1. health and fitness
2. disease

Plant Science 154 (2000) 43 – 51
www.elsevier.com/locate/plantsci
Molecular cloning of a novel water channel from rice: its products
expression in Xenopus oocytes and involvement in chilling
tolerance
Le-gong Li 1, Shi-fang Li 2, Yan Tao, Yoshichika Kitagawa *
Laboratory of Plant Genetic Engineering, Biotechnology Institute, Akita Prefectural Uni6ersity, Ogata, Akita 010 -0444, Japan
Received 15 March 1999; received in revised form 28 October 1999; accepted 1 December 1999
Abstract
Water channel proteins, aquaporins, play a fundamental role in transmembrane water movements in plants. We isolated rice
cDNA, rwc1, by screening a rice (Oryza sati6a cv. Josaeng Tongil) cDNA library using a conserved motif of aquaporins. Like
other aquaporin genes, rwc1 encodes a 290-residue protein with six putative transmembrane domains. The derived amino acid
sequence of RWC1 shows high homology with PIP1 (plasma membrane intrinsic protein 1) subfamily members, which suggest it
is localized in the plasma membrane. Injection of its cRNA into Xenopus oocytes increased the osmotic water permeability of the
oocytes 2–3 times. Northern analysis showed that rice aquaporin genes are expressed in rice seedling leaves and roots, but that
it disappeared from the root 6 h after osmotic stress began and that the transcript level remained low for about 24 h, then
recovered. The time course of rice aquaporin gene-expression under osmotic stress was correlated with time course of turgor
transition in plant. On the other hand, the levels of rice aquaporin gene-transcripts in leaves under chilling and recovery
temperature depend on the pretreatment of mannitol for short time. This variation of the transcripts shown that rice aquaporin
genes may play an important role in response to water stress-induced chilling tolerance. © 2000 Elsevier Science Ireland Ltd. All
rights reserved.
Keywords: Rice; Water channel; Water stress; Chilling tolerance; Xenopus oocyte
1. Introduction
Transmembrane water flow is a fundamental
process of life. Although water permeability as a
biophysical feature of cell membrane, the molecular pathway of transmembrane water movement
remained unknown until the discovery of aquapor
The nucleotide sequence data reported appeared in EMBL, GenBank and DDBJ Nucleotide sequence Database under the accession
number AB009665.
* Corresponding author.
E-mail address: [email protected] (Y. Kitagawa)
1
Permanent address: Shanghai Institute of Plant Physiology, Chinese Academy of Sciences, Shanghai 200032, People’s Republic of
China.
2
Present address: Institute of Plant Protection, Chinese Academy
of Agricultural Sciences, 2 West Yuanmingyuan Road, Beijing
100094, China. Le-gong Li and Shi-fang Li contributed equally to
this work.
ins [1]. The recent discovery that plants express
numerous aquaporins in both the plasma membrane and the tonoplast has changed our view of
how plant cells regulate transmembrane water
movement [2,3]. Water channel proteins (aquaporins) belong to the major intrinsic protein (MIP)
superfamily that permit the passage of specific
molecules through biological membranes. Since
the first aquaporin (AQP1) was identified in human erythrocytes [1], many more have been isolated from various organisms, including bacteria,
plants, and animals [3]. In plants, many MIP genes
have been isolated. They are encoded by several
gene families and are hydrophobic integral membrane proteins that range in apparent molecular
mass from 23 to 31 kDa [4]. Since g-tonoplast
intrinsic protein (g-TIP) was first recognized as a
plant aquaporin [5], more different genes have
0168-9452/00/$ - see front matter © 2000 Elsevier Science Ireland Ltd. All rights reserved.
PII: S 0 1 6 8 - 9 4 5 2 ( 9 9 ) 0 0 2 6 9 - 1
44
L.-g. Li et al. / Plant Science 154 (2000) 43–51
been identified [6]. Their products are located in
the tonoplast and plasma membrane. Sequence
comparisons have shown a high homology between plant aquaporins; all published sequences
are clearly of TIP or plasma membrane intrinsic
protein (PIP) members. These relationships even
extend to the PIP1 and PIP2 subfamilies, originally introduced by Kammerloher et al. [7]; easily
classified as PIP1 or PIP2 based on specific arrays
of amino acids at the N- and C-termini.
Although DNA sequences with high homology
to the aquaporin genes have been identified in
several plant species [4], the water permeability
and function haven’t been determined, only a few
of the gene products have been characterized [6–
11]. Their roles in response to various physiological and stress conditions warrants further research.
Here we report the isolation of the first water
channel gene to be identified in rice, the activity of
its water permeability, and the possible role in
response to osmotic and chilling stress.
2. Materials and methods
2.1. Plant material, osmotic and chilling
treatments
Wasetoitsu (Oryza sati6a cv. Josaeng Tongil) is
a less chilling-tolerant hybrid rice variety developed in the Republic of Korea. Seedlings and
culture cells were prepared as described previously
[12]. For treatment with mannitol and NaCl, rice
seedlings at the three leaf-stage were transferred to
fresh liquid Hoagland’s medium [5 mM Ca(NO3)2,
5 mM KNO3, 2 mM MgSO4, 0.025 mM FeSO4EDTA in tap water] containing 0.25 M mannitol
or 0.15 NaCl, at 25°C. For chilling, after mannitol
treatment the seedling was washed with tap water,
and transferred to fresh Hoagland’s medium, incubated for 24 h at 4°C and then transferred to 25°C
for 24 h.
2.2. cDNA library construction and screening
Total RNA was extracted from leaves that had
been treated for 30 min with 0.5 M mannitol. A
cDNA library was constructed in the NotI site of
lgt10. Aliquots of the cDNA were used as a
template for the polymerase chain reaction (PCR)
with designed primers corresponding to the se-
quences surrounding the Asn-Pro-Ala motif of
aquaporins [5]. A PCR product of 393 bp was
subcloned into the pT7Blunt vector (Novergen,
USA) and sequenced on both strands using
ABI373 Applied Biosystem (USA). This DNA
fragment was radioactive labeled with [a 32P]dCTP
by random DNA labeling (Takara, Japan) and
was used as a hybridization probe to screen 3 ×
105 plaques from the cDNA library. A positive
plaque was isolated and the insert of the phage
DNA was subcloned into a pBluescript KS+ according to the manufacturer’s protocol (Stratagene, USA). The subcloned cDNA, rwc1, was
sequenced and analyzed using the GENETYX Version 8 (Software Development Co., Japan).
2.3. Northern analysis
Total RNA was prepared as described by KogaBan et al. [13], and 5 mg of total RNA was
fractionated on a 1.2% denaturing formaldehyde
agarose gel. The RNA was transferred to a Hybond™-N+ membrane (Amersham, UK) using
200SSC [14]. Prehybridization and hybridization
were performed using a rapid-hybridization buffer,
as suggested by the manufacturer (Amersham).
The probe was the full-length rwc1 sequence labeled with 32P by the random primer method
(Takara, Japan).
2.4. Competiti6e PCR
Transcription levels of rwc1 were specifically
determined by the competitive PCR method [15].
Competitor lambda RNA (448 bases) against rice
actin mRNA (accession number X15863 [16]) was
made from a lambda DNA fragment placed in
between the rice actin 5% primer (5%-AGAGCTACGAGCTTCCTGATGGAC-3%) and 3% primer
(5% - GAGAGATGCCAAGATGGATCCTCC - 3%)
regions. A SP6 promoter (5%-ATTTAGGTGACACTATAGAATAC-3%), induced upstream of
the 5% actin primer, was used to synthesize RNA
using SP6 polymerase according to the manufacture’s protocol (Takara, Japan). Competitor
lambda RNA (530 bases) against rwc1 mRNA was
prepared in the same manner from a lambda DNA
fragment that was spaced by rwc1 5% (5%-ATCTACAACAAGGACCATGCCTGGA-3%) and rwc1 3%
(5% - ATTACACGATTGAGTTGTTCAGGGT - 3%)
primer, and placed downstream of the SP6 pro-
L.-g. Li et al. / Plant Science 154 (2000) 43–51
moter. Using the rwc1 or actin-primers, fragment
sizes of 333 bp for actin and 280 bp for rwc1 are
obtained by RT-PCR using total RNA. The reaction mixture contained 10 ng of sample RNA,
105 –109 copies of competitor lambda RNA, 10
pmol of random 9 mer primer, 1 U of AMV
reverse transcriptase, 4 U of RNase inhibitor, and
4 mM dNTP mixture in 4 ml of PCR buffer (10
mM Tris – HCl, pH 8.3, 50 mM KCl and 5 mM
MgCl2). cDNA synthesize was allowed to proceed
for 30 min at 42°C, followed by denaturation for 5
min at 99°C. The 4 ml cDNA solution was then
mixed with 16 ml of PCR reaction mixture containing 1 – 4 pmol each of the particular 5% and 3%
primers, and 0.5 U of Taq polymerase in PCR
buffer. Samples were amplified by 30 cycles at
94°C for 0.5 min, 55°C for 0.5 min, and 72°C for
1 min. An aliquot of each reaction mixture was
subjected to electrophoresis on 3% NuSive agarose
gel.
45
(Nanoject; Drummond). The oocytes were incubated for 2 days at 18°C in Barth’s buffer before
water permeability measurements.
Individual oocytes were transferred from
Barth’s buffer (200 mosm) to a three-fold dilution
of Barth’s buffer with distilled water (70 mosm) at
20°C. Oocyte swelling was checked using an area
Colony Analyzer (CA-7, Toyo Sottuki, Japan).
The area covered by the oocytes was measured at
5-s intervals; the total cell volume was calculated
from the cell area. The relative oocyte volume
(V/V0) was calculated from the relative oocyte
area (A/A0) using the equation V/V0 =(A/A0)3/2.
The osmotic water permeability coefficient (Pf,
cm/s) was calculated from oocyte surface area
(S= 0.045 cm2), initial oocyte volume (V0 =9×
10 − 4 cm), water volume (Vw =18 cm3/mol), and
the initial rate of oocyte swelling, d(V/V0)/dt,
using the equation Pf=V0d(V/V0)/dt[SVw(osmout −osmin)], where osmout is 70 mosm and
osmin is 200 mosm.
2.5. In 6itro synthesis of rwc1 cRNA
The rwc1 gene which was cut from the plasmid
with BamHI was inserted into the BglII site of the
Xenopus expression construct pXbG/ev-1; a
pSP64T-derived pBluescript-type vector into
which Xenopus b-globin 5% and 3% untranslated
sequences were inserted [1]. Recombination of the
plasmid was checked by sequencing. Capped RNA
transcripts of rwc1 were synthesized in vitro using
T3 RNA polymerase and linearized recombinant
plasmids containing rwc1 cDNA after digestion
with BamHI (Stratagene). After ethanol precipitation, the synthesis products were suspended in
diethylpyrocarbonate-treated H2O at a final concentration of 1 mg/ml.
2.6. Microinjection of cRNA into oocytes and
water permeability analysis
Mature oocytes (1.2–1.3 mm diameter, stage V
and VI) were isolated from adult Xenopus la6is
[17,18] and stored in Barth’s buffer containing
Na-penicillin (10 mg/ml) and streptomycin (10 mg/
ml). The follicular cell layer was removed by incubation with 2 mg/ml collagenase (Boehringer,
Germany) in Barth’s buffer for 2.0–2.5 h at 25°C
with gentle continuous agitation. Defolliculated
oocytes were injected with 46 nl of cRNA (1
mg/ml) or water using an automatic injector
3. Results and discussion
3.1. Isolation of rwc1 from the rice cDNA library
We used the most conserved sequences of the
aquaporins to design our PCR primers, and used
the cDNA library as the template. The 393-bp
product showed high sequence homology to PIP1c
from Arabidopsis, and it was used to probe the
same cDNA library. The 1.1-kb fragment of rwc1
contained a 49-bp 5%-untranslated sequence preceding an initiation site consensus sequence. An
870-bp open reading frame was followed by a
3%-untranslated sequence containing a polyadenylation consensus sequence (accession no.
AB009665).
3.2. Deduced structure of RWC1 and homology
comparisons
Analysis of the Genbank database showed that
rwc1 is a novel member of the aquaporin family.
The open reading frame encodes a polypeptide of
290 amino acids. Alignment of the deduced amino
acid sequence of RWC1 with the sequences of
mammalian (AQP2) and plant aquaporins (Fig.
1A) showed that RWC1 has residues known to be
highly conserved in each of the transmembrane
46
L.-g. Li et al. / Plant Science 154 (2000) 43–51
Fig. 1. (Continued)
L.-g. Li et al. / Plant Science 154 (2000) 43–51
domains as well as the functionally important B
and E loops. Hydropathy analysis indicated that
RWC1 has six putative bilayer-spanning domains
and five connecting loops, of which loops B and E
were also hydrophobic (Fig. 1b). Both hydrophobic loops, which may form opposite leaflets,
contained the NPA motif (Asn-Pro-Ala) that
is present in all aquaproins (Fig. 1b), however RWC1 did not contain the cysteine
residue that confers mercury sensitivity to AQP1
[19]. In addition, the phosphorylation site seen in
PM28A (Ser-274) [20] was not identified in
RWC1; however, the predicted topology of RWC1
contained some distinctive features. One putative
cAMP or cGMP-dependent protein kinase phosphorylation motif (RKLS) was identified at
residues 128 – 131. Two consensus sequences (SER,
SSK) for protein kinase C phosphorylation were
present near the N-terminal region (Fig. 1a),
which was longer than the corresponding domain
in E. coli [21] and mammalian aquaporins; some
domains may have functions that are specific to
plants.
Nucleotide sequence comparisons between rwc1
and other genes analysis are shown in Fig. 1C.
Related sequences were detected in human, Arabidopsis and spinach genes. The phylogenetic analysis indicates that rwc1 belongs to the MIP-related
genes and is more closely related to PIP1 of Ara-
47
bidopsis than to PM28A of spinach. We have
classified rwc1 as a member of the PIP1 subfamily.
The deduced amino acid sequence of RWC1 differs significantly from that of g-TIP, which is
located in the tonoplast, so RWC1 may be located
in plasma membrane.
3.3. Rice aquaporin genes response to osmotic
6ariation and in6ol6e into water stress-induced
chilling tolerance
The expression of rice aquaporin genes was
determined by Northern blotting using total RNA
isolated from leaves and roots of rice seedlings at
the three-leaf stage and full-length rwc1 as the
probe. Rice aquaporin-mRNAs were detected in
both leaves and roots (Fig. 2a and b). When the
seedlings were treated with 0.25 M mannitol or
0.15 M NaCl, the transcript level changed. Transcript level in root had declined drastically 6 h
after the stress began and remained low for about
24 h. After that period, the transcript level of
aquaporin genes increased again to at least the
pre-stress level (Fig. 2A and B). The response of
rice aquaporin genes to osmotic stress is similar to
response of MipA and MipC genes in ice plants
[11]; expression of aquaporin genes is suppressed
under osmotic stress. Beside aquaporin gene-signal, there are several signals in Fig. 2A and B, but
Fig. 1. Aquaporin gene comparison and the structure of RWC1 polypeptide product. (a) Comparison of the amino acid sequence
of RWC1 and those of other aquaporins. Two conserved NPA motif repeats are boxed. Putative bilayer-spanning domains
(TM1-6) and connecting loops (A–E) are indicated by solid line. Consensus sequences for phosphorylation sites are indicated by
italics and underlining. (b) Proposed membrane topology based on our sequence hydropathy analysis and the hourglass model of
aquaporins [24], six bilayer-spanning domains and five connecting loops (A – E). The selected residues are identified, NPA motifs
in the first and second aqueous hemichannels, and special motifs (RKLS etc.). (c) The evolutionary tree of the aquaporins. The
PIP1 and PIP2 subfamilies are indicated.
48
L.-g. Li et al. / Plant Science 154 (2000) 43–51
Fig. 2. Northern blot analysis of rice aquaporin-mRNA, stress response and tissue specificity. Total RNA fractions were prepared
from leaves and roots, and then aliquots (5 mg) of them were applied to northern analysis. The gels were stained with ethidium
bromide to detect rRNAs (indicated below). (A) Mannitol treatment. 1, control; 2, 0.25 M mannitol for 1 h; 3, 0.25 M mannitol
for 3 h; 4, 0.25 M mannitol for 6 h; 5, 0.25 M mannitol for 24 h; 6, 0.25 M mannitol for 48 h; 7, 0.25 M mannitol for 72 h. (B)
NaCl treatment. 1, control; 2, 0.15 M NaCl for 1 h; 3, 0.15 M NaCl for 3 h; 4, 0.15 M NaCl for 6 h; 5, 0.15 M NaCl for 24 h;
6, 0.15 M NaCl for 48 h; 7, 0.15 M NaCl for 72 h. (C) Chilling treatment (leaf). 1, control; 2, 4°C for 24 h; 3, 4°C for 24 h, then
transferred to 25°C for 24 h; 4, 0.25 M mannitol for 3 h; 5, 0.25 M mannitol for 3 h, then incubated at 4°C for 24 h; 6, 0.25 M
mannitol for 3 h, then incubated at 4°C for 24 h and transferred to 25°C for 24 h; 7, 0.25 M mannitol for 6 h; 8, 0.25 M mannitol
for 6 h, then incubated at 4°C for 24 h; 9, 0.25 M mannitol for 6 h, then incubated at 4°C for 24 h and transferred to 25°C for
24 h.
not in Fig. 2C. It is presumed that washing condition of RNA blot of Fig. 2A and B was not
optimal.
In previous reports, we showed that rice
seedlings of chilling sensitive varieties (Wasetoitsu)
could acquire chilling tolerance when first exposed
L.-g. Li et al. / Plant Science 154 (2000) 43–51
to 0.25 – 0.5 M mannitol over a short time before
chilling treatment [12]. When Wasetoitsu seedlings
pretreated with 0.25 M mannitol for 3 and 6 h
were incubated at 4°C for 24 h and then transferred to 25°C for 1 day, the expression of the
aquaporin genes in the leaves showed fluctuation.
Mannitol pretreatment for short time is helpful to
down-regulate the expression of the aquaporin
genes under chilling stress, and improve its expression during the period in recovering (Fig. 2C).
When the pretreatment time with mannitol are
increased, the transcription levels of the aquaporin
genes in leaves are to be lower at low temperature,
49
but the transcription levels are recovered significantly after the seedling transferred to 25°C (Fig.
2C). As we know, water channel is a bi-directional
pore for water efflux and influx. The driving forces
behind water movement are hydraulic or osmotic
in nature [2]. One aspect of the chilling harm to
plant is lost water. At low temperature, lower
expression of aquaporin genes is beneficial to keep
a suitable status of water; a fast recovery is also
necessary for adaptation to standard physiological
process. Characterization of the expression of
aquaporin genes is just right to match the plant
request. It is presumed that aquaporin genes may
play an important role in response to water-stress
induced chilling tolerance.
The multiplicity of MIP genes are in plants as
reported before [22], it leads us to presume that
many similar genes exist in rice; some may be
precisely regulated by water stress, whereas other
are probably not affected. In this Northern experiment we could not determine the specific expression of rwc1, because we used full-length rwc1 as
the probe. Next we determined the specific expression of rwc1 in rice roots under osmotic stress and
chilling stress by competitive PCR using specific
primers for the 3%-untranslated rwc1 region. The
agarose gel results are shown in Fig. 3A, and the
calculated numbers of rwc1 transcripts per actin
transcript are shown in Fig. 3B. The specific expression of rwc1 mRNA under osmotic and chilling stress is essentially similar to the results of
Northern hybridization shown in Fig. 2C, and
suggests that rwc1 in particular is involved in
responses to water stress-induced chilling
tolerance.
3.4. Analysis of the water transport function of
RWC1
Fig. 3. Determination of rwc1 mRNA expressed under chilling stress by competitive PCR. Wasetoitsu seedling were
treated for 24 h at (1) 25°C, (2) 4°C, and (3) 4°C and then
25°C. The roots of another seedlings were treated for 1 h in
0.5 M mannitol and then treated for 24 h at (4) 25°C, (5) 4°C
and (6) 4 and then 25°C. Total RNA fractions were prepared
from roots and then aliquots (10 ng) of them were assayed to
competitive PCR. (A) Data of agarose gel electrophoresis, (B)
calculated munbers of rwc1 transcripts per actin transcripts
from the data of agarose gel electrophoresis.
The water channel activity of RWC1 was assayed by injecting rwc1 complementary RNA
(cRNA) into Xenopus oocytes. A cRNA that was
synthesized in vitro from the cDNA, which had
been cloned in vector pXbG/ev-1. cRNA of aqp2
[23] and rwc1 synthesized using pXbG/ev-l, were
injected into oocytes. After 3 days of incubation in
isotonic Barth’s buffer, the oocytes were transferred to a hypotonic buffer (1/3 Barth’s buffer),
and the relative increase in cell volume, a consequence of water uptake, was measured [17]. The
results indicate that RWC1 has water channel
50
L.-g. Li et al. / Plant Science 154 (2000) 43–51
Acknowledgements
We thank Dr K. Fushimi and M. Kuwahara of
Tokyo Medical and Dental University for kindly
providing the AQP2 gene and pXbG/ev-1 vector.
This work was supported by Grant-in-Aid for
Scientific Research from the Ministry of Education, Science and Culture (Japan), for Special Scientific Research on Agriculture, Forestry and
Fisheries, and by Grants from the Sumitomo
Foundation (Japan) and Ciba-Geigy Foundation
(Japan) for the Promotion of Science; and National nature and science foundation: 39670074
(China).
References
Fig. 4. Expression of rwc1 cRNA and cell membrane permeability. Oocytes were injected with cRNA orF water as indicated. Oocyte swelling was as described in Section 2. Values
are the mean9 S.D. of 7–10 oocytes (stippled bars).
activity in oocytes (Fig. 4). Our osmotic water
permeability indicated that the RWC1 protein
led to a swelling rate 2–3 times higher than that
of water-injected oocytes. However, the water
permeability of the oocytes injected with rwc1
cRNA was not as great as that of oocytes injected with aqp2 cRNA. Why did RWC1 show
weaker water channel activity? There are several
possible reasons. One is that the phosphorylation
sites and the other residues of the carboxyl-terminal cytoplasmic domain of RWC1 do not clarify function as restraints, as they do in animals.
The second possibility is that, as for MIP in
animals, a specific membrane environment may
be required to improve the translation of the
rwc1 mRNA [24].
Aquaporins belong to the MIP superfamily.
Functional diversification may have produced extant complexity of the MIP members. The same
superfamily members may play different roles in
response to the different requirements of specialized physiological processes of species and tissues
[25]. We expect that the gene complexity of
plants reflects different metabolite transport activities or different adaptations to stress challenges.
[1] G.M. Preston, T.P. Carroll, W.B. Guggino, P. Agre,
Appearance of water channels in Xenopus oocytes expressing red cell CHIP28 protein, Science 256 (1992)
385 – 387.
[2] M.J. Chrispeels, C. Maurel, Aquaporins: the molecular
basis of facilitated water movement through living plant
cells?, Plant Physiol. 105 (1994) 9 – 13.
[3] C. Maurel, Aquaporins and water permeability of plant
membranes, Annu. Rev. Plant Physiol. Plant Mol. Biol.
48 (1997) 399 – 429.
[4] A.R. Scha¨ffner, Aquaporin function, structure, and expression: are there more surprises to surface in water
relations, Planta 204 (1998) 131 – 139.
[5] C. Maurel, J. Reizer, J.I. Schroeder, M.J. Chrispeels, The
vacuolar membrane protein r-TIP creates water specific
channels in Xenopus oocytes, EMBO J. 12 (1993) 2241–
2247.
[6] A. Weig, C. Deswarte, M.J. Chrispeels, The major intrinsic protein family of Arabidopsis has 23 members that
form three distinct groups with functional aquaporins in
each group, Plant Physiol. 114 (1997) 1347 – 1357.
[7] W. Kammerloher, U. Fisher, G.P. Piechottka, A.R.
Scha¨ffner, Water channels in the plant plasma membrane
cloned by immunoselection from a mammalian expression system, Plant J. 6 (1994) 187 – 199.
[8] M.J. Daniels, E. Mirkov, M.J. Chrispeels, The plasma
membrane of Arabidopsis thaliana contains a mercury-insensitive aquaporin that is a homolog of the tonoplast
water channel protein TIP, Plant Physiol. 106 (1994)
1325 – 1333.
[9] M.J. Daniels, F. Chaumont, T.E. Mirkov, M.J.
Chrispeels, Characterization of a new vacuolar membrane aquaporin sensitive to mercury at a unique site,
Plant Cell 8 (1996) 587 – 599.
[10] C.H. Oppermann, C.G. Taylor, M.A. Conkling, Rootknot nematode-directed expression of a plant root-specific gene, Science 263 (1994) 221 – 223.
[11] S. Yamada, M. Katsuhara, W.B. Kelly, C.B.
Michalowski, H.J. Bohernert, A family of transcripts
encoding water channel proteins: tissue-specific expres-
L.-g. Li et al. / Plant Science 154 (2000) 43–51
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
sion in the common ice plant, Plant Cell 7 (1995) 1129 –
1142.
Y. Kitagawa, K. Yoshizaki, Water stress-induced chilling
tolerance in rice; putative relationship between chilling
tolerance and Ca2 + flux, Plant Sci. 137 (1998) 73 – 85.
Y. Koga-Ban, M. Abe, Y. Kitagawa, Alteration in gene
expression during cold treatment of rice plants, Plant
Cell Physiol. 32 (1991) 901–905.
J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular
Cloning: a Laboratory Manual, second ed., Cold Spring
Harbor Laboratory Press, Cold Spring Harbor, NY,
1989.
G. Gilliland, S. Perrin, K. Blanchard, F. Bunn, Analysis
of cytokine mRNA and DNA: Detection and quantitation by competitive polymerase chain reaction, Proc.
Natl. Acad. Sci. USA 87 (1990) 2725–2729.
K.S. Reece, D. McElroy, R. Wu, Genomic nucleotide
sequence of four rice (Oryza sati6a) actin genes, Plant
Mol. Biol. 14 (1990) 621–624.
R. Zhang, K.A. Logee, A.S. Verkman, Expression of
mRNA coding for kidney and red cell water channels in
Xenopus oocytes, J. Biol. Chem. 265 (1990) 15375 –
15378.
R. Zhang, A.S. Verkman, Water and urea permeability
properties of Xenopus oocytes: expression of mRNA
from toad urinary bladder, Am. J. Physiol. 260 (1991)
C26–C34.
G.M. Preston, J.S. Jung, W.B. Guggino, P. Agre, The
.
[20]
[21]
[22]
[23]
[24]
[25]
51
mercury-sensitive residue at cysteine 189 in the CHIP28
water channel, J. Biol. Chem. 268 (1993) 17 – 20.
I. Johansson, M. Karisson, V.K. Shukla, M.J.
Chrispeels, C. Larsson, P. Kjellbom, Water transport
activity of the plasma membrane aquaporin PM28A is
regulated by phosphorylation, Plant Cell 10 (1998) 451–
459.
G. Calamita, K. Bettina, M. Bonhivers, R. Bishai, E.
Bermer, P. Agre, Regulation of the Escherichia coli water
channel gene aqp2, Proc. Natl. Acad. Sci. USA 95 (1998)
3613 – 3627.
S. Yamada, T. Komori, P.N. Myers, S. Kuwata, T.
Kubo, H. Imaseki, Expression of plasma membrane water channel genes under water stress in Nicotiana excelsior, Plant Cell Physiol. 38 (1997) 1226 – 1231.
K. Fushimi, S. Uchida, Y. Hara, Y. Hirata, F. Marumo,
S. Sasaki, Cloning and expression of apical membrane
water channel of rat kidney collecting tubule, Nature 361
(1993) 549 – 552.
S.M. Mulders, G.M. Preston, P.M.T. Deen, W.B. Guggino, C.H. van Os, P. Agre, Water channel properties of
major intrinsic protein of lens, J. Biol. Chem. 270 (1995)
9010 – 9016.
J.B. Mariaux, C. Bockel, F. Salamini, D. Bartels, Desiccation- and abscisic acid-responsive genes encoding major intrinsic proteins (MiPs) from the resurrection plant
Craterostigma plantagineum, Plant Mol. Biol. 38 (1998)
1089 – 1099.