Abstract
Indonesian migrant worker placement to almost the entire country, dominated by
women, and the majority of them work in the informal sector, such as Domestic Workers, babysitter and nurse. Many women who work in agriculture, and farming should be eliminated and
replaced with a modern technology event that became known as the "green revolution"
(agriculture cultivation technology changes that began in the 1950s and 1980s in many
developing countries, especially in Asia. Results are achieved self-sufficiency (adequacy of the
provision amount of food in some countries which had always been in short supply of staple
food), must look for other sources of livelihood feminization of poverty occurred, then placed
women in the domestic work sector, receive low wages with protection minimal, the majority
of the migrants work as domestic workers. Many countries the objectives of Indonesian
workers to work abroad, like Singapore, Hongkong, Brunei Darussalam, and one that many
countries recruit Indonesian migrant domestic workers is Malaysia.
Keywords: Legal protection, Indonesia domestic workers, female workers
Introduction
During 2004-2009, Indonesian migrant worker placement to almost the entire country,
dominated by women, and the majority of them work in the informal sector, such as Domestic
Workers, baby-sitterandnurse (Azmy, 2012). Many women who work in agriculture, and farming
should be eliminated and replaced with a modern technology event that became known as the
"green revolution" (agriculture cultivation technology changes that began in the 1950s and
1980s in many developing countries, especially in Asia. Results are achieved self-sufficiency
(adequacy of the provision amount of food in some countries which had always been in short
supply of staple food), must look for other sources of livelihood feminization of poverty
occurred, then placed women in the domestic work sector, receive low wages with protection
minimal, the majority of the migrants work as domestic workers.Many countries the objectives
of Indonesian workers to work abroad, like Singapore, Hongkong, Brunei Darussalam, and one
that many countries recruit Indonesian migrant domestic workers is Malaysia (Statistics Pusat
Penelitian Pengembangan Dan Sistem Informasi, 2010).Hune (1991) argues, the female
migrant workers are a new phenomenon in national and international policy theory, and social
policy. Therefore, in an attempt to make a living, many Indonesian migrant workers largely
dominated by women working in the informal sector working in several countries including
Malaysia.
To earn a substantial income, Indonesian women workers choose to work abroad rather
than working in the country, many of them are working as domestic workers, nurses, and a
baby sitter (Azmy, 2012). There are several factors that most of Indonesian women migrant
workers to work in Malaysia (Azmy, 2012).First, Malaysia's economy continues to rise for
some time and requires a lot of manpower. Secondly, due to the economic development of the
161
country, Malaysia offers better salaries than in Indonesia. Third, the use of the Malaylanguage
in Malaysia is very similar to Indonesian language. By sending workers have made cooperation
between the countries more closely and help each other as in labor migration, Malaysia can be
assisted by the Indonesian workers, especially domestic workers and the Indonesian
government to reduce unemployment caused by the unavailability of work, but the relationship
this mutual benefit is not accompanied by a qualified legal protection, Many Indonesian
domestic workers get exploitation and abuse at every stage of the migration cycle, including
recruitment, training, transit, jobs. In this case the role of the state is necessary to provide strict
protection for workers, especially for womenworkers.
The theory of human rights determines whether the government's policy of Indonesia
and Malaysia in relation to the delivery of labor is in accordance with the actual conditions of
human rights. Arifin (2012) argues that human rights can be divided into seven of rights, which
are:
1) Security rights which deal with protecting against assault’s on one person such as
torture, murder, and rape;
2) Due to process rights, which concern about protecting against legal abuses such as
imprisonment without trial, secret trials, and excessive punishment;
3) Fundamental personal freedom rights which emphasizeprotecting the freedom of
belief, expression, individuals, private life, association, assembly and movement;
4) Rights of political participation, which aim to provide individuals a democratic
political process;
5) Equality rights which concern about equality in all aspects of life and emphasize to
eliminate all forms of discrimination;
6) Social rights which ensure access to subsistence coupled with employment,
healthcare, education;
7) Minority combined with group rights which are addressing the problems of
distinctive groups by different forms or specific protections that go beyond the protections
already offered by other rights such as rights in practicing culture for the minority group.
To protect the rights of migrant workers, especially un-skilled workers because they are
vulnerable to human rights violations, the state requires the protection of migrant workers'
rights standards. It is intended to clarify the standards for the protection of workers, including
migrant workers at the international, regional and domestic. A standard reference that can be
used in determining the rights of workers. Currently, the provisions on the protection of
workers' rights at the international and regional levels are usually formulated into treaties,
conventions and declarations. The One wayto protect the rights of migrant workers, the
government can implement the standards set out in the treaties, conventions and declarations.In
other words, international labor standards are tools for migrant workers to claim and complain
about violations of their rights for the purpose of this legislation is to promote and protect the
rights of workers. International standards such as the workers' right to freedom from slavery or
servitude kind, free from forced or compulsory labor, the right to seek better opportunities of
employment, freedom of association and the labor market (Azmy, 2012).Therefore, the
international standard is expected to be able to protect and enforce the rights of workers.
The International Labor Organization (ILO) is an international organization founded in
1919 under the Treaty of Versailles (Price, 1945).It was created aims to protect and promote
the opportunity for all people regardless of race, religion, nationality, language, color, age or
162
other status to achieve decent and productive work in conditions of freedom, equity, security
and human dignity. However, the application of ILO efforts to implement international
legalinstrumentsthat can be used as to promote and protect the rights. According to The ILO
Declaration of Philadelphia in 1944gave an essential contribution to the recognition of labor
rights as a part of international human right law.The Declaration Promoted workers' rights,
especially the rights of migrant workers, to be included as a basic human right that must be
protected by international human rights organization or the United Nations. The UN concerns
about the rights of workers, especially migrant workers, by upholding some conventions that
can be used as a legal instrument to promote and protect the rights of migrantworkers. The
several international conventions adopted by the ILO is the International Covenant on Civil
and Political Rights (ICCPR), International Covenant on Economic, Social and Cultural Rights
(ICESCR), the International Convention against Torture and Other Cruel, Inhuman or
Degrading Treatment or Punishment (CAT) and migrant workers convention (CMW) which,
in particular, is more focused on protecting the rights of migrant workers compared to other
conventions. This agreement is basically a representation of the Universal Declaration of
Human Rights (UDHR) which has been translated and formulated as a binding instrument to
promote and protect the rights of workers.
There are several cases of violence experienced by women migrant workers one case
of Nirmala Bonat tortured by her employer (The Star Online, 2014). Therefore, In 2004,
Indonesia has a new law that Law No. 39 Year 2004 on the Placement and Protection of
Indonesian Workers Abroad (PPTKILN), pursuant to Article 94 paragraph (1) and (2), which
mandates the establishment of the National Agency for Placement and Protection of Indonesian
Workers Abroad (BNP2TKILN) (Azmy, 2012). However, the existence of this law is expected
to provide protection for Indonesian migrant workers in order to avoid abuse by her employer.
According to Part 3 article 8 undang-undang No. 39 tahun 2004, the rights and
obligations of workers stating that Indonesian workers are entitled to receive wages in
accordance with the existing wage standards in the country of destination but this article does
not show the existing employment policies in several countries such as Malaysia.Malaysia does
not have a policy of labor and wage standards for workers, particularly informal workers, so
the wage issue left entirely to the employer (Azmy, 2012).Moreover, on April 12, 2012,
Indonesia has ratified the UN Convention of 1990 on the Protection of the Rights of All Migrant
Workers and Members of Their Families (Hune, 1991). The convention aims to establish
minimum standards for the protection of migrant workers and their family members related to
civil rights, political, economic, social, and cultural, in addition to the convention can
harmonize with state laws universally applicable standards (Syahputra, 2014). Many of the
destination countries, such as Malaysia and Saudi Arabia are not ratifying this convention
(Komisi Nasional HAM, 2013). Ratification of this convention is very important because it
shows Indonesia’s commitment to the protection of workers who are working abroad and also
Indonesia as one of the largest source countries sending workers outside the country.In
addition, the Government ratified the Convention means obliged to provide equal opportunities
for foreign migrant workers and their family members who worked in Indonesia, and provide
severance pay when they are affected by layoffs.The Convention also sets the standard to
address the problems of lack of protection of civil rights, economic, social and cultural rights
of migrant workers and members of their families.This convention setssome important things,
such as (The United Nations General Assembly, 2014):
163
1) Sets the minimum standards regarding the protection of civil rights, political,
economic, social and cultural all migrant workers and members of their families. The
Convention encourages countries to harmonize its laws with universal standards contained in
the Convention.
2) Recognizing the contributions donated by migrant workers to the state economy and
society in which they work and the development of their home countries.
3) Include a set of standards for the protection of migrant workers and related state
obligations, including country of origin, transit and country of employment.
4) Prevent and eliminate the exploitation of all migrant workers and members of their
families throughout the migration process, including preventing human trafficking.
5) Convention is not only to protect migrant workers, but also protect the interests of
recipient countries of migrant workers related to job category access restrictions to protect its
citizens.
With the ratification of the Migrant Workers Convention, the Government should take
immediate steps harmonization of legislation related to the implementation of protection for
migrant workers. Therefore, This Convention shall be used as a basic reference for revising
Undang-undang Nomor 39 Tahun 2004 on the Placement and Protection of Indonesian Migrant
workers and fix weaknesses in terms of human rights protection for migrant workers. This
ratification can be used as to increase the power in running the protection of Indonesian migrant
workers abroad. Under the Malaysian law is Employment Act 1955 (The International Labour
Organization, 2014).These laws regulate the general provisions relating to the protection of
workers and employers / companies such as employment agreements, rights and obligations of
workers / employees and employers / entrepreneurs, working hours, wages, time off / breaks,
maternity leave, the provisions on overtime, social security, the right to worship, employment
termination / job cuts(The International Labour Organization, 2014).As a recipient of state
workers from Indonesia, Malaysia does not specifically related legal migrant workers in
Malaysia all workers both at home and abroad who work in Malaysia with a valid employment
contract between the employee and the provisions of the Employment Act 1955, except for
informal workers together with Indonesia, Malaysia does not have specific legislation relating
to informal workers, so that the entire wage issues submitted to the employer (The International
Labour Organization, 2014). As for some general rulesbased on the Malaysian Employment
Act, does not specifically regulate the rights of informal workers, such as the standard wage
determination.
In May 2004, graphic photographs of the bruised and burned body of Nirmala Bonat, a
young Indonesian domestic worker in Malaysia, were splashed across newspapers in Southeast
Asia. In a case that drew international attention and outrage as well as a prompt response by
both the Malaysian and Indonesian governments, Bonat accused her employer of brutally
beating and abusing her (Human Rights Watch, 2004).In addition to Nirmala Bonat, violence
experienced Ceriyati (2007), working hours Ceriyati experienced exploitation and abused by
her employer and not get wages to work in Malaysia.The rate of violence in many countries to
increase significantly every year, it can be seen from the data on violence against Indonesian
migrant workers, based on research by Migrant Care.
Table 1 Data violence against Indonesian migrant workers in various countries from 2004-2010
164
Country
2004
2005
2006
2007
2008
2009
2010
Malaysia
Saudi Arabia
Singapore
4
3
2
7*
-
19
5
-
58
55
4
37
53
14
1748
1048
16
1000
5563
3
Jordan
Kuwait
Hongkong
Taiwan
UEA
-
-
1
1
8
6
4
5
1
10
5
6
6
1004
784
78
103
103
5
2
2
2
8
Sum
9
7
26
141
131
5314
6588**
The percentage
of female and
male
 2004=90%
female and
10% male
 2008=82%
female and
18% male
 2009=97%
female and
3% male
 2010=5.653fe
maleand 679
male
TOTAL
12.216 persons
Source : Azmy (2012)
From these data above, it can be seen that Malaysia as one of the countries in Asia,
which has a number of violence against the Indonesian women migrant worker is very
high.Therefore,the Indonesian action of suspension (moratorium) of workers in the informal
sector delivery to Malaysia, but the implementations of these policies are not effective, there
are many more Indonesian women domestic workers are abusedand get a rough treatment.
Statistics from the Immigration Department of Malaysia for the year 2011 to October
2011 show the total migrant domestic workers in Malaysia are a total of 176.559 people. Of
the total, 124.281 people were from Indonesia and 33.071 people of Cambodia (Dewan Negara,
2011). From the data shows that Indonesia has one of the highest rates of workers seeking
employment abroad, with the majority of these workers being women employed in domestic
service. Many Indonesian domestic workers at risk of psychological and physical abuse,
including sexual abuse; and prohibition of their religious practice. Violations of labor rights
are also included in the long working hours without overtime pay, no holidays, and payment
of incomplete and irregular wages.
Indonesia and Malaysia in fact have adopted laws to protect foreign workers, especially
foreign workers in Indonesia. However, the legal protection was not effective because there are
many women workers are exploited and abused. As experienced by a 19-year-old Nirmala
Bonat Indonesia, Malaysia also has failed to protect domestic workers from Indonesia and has
ignored the standard of protection for foreign workers. Onehand, Indonesia does not have an
adequate system to monitor labor recruitment agencies and training centers. Whilethe
Malaysian labor law does not regulate the same protection for informal workers in particular,
domestic servants, such as the payment of overtime pay, holidays, and compensation for
accidents at work.
Indonesian Domestic Workers
165
There is some literature can help the author to understand to the problems of the
protection of Indonesian domestic workers in Malaysia. Research conducted by Anik Farida
(2003), describes the forms of violence that occur in Indonesian domestic workers and their
efforts to confront violence. Anik also explained that the violence in the form of economic
violence, psychological, physical, and sexual abuses. The violence is interactive and structural,
because abusers usually by an individual, such as unscrupulous brokers, husband or relatives
of workers and institutional agents such as, Indonesian Services Suppliers (agency/PJTKI),
Embassy of the Republic of Indonesia (KBRI) (Azmy, 2012).
Based on Fadjri (2007)found the problem regarding the protection of Indonesian
domestic workers, namely the Indonesian workforce poorly educated and do not understand
the work contract, many of those who did not complete the contract of employment (42
percent), while about 16 percent had a variety of problems such as violence, was not given a
ticket home, passport arrested employer, sexual harassment, unpaid wages, and etc. (Fadjri
2007).Moreover, Sukimi (2014) also argues employers should have to provide protection, fair
treatment and non-discrimination of foreign workers as well as employers are responsible for
providing housing facilities to facilitate the monitoring of foreign workers as a preventive
measure against the occurrence of labor problems and social problems that may violate the
laws of the country of the Employment Act 1955. But that occurred many Indonesian domestic
workers confront the risk of psychological and physical abuse, including sexual abuse; and
prohibitions on practicing their religion. Pervasive labor rights abuses in the workplace include
extremely long hours of work without overtime pay, no rest days, and incomplete and irregular
payment of wages.Some of these problems occur because of the limited ability of Indonesian
workers to obtain training, in addition to the role of the government is limited, especially in
terms of protection of Indonesian workers in Country of placement.
In authors perspective taken by the importance of the participation of a group of migrant
workers in the development of policies to protect Indonesian domestic workers, by looking at
the labor conditions of Indonesian domestic workers in Malaysia.The theory used in conducting
policy research on the protection of migrant workers to the study of Indonesian domestic
workers in Malaysia:
The State as the given of authority
The state consisting of various government institutions, bureaucracy, military, police
and others.According to Heywood argues that the relationship between the state and the
government is a complex relationship (Heywood, 2004).Government is part of the state, and in
some cases the government is the most important part. Government institutions in its work to
create, implement and interpretation of the law, which became binding rules for the
community.Moreover, there are three functions of the system of government: legislative or
law-making process, applying the law implementation, and interpretation of the law.
Theory of Public Policy
A public policy begins with the process of policy, according to James Anderson, who
quoted the opinion of David Easton that the characteristics of public policy will start from the
policy formulated by authorities in a political system, the ruling is defined as an institution or
an individualwho has the authority to run the government such as the King, and The Prime
Minister (Anderson, 2011).
Socialist Feminism Theory
166
Feminism is an awareness of the existence of systematic injustice to women around the
world.Feminism can be defined as understanding the fight for women’s equality. One of theory
socialist feminism is the feminism that carries that injustice that occurs in women is due to the
integration of capitalism in women’s lives.
Conclusion
Almost every country in 2004-2009 occupied by Indonesian migrant workers, many of
them is dominated by women, and the majority of them work in the informal sector, such as
domestic workers, baby-sitters and nurses. Themany activities of Indonesian domestic workers
get exploitation and abuse by employers. Therefore, it is a necessary role of the state in an
effort to provide strict protection for workers, especially women workers. Inthis case the state
has implemented the Law No. 39 2004 on the Placement and Protection of Indonesian Workers
Abroad (PPTKILN) and applying international standards to ratify the UN Convention of 1990
on the Protection of the Rights of All Migrant Workers and Members of Their Families, this
convention is aimingto increase the strength in running the protection of Indonesian migrant
workers abroad.
References
Anderson, J. (2011). Public Policy Making: an Introduction. Wadsworth.
Arifin, B. (2012). Critical analysis of domestic worker condition in Malaysia and Singapore:
ameliorated economic condition vs. Gateway to modern slavery or servitude. Online
thesis, International Migration and Ethnic Relations.
Azmy, A. S. (2012). Negara dan buruh migran perempuan. Yayasan Pustaka Obor, Jakarta.
Denzin N. K. & Lincoln, Y. S. (2003). Handbook of Qualitative Research. Sage Publications.
Dewan N.(2011). Pembantu Rumah Indonesia dan Kemboja. Retrieved from
http://rama4change.wordpress.com/2012/01/12/dewan-negara-sesi-disember-2011pembantu-rumah-indonesia-dan-kemboja.
Fadjri. (2007). Antar Kerja Antar Negara. STIK Jakarta Online Journal.
Heywood, A. (2004). Political Theory: An introduction. Palgrave Macmillan.
Human Rights Watch. (2004). Help wanted: abuses against female migrant domestic workers
in Indonesia and Malaysia. Retrieved from
http://www.refworld.org/docid/412ee7434.html.
Hune, S. (1991). Migrant women in the context of the international convention on the
protection of the rights of all migrant workers and members of their families.
International Migration Review, 25(4), 800-817.
Komisi Nasional HAM. (2013). Konvensiinternasionaltentangperlindunganhakhakseluruhpekerjamigrandananggotakeluarganya. Retrieved from
www.komnasham.go.id/informasi/images-portfolio-6/2013-03-18-05-4420/internasional/item/268-konvensi-internasional-tentang-perlindungan-hak-hakseluruh-pekerja-migran-dan-anggota-keluarganya.
Price, J. (1945). The International Labour Organization. International Affairs (Royal Institute
of International Affairs 21.
Statistics Pusat Penelitian Pengembangan dan Sistem Informasi. (2010). Penempatan Tenaga
Kerja Indonesia Di Asia Pasific, Menurut Kawasan Dan Negara Penempatan 2010.
Sukimi, M. (2014). Negara, undang-undang dan tenaga kerja asing: Antara ideal dan realiti di
malaysia. Malaysian Journal of Society and Space, 10(1), 101 – 109.
167
Syahputra, K. E. (2013). Penyebab Indonesia Meratifikasi Konvensi PBB 1990 Tentang
Perlindungan Hak Buruh Migran Beserta Anggota Keluarga. Jurnal Analisis
Hubungan 02 International, 2(02).
The International Labour Organization. (2014). Malaysia Employment Act 1955. Retrieved
from http://www.ilo.org/dyn/natlex/docs/WEBTEXT/48055/66265/E55mys01.htm.
The Star Online (2014). Nirmala bonat case: Court upholds 12-year jail term on housewife.
Retrieved from http://www.thestar.com.my/News/Nation/2012/10/01/Nirmala-Bonatcase-Court-upholds-12year-jail-term-on-housewife/.
The United Nations General Assembly. (2014). International convention on the protection of
the rights of all migrant workers and members of their families. Retrieved from
http://www.un.org/documents/ga/res/45/a45r158.htm.
168
ISLAM IN KAJANG : A STUDY ON THE IMPLEMENTATION OF
PATUNTUNG BELIEF IN THE AMMATOWA MODERN COMMUNITY
Sitti Aisyah Sulaiman
College of Law, Government and International Studies, Universiti Utara Malaysia
Abstract
The study discussed about the implementation of Patuntung belief in the Ammatowa
society in Kajang, South Sulawesi. The Ammatowa community has ordinances, customs,
languages and norms that are different with society in general. This study explained how the
condition of its community, particularly in the implementation of their belief in which it was
absolutely different with Islamic practices and values in general. It is a qualitative research
using historical, anthropology, and sociology approaches. The data were collected by
interview, observation, and documentation, and were analyzed by the deductive and inductive
analyses. The study found that the process of islamization in South Sulawesi that occurred in
the 17th century was not accomplished yet, as stressed by Christian Pelras (1985), in fact, it
can be seen in the Ammatowa community, in Kajang. It is also found that the implementation
of Islamic law in Kajang was not done. Even if there, it is just syahadat.
Keywords: Ammatowa community, Patuntung, Modern era.
Introduction
Kajang is not just an area’s name in Bulukumba, South Sulawesi. It is identically known
to a belief. The name is quite popular because within the area lives a community that have
spiritually belief social life’s values. It is not only physical form in which the community is
black-dressed people, but is also deeply about their belief that they have worshipped all the
time. This unique has attracted visitors in varieties, from researchers to international and
domestic tourists, to see directly and try to understand this community’s way of life. Similar
with, some places in Indonesia did the same things with what this community had done, such
as in Sammin, Blora, Central Java (TitiMumfangati, 2004), To Lotang in Pangkajene, South
Sulawesi (Mattulada, 1985), and Baduy in Banten, West Java (GunggungSenoaji, 2010).
Perhaps, many people estimate Kajang as a recommended place to vacation, because it’s unique
which is the “black-dressed” custom. They did not see deeply the wisdom and the majesty
behind its rituals. Before Islam entering Kajang, the community had embraced a belief or a
religion which was known as Patuntung. The process of islamization and its growth in South
Sulawesi in the 17th century showed that Islam had historical facts cultivating for four centuries
in the area. This occasion was a milestone on the beginning of the spread of Islam widely,
particularly once the Sultan Alauddin, the King of Tallo, announced that the kingdom of GowaTallo had chosen Islam as an official religion in 9 November 1607 AD. At the time, all citizens
accepted Islam as their religion (Mattulada, 1998). After that, in the short period of time, Islam
was flourished in many areas. The spread of Islam was getting stronger because before the
announcement of the Sultan, some Great Kings in South Sulawesi had already embraced Islam
such as the King of Luwu or Datu’ Luwu (La Patiware’ DaengParabbung) in 1604 AD known
as Sultan Muhammad, the King of Tallo (I Manga’rangiDaengManrabia) in 1605 AD known
as Sultan Alauddin, and several other kings. After the King of Bone embraced Islam in 1611,
the process of islamization in South Sulawesi was accomplished (Mattulada, 1991). However,
169
the islamization had challenged in Kajang in which the community did not fully accepted its
practices and values even though Islam is 100% embraced by its communities. Praying 5 (five)
times every day, fasting during Ramadhan, the hajj, and other prayers were not implemented
by the Ammatowa community. Therefore, we might rarely see its people praying or fasting
during Ramadhan in the community. Interestingly, they want to be called Muslim. This
contradiction is due to the mix between religious values and their ancestors practices
(tumariolo). In social life, they idolize a belief called PasangriKajang. Its belief is the highest
guidance for the community. It is shaping their thinking and ways of acting, as mentioned by
Usop that Pasang means oral message that should be followed, obeyed, and implemented and
will cause things or unintended consequences if not adhered. It contains the meaning of
message, trust, advice, demand, and warns. In this sense, the Ammatowa hold Pasang. It is not
only about good manners that must be implemented, moreover it is also about bad manners that
should be avoided. The Ammatowa community, in terms of Islamic law, they do syahada but
they do rarely pray 5 (five) times every day. Once they do praying (shalat), the form is different
with what Muslims usually do. They were just sit doing tafakkur (remembering and begging to
the God). Meanwhile, fasting during Ramadhan, they do only three times; the first day, the
middle, and the last day of Ramadhan. It is interested to know that they do hajj within the
Ammatowa area. The community can do hajj anytime they like, even not in hajj month as Islam
had already determined. It can even be done in a single day. As has been mentioned above that
the Ammatowa community is a portrait that shows us a fanatic tradition on a belief and
ancestors’ practice which was still preserved till today. This phenomenon is seen in their daily
life, in terms of both social life and their belief. This statement is supported by previous studies
(M.Usop, 1978; Ng, 1989; SamiangKatu, 1996, Joseph Devine, 2003; Mas AlimKatu, 2005;
SyamsulMaarif, 2012) in which stressed that the social life in the Ammatowa community,
especially the implementation of its belief, is syncretism.
Objectives
1) To understand well, why Ammatowa societies didn't receive Islam at all.
2) To know and to understand how did religion conducted in societies of Ammatowa
in Kajang.
3) To know why the belief of Ammatowa societies didn't make change or development.
Research Methodology
Thisresearch is qualitative approach because this research is able to make a fact describe
about phenomena (Bogdan &Biklen, 2003). Next Bogdan &Biklen (2003) stated that meaning
of qualitative is the best principle is used if the research has charachteriscs to say a deep
condition in descriptive form. In this research does a historical approach, sociological,
anthropological. To get the data of qualitative in this research, Creswel (2010), Moleong
(2010), did technic of data collection, as is used in this research: Observation, interview and
document analysis. For instrument of data collection in this research, is made and is prepared
three kinds are: 1) interview guide, is questions that are used in interviewee. In this interview
guide is made as a guide to collect the data in the field. 2) Check List, is instrument that is used
to be a guide of researcher to do observation in the field. 3) Tools of recorder such as voice and
picture, used voice recorder and camera photo. Those tools are used to overcome the limitation
of thinking by researcher during to do this research. In this research will do the data analysis
by Miles danHuberman (1994) is interactive analysis data. Data which has collected as findings
170
in this field of research report is analyzed as interactive and did continually until finish, by
doing some activities, are: 1) collection of data, 2) reduction of data, 3) presentation of data, 4)
verification of data.
Conclusion
Conclusion of answering from research result, that for Ammatowa societies in Kajang,
especially in doing of religion doesn't do islamsyariat, even they are adherent of Islam religion.
Culture and beliefnessAmmatowa societies are not changes because one of the factors is the
fastest distance from Islam spreading centre and the palce that we have to get is very difficult.
Also because of differentlanguage, they are not using a popular languages are
buginesslanguage and macassarese, but they are using their own language.
Recommendations
Recommendation after this research is done. The writer hopes to the government,
specially to whom, are doing of relation about religious that are different of Islam religion, so
that the societies need to be given a teaching about knowledge of religion, because actually
islamization process are happened in South Sulawesi in 17 M century, only got the basic and
hasn't touched about aqidah and syari’ah, this condition specially Ammatowa societies in
Kajang. The writer also hopes the government must be followed to conserve of cultures that
still relevant with Islam religion by giving facilitation that gets for conservation of culture and
then makes a role which can be protecting of societies culture in Kajang.
Reference
Ahmad, A. K. (1991). Komunitas Ammatowa di Kajang Bulukumba. Tesis, Pakultas Pasca
Sarjana Universitas Hasanuddin, Ujung Pandang.
Akib, Y. (2003). Potret Manusia Kajang, Makassar: Pustaka Refleksi.
Aminah. S. (1989). Nilai-Nilai Luhur Budaya Spiritual Masyarakat Ammatowa Kajang.
Ujung Pandang: Kanwil Dekdikbud Propinsi Sulawesi-Selatan.
Bogdan, R. C. & Bikien, S. K. (2003). Qualitative research foreducation: An introductionto
theories and methods (4th edition). Boston: Allyn and Bacon, Inc.
Cense, A. (1931). Patuntung in the Mountain of Kajang, Makassar: 11 December 1931.
Creswell, J. W. (2010). Research Design Qualitative, and Mixed Methodes Approaches,
California: SAGE Publications.
Katu, M. A. (1996). Pasangri Kajang (Kajian Pemikiran Dari Sudut Teologis), Tesis Banda
Aceh: Program Pascasarjana IAIN Ar-Raniry.
Katu, M. A. (2005). Tasawuf Kajang, Makassar: Pustaka Refleksi.
Katu, M. A. (2008).Kearifan Manusia Kajang, Makassar: Pustaka Refleksi.
Lexi, J. M. (2000). Metodologi Penelitian Kualitatif. Cet. XI; Bandung: PT Remaja
Rosdakarya.
Mattulada, H. A. (1982). Menyusuri Jejak Kehadiran Makassar dalam Sejarah, Ujung
Pandang: Bhakti Baru.
Mattulada, H. A. (1983). ‘Islam di Sulawesi Selatan’, dalam Taufik Abdullah (ed.),
Islam dan Perubahan Sosial, Jakarta: Rajawali Press.
171
Mattulada, H. A. (1985). Latoa: Suatu Lukisananalisis terhadap Antropologi Politik
Orang Bugis, Yogyakarta: Gajah Mada University Pres.
______. (1991). Makassar Dalam Lintasan Sejarah. Ujungpandang: Hasanuddin University
Press.
Miles, M. B. & Huberman, A. M. (1994). Qualitative data analysis an expanded sourcebook.
Newbury Park, CA: Sage.
Pelras, C. (1985). Religion, Tradition and the Dynamics of Islamization in South
Sulawesidalam Archipel 29, Paris.
Usop, K. M. A. M. (1978). Pasang Ri Kajang Kajian Sistem Nilai di Benteng Hitam Amma
Towa, Ujung Pandang: Pusat Latihan Ilmu-Ilmu Sosial Universitas Hasanuddin.
Woodward, M. R. (1989). Java, Indonesia and Islam. New York: Springer.
172
INDIGENOUS KNOWLEDGE ON NATURAL DISASTERS AND
SURVIVAL STRATEGIES AMONG THE RIVERINE MANOBO AND
HIGHLAND HIGAONON IN AGUSAN DEL SUR, PHILIPPINES
Arlan S. Ravanera 1, Edilberta C. Goce2, Fe M. Sarong3 and Luz A. Montil4
1, 2, 3, 4
Philippine Normal University-Mindanao, Prosperidad, Agusan del Sur, Philippines
Abstract
This qualitative research study explores the belief, knowledge system, practices and
survival strategies of riverine Manobo and highland Higaonon on the occurrence of natural
disasters. The findings revealed that the animistic belief of riverine Manobo and highland
Higaonon enunciates deep respect to nature. Thus, harming the natural environment in any way
was irreverent and sacrilegious for it brought about divine retribution in a form of natural
disasters. Reconciliation with nature may be obtained through adherence to moral codes or
customary lawsand the performance of religious rites. Behavior of flying and creeping
creatures and the conditions of clouds and rainfalls were the prevailing signs and warnings of
the impending floods. In co-equal importance, predictions by the baylan or priest were highly
regarded and believed to be reputable.As coping, the Manobo were resilient to withstand the
severity of floods by ingeniously building shelters on raft termed as migyo’tow nu ‘bayoy to
float with the water. In similar manner, the Higaonon developed a gable roof-like temporary
shelter called botok made of logs strongly fastened on the ground as to be unlikely affected by
strong winds and typhoons.
Keywords: Culture, Indigenous Knowledge System, Survival Strategies, Thematic
Approach, Agusan del Sur, Philippines
Introduction
The richness of knowledge survival was noted among the indigenous cultural
communities. This knowledge was interwoven in their belief systems which have been
developed and handed over many generations by way of oral tradition. This was shown when
a Tsunami incidence of December 26, 2004 struck the coastal communities around the Indian
Ocean that has left trails of deaths while the indigenous people in the region were generally
spared. Their survival strategies were believed to be attributed to the indigenous knowledge of
understanding the behavior of nature and their traditional resource management practices.
The European Union (2009) posited that indigenous knowledge has a compelling
evidence of its potential to provide solutions for reducing disasters at many levels.It further
stated that if this indigenous knowledge will be recognized in scientific approach, it unravels a
vast domain of approaches and tools that can be applied in the current context with appropriate
adaptation and adjustments. This corresponded with the idea stated by UN/ISDR (2008) that
indigenous practices and strategies embedded in the knowledge which prove to be valuable
against natural disasters can be transferred and adapted to other communities in similar
situations. The incorporation of such knowledge in existing practices and policies encourages
participation of the indigenous community and empowers them to lead in disasters risk
reduction activities. Also, indigenous knowledge can help improve project implementation and
may provide a successful model for other education on disaster risk reduction.
173
In the Philippines, the indigenous inhabitants have ingeniously developed distinct
survival knowledge after experiencing inexhaustible number of deadly typhoons, earthquakes,
volcanic eruption and other natural disasters (Wingard and Brandlin, 2013). Among of whom
were the riverine Manobo and highland Higaonon in Agusan del Sur. Living in a marshland
and along water tributaries, long duration of uninterrupted dreadful flooding was no longer an
unfamiliar natural phenomenon. It is in this context that the researchers were interested to
explore the survival knowledge, strategies and beliefs of the Manobo and Higaonon on the
occurrences of natural disasters.
Objectives
This study is anchored on Warren (1991) that indigenous knowledge is the local
knowledge that is unique to a given culture or society. It is the bases for local level decisionmaking in agriculture, health care, food preparation, education, natural resource management
and a host of other activities in rural communities. This knowledge is the basis of community
coping practices that have helped community survive natural calamities over centuries.
Bankoff (2003) stated that the survival strategies or coping mechanisms adopted by the people
are based on the assumption that what has happened in the past is likely to repeat itself
following a familiar pattern. The people’s earlier actions constitute a reasonable framework for
guidance during similar events.
Research Methodology
In carrying out this study, the researchers utilized the case study research design. A
purposive sampling of 18 key informants and 20 participants with age ranging 60-80 who were
natives of Loreto and Esperanza, Agusan del Sur.
Data collection for this qualitative study utilized multiple sources. This involved indepth interview, focus group discussion and field notes. The resulting information from these
sources created a triangulation or convergence of sources (Creswell, 1998). Data analysis will
be done using the thematic approach. In finding patterns and developing category system, the
researcher will deal with the problems of divergence and convergence as suggested by Guba
(1978, as cited in Patton, 1990, pp.402-406). In this study, the researchers looked for recurring
regularities in the data; sorted these into categories; and proposed new information that ought
to fit which will verify its existence.Free prior and informed consent (FPIC) was sought from
the municipal tribal councils of the research sites.
Results and Discussions
Beliefs on the Occurrence of Natural Disasters
The Manobo and Higaonon people have shared traditional beliefs on nature spirits. Acts
contrary to nature for instance disobeying customary laws called as Batasan Sinajahan, Bu’ot
Sinabinitan for the Manobo and Bungkatol Ha Bulawan, Nang Katasa Ha Lana for the
Higaonon; forgetting habits of performing religious rites; engaging in illegal logging or cutting
of trees for the purpose of trade or merchandize; polluting and damaging water source; and
utilizing chemicals in farming were believed to be irreverent and sacrilegious and had caused
the nature spirits to wrath.
This belief has been apparent in ancient time that natural disasters were seen as response
to immoral behavior (Elvin, 1998). The author posited further that such nonconforming
behaviour carried weights in varying degrees depending on the social standing of the person
174
who committed the act. Thus, ensuring the conduct of important people in the community such
as the leader called hawudon of the Manoboand datu of the Higaonon, the baylan or
priest/priestess, and adult community members, by adherence to moral codes or customary
laws andother important obligations such as the habit of performing religious rites would
prevent disasters to happen.
Indigenous Knowledge on Predicting the Impending Natural Disasters
In terms of the indigenous knowledge of the occurring natural disasters, the baylan of
the Manobo and Higaonon became the medium between people and the supernatural world or
unseen world of spirits. Through dreams, he/she may receive warnings of unfavorable
condition or disaster yet to occur.
The study found very interesting information on signs and warnings through
observation of nature although such observation was scanty for it is only true to forecasting
typhoon, flashfloods and pest infestations. Scott (1997) pointed out a comparable thought that
during prehistoric time some old men were renowned for the accuracy of their weather
forecasts. They may know the impending severity of storms and flood through cloud
formations and the color of the skies, sun and moon. They may know that the coming year
would be wet and dry by observing the position of stars and constellations.
Typhoon. As usual occurrence, the respondents were familiar of the coming typhoon
through the formation of clouds which were typically dark. Winds coming from the east were
cold and destructive. A key informant in barangay Panlabuhan, Loreto, shared her experience,
saying:
Cloudy sky and strong wind coming from the east, dark clouds cover the firmament,
and there were lightning and thunderstorm.
It is interesting to note that some respondents took notice of a variety of trees that would
alarm the befalling typhoons or flashfloods. According to the respondents, the Philippine
rosewood (Petersianthus quadrialatus) trees locally known as the Toog bear fruit when
typhoon comes.
Flashfloods. A small creeping creature of myriapods arthropod which is called by the
Manobo and Higaonon as labod or millipede of class Diplopoda moved to higher grounds
when there was flood. Related studies published by UNEP (2007) shared similarities in terms
of observation of living creatures in typhoon and flood-prone communities. Birds called
Tsubane (swallows) in Japan were keenly observed the quick eating habits and build their nests
at higher grounds. It was an indication that the forthcoming typhoon would be big and strong
with high water surge. This attributes can also be observed from honeycombs. The prediction
was said to be highly accurate.
Akin to the study was the findings of Matowanyika (1994, cited in UNEP: 2007) that
in Swaziland floods are likely to occur when the nesting of the emahlokohloko (Ploceus spp.)
is very high up the trees next to the river. While in Kenya, people were alarmed when the
crocodiles started laying their eggs on river banks at higher ground.
Some respondents had expressed concerns of fewer fish catch during flashfloods. The
fish usually seek refuge underwater to get rid of strong water current. In the case of the riverine
Manobo in Agusanmarsh, they observed the fish usually seeking shelter either in the hyacinths
which were vastly numerous in the marsh or in the forest of the marsh. For this reason, the
175
riverine fishing usually done in the forest area of the marsh during the flood for the fish were
plenty therein.
Heavy rainfalls and floods can also be detected through the growth patterns of the trees.
The respondents observed that Narra (Pterocarpus indicus) trees and Talutu (Bombax spp.) or
wild cotton trees often had shed leaves.
Pest Infestation. The crops like rice were discolored and can never be consumed
because of the unpleasant smell-induced damage caused by pyangaw (Leptocorisa spp) or rice
bug.It damaged rice by sucking out the contents of developing grains from pre-flowering
spikelets to soft dough stage, thus causing unfilled or empty grains and
discoloration(http://www.knowledgebank.irri.org/training/fact-sheets/pestmanagement/insects/item/rice-bug). Other pests mentioned by the respondents were amigas or
ants and stem borerwhichdestroyed the stems and branches of the rice.
Moreover, lowland rodents or field rats had caused heavy loss to crops which greatly
reduced yields. The farmers were alarmed of the impending pest infestation when they saw
rodents on water swam in a row biting each other’s tail and formed like a snake on water. A
similar experience was shared by Higaonon respondent, thus:
Lowland rodents went uphill…you will see them biting each other’s tails like a snake
on water…they were many.
There were times that locusts infested the trees and plants in the farm. Locusts were
short-horned grasshoppers which are common in moist and swampy areas. Particularly, they
are commonly found in all rice environments but they are more concentrated in rain fed areas.
These insect pests feed on the rice foliage at night, for they are nocturnal. At daytime, they hide
at the base of the plant. The adults swarm and migrate when under favorable conditions,
according to Rice Knowledge Bank (http://www.knowledgebank.irri.org/training/factsheets/pest-management/insects/item/short-horned-grasshopper).
Indigenous Survival Strategies
1. Technology coping
Infrastructure. Theriverine Manobo in Agusan, who were sometimes called as “people
of flowing water,” had experienced series of great floods brought about by rain and flood water
from surrounding mountains outpouring the marsh. Considering their long habitation on water,
they learned the ways and moods of the marsh. To live through the harshness of the flood, they
ingeniously built houses on raft termed as “migyo’tow nu ‘bayoy” to float with the water. This
raft has two layers. The lower layer was made of bamboos in three (3) or more bundles. Each
bundle has 50-100 bamboo pieces tied up together with the use of nylon rope. Three (3) or
more huge logs were placed then on the second layer. The wood floors of the house were nailed
on these logs (See Figure 1).
During flashfloods, they tied their homes and along with their neighbors, they
moved to a place where hyacinths were many, an indicator of the absence of sturdy water
current, and the ropes were fastened onto nearby trees. The adult male members stayed
alert and kept adjusting the ropes which were anchored onto the tree when the water rises
to keep their rafts afloat. A Manobotribal leader shared his experience, he said:
We would not sleep at night for we watched the water rises and swam to raise the rope
on higher part of the tree to keep the raft floating. We can only rest when the water
receded.
176
On the other hand, the highland Higaonon would find a place where their families will
be spared from strong winds and typhoons. These were places on lower and clear grounds
which were free from falling trees. Each family build shelter for refuge called botok. It isa gable
roof-like shelter which has four (4) or more pair of posts, which were about 5 feet tall and made
of Tanggili (Shorea spp.) tree, a family of Philippine mahogany trees. The upper edges of each
pair of posts were tied up together with the use of rattan (Plectocomia spp.) knots. The lower
edges were apart, a portion of which were buried firmly on the ground to withstand strong
winds and typhoons. The roof materials were taken from the bark of the tree of the same kind
(See Figure 2).
Prior to the landfall of strong winds or typhoons, the elderly, the children and the spouses were
moved with their important belongings and stock of foods in the botok that each household had
built while the male adults remained at their homes to watch over their livestock and other
tangible properties. During the occurrence of the disaster, these men moved quickly in the
botok for refuge.
For the Higaonon, botok were found to be very essential and effective form of refuge.
An interesting incidence happened during the typhoon Bopha, known in the Philippines as
typhoon Pablo, the strongest tropical cyclone to ever hit the southern Philippine island
of Mindanao last December 4, 2012. A Higaonon elder from Guibonon, Esperanza expressed
well his experience, thus:
We were told by the authority to evacuate for there was an approaching typhoon. We
followed and leave our homestead and went to evacuation center. The evacuation
center fell because of the strong winds brought by the typhoon…It would be alright
then if we rather build ‘botok’ for it was safer.
It can be surmised that these people had developed mechanism making their shelter,
either temporary or permanent, a flood-and-typhoon-resilient. These technologies were
ingeniously conceived and developed through times to withstand the severity of disasters.
(a)
(b)
Figure 1. A typical description of a flood- Figure 2. A temporary gable roof-like shelter
resilient shelter on raft as way of coping by the called botok build by highland Higaonon as
riverine Manobo during the occurrence of flood. refuge when strong winds or typhoons befall
them;(a) side and (b) front views of botok.
Pest control. The riverine Manobo and the highland Hiagonon shared common farming
practices. When the knowledge of the impending pest infestation had reached them, they
hurriedly gathered bugang (Imperata spp.) and burned which produced smoke that drove away
177
pests like pyangaw or rice bugs. The Higanonon called this method as magpaubol.
Another form of mitigating or controlling pest infestation was the use of tubli (Derris
spp).This variety of plant is known to release poisonous extract. It is usually mixed with apog
or ash / powdered limestone and spread to the farm field to repel pests from the crops.
Such indigenous pesticide has in common with the pest control practices of a subgroup
of Ifugao tribe in the Northern Philippines. They used certain local plants with bitter or
unpleasant taste as remedy to eliminate pests and diseases of plants (Dolom and Serrano, 2005).
Farming management. For food security and to lessen the possibility that the entire
harvest may be lost, the Higaonon practiced multi-cropping and land fragmentation. They were
cultivating more than one crop and each crop has got different span of growth and harvesting
time in widely scattered parcels, hence a continuous yields of crops may result.
The riverine Manobo, on the other hand, took advantage of the richness of the soil by
planting maize or corn as their main crop during dry season or engaged in fishing in the swamp
forest where fishes would seek refuge during the flood.
Food Storage. To avoid food from spoiling and at least last for a day or two, these
indigenous people cooked rice and wrapped in banana leaves. Or when time allows, they
prepared cassava root crops which are grated, wrapped in banana leaves and steamed. This is
termed as pinutos nu kuonon by the Manobo or kimam-o by the Higaonon. Though it is not
difficult to cook but wrapping the bundles in banana leaves can be time consuming. Such
preparation would not be wise in case of emergency instead they simply washed and steamed
the root crops right away. For the Manobo, the fish which were spared from the bountiful catch
during rainy season will be dried or smoked as a way of preserving them and would serve as
source of food during the flood.
As much as possible, the Manobo and Higaonon stored plenty of root crops e.g, camote
(Ipomea batatas) or sweet potato and cassava (Manihot esculenta); rice grains and other food
that would last for long period of time and that would sustain them during disaster crisis.
However, when food was found in scarcity, their forest became the source of wild food plants
and animals. As noted by Diaz (cited in Polinag, 2003), many indigenous groups and upland
people often depend on these wild food plants for their subsistence. The Higaonon elders have
identified some of these varieties, namely:panoon (Hornstedtia conoidea), agutay (Musa
errans) or wild banana, kalipe or rattan fruits, ubod or rattan shoot, balon saging or fruit of the
wild vine, balangas (Nephelium mutabile), ube ihalas (Dioscorea alata) and other varieties
that would be eaten by wild boar as edible plants.
The respondents also mentioned edible insects like dugos or honey and‘bayoy tu
putyukan’or honeycombsand batod, wang-wang / takii or edible larva. They made mentioned
of baboy ihalas (Sus philippinses) or wild boar/pig and manok ihalas (Gallus spp.) or wild
rooster as the common source of animal protein in the forest.
2. Religious coping
Religion is essential part of the life of the indigenous people. Great events that happened
in their lives were consecrated by formal, and often public, religious rites. This includes
hunting, planting and harvesting, marriage, pregnancy of the wives, death, burial, and war
among others (Garvan, http://www.gutenberg.org/ebooks/18607).
As shared beliefs of the Manobo and Higaonon, religious rites performed by the baylan
called as pangapog or panawagtawag were often mentioned by the elder respondents as
essential religious rites to gain favor from themagbabaja or the God the Father,the Creator of
178
Heaven and Earth. The latter was summoned to mediate or reconcile people with the nature
spirits who caused the occurrence of disaster.
When farm, for example, was in danger of pest infestation, religious rites were
performed by the baylan as a form of petition to spare the crops from complete destruction and
therefore losing their yields. A parallel study was conducted among the Hanunoo Mangyan of
Mindoro Island province of Central Philippines. They believe that people’s acts result to natural
calamities for which conciliations have to be offered to the appropriate deities. For instance,
they offered food for the spirit of water when there were droughts (Peralta, 2013).
3. Social coping
Mostly, these people find relief with family members helping one another’s burden.
The father was the one who did the hard labor from harvesting, building shelter to securing
settlement when disaster was approaching. After the occurrence of disaster, he, together with
other male members of the household, fixed the damaged materials misfortune by the disaster.
Lighter chores were done by the female members such as preparing food and securing children
in a safe settlement.
Kinship connection has an important bearing in their social life. They usually shared
common ascendants and their concerns of general welfare of the community were almost equal
with the way they treat their immediate family members. When the elder respondent was asked
on his usual activity after disaster, he said:
We resumed for work to earn a living…we extended hands when neighbors needthem
in fixing their houses...we shared our food with them.
Bayanihan, among the core Filipino value, was a culturally specific coping practice.
Bankoff (2003) defined the concept of bayanihan as not only unity or togetherness but it has
the connotation of shared identity and common association. This has been strengthened since
the Manobo and Higaonon form part in their practices a communal resource sharing. When
one has expertise distinct of his/her own or any produce yield of crops or as a result of gaming
activity, that individual shared them with other members in the community village. Other form
of community mobilization was the information dissemination and areas settlement or
relocation identified and spearheaded by the tribal leader.
Conclusion
The Manobo and Higaonon developed distinct ways of coping threats posed by natural
disasters. It is manifested through their ability to predict impending disaster and their capacity
to build typhoon-and-flood resilient dwellings which have been tested over generation.
Having relatively large extent of role, their religious priests were highly regarded as
essential instruments in foretelling disasters that might occur. Indigenous mechanism on pest
control, land fragmentation and wild food plant collection as a form of economic subsistence
sustained these people in the midst of disaster. Recognizing their indigenous knowledge in
disaster risk reduction provides better understanding of their condition.
For future researches, there will be documentation and preservation of their relevant
best practices; inclusion in both local and national government programs on disaster risk
reduction; and integration in school curriculum as local resource materials. Similar studies may
be undertaken to see patterns of transmission of these indigenous survival knowledge to the
179
next generations. Revisit the framework governing Local Disaster and Risk Reduction and
Management program and its impact to the existing indigenous survival practices.
References
Bankoff, G. (2003). Cultures of Disasters: Society and Natural Hazard in the Philippines.
RoutledgeCurzon: London.
Creswell, J. W. (1998). Qualitative inquiry and research design: choosing among five
traditions. Thousand Oaks: SAGE Publication, Inc.
Dolom, B.L., Serrano, R. (2005). The Ikalahan: traditions bearing fruit. In: Durst,
P.B.,Brown, C., Tacio, H.D.& Ishikawa, M. (Eds.), In Search of Excellence:
Exemplary Forest Management in Asia and the Pacific. RAP Publication.
Elvin, M. (1998). “Who Was Responsible for the Weather? Moral Meteorology in Late
Imperial China”,Science, Technology, and Medicine in East and Southeast Asia,
Osiris, 2nd Series, Volume 13, University of Chicago Press; USA, viewed 9 November
2014,http://teach311.org/2014/Article-who-was-responsible-for-the-weather-moralmeteorology-in-late-mperial-china/.
European Union, ISDR, Kyoto University, and Seed. (2009). Indigenous Knowledge.
Disaster Risk Reduction. Policy Note,viewed 9 November
2014,http://www.unisdr.org/we/inform/publicaitons/8853.
Garvan, J. M. The Manobos of Mindanao,viewed 14 July
2014,http://www.gutenberg.org/ebooks/18607.
Patton, M.Q. (1990). Qualitative Evaluation and Research Methods. 2nd Edition, London:
Sage Publication.
Peralta, J. T. (2013). PINAGMULAN. Enumerations from the Philippine Inventory of
IntangibleCultural Heritage. NCCA and ICHCAP Manila, Philippines,
www.ichcap.org.
Polinag, M. A. (2003). Food from the Wilderness. Ecosystem and Research Bureau.
Department of Environment and Natural Resources College. Laguna 4031, viewed 19
November 2014,http://erdb.denr.gov.ph/publications/denr/denr_v12.pdf.
Rice Knowledge Bank. Your information source for rice farming, viewed 18 November
2014,http://www.knowledgebank.irri.org/training/fact-sheets/pestmanagement/insects/short-horned-grasshopper.
Scott, W. H. (1997). Barangay. Sixteenth Century Philippine Culture and Society. Ateneo de
Manila University Press: Philippines.
UN/ISDR (United Nation/International Strategy for Disaster Reduction). (2008). Indigenous
Knowledge for Disaster Risk Reduction: Good Practices and Lessons Learned from
Experiences in the Asia-Pacific Region. Bangkok, Thailand.
UNEP. (2007). Environmental Emergencies News. Issue 6 April 2007, pp. 2-3, viewed 9
October 2007, http://www.unep.or/DEPI/PDF/EESnewsletterissue6.pdf.
UPLPB Research Development and Extension, viewed 18 November
2014,http://ovcre.uplb.edu.ph/index.php?option=comjoodb&view=article&joobase=2&id=22:derris-tubli-roots-for-the-control-of-goldensnail&Itemid=209.
180
Warren, D. M. (1992). "Indigenous knowledge, Biodiversity Conservation andDevelopment."
Keynote Address atInternational Conference on Conservation of Biodiversity in
Africa: Local Initiatives and Institutional Roles. Nairobi, Kenya August 30 September 3, 1992.
Wingard, J. and Anne-Sophie B. October 11, 2013. Philippines: A Country Prone to Natural
Disasters, viewed 27 July 2014, http://dw.de/p/1AF24.
181
EFFICIENCY OF CORNSTALK AND SNAKE PLANTS ABSORB
CARBON DIOXIDE IN OFFICES
Pajaree Thongsanit1, Kanyarat Boontim2, Chonnikan Jantako3 and Nisarat Sukpai 4
1
Center of Excellence for Energy Technology and Environment and Department of Civil Engineering,
Faculty of Engineering, Naresuan University, Phitsanulok
2, 3, 4
Faculty of Engineering, Naresuan University, Phitsanulok
Abstract
The aim of this research was to measure the concentration of carbon dioxide absorb by
cornstalk and snake plants. The measuring time was done during working time 8.30 am to 4.30
pm, at three different size offices. The first room was the academic affair at engineering
building with volume of room is360 m3. The second room was the secretary office of civil
engineering department with volume of 192 m3. The third room was controlled room, empty
room with the volume of 165 m3. The different numbers of cornstalk and snake plants were
used. The result found that the academic affairs, 360 m3, with three staffs and 25-35 visitors
per day used the one cornstalk plant and four snake plants. The secretary office of civil
engineering department, 192 m3, with two staffs and 30-50 visitors per day used one cornstalk
plant and five snake plants. The controlled room, empty room, found that the three cornstalk
plants and one snake plants. The percentages of carbon dioxide absorption of three rooms were
25.72, 29.42, and 39.00, respectively. The data can be used forthe future research and applied
to the other offices and houses.
Keywords: cornstalk plant, snake plant, Carbon dioxide, offices
Introduction
Carbon dioxide affects the health of people who work in the office. The high
concentration of carbon dioxide in office will affect the health of the occupants and the work
performances of the staffs were down. Many researchers studied the houseplants improved
indoor air quality and carbon dioxide in the offices. Plants absorbed the Carbon Dioxide
indoor air environment of both offices and houses. 1-4 The study of Phonthawat and
Pasinee,those studied the four types of houseplants absorbed Carbon Dioxide in home under
system was close chamber.5-6 The study of cornstalk plant and snake plants absorb carbon
dioxide in the Naresuan University’s offices was done under the green university project.
Therefore, it is interesting to study the cornstalk and snake plants absorb carbon dioxide in
the office and the optimum numbers of plants were used for the different size of rooms.
Objectives
1) To providing the better life quality when staff working in university.
2) To study on the optimum numbers of plants were used for the differentof rooms’ size.
182
Research Methodology
The cornstalk plant, Dracaena fragrans massangeana, (figure. 1 (A)) is a native
flowering plant species throughout tropical Africa, 7 the plants use for these experiments were
one year old. The bunch sizing was approximately 50 cm, the plants height were 60 to 80 cm.
These plants grow in the plastic pots diameter of 30 cm. The weight of soil were five
kilogram, consisting of 50% of soil, 20% of coconut fiber, 10% of therain tree leaf and 10%
of the fertilizer and 10% of black rice husk. Snake plant, Sansevieriatrifasciata., (figure. 1
(B)) is a native species of flowering plant in the family Asparagaceae, throughout tropical
west Africa,8 The plants use for these experiments were one year old and the bunch sizing
was approximately 60 cm, the plants height were 60 to 80 cm. These plants grow in the
plastic pots diameter of 30 cm. The weight of soil was 4.2 kilogram .5 which consisting of
50% of soil, 20% of coconut fiber, 10% of the rain tree leaf and 10% of the fertilizer and 10%
of black rice husk.
(A)
(B)
Figure 1. Cornstalk plant(A) and Snake plant (B)
Study of Carbon dioxide absorption by plant samples
1. Carbon dioxide concentration was measured one point in the office without the
plants on Monday to Friday for ten days during working hours 8.30amto4.30 pm.
2. Calculate the number of the cornstalk and the snake plant use in the room. The
parameters of design were different room sized and carbon dioxide concentration in a room.
The calculate was follow Phonthawat’s, Somprasong’s and Phatthaporn’s research. 5,9-11The
effective of Carbon dioxide absorption of cornstalk plant and the snake plant were 1.50 and
0.49 ppm/m3/sec. in the closed system.
3. The cornstalk and the snake plant set in the rooms for one week to adjust the air
environment. Then measure the concentration of carbon dioxide from Monday to Friday for
five days during working hours 08.30 am to 4.30 pm.
4. The number of the plants used in the room set in table 1.
183
Table 1. The number of the cornstalk plants and the snake plants were used in the rooms
Controlled room
Civil Engineering
Academic affair
(Empty room)
Secretary office
office
Period
Cornstalk
Snake
Cornstalk
Snake
Cornstalk
Snake
(Pot)
(Pot)
(Pot)
(Pot)
(Pot)
(Pot)
Week 1
3
1
2
1
2
1
Week 2
3
1
2
1
2
1
Week 3
2
2
2
2
1
2
Week 4
2
2
2
2
1
2
Week 5
2
3
1
3
1
3
Week 6
2
3
1
3
1
3
Week 7
1
4
1
4
1
4
Week 8
1
4
1
4
1
4
Week 9
1
5
1
5
1
5
Week 10
1
5
1
5
1
5
5. Carbon dioxide, the air in office pumps into Sodium Hydroxide (NaOH) solution of 0.7 M
with 500 ml for 8 hours. The CO2 level is measure from the Sodium Hydroxide (NaOH)
solution.
Academic affairs office
Controlled room
Civil engineering secretary office
Figure 2. Layout of the cornstalk plants and the snake plants culturedin the rooms
184
Results/ Discussion
The initiated concentration levels of carbon dioxide (CO2) in controlled room (165
m ), academic affair office (360 m3) and civil engineering secretary office (192 m3) were
662.9, 655.4and 618.7ppm. The effective of CO2 absorption in control room was shown in
table 1. The effective carbon dioxide absorbed by cornstalkand snake plant was slowly down
in ten day. The highest carbon dioxide absorption was used three cornstalks and one snake
plant. The highest carbon dioxide absorption was 1.033 ppm/m3/sec.
3
Table 2 The effective of Carbon dioxide absorption byplants cultured in controlled room
Carbon dioxide absorption
(ppm/m3/sec)
No of plants
Cornstalks 3 pot
Cornstalks2 pot
Cornstalks2 pot
Cornstalks1 pot
Cornstalks1 pot
Snake plant 1 pot
Snake plant 2 pot
Snake plant 3 pot
Snake plant 4 pot
Snake plant 5 pot
1
0.030
-0.050
0.371
-0.226
-0.27
2
0.201
0.156
0.443
-0.116
-0.07
3
0.208
0.165
0.481
-0.084
-0.01
4
0.244
0.225
0.498
-0.062
-0.03
5
0.311
0.293
0.506
-0.056
0.008
6
0.381
0.328
0.545
0.073
0.014
7
0.624
0.334
0.598
0.275
0.312
8
0.884
0.372
0.605
0.304
0.334
9
0.924
0.535
0.732
0.461
0.379
10
1.033
0.703
0.828
0.521
0.456
Day
The effective of CO2 absorption in academic affairs office was shown in table 2. The
highest carbon dioxide absorption was used one cornstalkand five snake plant. The highest
carbon dioxide absorption was 0.536ppm/m3/sec.
185
Table 3 The effective of Carbon dioxide absorption byplants cultured
in academic affairs office
Carbon dioxide absorption (ppm/m3/sec)
No of plants
Cornstalks 2 pot
Cornstalks1 pot
Cornstalks 1 pot
Cornstalks1 pot
Snake plant 1 pot
Snake plant 2 pot
Snake plant 3 pot
Snake plant 4 pot
1
0.097
0.025
-0.010
0.045
2
0.213
0.183
0.071
0.153
3
0.231
0.188
0.103
0.171
4
0.291
0.219
0.119
0.171
5
0.302
0.222
0.152
0.193
6
0.373
0.233
0.162
0.211
7
0.381
0.276
0.265
0.464
8
0.424
0.298
0.384
0.485
9
0.467
0.319
0.403
0.504
10
0.478
0.330
0.453
0.536
Day
The effective of CO2 absorption in civil engineering secretary office was shown in table
3. The highest carbon dioxide absorption was one cornstalkand five snake plants.
The highest of carbon dioxide absorption was 1.257ppm/m3/sec.
186
Table 4 The effective of Carbon dioxide absorption ofplants in civil engineering
Secretary office
Carbon dioxide absorption (ppm/m3/sec)
No of plants
Cornstalks 2 pot
Cornstalks2 pot
Cornstalks 1 pot
Cornstalks1 pot
Cornstalks 1 pot
Snake plant 1 pot
Snake plant 2 pot
Snake plant 3 pot
Snake plant 4 pot
Snake plant 5 pot
Day 1
-0.110
-0.010
0.213
-0.080
0.615
Day 2
0.147
0.190
0.365
0.019
0.663
Day 3
0.191
0.205
0.402
0.019
0.669
Day 4
0.232
0.234
0.407
0.045
0.676
Day 5
0.280
0.288
0.435
0.056
0.747
Day 6
0.398
0.309
0.463
0.072
0.771
Day 7
0.617
0.493
0.469
0.380
0.771
Day 8
0.658
0.657
0.517
0.517
0.936
Day 9
0.794
0.700
0.629
0.546
1.091
Day 10
0.795
0.772
0.723
0.581
1.257
Day
Conclusion / Recommendations
The difference in numbers of cornstalk plant and snake plant were used. The result
found that the academic affairs, 360 m3, with three staffs and 25-35 visitors per day used the
one cornstalk plant and four snake plants. The secretary office of civil engineering department,
192 m3, with two staffs and 30-50 visitors per day used one cornstalk plant and five snake
plants. The controlled room, empty room, found that the three cornstalk plants and one snake
plant. The percentages of carbon dioxide absorption were 25.72, 29.42,and 39.00, respectively
at three rooms.
Acknowledgements
This paper presentation was funded by the Center of Excellence for Energy Technology
and Environment, Faculty of Engineering, Naresuan University, Phitsanulok, Thailand. The
research was funded by Neresuan University. The authors wish to thank the staffs of the
department of civil department engineering and staffs of air pollution research unit research for
their support and provide research equipment. Thanks Mrs Wichya Imkrajang and Mr.
Thapanan sirichodoc who the sciencetist and graduated master student at faculty of
engineering, Naresuan university. Phitsanulok, Thailand.
187
References
Dracaena fragrans, Cornstalk Plant, Wikipedia, http://en.wikipedia.org/wiki/.Dracaena
fragrans, access 8/2/2558.
Jewyou, P. & Kunktaisong, A. (2012). Snake plant absorbs carbon dioxide in the offices,
Thesis of bachelor degree, Naresuan University, Phitsanulok, Thailand.
Kobayashi, K. D., Kaufman, A. J., Griffis, J.& McConnell,J.(2007). Using houseplants to
clean indoor air, Ornamentals and flowers, Collage of tropical agriculture and human
researches, University of Hawaii, Honolulu, Hawaii, USA, Dec, 2007.
Pegas, P.N., Alves, C.A., Nunes, T., Bate-Epey, E.F., Evtyugina, M.& Pio, C.A. (2012).
Could houseplants improve indoor air quality in schools?www.researchgate.netaccess.
8/2/2015.
Sansevieria trifasciata, Snake Plant, Wikipedia, http://en.wikipedia.org/wiki/.
Sansevieria_trifasciata, access 8/2/2558.
Su, Y. M.& Lin, C. H. (2013). CO2 purify effect on improvement of indoor air quality (IAQ)
through indoor vertical greening, Proceeding of the world congress on
Sunakorn, P. (2010). Capacity to absorb carbon dioxide, the ivy
walls.http://biofacade.com/Abstract08_THA.html, access 10/20/2013.
Tarran,J., Torpy, F.& Burchett,M.(2007). Use of Living pot-plants to cleanse indoor airresearch review, proceeding of sixth international conference on indoor air quality,
ventilation & energy conservation in buildings- sustainable built environment, Oct 2831, 2007, Sendai, Japan Volume III, 249-256.
Thongrod, S. &Tesprom, S. (2012). Cornstalk plant absorb carbon dioxide in the offices,
Thesis of bachelor degree, Naresuan University, Phitsanulok, Thailand. engineering
2013, Vol. II, WCE 2013, July 3-5, (2013), London, U.K.
Thongsanit, P., Thongrod, S., Tesprom,S., Sririchodok,T.& Imkrajang, W.(2012). Cornstalk
Plant and Absorption of Carbon dioxide in the Offices, The proceedings of
8thNaresuanAnnual EnvironmentalConference,July26, 2012, Naresuan University.
Wongruk, P. (2010). Performance of the plant to reduce carbon dioxide. Thesis master
degree, Kasetsart University, Bangkok, Thailand.
188
THE NEEDS DEVELOPMENT OF CREWMEN SKILL IN PATROL
BOATS OF SUB-DIVISION 6, MARINE POLICE DIVISION
Prathueang Srilamontri 1, Chusak Akepetch 2 and Poonchat Vichaidit 3
1, 2, 3
Master of Public Administration of Suratthani Rajabhat University
Abstract
The research “The needs development of crewmen skill in patrol boats of sub-division
6, Marine Police Division” aimed to investigate the needs and to propose the model for the
operation on the patrol boats. The tools for data collection were surveys and a group discussion.
The data was collected from the crewmen of the patrol boats. It was then analyzed with the
basic statistical tools such as mean score, and standard deviation. The hypothesis was tested
with t-test and F-test.
The results indicated that the mean score of the needs for skill development in patrol
boats was in the high degree. When examining the needs in more specific details, it was found
that every task also needed the skill development in the high degree – with basic seamanship
being the most needed skill development and followed by basic navigation, boat machinery,
and rope and knot tying. The comparison of the needs for skill development and personal
characters suggested that there was a statistical difference of 0.05.These characters included
age, educational background, work experience, and patrol boat operational course experience.
However the different working stations did not appear to be a significant factor. The summary
of the group discussion showed that there were important basic skills for the 4 major tasks on
the patrol boats – basic seamanship, basic navigation, boat machinery, and rope and knot tying.
Furthermore there were also other important factors which were crucial for the crewmen on the
patrol boats. These factors included the maritime law, physical ability of the crewmen, and
teamwork. The crewmen on the patrol boats should be theoretically and practically trained.
Keywords: development, crewmen skill, Marine Police
Introduction
Human is considered world’s most valuable resource. When trained to its potential,
human will be the creator and saviour of the world. On the opposite pole, if human is trained
otherwise, they will destruct the environment and eventually obliterate themselves. Today
some academic scholars pose more emphasis on human than the organizational management.
This indicates that human is seen as a crucial factor of the success or failure of the organization.
People hence attempt to explore ways to efficiently develop the human resource. Thailand’s
National Economic and Social Development Plan 9 (2002-2006) envisaged the country’s
development scheme and its direction by highlighting human the resource development; as the
human resource is believed to be the key to every success. The main strategy of the Plan was
the development of society’s fundamental skills through the development of families,
communities and societies. Furthermore the Royal Thai Police also has human resource
management policy 2014-2023. This policy views that the environmental factors rapidly
change. Hence the modern human resource management ought to compose an administrative
framework respecting the organization’s strategies. The framework must maximize the
potentials of personnel to drive the organization’s strategies; to support the constant and future;
and to achieve the organization’s vision (Royal Thai Police 2014).
189
In the public administration sector, the administrators need their personnel to be
constantly self-developed. These self-developed personnel tend to be well prepared for
impulsive changes. Hence the organizations which employ this type of personnel are liable to
improvement. Apart from the organizations themselves, self-development is responsible for
career advancement. Being self-developed means the preparation for a competition in a highly
competitive environment. Work opportunities are always available for the efficient workers
who are equipped for every challenge (Maneepong Wayuchoey 2013:4).
The Sub-division 6, Marine Police Division, Central Investigation Bureau is the only
division within the Royal Thai Police which is responsible for the crime suppression in the
Thai jurisdictional waters. It has patrol boats and major operational devices. Its responsibilities
include protection of life and property. In order to do so, prudent crewmen with significant
seamanship knowledge are essential. Though there is training offered to the crewmen, but with
a number of restrictions, merely 30 crewmen can be trained annually. This is considered
inefficient (Sub-division 6, Marine Police Division, 2014).
The previously discussed problems intrigued the researcher to develop the skills of the
crewmen – previously trained and untrained. Such development only promotes the necessary
operational skills of the crewmen, but also helps endorse the trustworthy image of the Marine
Police.
Objectives
This research aims to examine the needs for operational skill development in the patrol
boats. This is conducted through an investigation of the personal characters of the crewmen.
The results are then used to offer suggestions for the operation in the patrol boats of the Subdivision 6, Marine Police Division.
Research Methodology
This research adopts a mixed method – quantitative and qualitative methods.
1. Investigating the management system relating to the crewmen. This includes
practices and regulations such as administration, human resources, welfare, appraising, and
annual boat restoration. The data collected is analyzed and used for group discussion.
2. Designing questionnaire for data collection from the crewmen. The questionnaire is
reviewed and revised by the researcher, advisors and experts. The questionnaire comprises 3
parts – personal background of crewmen, needs for skill development, and suggestions from
crewmen.
3. Statistically analyzing data using a computer program. The data is analyzed using
frequency, mean score, and standard deviation. The hypothesis is tested with t-test and F-test.
The pairwise comparison is tested with LSD. The results are later used for group discussion.
4. Group discussing between the participants and researcher. The assistant of the
researcher inserts discussion topics which previously obtained; and the participants discuss
accordingly. The participants are encouraged to contemplate the skill development of crewmen,
and its accomplishment, as well as to summarize the suggestions for such development.
Results
The Sub-division 6, Marine Police Division uses the Thai abbreviation “กก. 6 บก. รน. ”.
It is situated at 166 Namuang Road, Muang, Surat Thani. The division has 183 police officers
and 88 crewmen. The major roles of the crewmen are not merely restricted to the patrolling.
190
Their roles also include administration, crime suppression, security and special affairs, law and
inquiry, and internal affairs. An illustration of the responsible areas of the sub-division 6 is
displayed below.
Figure 1: Responsible areas of the Sub-division 6, Marine Police Division
Source: Navigation maps surveyed by the Hydrographic Department, Royal Thai Navy,
numbers 203, 204, and 205
The data shows that the majority of crewmen age between 41-50 years with no graduate
degree. They are on duty at the Marine Police Station 1 and have more than 10 years
experience. They have also attended the patrol boat operation lessons.
The mean score of the needs for development is ranked ‘high’. When considering
closely, every skill is also ranked ‘high’ with basic seamanship being the most needed skill.
The second most needed development is in the areas of basic navigation, boat machinery, and
rope and knot tying accordingly. The comparison of the needs for skill development and
personal characters is displayed in Table 1.
191
Table 1: Comparison of the needs for skill development
Personal character
Age
Education
Station
Work duration
Experience
Needs for skill development
Seamanship
Navigation
*
*
*
*
*
Machinery
*
-
Rope
-
All
-
*Sig. < 0.05
The group discussion indicates that there are 4 major tasks on the patrol boats – basic
seamanship, basic navigation, boat machinery, and rope and knot tying. In addition there are
also other crucial factors for the crewmen of the patrol boats. These factors are the knowledge
of maritime law, physical ability, and teamwork. Also these crewmen should be theoretically
and practically trained in order to best operate and serve the community.
Discussion
This section discusses different aspects of the findings.
1. It is found that 36% of the crewman participants do not have bachelor degree. This
data confirms the study by Sophon Chang-Glang (2013:123) which investigated the needs for
professional development of the Thai Border Patrol Police. One possible reason for this fact is
that in the past, higher degree was not a recruitment requirement. Hence the majority crewmen
of the Sub-division 6, Marine Police Division who age between 41-50 years were not required
to complete bachelor degree. Educational institutions in Thailand lacked higher degrees in the
past. Therefore some Thais sought this type of education in other countries. However now
many educational institutions offer a number of post-graduate degrees across different fields.
These degrees offer professional development and are opened to any interested professionals.
2. The study also uncovers that the crewmen urgently need skill development in the
basic boat maintenance. This is because the boat maintenance requires specialist skills and
techniques, physical endurance, patience, orderliness, and high professional experience. The
boat maintenance is utmost important because it not only helps extend the useful life of the
boat but it is also cost-effective to manage. Lastly if the crewmen maximize their boat
maintenance skills, they can potentially utilize these skills to offer services to other outside
institutes.
3. The investigation discovers that different ages, educational levels, lengths of service,
and experiences in patrol boat training affect the needs for development statistically. This is
common as education and experiences influence one’s viewpoints. For that reason, the policy
of the Sub-division 6, Marine Police Division should embrace the education aspect to be
accurately relatable to the needs of the crewmen.
4. The group discussion suggests practical information for skill development of the
crewmen. It presents the needs for various skills such as basic seamanship, basic navigation,
boat machinery, and rope and knot tying. The content of each of these subjects is relevant to
the operation in the patrol boats, yet it cannot be included and taught simultaneously. This is
because each subject requires practicum in conjunction with the theoretical training – which is
time consuming. And so this research merely accumulates and presents necessary aspects for
the development of crewmen.
192
Recommendations
The study yield possible valuable information for the Sub-division 6, Marine Police
Division and other relevant organizations. The information is discussed here.
1. Due to the type of operation, it is necessary for the crewmen to be physically fit and
always be prepared for the duty. Hence the crewmen should be encouraged by the division to
do so by attending regular heath examination and physical fitness. The division can also fully
promote the crewmen’s fitness by constructing a fitness centre.
2. The crewmen should be encouraged to obtain higher education. Though it may not
be directly relevant to the operational tasks on the patrol boats, but it helps the crewmen with
better understanding of the community and technology. This will ultimately assist the future
operation. Furthermore higher education and academic researches help develop academic and
professional knowledge and essential for the position advancement.
3. According to the results of needs for skill development, the Sub-division 6, Marine
Police Division should offer regular basic navigation and boat repairing courses. Today there
is not adequate boat skill development training. Moreover some marine police officers have no
real experience in the patrol boats. Therefore the Sub-division 6, Marine Police Division needs
to take immediate actions by cooperating with the Merchant Marine Training Centre, Logistics
(Nautical Science) Department, Burapha University, and the International Maritime College
Kasetsart University. For basic diesel machines, the Sub-division 6, Marine Police Division
can provide a manual or a training course of the basic diesel machines for the crewmen. This
is to set a standard and mutual understanding between all the crewmen.
Acknowledgements
Possible investigation in regards to this research includes an inquiry of operational
problems and obstacles in patrol boats of the Sub-division 6, Marine Police Division. An
examination of satisfaction of the crewmen, their training, and curriculum design of the Subdivision 6, Marine Police Division and other divisions can also be further explored.
References
Chang-Glang, S. (2013). Needs of Self Development for Border Patrol Police. Bangkok :
Border Patrol Police Headquarters.
Hirantirapon, P. (2012). Organizational Personnel Development. Bangkok : S.R.
Kitcharoon, W. (2007). Organizational Personnel Development and Training. Bangkok :
Bannakij 1991.
Marine Police, Workforce. (2014). Training of Fusion Torch 09-1. Bangkok : Marine Police
Division.
Montarak, Ch. (2012). Training Package for Motor Maintenance. Mechanical Engineering
Program Master Degree Thesis of King Mongkut’s University of Technology North
Bangkok.
Royal Police, Bureau. (2014). History of Marine Police. Bangkok : Marine Police
Headquarter.
Wanitbancha, K. (2008). Variable Analysis with SPSS for Windows. Bangkok :
Chulalongkorn University.
Wayuchoey, M. (2013). Management and Organizational Behavior (4th edited). Bangkok :
H.N.
Yotsomsak, S. (2005). Human Resource Management. Bangkok : M.T.
193
GENE EXPRESSION ANALYSIS OF MELANIZATION INHIBITION
PROTEIN (MIP) GENE FROM BLACK TIGER SHRIMP
PENAEUS MONODON
Noothuan, N.1, Amparyup, P.2, Tassanakajon, A.3
1, 2, 3
Center of Excellence for Molecular Biology and Genomics of Shrimp, Department of
Biochemistry, Faculty of Science, Chulalongkorn University
2
National Center for Genetic Engineering and Biotechnology (BIOTEC), National Science and
Technology Development Agency (NSTDA)
Abstract
Melanization, which is activated by prophenoloxidase (proPO) system, is an important
immune response in invertebrates. The melanization cascade is controlled by proteinase
inhibitors and melanization inhibition protein (MIP) to prevent excessive production of reactive
intermediates that might be harmful to host cell. Here, the full-length cDNA of PmMIP with
complete open reading frame was isolated using RACE-PCR and showed that the deduced
amino acid sequence shares high homology (80%) to MIP of crayfish Pacifastacusleniusculus.
The PmMIP cDNA consists of a 957 bp open reading frame (ORF) encoding a 318 amino acid
protein with predicted molecular mass of 35.9 kDa and pI of 5.5. The phylogenetic tree clearly
indicates that the PmMIP was more closely related to crayfish MIP than other fibrinogenrelated proteins. Tissue distribution of PmMIP by RT-PCR indicated that PmMIP was mainly
expressed in gills, intestine, and muscle. Quantitative real-time RT-PCR showed PmMIP
mRNA expression in gills and that after bacterial Vibrio harveyi challenge was down-regulated
at 24 h post infection. The results suggested that PmMIP might play a role in shrimp immunity
to bacterial infection.
Keywords: Melanization inhibition protein, Penaeus monodon, prophenoloxidase system
Introduction
The prophenoloxidase (proPO) system is a major innate immune response in
invertebrates which produce melanin called melanization (Cerenius & Söderhäll, 2004;
Söderhäll & Cerenius, 1998; Cerenius et al., 2008). The system is activated by pattern
recognition proteins (PRPs) that recognize microbial cell wall components such as
lipopolysaccharide, β-glucan, and peptidoglycan and lead to activate serine proteinase cascade.
The final activation of serine proteinase cascade produces the active prophenoloxidase
activating-enzyme (PPAE) to convert the key enzymeproPO, zymogen form, to active PO.
Then the PO catalyzes the phenolic compounds to reactive intermediate quinones and melanin
for killing and trapping the invading microorganism (Cerenius & Söderhäll, 2004; Iwanaga &
Lee, 2005; Kanost & Gorman, 2008; Sritunylucksana & Soderhall, 2000). However, the
production ofquinone can be dangerous to host cell. Hence, this system needs to be regulated
by several inhibitors such as pasifastin (Liang et al., 1997) and serpins (Wang & Jiang, 2004;
Homvises et al., 2010; Sommuk et al., 2012). Previously, a 43-kDa protein from beetle
Tenebriomolitor has been found to act as an inhibitor of melanin synthesis called melanization
inhibition protein (Zhao et al., 2005). In crayfish Pacifastacusleniusculus, MIP was also
194
discovered and PlMIP has the similar function as TmMIP (Söderhäll et al., 2009). Recently,
PmMIP from black tiger shrimp was identified from an intestine cDNA. The gene expression
was studied in different developmental stage and tissues (Angthong et al., 2010).
In this study, MIP from black tiger shrimp Penaeusmonodon was further characterized.
Tissue distribution and gene expression response to bacterial infection were examined.
Research Methodology
Shrimp and microorganism preparation
Shrimps were obtained from Suratthani province and reared in seawater (20 ppt) at least
7 days before experiment. V. harveyi 639 was cultured in tryptic soy broth (TSB) containing
2% NaClat 30°C overnight and inoculated in TSB (2% NaCl) for 2 h. The bacterial
concentration was established by estimating the optical density (OD) at 600 nm.
RNA extraction and first strand cDNA synthesis
Tissues from shrimp (hemocytes, heart, hematopoietic tissue, gills, hepatopancreas,
fore and mid gut, hind gut, lymphoid organ, and muscle) were collected and snap-frozen
toextract for the total RNA by TRIZOL reagent according to the manufacturer’s protocol. First
strand cDNA were synthesized using Thermo ScientificTM RevertAidTM First Strand cDNA
Synthesis according to the manufacturer’s instructions. The cDNAs were stored at -20 °C until
required for experiments.
Rapid amplification of cDNA ends (RACE) and cDNA cloning
Gene-specific primers were designed from nucleotide sequence of P.monodon EST
database to amplify the full-length cDNA of PmMIP. Total RNA from gills was used to
performed 3’ and 5’RACE cDNA susing SMARTerTM RACE cDNA Amplification Kit. The
PCR products were separated by agarose gel electrophoresis, and then the expected size bands
were excised and purified using Qiagen DNA Purification kit. The purified fragments were
cloned into pGEM-T Easy vector and sequence. Finally, a single-fragment amplification of
each full-length cDNA was carried out by PCR using the primers and Pfu DNA polymerase
(Promega, USA). The PCR product was cloned and sequenced in both directions to obtain the
complete consensus sequence.
Sequence analysis
The cDNA and deduced amino acid sequence of PmMIP were analyzed with the
GENETYX 7.0.3 program (GENETYX Corporation). The sequence alignment was performed
by ClustalW multiple sequence alignment program (http://www.ebi.ac.uk/Tools/ clustalw2/).
The putative signal peptide and domain were predicted by the simple modular architecture
research tool SMART version 4.0 (http://www.smart.emblheidelberg.de/).
Phylogenetic tree analysis
The sequence of PmMIP was performed the phylogenetic tree with other fibrinogen
proteins in arthropods. The amino acids sequences were obtain from NCBI database and
analyzed by MEGA 6 program using neighbor-joint method.
Tissue distribution
The total RNA from different shrimp tissues (gills, hemocytes, heart, hepatopancreas,
muscle, and lymphoid) were analyzed for the expression by semi-quantitative RT-PCR using
PmMIP specific primers and EF1 as an internal control. The PCR condition was 94 °C for 1
min, 30 cycles of 94 °C for 30 sec, 55 °C for 30 sec and 72 °C for 30 sec, and then a final
195
extension at 72 °C 5 min. PCR products were analyzed by 1.8% agarose gel electrophoresis
and visualized by UV-transillumination.
Bacterial challenge in shrimp
Shrimps were injected with bacteria V. harveyi 639 (2 x 105cfu) into the third segment
and control shrimps were injected with150 mMNaCl. Then, gills were collected at various time
points. Total RNA were extracted from gills and the first strand cDNA was synthesized. The
expression levels were analyzed by quantitative real time RT-PCR using SsoFastTM
EvaGreen® Supermix and normalized using EF1 (an internal control). The cycling conditions
were 95 °C for 8 min (1 cycle), 95 °C for 10 sec, 58 °C for 15 sec, 72 °C for 30 sec (39 cycles),
95 °C for 30 sec (1 cycle), 55 °C for 1 min (1 cycle), and 55 °C for 10 sec (1 cycle). Standard
curve was performed using 5-fold diluted cDNA (1500 ng down to 2.4 ng of total RNA). Data
were analyzed by using CFX96 Touch™ real-time PCR detection system. The Ct values of V.
harveyi-injected samples at each time point were normalized with saline-injected samples.
Results
Sequence analysis of PmMIP
The open reading frame of PmMIP was 957 bp encoding a putative 318 amino acid
with a predicted molecular weight of 35.9 kDa and pI of 5.5 (Fig. 1). The sequence analysis
showed a putative fibrinogen related-domain at C-terminanus. The alignment of PmMIP
showed the high similarity with PmMIP (Angthong, et al., 2010) 100% and PlMIP 80% (Fig.
2). The results showed that the PmMIP from this research was same as PmMIP of Angthong,
et al., 2010.
Figure 1. The amino acid sequence of PmMIP. The signal peptide was located in positions 122 and shown byblack underline. The putative fibrinogen-related domain was located in
positions 98-317 and shown by red underline.
196
Figure 2. The amino acid sequence alignment of PmMIP with PmMIP (Angthong, et al., 2010)
and PlMIP by ClustalW multiple sequence alignment program.
Phylogenetic analysis
To investigate the relationship between PmMIP and other fibrinogen-related proteins,
the sequences of PmMIP and the other fibrinogen-related proteins were analyzed and the
phylogenetic tree was constructed using MEGA 6 program. PmMIPexhibits the closest
similarity to PlMIP from crayfish. The results reveal the potential function of PmMIP in shrimp
defense to bacterial infection.
OmFREP Ornithodoros moubata AF527411.1
100
DorinM Ornithodoros moubata AY333989
96
TL5A Tachypleus tridentatus AB024737.1
61
TL5B Tachypleus tridentatus AB024738.1
60
PlFLP1 P. leniusculus GU937075
100
PlFLP2 P. leniusculus GU937076
Aslectin Armigeres subalbatus AY426976.1
CG5550 Drosophoila melanogaster NM_137316
94
PlMIP P. leniusculus EX571686
100
PmMIP P. monodon
0.2
Figure 3. Phylogenetic tree analysis of PmMIP with the other fibrinogen related protein in
arthropoda. The tree was constructed via the NJ method using MEGA 6 on amino acid
alignment of OmFREPOrnithodorosmoubata (AF527411.1), dorinMOrnithodorosmoubata
(AY333989), PlFLP1 P. leniusculus (GU937075), PlFLP2 P. leniusculus (GU937076),
PlMIPP. Leniusculus (EX571686), AslectinArmigeressubalbatus (AY426976.1), TL5A
Tachypleustridentatus (AB024737.1), TL5B Tachypleustridentatus (AB024738.1), CG5550
197
Drosophila melanogaster (NM_137316). The bar (0.2) indicated genetic distance. The
boostrap was 1:1000.
Tissue distribution of PmMIP transcripts
Tissue distribution analysis of PmMIP in hemocytes, heart, hematopoietic tissue, gills,
hepatopancreas, fore and mid gut, hind gut, lymphoid organ, and muscle was examined by RTPCR. The PmMIP transcript was highly expressed in many tissues such as gills, intestine,
lymphoid organ, and muscle. But, the PmMIP expression was low in heart and hematopoietic
tissue and fairly low in hemocytes.
Figure 4. The tissue distribution of PmMIP by semi-quantitative RT-PCR.Lane 1, hemocytes;
Lane 2, heart; Lane 3, hematopoietic tissue; Lane 4, gills; Lane 5, hepatopancreas; Lane 6, fore
and mid gut; Lane 7, hind gut; Lane 8, lymphoid organ; Lane 9, muscle. Upper row, expression
of PmMIP. Lower row, expression of EF1 in the corresponding tissues.
Expression analysis of PmMIP after V. harveyi challenge
Shrimps were challenged with bacteria V. harveyi and the transcript of PmMIP was
analyzed by quantitative real-time PCR. PmMIP transcripts from gills were
decreasedsustantially at 24 h after bacterial infection.
Figure 5. The expression level of PmMIP in V. harveyi challenged P. monodon by quantitative
real-time PCR. Total RNA from gills were extracted at various time points. EF1 is an internal
control.
Conclusion
The transcript of PmMIP was identified in various shrimp tissues. The gene showed the
down-regulation upon bacterial infection suggesting the role of this protein in bacterial defense.
198
Discussion
Melanization inhibition protein plays a crucial function in the proPO system as
amelanization inhibitor. In this report, PmMIP was found in various tissues of black tiger
shrimp and responded to bacterial infection. The first MIP has been reported in beetle T. molitor
and later in crayfish P. leniusculus (Zhao et al., 2005; Söderhäll et al., 2009). Recently, PmMIP
was cloned and initially characterized. PmMIP sequence has a fibrinogen related-domain at Ctermial region. Phylogenetic tree analysis with other fibirogen proteins shows that PmMIP is
closely related to PlMIP suggesting that PmMIP might function in proPO system as an
inhibitor. PmMIP expression is high in gills, muscle, lymphoid organ, and heart which similar
to the results of Angthong et al. (2010) revealing the expression of all examined tissues except
in hemocytes, whilst PlMIP was highly expressed in nerve tissue, heart, and intestine and fairly
low expressed in muscle (Söderhäll et al., 2009). In addition, PmMIP expression after V.
harveyi challenge was decreased at 24 h post infection suggesting down-regulation of PmMIP
to allow melanization to accuse for combating invading bacteria.
Acknowledgements
This work has been supported by research grants from the Thailand Research Fund to A.T.
(TRF Senior Scholar No. RTA5580008) and Chulalongkorn University Graduate Scholarship
to Commemorate the 72nd Anniversary of His Majesty King BhumibolAdulyadej.
References
Angthong, P., Watthanasurorot, A., Klinbunga, S., Ruangdej, U., Söderhäll, I. &
Jiravanichpaisal, P. (2010). Cloning and characterization of a melanization inhibition
protein (PmMIP) of the black tiger shrimp, Penaeusmonodon. Fish Shellfish Immunol,
29, 464-468.
Cerenius, L. & Söderhäll, K. (2004). The prophenoloxidase-activating system in
invertebrates. Immunol Rev198, 116-26.
Cerenius, L., Lee, BL. & Söderhäll, K. (2008).The proPO-system: pros and cons for its role
in invertebrate immunity. Trends in Immunology, 29, 263-271.
Homvises, T., Tassanakajon, A. & Somboonwiwat, K. (2010). Penaeusmonodon SERPIN,
PmSERPIN6, is implicated in the shrimp innate immunity. Fish Shellfish Immunol,
29, 890-898.
Iwanaga, S. & Lee, BL. (2005). Phenoloxidases in insect immunity. J BiolChem, 38, 128150.
Kanost, MR. & Gorman, MJ. (2008). Innate immune responses of a lepidopteran insect,
Manducasexta.In: Beckage NE Ed. Insect Immunology San Diego: Elsevier, 69-96.
Liang, Z. C., Sottrup-Jensen, L., Aspan, A., Hall, M. & Söderhäll, K. (1997). Pacifastin, a
novel 155-kDa heterodimeric proteinase inhibitor containing a unique transferrin
chain. Proc. Natl. Acad. Sci. U.S.A., 94, 6682-6687.
Söderhäll, I., Wu, C., Novotny, M., Lee, BL. & Söderhäll, K. (2009). A novel protein acts as
a negative regulator of proPO activation and melanisation in the freshwater crayfish,
Pacifastacusleniusculus. J BiolChem, 284, 6301-10.
Söderhäll, K. & Cerenius, L. (1998). Role of the phophenoloxidaseactivating system in
invertebrate immunity. CurrOpinImmunol, 10, 23-8.
199
Somnuk, S., Tassanakajon, A. & Rimphanitchayakit, V. (2012). Gene expression and
characterization of a serine proteinase inhibitor PmSERPIN8 from the black tiger
shrimp Penaeusmonodon. Fish Shellfish Immunol, 33, 332-341.
Sritunylucksana, K. & Soderhall, K., (2000). The proPO and clotting system in
crustaceans.Aquacuture, 191, 53-69.
Wang, Y. & Jiang, H. (2004). Purification and characterization of Manducasexta serpin-6: a
serine proteinase inhibitor that selectively inhibits prophenoloxidase-activating
proteinase-3. Insect Biochem.Mol. Biol, 34, 387-395.
Zhao, M., Söderhäll, I., Park, JW., Ma, YG., Osaki, T., Ha, N., et al. (2005). A novel 43-kDa
protein as a negative regulatory component of phenoloxidase-induced melanin
synthesis.J BiolChem, 280, 24744-51.
200
CLONING AND EXPRESSION OF ANTI-LIPOPOLYSACCHARIDE
FACTOR ISOFORM 6 (ALFPM6) FROM BLACK TIGER SHRIMP,
PENAEUS MONODON
Pitchayanan Kamsaeng 1, Anchalee Tassanakajon 2, Kunlaya Somboonwiwat 3
1, 2, 3
Center of Excellence for Molecular Biology and Genomics of Shrimp, Department of
Biochemistry, Faculty of Science, Chulalongkorn University, Bangkok, Thailand
Abstract
Anti-lipopolysaccharide factor (ALF) is one of the antimicrobial peptide families
identified in invertebrates. Six different isoforms of the ALF homologues have been previously
identified from Penaeus monodon. ALFPm6 was firstly identified by suppression subtractive
hybridization as an up-regulated gene in P. monodon hemocyte in response to the yellow head
virus infection. Moreover, knockdown of ALFPm6 gene led to a significant increase in the
cumulative mortality following Vibrio harveyi and white spot syndrome virus (WSSV)
infections. These reveal the importance of ALFPm6 importance in shrimp immunity against
pathogen invasion. To further characterize ALFPm6, the nucleotide sequences of ALFPm6
gene coding for the mature peptide were cloned into pPIC9K vector and transformed into
Pichia pastoris strain KM71. Under methanol induction, the recombinant ALFPm6 protein
(rALFPm6) with the expected size and pI of 12 kDa and 9.69, respectively, was successfully
expressed. The crude rALFPm6 protein showed antibacterial activities against both Grampositive and Gram-negative bacteria, such as Bacillus megaterium and Escherichia coli 363,
respectively.
Keywords: Antimicrobial peptide, Anti-lipopolysaccharide factor, Pichia pastoris, Penaeus
monodon
Introduction
Anti-lipopolysaccharide factors (ALFs) are antimicrobial peptides (AMPs) that have
been found in horseshoe crabs and crustaceans. ALFs are highly cationic polypeptides of about
100 residues with a hydrophobic N-terminal region. The three-dimensional structures of ALF
from horseshoe crab Tachypleus tridentatus and Limulus polyphemus (ALF-L) (Tanaka et al.,
1982; Muta et al., 1987) and the shrimp Penaeus monodon (ALFPm3) share a similar structure
consisting in three α-helices packed against a four-stranded β-sheet (Hoess et al., 1993; Yang
et al., 2009). ALFs contained a signal peptide at the N-terminus and a predicted LPS binding
domain. Two conserved cysteine residues between LPS binding domain (LPS-BD) are
involved in an intramolecular disulfide bridge which delimits the central β-hairpin. The
differences in the LPS-BD sequences might indicate the ability of these different ALFPm
isoforms to bind to different microbial cell wall components.
Many reports showed that ALFs exhibit a potent antimicrobial activity against a broad
range of microorganisms (For review; Tassanakajon et al., 2010). The P. monodon ALF major
isoform, ALFPm3, exhibits a broad antimicrobial spectrum against filamentous fungi, Grampositive and Gram-negative bacteria with a high potency against the natural shrimp bacterial
pathogen, Vibrio harveyi (Somboonwiwat et al., 2005). Treating of V. harveyi with rALFPm3
showed the locarization of rALFPm3 on the V. harveyi cells and induced membrane
201
permeabilization and leakage of cytoplasmic components (Jaree et al., 2012). The antiviral
property of rALFPm3 against the major shrimp viral pathogen, WSSV, has been shown to
inhibit WSSV propagation in crayfish hematopoietic cell culture and in shrimp (Tharntada et
al., 2009). Recently, the neutralization effect on WSSV in vivo shown that the ALFPm3
performs its anti-WSSV action by binding to the WSSV189 envelope protein and possibly
other WSSV proteins (Suraprasit et al., 2014). These results suggested the important role of
ALFPm3 protein in the defense mechanism against WSSV infection and vibriosis in P.
monodon. Although ALFPm3 is found to be the major ALF isoform responsible for fighting
against pathogen infection, interestingly, the other ALFPm such as ALFPm6 gene has been
shown to be up-regulated in P. monodon hemocyte in response to the yellow head virus
infection (Prapavorarat et al., 2010) and gene silencing of ALFPm6 led to a significant increase
in the cumulative mortality of Vibrio harveyi- and WSSV- infected shrimp (Ponprateep et al.,
2012). These imply that ALFPm6 might be also important in shrimp immunity. However, there
is no report on ALFPm6 characterization. In this study, ALFPm6 was produced in the P.
pastoris expression system and the antibacterial activity of the recombinant ALFPm6 protein
(rALFPm6) was studied.
Research Methodology
1. Preparation of the ALFPm6 gene fragment
The gene coding for the mature peptide of ALFPm6 was amplified using Phusion
DNA polymerase (NEW ENGLAND BioLabs, Inc.) with specific primers ALFPm6-F: 5'
GAGCTCTACGTAAGTGGCTGGGAGGCATTG 3' and ALFPm6-R: 5'
GCGATAGCGGCCGCTTAATGATGATGATGATGATGATTATTCAGCCAAGCTTGAG
CC 3'. The ct31 plasmid containing ALFPm6 gene was used as a PCR template. The PCR
product was analyzed on 1.0% agarose gel. The expected PCR product was purified using
NucleoSpin Gel and PCR Clean-up kit (MACHERAY-NAGEL). The purified DNA
fragments were cloned into the T&A cloning vector (RBC). The recombinant clones,
ALFPm6-TA, were randomly selected for each DNA fragment and screened by colony PCR.
The clone containing an expected size of insert was selected and the recombinant plasmid
was isolated. The extracted plasmid was digested by HindIIIto confirm the insertion.
2. Construction of the expression vector
The gene fragment coding for mature ALFPm6 was sub-cloned into the expression
vector pPIC9K (Invitrogen). The pPIC9K vector and the recombinant plasmid ALFPm6-TA
was double digested using the restriction enzymes SnaBI and NotI. The SnaBI and NotIdigested insert and pPIC9K vector were ligated and subsequently transformed into E. coli strain
XL-1 blue by electroporation. The recombinant clones, pALFPm6, were selected by blue-white
screening and the recombinant plasmid was confirmed for the insertion by digested with SnaBI
and NotI. The sequence of recombinant plasmid, pALFPm6, was confirmed by nucleotide
sequencing.
3. Transformation into Pichia pastoris KM71
The expression host P. pastoris strain KM71 was grown overnight at 30˚C, 280 rpm in
YPD medium. The cells were collected, washed twice with ice-cold sterile water, and
resuspended in 1 M sorbitol. The pALFPm6 expression plasmid was linearized by SacI, and
then purified and precipitated the linearized plasmid by isopropanol, 5 μg of it was transformed
into P. pastoris by electroporation. The transformant were spread on MD plates and incubated
at 30˚C. The cells were resuspended in sterile water and pooled. The highest multiple inserts
202
of transformant were selected on YPD plates with G418-sulphate at a final concentration of 1
and 2 mg/ml. Plates were incubated at 30˚C for 3-5 days, then single colonies were streaked
on YPD plates with G418-sulphate to confirm G418-sulphate resistant clones.
4. Expression of recombinant Pichia strain
The single colony was grown in YPD broth medium at 30˚C for overnight. Then
inoculated 100 ml of BMGY medium (1% yeast extract, 2% peptone, 100 mM potassium
phosphate, pH 6.0, 1.34% YNB, biotin, and 1% glycerol) in a 1 liter baffled flask and grown
at 30˚C in a shaking incubator with 300 rpm until the culture reaches an OD600 = 4-6. The cell
was harvested by centrifugation at 1500×g for 5 min at room temperature and resuspended in
20 ml BMMY medium (1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0,
1.34% YNB, biotin, and 0.5% methanol). After 1 day of methanol induction, the expression of
the recombinant ALFPm6 (rALFPm6) in the culture medium supernatant was analyzed by 15%
SDS-PAGE and the protein bands were detected with silver staining.
5. Antibacterial activity assay
Gram-negative bacteria (Escherichia coli 363) and Gram-positive bacteria (Bacillus
megaterium) were used to study the antibacterial activity. The crude rALFPm6 was tested by
liquid growth inhibition assay. Briefly, 40 μl aliquots of the crude rALFPm6 were incubated
in 96-well plate with 100 μl of a suspension of mid-logarithmic phase culture of bacteria at
OD600 = 0.001. Poor-broth nutrient medium (1% bactotryptone, 0.5% NaCl, w/v, pH 7.5) was
used for standard bacterial culture. The negative and positive controls were designed for
checking the desired outcome of this experiment. The bacterial culture was grown at 30˚C in a
shaking incubator at 150 rpm and measured the bacterial growth at 600 nm after 24 h.
Results
1. Construction of an expression vector for the recombinant ALFPm6 protein
production
The ALFPm6 gene was amplified and the expected PCR product of 344 bp was detected
on 1.0% agarose gel (Fig. 1A). The PCR product was purified and ligated with T&A cloning
vector. The ALFPm6-TA plasmid was digested with HindIII to confirm the insertion (Fig. 1B).
The ALFPm6 fragment was then sub-cloned into pPIC9K vector. The SnaBI/NotI-digested
ALFPm6 fragment was ligated into the SnaBI/NotI-digested pPIC9K. Then, the ligation
mixture was transformed into E. coli strain XL-1 blue. The colony PCR was used for screening
of the desired recombinant expression plasmid, pALFPm6 (Fig. 1C). The plasmid was
extracted from the positive colony and confirmed for the correctness of the clone by
SnaBI/NotIdigestion (Fig. 1D).
203
(C)
(D)
Figure 1: Construction of rALFPm6 expression plasmid. (A) ALFPm6 gene fragment coding
for ALFPm6 of mature peptide was amplified. (B) The mature ALFPm6 gene was cloned into
TA vector. The resulting plasmid, ALFPm6-TA, was checked for insertion by HindIII
digestion. The ALFPm6 fragment was then sub-cloned into pPIC9K vector. The recombinant
expression plasmid, pALFPm6, was transformed into E. coli strain XL-1 blue. (C) The
pALFPm6was checked forthe positive clone bycolony PCR. (D) Also, the pALFPm6 was
checked for insertion by SnaBI/NotI digestion.
2. Transformation of pALFPm6 into P. pastoris
The pALFPm6 was linearized (Fig. 2A) with SacI and transformed into P. pastoris by
electroporation. The transformants were spread onto MD plates before screening for G418sulfate resistance. The transformants were screened on YPD plates containing 1 and 2 mg/ml
G418-sulfate antibiotic. The resistant clones that grew on the YPD plates contain G418-sulfate
were tested to determine the presence of integrated ALFPm6 expression cassette in Pichia
genome by colony PCR (Fig. 2B). The parental plasmid pPIC9K and the pALFPm6 gave a
specific band of 209 bp and 344 bp, respectively. All selected transformants contained the
integrated ALFPm6 gene in Pichia genome. The hyper-resistance clone which could grow on
YPD plate containing 1mg/ml G418-sulfate was selected for expression analysis.
Figure 2: RecombinantPichia pastoris GS115 containing pALFPm6 (A) The pALFPm6 was
linearized with SacI and transformed into P. pastoris by electroporation. (B) The resistant
204
clones that grew on the YPD plates containing G418-sulfate (1 and 2 mg/ml) were checked for
ALFPm6 expression cassette in Pichia genome by colony PCR.
3. Expression of the recombinant ALFPm6 protein (rALFPm6)
The hyper-resistant clone was selected for the expression analysis. The selected clone
was expressed under methanol induction for 1 day. The culture supernatant was collected and
the rALFPm6 protein was detected by 15% silver-stained SDS-PAGE (Fig. 3). The result
showed that the rALFPm6 protein with the expected size of 12 kDa was detected as a major
band.
Figure 3: Silver-stained SDS-PAGE analysis of rALFPm6. The rALFPm6 protein was
produced in day 1 after methanol induction.
4. Antibacterial activity of rALFPm6
The crude rALFPm6 was tested for its antimicrobial activity against Gram-positive and
Gram-negative bacteria using liquid growth inhibition assay. The result showed that the crude
rALFPm6 exhibited antimicrobial activity against Escherichia coli 363 and Bacillus
megaterium (Fig. 4).
OD600
OD600
Figure 4: Antimicrobial activity of the crude rALFPm6. The activity against (A) Gramnegative bacteriam: Escherichia coli 363 and (B) Gram-positive bacteriam: Bacillus
megaterium was tested by liquid growth inhibition assay.
Discussion
Previous reported indicated that the ALFPm6 is the most recent isoform. This isoform
was the second most abundant isoform identified from the P. monodon EST database (For
review; Tassanakajon et al., 2006). P. monodon ALFs (ALFPm1-6) can be divided into three
groups based on their LPS-BD sequences. ALFPm1 and ALFPm2 formed group A, whilst
ALFPm3-5 formed group B. Since the putative LPS binding site of ALFPm6 was different
205
from those of groups A and B, ALFPm6 was classified as group C (Prapavorarat et al., 2010).
The differences in the LPS binding site sequences confer the ability of these different ALFPm
isoforms to bind to different microbial cell wall components.
The antimicrobial activities of ALFs were characterized in many species of shrimps.
rALFPm2, the member of ALFs group A, exhibited strong antibacterial activity againstGramnegative and Gram-positive bacteria represented by E. coli 363 and B. megaterium (Thantada
et al., 2008). ALF in group A have also been reported the antimicrobial activity in other species
of shrimp such as MjALF2. In vitro After LPS stimulation in lymphoid organ cells, the major
tissue for elimination of the injection bacteria, the gene expression of MjALF2 was higher than
control group (Mekata et al., 2009). These data suggested that MjALF2 protein involve in the
elimination process of invasive pathogen. In addition the MjALF1 synthetic peptides
corresponding to the LPS-BD exhibited LPS neutralization and inhibition NO production in
RAW264.7 cell (Nagoshi et al., 2009).The shrimp ALFs in Group B such as ALFPm3 and
ALFFc from Fenneropenaeus chinesis,ALFPm3 is the most abundantly expressed isoform of
P. monodon. The recombinant ALFPm3 (rALFPm3) showed bacterial activity against both
Gram-negative and Gram-positive bacteria (Somboonwiwat et al., 2005). In addition,
rALFPm3 showed bacterial activity against V. harveyi cells, acting through the membrane
disruption (Jaree et al., 2012). The rALFPm3 protein was also able to eliminate white spot
syndrome virus (WSSV) (Suraprasit et al., 2014).
Although the antimicrobial activity of several ALF has been characterized; there is no
report on ALFPm6 characterization. In this study, the rALFPm6 was over-produced using the
P. pastoris expression system as reported previously for rALFPm3 (Somboonwiwat et al.,
2005). This system was chosen because P. pastoris is an eukaryotic yeast and possess many
advantages of higher eukaryotic expression system such as protein processing, protein folding
and posttranslational modification. The yeast transformant expressing rALFPm6 was selected
based on the level of G418-sulfate resistance indicating multiple copies of the expression
cassette. The transformant yeast was induced for protein production by methanol induction.
The recombinant protein corresponding to the expected size of rALFPm6 was detected in the
culture supernatant. This crude preparation also exhibited antimicrobial activity against E. coli
363 and B. megaterium. Each isoform of ALFPms contain signal peptide and LPS-binding
domain with 2 conserve cysteine residues and form a disulfide loop, within disulfide loop
contain positively charged amino acid that can bind to negatively charge on bacterial cell wall.
The numbers of positively charged amino acid composition of LPS-binding domain are
different. ALFPm2 include 4 Arg, ALFPm3 include 4 Lys and 2 Arg while ALFPm6 contain
3 Arg and 2 Lys with the net charge of LPS binding domain of 4, 6 and 5, respectively. The
different net charge of each ALFPm might involve in the ability to LPS binding. According to
preliminary result, it can be speculated that rALFPm6 might involve in the bacterial elimination
process.
Acknowledgements
This research is supported by the TRF Senior Research Scholar (RTA5580008),
Thailand Research Fund.
206
References
Aketagawa, J., Miyata, T., Ohtsubo, S., Nakamura, T., Morita, T., Hayashida, H., Miyata, T.,
Iwanaga, S., Takao, T. & Shimonishi, Y. (1986). Primary structure of Limulus
anticoagulant anti-lipopolysaccharide factor. J Biol Chem 261: 7357-7365.
Carriel-Gomes, MC., Kratz, JM., Barracco, MA., Bache`re, E. & Barardi, CR. (2007). In
vitro antiviral activity of antimicrobial peptides against herpes simplex virus 1,
adenovirus, and rotavirus. Mem Inst Oswaldo Cruz 102: 469-472.
Gross, PS., Bartlett, TC., Browdy, CL., Chapman, RW. & Warr, GW. (2001). Immune gene
discovery by expressed sequence tag analysis of hemocytes and hepatopancreas in the
Pacific White Shrimp, Litopenaeus vannamei, and the Atlantic White Shrimp, L.
setiferus. Dev Comp Immunol 25: 565-577.
Hoess, A., Watson, S., Siber, GR. & Liddington, R. (1993). Crystal structure of an endotoxinneutralizing protein from the horseshoe crab, Limulus anti-LPS factor, at 1.5 A
resolution. EMBO J 12: 3351-3356.
Jaree, P., Tassanakajon, A. & Somboonwiwat, K. (2012). Effect of the antilipopolysaccharide factor isoform 3 (ALFPm3) from Penaeus monodon on Vibrio
harveyi cells.Dev Comp Immunol 38: 554-560.
Mekata, T., Sudhakaran, R., Okugawa, S., Kono, T., Sakai, M. & Itami, T. (2009). Molecular
cloning and transcriptional analysis of a newly identified anti-lipopolysaccharide
factor gene in kuruma shrimp, Marsupenaeus japonicus. Applied Micro
doi:10.1111/j.1472-765X.2009.02763.x.
Muta, T., Miyata, T., Tokunaga, F., Nakamura, T. & Iwanaga, S. (1987). The primary
structure of anti-lipopolysaccharide factor from American horseshoe-crab, Limulus
polyphemus. J. Biochem. 101: 1321-1330.
Nagoshi, H., Inagawa, H., Morii, K., Harada, H., Kohchi, C., Nishizawa, T., Taniguchi, Y.,
Uenobe, M., Honda, T., Kondoh, M., et al. (2006). Cloning and characterization of a
LPS regulatory gene having an LPS binding domain in kuruma prawn Marsupenaeus
japonicus. Mol Immunol 43: 2061-2069.
Ponprateep, S., Tharntada, S., Somboonwiwat, K. & Tassanakajon, A. (2012). Gene silencing
reveals a crucial role for anti-lipopolysaccharide factors from Penaeus monodon in the
protection against microbial infections. Fish & shellfish immunol 32: 26-34.
Prapavorarat, A., Pongsomboon, S. & Tassanakajon, A. (2010). Identification of genes
expressed in response to yellow head virus infection in the black tiger shrimp,
Penaeus monodon, by suppression subtractive hybridization. Dev Comp Immunol 34:
611-617.
Somboonwiwat, K., Marcos, M., Tassanakajon, A., Klinbunga, S., Aumelas, A., Romestand,
B., Gueguen, Y., Boze, H., Moulin, G. & Bachere, E. (2005). Recombinant expression
and anti-microbial activity of anti-lipopolysaccharide factor (ALF) from the black
tiger shrimp Penaeus monodon. Dev Comp Immunol 29: 841-851.
Supungul, P., Klinbunga, S., Pichyangkura, R., Hirono, I., Aoki, T., et al. (2004).
Antimicrobial peptides discovered in the black tiger shrimp Penaeus monodon using
the EST approach. Dis Aquat Organ 61: 123-135.
207
Suraprasit, S., Methatham, T., Jaree, P., Phiwsaiya, K., Senapin, S., Hirono, I., Lo, CF.,
Tassanakajon A. & Somboonwiwat K. (2014). Anti-lipopolysaccharide factor isoform
3 from Penaeus monodon (ALFPm3) exhibits antiviral activity by interacting with
WSSV structural proteins. Antiviral Research 110: 142-150.
Tanaka, S., Nakamura, T., Morita, T. & Iwanaga, S. (1982). Limulus anti-LPS factor: An
anticoagulant which inhibits the endotoxin-mediated activation of Limulus
coagulation system. Biochem. Biophys Res Comm 105: 717-723.
Tassanakajon, A., Klinbunga, S., Paunglarp, N., Rimphanitchayakit, V., Udomkit, A.,
Jitrapakdee, S., et al. (2006). Penaeus monodon gene discovery project: the generation
of an EST collection and establishment of a database. Gene 384: 104-12.
Tassanakajon, A., Amparyup, P., Somboonwiwat, K. & Supungul, P. (2010). Cationic
antimicrobial peptides in penaeid shrimp. Mar Biotechnol 13: 639-657.
Tharntada, S., Somboonwiwat, K., Rimphanitchayakit, V. & Tassanakajon, A. (2008). Antilipopolysaccharide factors from the black tiger shrimp, Penaeus monodon, are
encoded by two genomic loci. Fish Shellfish Immunol 24: 46-54.
Tharntada, S., Ponprateep, S., Somboonwiwat, K., Liu, H., Söderhäll, I., Söderhäll, K., et al.
(2009). Role of anti-lipopolysaccharide factor from the black tiger shrimp, Penaeus
monodon, in protection from white spot syndrome virus infection. J Gen Virol
90:1491-1498.
Yang, Y., Boze, H., Chemardin, P., Padilla, A., Moulin, G., et al. (2009). NMR structure of
rALF-Pm3, an anti-lipopolysaccharide factor from shrimp: model of the possible lipid
A-binding site. Biopolymers 91:207-220.
208