AGRICULTURAL BIOTECHNOLOGY FOR AFRICA’S DEVELOPMENT Dr. Joseph Ndunguru Mikocheni Agricultural Research Institute INTRODUCTION Agricultural sector is the backbone of most African economies contributing on average about 33% of Africa’s Gross Domestic Product. Today Food is a Global Issue There is enough food in the world - Distribution is a problem (local production?) - Poverty restricts full access - Energy issues for transport, storage What are the best production solutions? -Biotechnology, better varieties - large-scale farmers (yes) - subsistence farmers (questions) -Reduce post-harvest losses (small scale) What are the societal concerns? (sustainability) Emerging Emphasis on Sustainability Plus “Resilience” (year-to-year stability) 1. Can sustainability components be maintained and stabilized? 2. Traumatic events are occurring more frequently - Global climate change occurring - More droughts and they are more severe - More severe storms causing flooding and erosion - Greater range in day and season temperatures - More insect and disease pressure - More drought and flooding stress - Energy costs change rapidly altering - costs for transportation - costs for equipment and farm operations - costs to consumer so less money for food - Grain prices change rapidly and lead to more poverty 3. How can biotechnology improve sustainability and resilience Population growth is outstripping food supply. The world population is expected to reach 7 billion within 25 years, over 10 billion in the year 2050, while agricultural production is growing at the slower rate of about 1.8 % annually. Immediate implementation of non conventional practices to bridge this deficit like Agricultural Biotechnology is the need across the globe. However, this technology has not penetrated areas where it is most needed like Africa and Asia. Realities….. 800 million people cannot afford two course of meals About 30,000 people, half of them children, die every day due to hunger and malnutrition Nearly 1.2 billion people live on less than a dollar a day “In the next 50 years, mankind will consume as much food as we have consumed since the beginning of agriculture 10,000 years ago - Clive James” Problems with Agriculture in Developing Countries Low productivity – – – – – Small holdings Subsistence Limited water and land Disease, pests, drought, weeds Storage and transportation Conventional plant improvement methods are reaching their limits Agricultural growth is now 1% compared to 3% in 1970s Low Productivity Smallholder Farming Low Crop Yields not enough to invest No capital to invest for high quality inputs Poverty & unemployment Food insecurity not enough to eat Low/no marketable surplus not enough to sell Vicious Cycle of Poverty Low/no farm cash income Several advancements have been made recently in Africa towards biotechnology application Plant biotechnology has been highlighted as having the potential to contribute to the food security and poverty alleviation goals In Tanzania for example it fits within a target of increasing agricultural productivity and ensuring food security as stipulated in KILIMO KWANZA and MKUKUTA Definitions Traditional – Biotechnology Making use of living organisms or genetic material from living organisms to provide new products for agricultural, industrial, and medical uses. Modern Biotechnology – The application of the techniques of molecular biology and/or recombinant DNA technology, or in vitro gene transfer, to develop products or impart specific capabilities to organisms Biotechnology Genesis 1st Generation Biotechnology producing wine, beer, cheese, vaccines 2nd Generation Biotechnology conventional breeding, tissue culture techniques 3rd Generation Biotechnology or “Modern Biotechnology recombinant DNA technology, GMO’s, genomics, proteomics, metabolomics, Human genome project… How can Biotechnology Contribute? 1. Contribute to food security - Sustainability (yes) - Resilience (yes, by tolerance/resistance to drought, disease and pest resistance) - Reduce post-harvest losses 2. Components for use of biotechnology -“locate” and “follow” gene in breeding (MAS) -“transfer” gene from one organism to another - genetically modified organism - genetically engineered crop 3. Does the public understand? - Would you eat a food that contains “genes”? What is the role of biotechnology in food security? Role - What can it do? (near unlimited potential) What will society allow it to do? (challenge) Biotechnology - A “new” tool to locate and follow a gene within the same species (very high) - A “new” tool to move a gene into a different species (able but concerns) - Really a support tool - Still needs other disciplines Food Security - Adequate supply, affordable (yes) - Improve sustainability (yes) - Improve resilience (yes) - Depends on local customs and cultures - Depends on local laws and policies Transgenic Plant – a plant contains transgene(s) that have been artificially inserted instead of acquiring them through other means. – The transgenes (or inserted gene sequence) may come from another unrelated living organism. Example: Bt maize contains an endotoxin gene from Bacillus thuringiensis, an insect pathogenic bacterium. – Also known as: GMO (Genetically Modified Organism) Genetically Engineered Organism Genetically Enhanced Organism Biotech Crop Transgenics • The power of this technique lies in its ability to move genes from one organism to crop plants to impart novel characteristics • It is possible to transfer genetic material from algae, bacteria, viruses or animals to plants or to move genes between sexually incompatible species Application of GM technology Improving yield Nutritional improvement Increasing shelf life of fruits and vegetables by delayed ripening Conferring resistance to insects, pests and viruses Tolerance to abiotic stresses (drought, salt, water-logging) Herbicide tolerance Edible vaccines “What Is a Gene?” A gene is a segment of DNA that contains the genetic instructions for a protein. Proteins give plants unique traits. Chromosomes are composed of long strings of DNA. CONVENTIONAL CROSSING BETWEEN UNRELATED SPECIES …… IMPOSSIBLE! Homo sapiens X Homo sapiens Gallus gallus X Oryctolagus cuniculus Genetic engineering Moving bits of DNA from one species to the DNA of another (made possible by the MIRACLE of the genetic code) PROCESS = TRANSFORMATION PRODUCT = TRANSGENIC ORGANISM G M O CONVENTIONAL BREEDING Conventional donor Commercial variety X New variety = CONVENTIONAL BREEDING VS BIOTECHNOLOGY Conventional Donor Commercial line X Donor New variety = Commercial variety Geenoordrag Biotechnology New variety = Selective Breeding Test Test m many any y pla plants a for a certain cerrtain ttrait rait Cross-breed Cros ss-br breed that th ha plant with the crop ec rop strain Repeat untill a s trrain ain of wi with that tha at trait trait iis s crop wit found Conclusion: Unspec Unspecifi Unspecific cific so no confirm m amount am m of time needed Genetic Engineering Find Fin and isolate gene that tha a results in a certain trait tra – Can be from non-plant organisms Insert gene into crop Conclusion: Co Specific so much mu faster to do WHY IS BIOTECHNOLOGY CRUCIAL IN AFRICA? BIOTIC STRESSES IN CROPS CBSD 3/4/2013 Bacterial wilt Striga L/yellowinng 29 BIOTIC STRESSES IN HUMAN AND LIVESTOCK Malaria Cancer Tuberculosis HIV Diabetes East Coast Fever (ECF) New castle disease (ND) Rift Valley Fever (RVF) African Swine Fever Pests e.g. ticks, fleas 3/4/2013 30 ABIOTIC STRESSES IN CROPS Drought Low P, N Low soil fertility Low pH and Al toxicity 31 ENVIROMENTAL CONCERNS Increasing population Per capita arable land decreasing Overgrazing Soil erosion/degradation Loss of genetic resource 3/4/2013 32 Global Environment Grossly stressed Wide spread pollution Disrupted ecosystems Water scarcity – By 2025, nearly 50 percent of the world's population will face water scarcity. What are the causes of stress? Modern industrial economies not sustainable – Consume immense energy (soon global oil reserves be depleted) – Produce enormous volumes of waste and emissions Causes of stress cont. Developing world – Poverty and rapid population growth .. widespread degradation of natural resources for energy and materials – Rapid urbanization and industrialization .. high levels of air and water pollution hitting the poor hardest Biotechnology is being used to address problems in all areas of agricultural production and processing. The focus is on: 9 raising and stabilizing yields, 9 improving resistance to pests and diseases 9 Improve tolerance to abiotic stresses such as drought, salinity, low soil fertility and hence climate change mitigation, 9 enhancing the nutritional content of foods 9 to develop low-cost, disease-free planting materials Tolerance / Resistant to: – Pests (less pesticides used) – Herbicides – Diseases – Cold – Drought – Salinity https://www.achooallergy.com/b log/images/gm_strawberries.jpg Increases survival of crops Æ Higher crop yield M b i l bl l d Increased nutritional value – Undernourishment is a major problem in third world countries such as those in Africa Food can stay fresh for longer Food may taste better Current Crops with Biotech Traits Commercial Products Benefits to Growers / Consumers Herbicide Tolerance - Lower grower cost (corn, soy, cotton, canola) - Reduced herbicide residues - Enables no-till - Simplicity / flexibility Insect/Corn Borer Resistance costs (corn, cotton, potato) - Lower grower - Reduced pesticide usage - Decreased molds - Higher yields - Simplicity Current Crops with Biotech Traits Commercial Products Virus Resistance (potato, papaya) Delayed Ripening products Benefits to Growers / Consumers - Lower cost - Higher quality foods - Less acres used - Higher quality food - Longer shelf-life Biotech Foods and Health Enhanced protein and essential nutrients prevent disease – Vitamin A to prevent childhood blindness – Increased calories and nutrients to prevent malnutrition Increasing food availability by reducing spoilage Golden rice Healthier Foods Added Nutrients – Wheat – Rice Reducing Natural Food Toxins Fighting Hunger Improving yields of food staples Controlling insects Controlling crop diseases – Bananas – Cassava – Sweet potato virus Greater salt tolerance Food Security Increasing crop productivity to meet growing global food needs Increasing crop productivity of staple foods rich in protein and calories Increasing access to a healthy, diverse diet Biotechnology tools used in Africa (percent use of all institutions surveyed Source: FAO’s GIPB plant breeding and biotechnology database (http://gipb.fao.org/Web-FAO-PBBC/) using FAO classification of countries. Note: AfDB classification considers 1) Eastern Africa contains data from Eritrea, Ethiopia, Kenya, Madagascar, Malawi, Mozambique, Rwanda, Uganda, Zambia, and Zimbabwe; (2) Middle Africa contains data from Angola, Cameroon, and Gabon; (3) Southern Africa contains data from Namibia only; (4) Western Africa includes data from Benin, Burkina Faso, Côte d'Ivoire, Ghana, Mali, Niger, Nigeria, Senegal, Sierra Leone, and Togo; and 5) Northern Africa includes data from Algeria, Morocco, Sudan, and Tunisia. Africa’s GM research and commercial projects 2003-2010 Crop Banana Cassava Cocoa Cotton Cowpea Technolog y type PQ FR IR IR BR NE PQ PQ VR NE FR AP HT IR IR/HT AP AP IR Cucumber, VR Melon, Squash Groundnuts AP Research projects and areas of interest Africa wide 2003 –2005 Extended shelf life Fungal resistance to Sigatoka Nematode resistance Weevil resistance Bacterial resistance Decrease post-harvest deterioration novel starches Virus resistance mosaic virus Ongoing research projects Commercial release 2010 2010 Uganda Uganda South Africa Egypt, Kenya, Uganda, Zimbabwe Kenya, Nigeria, Uganda fungus resistant-witches broom and frosty pod rot Drought tolerance Insect resistance - Bollworm Drought tolerance productivity enhancement Resistance to cowpea aphid- borne mosaic Egypt South Africa Kenya, Nigeria, Uganda, Zimbabwe South Africa South Africa Burkina Faso South Africa South Africa Ghana Egypt Drought tolerance, Aflatoxin control Resistance to rosette and clump VR viruses IR Control of storage insects (weevils) Source: Atanassov et al. (2004); IFPRI Rapid Assessment Report (2006); Karembu (2009); personal communication. tobacco streakresistant; virus VR Note: AP: agronomic property; IR: insect VR: viral resistant; FR: Fungal resistant; PQ: Product quality; HT: herbicide tolerant. HT Herbicide resistance used to manage Crop Maize Technology type Research projects and areas of interest Africa wide Ongoing research projects Commercial release 2010 2010 HT 2003 –2005 Herbicide resistance South Africa IR Insect resistance - Stem borer South Africa, Zimbabwe VR Resistance Maize Streak Virus Drought tolerance AP FR Fungal resistance to Fusarium and Stenocarpella HT Glyphosate resistance PQ Vitamin enhanced IR/DT Kenya, Mozambique, Tanzania, South Africa, Uganda South Africa South Africa HT/Bt South Africa Potato IR Rice IR Insect resistance PQ Nerica VR RYMV resistance FR Pyriculariose resistance (fungus) Egypt, South Africa Sugarcane AP Sweet potato VR Featherly mottle virus Kenya, Zimbabwe Sorghum PQ Nutrition enhancement Kenya, Nigeria, South Africa IR Striga resistant South Africa Soybeans Tomato Egypt, South Africa South Africa VR Resistance to TYLCV PQ Delayed Ripening Egypt Agricultural Biotechnology focus in Africa Tissue Culture and Micropropagation Disease diagnostics Genetic Engineering to produce GMO Livestock vaccine Marker-assisted breeding Germplasm characterization Environmental conservation and climate change mitigation and adaptation 3/4/2013 49 I: TISSUE CULTURE Rapid mass propagation of improved planting materials Production of pathogen-free planting materials – Banana, cassava, Sweet potato, – Pyrethrum, sisal Germplasm and biodiversity conservation Micropropagation and tissue culture plant generation at MARI Tissue Culture banana (MARI, Tengeru, Arusha) 3/4/2013 52 II: PLANT DISEASE DIAGNOSTICS Recently Agricultural biotechnology labs have been established in Africa for crop disease diagnostics Using biotechnology and molecular biology tools viruses affecting different crops in Africa (eg Cassava, sweetpotato, banana in Tanzania) have been identified and characterized Complete genomes of cassava mosaic disease (CMD) and cassava brown streak disease (CBSD) have been sequenced Maps showing distribution of these virus strains (we know what is where) are available. Information is useful for decision making and breeding CMD-affected cassava plants display severe mosaic symptoms (BATO BATO) Yield of CMG-infected Plant Severe root necrosis and constrictions PCR-based detection of cassava mosaic geminiviruses RT PCR detection of CBSV Novel viruses identified Other Molecular Techniques for Disease Diagnostics - in crops Coconut Phytoplasma Rice Yellow mottle virus Sweet potato viral diseases Banana viruses MARI, SUA, 3/4/2013 61 Biotech - in Livestock Dev. of Diagnostics and vaccines for East Coast Fever (ECF) New castle disease (NCD) Rift Valley Fever (RVF) Contagious bovine pleuro pneumonia (CBPP) Breeding for improved milk and meet production 3/4/2013 CVL, SUA IN COLL WITH ILRI Emerging Plant Disease diagnostic capacities in Africa RWANDA MOZAMBIQUE DIAGNOSTIC LAB BIOTECH CENTRES Status of cassava mosaic viruses in the project countries (2009-2010) COUNTRY ACMV EACMV A+E TOTAL Tanzania 8(3.1%) 134(51.9%) 6(2.3%) 258 Uganda 50(30.1%) 20(12) 20(12) 166 Kenya 29(8.0%) 176(49%) Rwanda 9(3.1%) 258(89.5%) 8(2.7) 288 Malawi 0 120(72.2%) 0 165 Zambia 59(30.8%) 39(20.4%) 15(7.8) 191 Mozambique 0 49(42.9%) 0 114 T t l 155 (10%) 796(51 6%) 359 70(4 5%) 1541 A Map of Tanzania showing distribution of CMGs III: GENETIC ENGINEERING – a plant contains transgene(s) that have been artificially inserted instead of acquiring them through other means. – The transgenes (or inserted gene sequence) may come from another unrelated living organism. Example: Bt maize contains an endotoxin gene from Bacillus thuringiensis, an insect pathogenic bacterium. Basic steps in creating a transgenics.. Isolate the gene of interest.. Vector is chosen, to carry in to the plant’s cell Gene is clipped & loaded on to vector (genetic gun) Once the gene has been delivered in to cell, travels in to the chromosome strand. New gene becomes part of the plant’s recipe book. Development of genetically engineered plants: First transgenic plant: 1983 Field testing began: 1987 Commercial planting began: 1995 In 1998, a transgenic papaya resistant to Papaya Ring Spot Virus was introduced to farmers in Hawaii Dominant Biotech Crops, 2005 S. No. Crop MHa %Biotech 1 Herbicide tolerant soybean 54.4 60 2 Bt maize 11.3 13 3 Bt/herbicide tolerant maize 6.5 7 4 Bt cotton 4.9 5 5 Herbicide tolerant Canola 4.6 5 6 Bt/herbicide tolerant cotton 3.6 4 7 Herbicide tolerant maize 3.4 4 8 Herbicide tolerant cotton 1.3 2 Total 90.0 100% Genetic engineering for Crop Protection… Protection of crops from pests, insects, viruses, bacteria, nematodes, fungi & weeds. Chemical pesticides, herbicides are not selective enough to affect only harmful organisms. More refined BT can be used (Bt cotton) New approaches to Animal Agriculture.. Animal breeding, Fish farming. Bt crops protect plants against specific insect pests… A unique feature of the insect-disease-causing organism. Bacillus thuringiensis (Bt), - its production of crystal-like proteins that selectively kill specific groups of insects. When insect eats these cry proteins, its own digestive enzymes activate the toxin form of the protein. Cry proteins bind to specific receptors on the intestinal walls and rupture the midgut cells. Bt crops protect plants against specific insect pests GE for Transgenic crops… Transgenic varieties – more productive, precise… Overcomes the limitations of traditional breeding $OORZVVFLHQWLVWVWRXVHQHZWUDLWVIURPPDQ\ NLQGVRISODQWVDQGRWKHUOLYLQJWKLQJV Generating high-yielding varieties by genetic manipulation of plant architecture…………... 9 The major factor that contributed to the success of the green revolution was the introduction of high-yielding semi-dwarf varieties of wheat and rice, in combination with the application of large amounts of nitrogen fertilizer. DR. M. S. Swaminathan World Food Prize - 2003 Beta- Carotene rich - Golden Rice (improved nutrition) Golden Rice http://www.princeton.edu/~fecelik/GMFoods/impactshumanconsumptionpros. Case study: Virus-resistant Cassava for sub-Saharan Africa and maize ■ Kenya, Nigeria, Tanzania, Malawi, Uganda, USA, (South Africa) Cassava and Geminiviruses 35 to 50 Mt losses / year Genetic engineering facility at MARI Funding from – ASARECA – RF – BMGF Objectives Regeneration and transformation protocols for CBSD and CMD resistance in cassava 3/4/2013 87 ROOT NECTROTIC SYMPTOMS CAUSED BY CBSV For the first time MARI has been able to transform cassava with a reporter gene (GUS). Somatic embryos have been generated from cassava landraces in Tanzania Cotyledon embryos Friable Embryogenic callus GUS + embryos TMS 60444 cassava plantlets emerging from transformed FEC at MARI Regeneration of new plants from embryogenic culture Developing transformed plantlets B) WATER EFFICIENT MAIZE FOR AFRICA (WEMA) • Goal: – To enhance food security by producing and availing drought tolerant and insect protected maize seeds to farmers in Sub-Saharan Africa royalty-free • Partners – AATF – NARS Institutions from Kenya, Uganda, Mozambique, S. Africa and Tanzania – CIMMTY – Monsanto CFT Development What are people’s concerns Is this food safe? Should food be labeled? Are there adverse environmental effects? Patenting of seeds Discrimination against the poor Who benefits? All of these concerns apply to food and agriculture in general Environmental concerns Transfer of genes to wild relatives increases their “weediness” Increased pest and pesticide resistance Deleterious impacts on non-target organisms Reduced in situ crop genetic diversity ? 95 Environmental concerns… Horizontal gene transfer Effect on non target organisms Development of resistance by pests GMOs may increase weediness Concerns have been expressed that GM crops will hybridise with related species and result in the introduction of foreign genes to weedy relatives For GMOs conferring resistance to pests, diseases, and herbicides it is often feared that they may result in enhanced fitness, survival and spread of weeds. – To address this one could: Create sterile male plants that don’t produce pollen Engineer the plants so that pollen doesn’t contain the foreign genes Create buffer zones of non-GM crops around GM crops. The buffer crops would not be harvested. Fears versus Impact Consumer fears: Real impact: Chemical interaction with living things Very small, but targeting a pest with any method, biological or chemical, without side effect is possible cause of problem. (Dale et al. 2002) Change in persistence or invasiveness of the crop Small with current case-by-case assessment of GM crops, with relevant underpinning research. (Dale et al. 2002) Gene flow by pollination to weeds and feral plants Some possible future modifications in GM crops, such as salt tolerance or cold tolerance, could potentially produce novel crop types whose impact on the environment will need to be assessed with particular care. (Dale et al. 2002) Smaller risk than with the use chemical control. (Dale et al. 2002) Reduced efficiency of pest, disease, and weed control Effect on wildlife biodiversity Risk not higher than with conventional agriculture. (Dale et al. 2002) Effect on soil and water by the increased use of herbicides due to GM herbicide tolerant crops Decrease in herbicide use in the US after the introduction of GM soybean. (Dale et al. 2002) Introduction of allergenes Negligible with current methods GMO’s in the media: many false messages • GMO’s are allergenic • GMO’s make you impotent, make your brain shrink • Bt corn kills the Monarch butterfly • Genes from GMO’s spread without control, normal genes don’t The true claims also hold for traditionally bred varieties, for example risks of herbicide tolerant plants Agricultural biotechnology research and development pipeline Lab research Field studies Regulatory development Commercial development Farmer-ready products IV: APPLICATION OF BIOTECHNOLOGY IN PLANT BREEDING Techniques used to accelerate and facilitate conventional plant and animal breeding (very useful in Africa) This involves use of DNA probes (molecular genetic markers) to identify genetic material of interest in plant varieties and animals used for breeding. In Tanzania, molecular markers have been identified that are useful for germplasm characterization eg in cassava and sweetpotato MAS in Cassava in Tanzania 504 genotypes (3032 in vitro plantlets) selected by MAS introduced from CIAT in 2004 Field planting & evaluation of the introduced genotypes at Alawi estate, Kibaha in collaboration with IITA They were crossed with 140 local cassava genotypes Using 13 SSR markers and 1176 SNPs validation, A total of 685 (530 SNPs and 155 SSRs) markers were successfully mapped in 29 genetic linkage groups in cassava 1 2 3 5632/8xMT Toapesa Kimaji Limbanga Guzo(Amani) 4749 5043/2 5538/19MT MilundiyaNzobe 4760/37 476 Rushura Saranga Njemu Chimaji 27234/114 Ndelela LiongoKwimba LumaraNyeupe Miguluko Borakupata Rubonarusharila Siyatera Lwihilaabanafu Soya Ismail LumaraNyekundu Obaradak1 kachongoma karingisi Konyu Lwabakanga Famba Albert Rubona Kachaga Musongoma Syenene Nanchinyaya2 Nanchinyaya-1 Mdala Kasumaili Klorokwini 82324 Kilusungu kalombe Lipukalyene Kichoko Kalolo(mtwara) 4759/25 Nyakinyaha KitingishandevuPamba Mshelisheli Mahiza Kitumbua Dendrogram showing three similarity clusters of the local cassava varieties and improved Amani varieties – 1: Predominantly LZ – 2: Predominantly EZ & SZ – 3. Predominantly Amani KitingishandevuMwekundu Guzo(Local) Kabinda Kaniki2(nyeupe) Ndunga 5649/17 Sheria1 Kigoma Ex-masosi Mfaransa(chasimbMW Cheusimwangia-2 Kibangameno Mreteta-1 Bilali Mfaransa2 Kigomamtoto Mreteta(EZ) Cheupe/Kibangame Mzungu Kigomared 5043/14 Bwanamrefu Bukarasa Takolamhindi Tukuyu Mbarika Lulanda Grisi Mkiwa2(B) Mizolo Kimanga Selele Cheusimwangia1 Swela Kalulu Kabiguto Ndyale Mdala Obaradak-2 Dide Mfaransa(chasimb Kalolo(8) Kikombe Jaributena Kalolo7 4752 5318/3 50583/40 Tandika 5535/17 1299 5312/11x 5414/11 4593/1 50284/15 50432/11 Mreteta-2 50298/21 3232x 5543/20 5317/12 5512/14 Mpira Usiliechumbani 553/6 Kas-Red Makaranga Kiroba 4026/20MT Kashanshablii 12198 803 46106/26 12767 Kalinda 6330/22MT 12701 0.02 0.16 0.30 Coefficient 0.45 0.59 MARI has used SSR molecular markers to successfully characterize 57 sweet potato . Genotypes. About 4 clusters A, B C and D could be obtained ADVANTAGES: Varieties misnamed by farmers or with lost identity can be correctly identified using molecular markers MAS FOR Biotic stresses Lg: 1 0.0 11.1 29.6 34.2 43.0 52.5 54.8 57.2 59.8 62.5 69.2 71.5 73.8 79.5 85.5 88.0 92.8 95.2 95.9 97.2 97.9 102. 7 105. 2 107. 4 114. 0 118. 6 120. 8 124. 8 125. 2 129. 6 134. 1 49/1 136/ 3 175/ 1 1/8 177/ 4 55/4 CNZ29 CN1 1E10 48/4 158/ 4 Q41 Q51 143/ 6 B3/F7A_1 177/ 1 56/1 B2B /F9_1 42/2 Q11 CNIC 6 27/4 Q61 163/ 1 125/ 2 120/ 8 35/1 165/ 3 26/9 12/2 9/2 32/7 30/2 Q10 1 Q21 183/ 3 158/ 3 183/ 4 161/ 4 40/4 SNP 4-7a 161/ 6 55/1 161/ 3 143/ 8 Q42 126/ 4 123/ 3 185/ 1 Lg: 2 0.0 11.1 21.6 38.6 40.8 45.4 50.2 54.7 57.0 84.8 91.9 96.4 99.1 101. 4 103. 9 106. 2 108. 5 111. 0 115. 5 128. 3 130. 8 133. 1 135. 4 CNZ03 123/ 2 Qrl2 184/ 5 CNZ43 124/ 1 147/ 8 12/7 177/ 5 8/2 13/1 133/ 4 45/1 148/ 6 58/2 B4/F6A_1 119/ 10 12/5 CNZ12 119/ 7 159/ 14 184/ 10 26/3 161/ 2 159/ 2 171/ 4 31/1 Q01 CAC 13 117/ 2 B2B /F5_2 53/1 186/ 1 118/ 4 B7/F7A_2 CAC 11 36/6 119/ 9 171/ 7 187/ 1 129/ 3 130/ 5 171/ 6 175/ 4 3/4/2013 Lg: 3 54.4 58.8 66.5 4/5 141/ 9 12/6 121/ 2 1/3 46/5 134/ 4 118/ 7 31/3 36/4 141/ 2 1/4 39/3 160/ 2 164/ 3 147/ 9 118/ 3 SNP 4-7b 146/ 3 21/3 51/3 34/1 165/ 1 84.1 B6/F3_1 91.7 96.4 26/8 164/ 6 110. 6 115. 5 5/1 161/ 5 132. 5 37/1 0.0 4.6 7.0 9.4 14.0 23.5 25.8 30.2 34.6 36.7 41.0 48.3 52.1 144. 1 150. 7 119/ 12 169/ 3 136/ 4 Lg: 4 0.0 2.5 7.5 9.8 12.0 14.2 16.5 18.8 21.3 29.0 31.3 35.8 42.9 45.5 48.0 48.4 55.6 58.2 60.6 65.2 74.7 98.5 103. 3 117. 2 119. 5 121. 6 123. 9 131. 6 145. 5 147. 7 161. 9 56/5 5/2 155/ 3 38/1 52/4 35/6 181/ 4 152/ 8 115/ 5 120/ 1 131/ 3 135/ 1 53/5 180/ 1 139/ 2 161/ 1 Qll1 56/3 11/2 53/7 122/ 2 Q62 B5A /F1_1 157/ 4 120/ 2 184/ 6 188/ 5 171/ 8 159/ 4 116/ 2 52/1 136/ 1 B3/F6A_3 159/ 8 159/ 5 2/1 127/ 2 133/ 2 18/2 47/1 140/ 1 4/6 39/1 Lg: 5 0.0 5.1 9.7 15.6 20.6 40.2 49.1 51.6 56.3 60.8 70.4 77.3 81.8 86.5 94.4 99.1 103. 7 110. 7 117. 2 119. 6 122. 2 129. 3 49/6 51/2 127/ 4 12/3 CAC 4 B5A /F6A_2 38/7 Qlp1 127/ 3 178/ 6 162/ 4 156/ 2 127/ 6 184/ 7 127/ 3 CNA 12 156/ 3 1/7 176/ 4 183/ 2 Qw2 134/ 1 9/1 CNZ42 46/1 56/4 12/1 3/3 57/1 Qll2 145/ 1 53/3 16/1 Lg: 6 0.0 4.8 7.2 12.0 18.8 23.5 24.5 30.6 35.1 37.5 39.7 42.1 44.4 46.6 51.1 53.3 74.2 78.7 81.0 83.4 85.8 88.0 92.4 94.6 97.1 100. 2 102. 9 107. 2 Lg: 7 29/5 4/2 29/1 124/ 3 36/7 48/2 Q71 36/8 171/ 5 B3/F6A_1 B5A /F5_2 21/2 178/ 5 30/4 130/ 4 37/7 0.0 2.4 7.0 9.3 11.7 14.2 16.6 21.2 23.6 25.9 28.3 37.8 48/5 49/3 44/1 B8/F6A_1 135/ 5 188/ 1 32/9 46/3 155/ 1 128/ 3 175/ 2 5/4 49.9 52.2 3/7 173/ 10 13/2 144/ 1 51/4 14/1 32/6 27/3 174/ 2 163/ 9 149/ 3 CNZ23 119/ 2 53/6 67.7 148/ 5 85.3 CN2 A5 100. 4 Lg: 8 0.0 CNIG4 6.4 B8/F9A_1 16.6 21.0 25.3 29.6 36.2 38.4 42.8 17/1 5/5 131/ 1 141/ 14 141/ 4 115/ 4 130/ 2 49/2 CNZ06 35/3 B5A /F1_2 52/3 150/ 6 26/1 135/ 4 48/1 137/ 7 3/5 160/ 4 127/ 1 132/ 5 45.2 47.6 50.0 56.9 59.2 61.5 63.9 70.8 75.4 82.2 86.6 91.3 137/ 2 107. 9 32/5 124. 1 24/1 Rice – MAS for RYMV (RF) Maize - MAS for GLS Coconut- L/Yellowing (GTZ, EU) Cashew P/Mildew (GOT-Levy) 9 MARKER ASSISTED BREEDING Resistant Susceptible R S PAN 6124 B PAN 6128 R PAN 6118 PAN 6114 PAN 6126 PAN 6236 B PAN 6238 R NORTHERN CORN LEAF BLIGHT (WITROES) Exserohilum tursicum MAS for Abiotic stressesSorghum MAS for Drought tolerance in sorghum (SIDA) MAS for tolerance to Al toxicity in sorghum (SIDA) MAS for Increased P uptake sorghum (SIDA) Regional project ( MARI, MOI, Makerere univ, ICRISAT) 3/4/2013 11 Tea genotyping in Tanzania A B C D Abiotic stresses- Tomato MAS for Drought tolerance MAS for Heat tolerance (MARI, Univ DSM, AVDRC, Hannov univ, ICRISAT) 3/4/2013 13 VI: NOVEL DISCOVERIES OF GENES AND OTHER MOLECULES A) Recently, for the first time in the history of CMD research, two novel DNA molecules (satellites) were discovered (J. Ndunguru, 2005) in Tanzania They are associated with cassava mosaic disease, enhance virus symptoms, replication and break high CMD resistance in cassava We have confirmed that the satellites sequences are integrated in the cassava genome and are wide spread in wild and domesticated cassava in Africa and south America GGTACCACTACGCTACGCAGCAGCCATCATCGACATCGTATTTTAACCAG AGGACCCGTCGACCGCCTGAGCAGCAGCACGTCGCACCAGCACCACCGC CGCATCGCGCGCCTGTGAGCCGCCGCACCACTGGATCTCGTGCTCGTGAG CCGCCGCACGCCGCAACTCTTCATCTACCGCTCGTTTACAGCCCACCTCTG TATCACGCGATTGTGAGCCGCCGACTGCCCGCCGCACGCCCGCACCTCTG CATCAACTGCTCGTTTGCCACCCACCTCGCTCCTCTGCAGTTCAGCAGTTC AACTGTAAGCATTTTTTCGTTAAATCTGAAGAAAATAGTTCTGGATAGAATTT TGATTGGTAAGCATTATGAATTTATTATGACATTCAAGTTTATAGGCATCATAG TGTTGCTTAGGACATACTTAGCTTGTAGTTCCAGAAAATAGAGTCATTTCTG GTTTTCTTTTACAATGGAGGTGTTTATTCCATTGTAATTTTGAGCTGAGCTTT GTTAAGGACCTTTGGAGCTCGAGCTTTGTTTACAAGGCATCTTGATAGAGCT TTTCGAGCTCGAATTAGAATTAGGCTCATGGTTATACTAAAGGGAGTTTTTCA TGAGTTTGAGTGCTTCCAAAATTTTTTAATAA AAGCTTTACAAAGCTCAGCTTGGATCGATTACACCTCTACTGACCCTACT CAGTTTGGGACTCTGGCTGGGGCCATTCTCAAAAGCCATTTATCTGGGTA GCCTCTAATCCTTCAACTCTATTTTTCCGTTTGGTTCTGAGAGAGTACTA AAAAGGAAATCCAACCATATATGATCAAATCTAATGATATAGCTGGTGAG TACTGCAACATAATTGCAATTTATGCAGTTATTTCTCTTGAATTTGGTAT CTGCAATTTATGTATAAATCCCTAGCAGAATATTTTACTGGAGTGGTGAA TATGTGTAGGCTTCACTATGGTGGAAATGGAAATTTGTGTGTGATAACTT CCTGACTGGCTGCTGCGTAGCGTAGTGGTACC satDNA II (1032 nts) TGGGGATCCTAGGATATAAATAACACGTCCTTGTTTGCCAAAAAAAAAAAAAA AAATAATAATAATCTAGGCCTCGTTACTAAAAGTGCAAAAACCAAATAACTAAA CCCTCACTCTCCATCCCTAACATCTCGTATACTCTCAACGCAGCTGCCCGTTCC CTCCCCCGCCCGTGTCTACCTATCCGCCTCACCCTCTGGTGTAGACGTCCGCC TTCCGCCGATTGTCCCTCTGCTCTTCATGCTGTCAACGCCATTGCTGCATCCGG TGCTCGTTGCTGCGTCCGCTAGTCCTGGTTGCTTCTTTTCTCTCCTCCGCCGCT CCCTCTGGTCCTCGTCGTTGCATCCCCTGCTCCATTCCTTCTGCCGCCCGGTG CTGCTTGTCGCCTTTGGTCCTCGTCCTCAATCGCACCGCTGCTGCTCCTCGCC GCTACGTCAATCACTGTGGTTTCATATGTGTGCTTTCTAAGATTTGTTAGATTTAT TGATTTGGGTTTTTGAAATTTGCGGAAATGTTAAGATTTATATCAATGTGCTTGG GGTTGTATTCTTGAGATTTATTGAAAAAACTTTGAAATAAAGACTATTGTGAATT GATTGAGAGTTGTTTTAGTCAGATTTATTGAAATGGGTTTCTGAATTTTATTGAA ATGGTACTGTGAGATTTGGTATGAATTTTGTTTTATTTGTTGGGATTATGAGGTAA TGGGGTTCGGGTTGTTTCGTGTAGTAAATGGATAATGGTAAACGGGTTTAGGAC AGATAGGGGTAGTGAAATCCAATTCCTAAACAGGGTTGGGATGGGTTTGGGTT TGGATAGTGTATTTATAAAGGATTCGGGTACTTAAAATTTCGATGGTATCCTACC CAGTACCATCCCTAATTAGAGCTTATTAGCGACCAATTTGCAAGTAACCACTCT GCTGATGATATACATATATATTTAAAAGAATTAGGCATTTTTTGCTTCCAATTTTG AGCCCCGTTTAAGAATTGCAATTGAAACTAAACTCCTAGCTCTTTGATTTTTATG AATTTAACTTGAAATCAAGTGTTGAATTTGTATGCATGTATTGTGATTTGACTGT TCTGTGTGCAAGTGAGATTTGTTAAACCGCTGGTTCTCTATTTTGTTTCCGATGT GCTGAGATCTGTATATATGAGTTGAGAAGCAAATGATAGACGTGTTATTTATATC CTAGGATCCCCA satDNA III (1209 nts) Symptom enhancement and breaking of resistance VIRUS ONLY Virus + satellite DNA TME3 B) A new natural host of Cassava mosaic virus discovered in Tanzania (July 2012) Using modern biotechnology tools a shrub dating back to 1870 has been found by MARI team to be a new host of cassava mosaic begomovirus (CMB) in Tanzania. Sequence data confirmed this In addition to CMB , 3 more viruses were found in the same shrub that are known to infect tomato, pepper and cotton C) New Whitefly Biotype A new whitefly biotype (previously uncharacterised) has been found on the coastal areas of Tanzania using MCOI DNA analysis by MARI scientists. (Mugerwa et al., 2012 Ecology and Evolution in press) Distinct biotype HUMAN RESOURCE CAPACITY BUILDING ON AGRICULTURAL BIOTECHNOLOGY IN AFRICA a) LONG TERM TRAINING – BSc Molecular biology and biotechnology – MSc/PhD in biosafety – Diploma- in preparation Short term trainings -in all biotech aspects -biosafety and IP 3/4/2013 3/ 21 B) SHORT TERM TRAINING ON BIOTECH Univ Dar Es Salaam – Biosafety SUA – Livestock and crop biotech – Seed technology lab – Genome science centre MARI – Biotech in general – GMO detection TPRI – Biosafety GMO detection course at MARI 3/4/2013 22 Biotechnology information dissemination Biotechnology stakeholders attends National and Regional open biotechnology forums Manuscripts publications 10 submitted in 2011, 3 published 100 leaflets produced 30 posters produced 3 radio and TV programs Attending national agricultural shows FUTURE PROSPECTS/OPPORTUNITIES Although biotechnology application is limited in Africa, its potential application to agricultural improvement is huge. I: APPLICATION IN CLIMATE CHANGE MITIGATION -Biotechnology tools can be used to identify and characterize drought and salt tolerant genes for climate change mitigation II: APPLICATION IN SEED COMPANIES AND SEED PRODUCTION -Biotechnology is very useful in seed production, -Seed purity, -Produce high quality seeds Determination of seed purity using conventional methods Determination of seed purity using biotechnology III: PRODUCTION OF BIOINPUTS –Agric and industrial waste treatment (Bioremediation) –biopesicides –Production of biofertilizers (Univ DSM –DMBB) 3/4/2013 31 iv) Waste treatment Technology to compost municipal solid waste to produce fertilizer and spare landfill land V) Biofuel Production of fuel ethanol from molasses Replacement of leaded fossil fuel VI) Cleaner industrial production Cleaner Industrial production – Replacement of chemical processes with biological ones e.g. pulp and paper industries, textiles industries etc. VII. Mineral recovery Use of microorganisms to recover minerals from low grade ores e.g. gold mining (bioleaching) VIII. Industrial water cleaning Industrial wastewater treatment technologies for reuse of water – Fish and food processing factories – Textiles – Tanneries – Breweries – Sisal and coffee processing IX) Value added industrial chemicals Technologies for production of value added industrial chemicals e.g. Polyunsaturated fatty acids (PUFA) from fish waste. – Production est. at 120 kg PUFA/ton of Nile Perch waste (Turon et al 2005) – Production of citric acid from sisal inulin XI). Enzymes from local microbes Production of enzymes from local microbial resources CONSTRAINTS OF BIOTECH IN AFRICA Lengthy procedures for biosafety permit application (eg 2006-2010) Biosafety regulations not ready or conducive in some countries Limited capacity for biotech R &D and biosafety enforcement Lack of critical mass of highly trained scientists, technicians and entrepreneurs Lack of capacity to supply, service and repair scientific equips Inadequate biosafety facilities- waste and GMOs Limited linkages and networks 3/4/2013 3/4/2 39 Lengthy Procurement procedures for lab consumables Cost of plant biotechnology lab chemicals are very high and most scientists cannot afford Government regulations concerning import of perishable laboratory chemicals for plant biotech do not favour scientists Public acceptance Lack of trained people on Plant Biotechnology and those who are trained receive very little support In adequate laboratory space Underutilized tissue culture labs due to lack of funds Factors Determining the Future of Biotechnology in Africa Proactive policy: Africa deciding for Africa Biosafety legislation and institutions: ability to assess the technology for ourselves Scientific capacity building: ability to appropriate & adapt biotechnology IPR Regimes: protect and encourage private investments Public awareness and acceptance: credible competent communication strategies. Biotechnology funding in Africa Gross expenditure on R&D less than 0.3% (some 0%) International donors provide 75% of the R&D budgets Bilateral donors: EU, DFID, USAID, DANIDA, GTZ, SIDA,CIDA, etc Foundations: Rockefeller, BMGF, Gatsby Trust, IFS, KirkHouse Trust, etc World Bank Africa Development Bank Others: IDRC, IFAD, MAE(France),CTA, etc Challenges for the Future •Continuing Responsible Stewardship - assessment of risk •Ensure that biotech crops in conjunction with conventional technologies can CONTRIBUTE to a more Sustainable Agriculture, Global Food, Feed & Fiber Security, Alleviation of Poverty and a Safer Environment •Improved Communication with Society. Knowledge-based decisions re GM crops Way Forward Speed up the development of products with clear consumer benefits. Improved Communication with Society. Knowledge-based decisions re GM crops. Improve and maintain confidence in science and the government regulatory system. • Ensure that biotech crops in conjunction with conventional technologies can CONTRIBUTE to a more Sustainable Agriculture, Global Food, Feed & Fiber Security, Alleviation of Poverty and a Safer Environment Hoban, 2001 “There can be no peace until people have enough to eat… investments in agricultural research today can cultivate peace tomorrow… Biotechnology is not the enemy, Partner in progress.”