1. No category

From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
1992 80: 1537-1545
Human lymphotropic retroviruses associated with mycosis fungoides:
evidence that human T-cell lymphotropic virus type II (HTLV-II) as well
as HTLV-I may play a role in the disease
D Zucker-Franklin, WC Hooper and BL Evatt
Updated information and services can be found at:
http://www.bloodjournal.org/content/80/6/1537.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
Human Lymphotropic Retroviruses Associated With Mycosis Fungoides:
Evidence That Human T-cell Lymphotropic Virus Type I1 (HTLV-11) as Well as
HTLV-I May Play a Role in the Disease
By Dorothea Zucker-Franklin, W. Craig Hooper, and Bruce L. Evatt
The human T-cell lymphotropic virus type I (HTLV-I) is
causally associated with adult T-cell leukemia, but its role in
mycosis fungoides (MF) has remained enigmatic. The virus is
suspect because a small percentageof patientswith MF have
antibodies to it, the cells of others harbor deleted HTLV-I
proviral sequences, and particles resemblingHTLV-I emerge
in cultured blood lymphocytesobtained from most patients.
An alternative possibility is that disparate lymphotropic
retrovirusesmay infect or affect a population of epidermotropic lymphocytes, leading to the same outcome, ie, MF. In
studies designed to identify the particlesdetected in lymphocyte cultures of nine patients with a diagnosis of skin
involvement characteristic of MF, this concept has gained
support. While the cells of four patients provided evidence of
HTLV-I infection, molecular hybridization with HTLV-IIspecific pol probes showed HTLV-II in the cells of another
patient. The 103-bp fragment amplified by the HTLV-IIspecific probe was sequenced and proved to have greater
than 90% homology with the same fragment amplified from
cells known to be infected with HTLV-II. A role for HTLV-II in
MF has not been suggested heretofore. Therefore, HTLV-I,
HTLV-II, and their incomplete forms may be found in cells of
MF patients, suggestingnew theories regardingthe pathogenesis of this disease.
o 1992 by The American Society of Hematology.
T
additional observations bearing on the subject: (1)HTLV-I1
infection is endemic among several indigenous populations
in the western world, where it is acquired perinatally when
the virus appears to have little or no pathogenicity. (2)
There is a rapidly increasing prevalence of adult-acquired
HTLV-I1 infection among sexually promiscuous individuals
and intravenous drug a b ~ s e r s . ’ ~The
- ’ ~ observation that the
blood lymphocytes of one of nine patients presenting with
clinical and pathologic signs typical of MF harbored HTLV11, whereas four others studied in parallel showed incomplete HTLV-I DNA sequences supports the concept that a
variety of lymphotropic human retroviruses could directly
or indirectly play a role in the pathogenesis of this disease.
The present report communicates these observations.
H E HUMAN T-CELL lymphotropic virus type I
(HTLV-I) is causally associated with adult T-cell
leukemia/lymphoma (ATLL). When the virus was first
isolated, it seemed likely that the cutaneous neoplasm,
mycosis fungoides (MF), and its leukemic variant, the
Stzary syndrome, were also caused by this agent.’” However, even now, more than a decade later, there are
arguments suggesting that this assumption may have been
premature. Although both ATLL and MF are neoplasms
involving T-helper lymphocytes, the conditions are clinically, pathologically, and epidemiologically distinct4 (Table
1).Nevertheless, a small percentage of patients with classical MF have antibodies directed against HTLV-1: and MF
is often considered part of a spectrum of cutaneous T-cell
lymphoma. Thus, there is some overlap. Recently, Hall et
a16 have reported evidence for the presence of deleted
HTLV-I provirus in cells derived from such individuals.
Our own laboratory has observed viral particles in cultured
lymphocytes of 18 of 20 consecutive MF patients,’ and we
were able to amplify HTLV-I proviral sequences in three of
these specimens? Although Manzari et a19reported to have
shown a new retrovirus (HTLV-V) in the lymphocytes of
seven patients with cutaneous T-cell lymphoma, this report
has remained unconfirmed. Therefore, HTLV-I has remained a prime suspect in the disease even though the virus
particles that emerge in the cultured lymphocytes of almost
all patients with MF can be shown to represent HTLV-I
only in a small portion of cases. It seems possible that
disparate HTLV may be involved in the pathogenesis of the
disease. This concept has gained support from the present
observation that the cells of one patient with MF studied in
parallel with the specimens of eight others were proved to
harbor HTLV-11. An etiologic role for HTLV-I1 in patients
with MF has not been suggested heretofore. HTLV-I1 was
first isolated from a culture of mononuclear leukocytes
obtained from a patient with atypical hairy cell leukemia
(HCL) whose cells had a T-cell phenotype.1° Subsequently,
this virus was found to be associated with some other
atypical lymphoid malignancies, none of which were diagnosed as MF.*’-14New developments in immunologic and
biomolecular techniques have provided better means to
distinguish between HTLV-I and HTLV-11. This has led to
Blood, Vol80, No 6 (September 15). 1992: pp 1537-1545
MATERIALS AND METHODS
Patients. Heparinized peripheral blood (PB) was obtained
from nine patients with an unequivocal diagnosis of MF on the
basis of clinical manifestations and skin biopsies. Their ages ranged
from 35 to 80 years. They were either untreated or received topical
applications of steroids or nitrogen mustard. The time from
documentation of MF to culture of blood cells varied from 1month
to 12years. Their circulating Stzary cells, identified and counted by
electron microscopy as described,”21 ranged from 12% to 85%.
None of the patients had risk factors for HTLV-1/11, with the
exception of patient EB. Patient EB is described in greater detail
From the Department of Medicine and Kaplan Cancer Center, New
York University Medical Center, New York, Ny;and the Division of
HNIAIDS, Centerfor Disease Control, Atlanta, GA.
Submitted February 5,1992; accepted June 5,1992.
Supported by the National Institute of Health Grants No. AM-12274
and HL-42103 to D. Z.-F.
Presented in part at the meeting of the American Society of
Hematology (Blood 78:399, I991 [abstr, suppl I]).
Address reprint requests to Dorothea Zucker-Franklin,MD, N.Y. U.
Medical Center, Dept. of Medicine, 550 First Ave, New York, NY
10016.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1992 by The American Society of Hematology.
0006-4971f 92/8006-0024$3.00f0
1537
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
ZUCKER-FRANKLIN, HOOPER, AND EVAlT
1538
Table 1. General Characteristicu of ATLL and MF
AnL
Marrow
Nucleus
Elevated
Infiltrated
Irregular contour
IL-2 receptors
Skin lesions
Serology
Course
Distribution
Present
Minor, nonspecific
Positive
6 mo-2 yr
Mostly endemic
WBC
MF
Usually normal
Normal
Deeply convoluted
(cerebriform)
Usually absent
Major, diagnostic
Usually negative
Chronic
Sporadic
because, to our knowledge, she represents the first patient with MF
who is infected with HTLV-11. The patient is a 52-year-old black
female who had been symptomatic for only 1 year. Physical
examination showed widespread lichenification of the skin with
fine scales, multiple 2- to 4-mm nodules, and onchodystrophy.
There were palpable axillary and inguinal nodes, but no organomegaly. Laboratory data were significant for a white blood cell
(WBC) count of 18.9 x 109/L with 55% large and small atypical
lymphocytes seen on a routine PB smear. Abdominal scan showed
no abnormalities. Bone marrow (BM) aspirate as well as biopsy
were normal and showed no lymphocyte infiltrates. A skin biopsy
was diagnostic for MF (Fig I). The cells infiltrating the skin were
morphologically identical to those circulating in the PB. A lymph
node biopsy was considered consistent with “dermatopathic
lymphadenopathy.”
Immunofluorescence phenotyping of her blood lymphocytes
showed the following: 8% of the cells had surface Ig (5.4% light
chains, 2.6% A light chains); CD2,92%; CD5 (pan T). 80.9%; CD3,
88.9%; CD4, 85.1%; CD8, 7.8%; CD4/CD8 ratio. 10.9; CDla,
4.5%; CDIO. 2.8%; CD20 (pan B), 13.5%; interleukin-2 receptor
(IL-2R) (CD25). 4.3%; T-cell receptor, 81.5%; CD7,6%. Western
blot on the patient’s serum showed the following antibodies to
HTLV-1/11: P 15. 19,24.26.28,32,36,42, and Gp 46.
The patient was born in North Carolina. She is a Jehovah’s
Witness who accepts no blood products. She had been widowed for
2 years and raised four healthy daughters, who have produced 13
healthy grandchildren. No risk factors for either human immunodeficiency virus4 (HIV-I) or HTLV-I1 infection were elicited,
except that her deceased husband used intravenous drugs for 2
years before his death. Two deceased brothers were said to have
had Gaucher’s disease. Two siblingswho were available for testing
proved to be serologically negative for antibodies to HTLV-1/11.
They stated to have been breast-fed by the same mother as EB.
Their lymphocytes were also cultured. On our request, the patient’s pregnant daughter was tested for antibodies to HTLV-1/11
in North Carolina. She claims to be negative. No documentation
could be obtained.
Cell culrures. The PB mononuclear cells (PBMC) of the nine
MF patients, EBs siblings, and five healthy individuals were
isolated by ficolllhypaquegradient centrifugation, washed twice in
Hank‘s Balanced Saline (GIBCO, Grand Island, NY),and resuspended in RPMI-1640 (GIBCO) containing 10% heat-inactivated
fetal calf serum, penicillin, and streptomycin. Then the cells were
plated on 35-mm petri dishes at a concentration of 5 x 1CP cellsl2
mL. All cultures were supplemented with 1,OOO U/mLgranulocytemacrophage colony-stimulating factor (GM-CSF; Cetus Corporation, Emeryville, CA) and 10 U/mL 1L2 (Genzyme, Boston, MA).
Half of the dishes also received 30 mg phytohemagglutinin (PHA;
ICN lmmuno Biologics, Lisle, 1L) for the first 72 hours of culture.
When aggregates consisting of 20.000 to 90,OOO cells had formed,
GM-CSF was omitted. 1L2 was discontinued when cell proliferation appeared well established, which was within 4 to 6 weeks.
R
Fig 1. Skln and lymphr ~ n obtained
”
from patient EB at the tima of diagnosh. (A) Skln biopsy, embedded In paraffin, hemmtorylln
and eouin-stained, rhocharacteristic Pautriefs abwur (arrow) in the epldewnis. The dermis h intiltrated with lymphocytes. (B) Higher
magnification of Pautriefs abwss seen in (A). (C) Ultrastructureof pwlfled PB lymphocytes illustratesthe cerebriform nuclei of many of the cells.
The cytoplasmic filaments cannot be soan at thlr magnlfication. However, the cells’ stubby surface villi am apparent (arrow). Magnification
x3.500.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
HTLV-I AND HTLV-II IN MYCOSIS FUNGOIDES
1539
Electron microscopy and ultrastructural immunohistochemistry.
Freshly isolated mononuclear cells, as well as cells cultured for
various time periods, were fixed in 3% phosphate-bufferedglutaraldehyde, postfixed with osmium, dehydrated, and embedded in
Polybed 812 (Polysciences,Inc, Warrington, PA) as routine in this
laboratory. Thin sections were stained with uranyl acetate and lead
citrate. They were viewed with a Siemens Elmiskop I electron
microscope. For ultrastructural identification of the virus, the
immunogold technique was used as described.22The antibody
consisted of either IgG isolated from the patient’s own serum or a
monoclonal mouse antibody directed against the envelope epitopes
of HTLV-1/11 gp46 and gp63 (Genzyme). Briefly, the fixed cells
were incubated with 0.1% bovine serum albumin (BSA) for 10
minutes at 4°C to decrease nonspecific binding of the label. The
cells were then washed three times with 0.01 mol/L glysine in
phosphate-buffered saline (PBS) buffer to quench free aldehyde
groups. Subsequently, the cells were incubated with 0.1 mL of
monoclonal antibody (MoAb) diluted 1 : l O with PBS for 30 minutes
at 4°C. After being washed with buffer three times, the cells were
incubated for 30 minutes with 10 nm protein A-Colloidal gold
particles (Janssen Life Sciences Producfs, Piscataway, NJ) diluted
1:lO in PBS containing polyethylene glycol and BSA. This was
followed by five washes in PBS and fixation with 3% glutaraldehyde
in 0.067 mol/L phosphate buffer containing 1% sucrose at pH 7.2.
Postfixation and embeddingwas performed as described above.
Coculture. Aliquots of EB-cultured lymphocytes were irradiated with 5,000 R. Cell death was confirmed by the Trypan blue
exclusion test and the failure of the irradiated cells to have
incorporated 3H thymidine 72 hours after its addition. The cells
were then cocultured in a ratio of 1:l with Molt-4 cells, a
lymphocyte line that bears CD4 epitopes and that by electron
microscopy was found to be free of virus. At different time intervals
ranging from 3 to 9 days, aliquots were cytospun, fixed, stained with
Giemsa, and inspected for the formation of syncytia.
Enzymatic amplification of viral DNA. High molecular weight
DNA was extracted from the patient’s freshly isolated blood as well
as from her cultured cells using the Applied Biosystems 340A DNA
extractor (Foster City, CA). Control DNA was prepared from
PBMC obtained from five healthy individuals, HL-60 cells, MT-2
cells (a cell line infected with HTLV-I), and MOT (a cell line
infected with HTLV-11). The extracted DNA was subsequently
resuspended in sterile water. Primer pairs SK110-SK111, corresponding to a conserved region of both HTLV-I and -11; SK58-59,
corresponding to a conserved pol region of only HTLV-11; and
SK43-SK44, corresponding to a conserved pol region of tax
common to both HTLV-I and -11were commerciallyobtained from
Perkin Elmer (Nonvalk, CT).The hybridization probes SK112,
SK118, SK45, and SK60 were purchased likewise. The primer pair
2P4-2P6,correspondingto another conservedpol region of HTLV-I1
and the probe 2P5, was kindly provided by Dr Barum De (CDC,
Atlanta, GA). The primer pairs and probes are listed in Table 2.
One microgram of DNA was amplified through 35 cycles of
polymerase chain reaction (PCR) with the annealing temperature
at 55°C for 1 minute and the extension temperature at 72°C for 1
minute. The reaction mixture consisted of 50 mmol/L KCl, 10
mmol/L Tris (pH 8.3), 2.5 mmol/L MgC12, 200 mmol/L dNTP, 50
pmol of each primer, and 1.75 U of the Taq polymerase. The
reaction volume was 50 mL. To avoid possible contamination,
sample preparations and reactions were performed in separate
rooms using separate sets of positive displacement pipettors.
Furthermore, the PCR reactions were set up in an enclosed
plexiglass hood (Oncor, Gaithersburg, MD).
After PCR, the reaction mixture was electrophoresed through a
1% agarose gel and the amplified product was visualized by
ethidium bromide staining. The gel was denatured and neutralized,
and the amplified products were transferred to Gene Screen Plus
(Dupont, Wilmington, DE). The membrane was prehybridized
(50% formamide, 10% dextran sulfate, 6 x SSC, 1% sodium
dodecyl sulfate [SDS], and 150 mg of sheared salmon sperm) at
42°C for 1to 2 hours. The probes, SK188, SK112, SK45, SK60, and
2P5, were 5’ end-labeled with 32Pand added to the hybridization
bag at 2 million cpm/mL. After overnight hybridization, the
membrane was washed in two changes of 6 x SSC at room
temperature, followed by four washes in 4 X SSC, 0.1% SDS at
room temperature. The filters were exposed to film overnight at
-70°C.
Nucleotide sequencing of the amplifiedfiagments. After visualization on a 5% polyacrylamidegel, the DNA fragments were excised
Table 2. Position of Primer Pairs and Probes
Name
PrimerIProbe
Virus
Region
SKI10
Primer
HTLV-1/11
POI
SKI 11
Primer
HTLV-I/ II
POI
SKI12
SKI88
SK43
Probe
Probe
Primer
HTLV-I
HTLV-II
HTLV-I/ II
POI
POI
tax
SK44
Primer
HTLV-I/ II
tax
SK45
Probe
HTLV-1/11
tax
SK58
SK59
SK60
2P4
2P6
2P5
E-I
E-2
E-3
Primer
Primer
Probe
Primer
Primer
Probe
Primer
Primer
Probe
HTLV-II
HTLV-II
HTLV-II
HTLV-II
HTLV-II
HTLV-II
HTLV-I
HTLV-I
HTLV-I
POI
POI
POI
POI
POI
POI
env
env
env
Fragment
Size (bp)
186
159
103
143
430
Position
4757-4778 (HTLV-I)
4735-4756 (HTLV-II)
4919-4942 (HTLV-I)
4897-4920 (HTLV-II)
4825-4850 (HTLV-I)
4880-4898 (HTLV-II)
7358-7377 (HTLV-I)
7248-7267 (HTLV-II)
7496-7516 (HTLV-I)
7386-7406 (HTLV-II)
7447-7486 (HTLV-I)
7337-7376 (HTLV-II)
4198-4217
4281-4300
4237-4276
2989-3010
3131-3110
3025-3049
5476-5505
5905-5876
5509-5130
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
1540
ZUCKER-FRANKLIN, HOOPER, AND E V A l T
as slices from the gel and electroeluted. Direct sequencing was
performed according to Win~hip*~
with the exception that 200 ng of
template was used and dimethylsulfoxide (DMSO)was eliminated
from the termination mixture. The reactions were run on an 8%
denaturing polyacrylamide gel. The gel was subsequently dried and
exposed to film overnight with 1x intensifying screens.
RESULTS
A representative electron micrograph of the lymphocytes
(devoid of adherent cells) isolated from EB is shown in Fig
1C. These cells constituted 80% of her lymphocytes and
were in no way distinguishable from the cells of other
patients with MF or SCzary syndrome. Virus particles were
not seen in fresh isolates. A thorough search for ribosomal
lamellar complexes, frequently considered a hallmark for
HCL,B,z yielded negative results. The long processes
characteristic for hairy cells were also absent. Of note was
the abundance of cytoplasmic filaments commented on by
us in previous reports.20.26 Indirect fluorescence staining
with a variety of antibodies suggested that these structures
consisted of vimentin (data not shown).
Ultrastructural and immunohistochemical analyses. Because we have recently reported on the emergence of virus
particles in the lymphocyte cultures of patients with MF
who were infected with HTLV-I,8 only morphologic data
relevant to EB will be presented here. Particles were readily
found in specimens that had been fixed as early as 2 weeks
after the beginning of culture. These measured 100 to 150
nm in diameter, and were usually closely apposed to the
plasma membrane. They were indistinguishable from those
reported by us in cultured lymphocytes of patients with MF
who had no demonstrable antibodies to HTLV-I/II.7,s
Many particles were incomplete in that they lacked nucleoids. On the other hand, occasional cells were surrounded
by massive numbers of particles, most of which appeared to
be complete virions (Fig 2). Viral budding, as illustrated in
Fig 2D, was also seen. The immunogold method using
either the patient’s own antiserum or monoclonal antisera
directed against envelope proteins gp46 and gp63 reacted
specifically with the particles as well as with areas of the
plasma membrane of cells with which viruses were associated at other sites (Figs 3 and 4). By indirect immunofluorescence microscopy performed when the cultures were 71
days old, 43% of the cells were brightly fluorescent, 33%
had faint fluorescence, and 24% were negative for viral
epitopes (Fig 5A). At the time these immunofluorescence
studies were performed, ie, after 2.5 months in culture, 80%
of the cells had remained CD2+, 50% were CD4+, 5%
reacted with anti-CD20, and none were IL-2R positive. The
cells appear to be immortalized as they continue to proliferate for more than 1 year in the absence of any growth
factors. It is noteworthy that the mononuclear cells obtained from EB’s siblings did not show any viral particles.
Coculture. Syncytia formation was seen within 3 to 9
days among Molt-4 cells that had been cocultured with
irradiated EB cells (Fig 5B). It may be of interest to
mention that syncytia gradually disappeared from these
cultures and were no longer seen after 4 weeks. Whether
the virus is still detectable by electron microscopy has not
yet been determined.
Molecular identification of viruses. The findings on DNA
extracted from the cells of all nine patients are summarized
in Table 3. The “group specific” primer SK434V7 that
amplifies a conserved region of tax, common to both
HTLV-I and -11,27yielded a positive result only with EB
cells. DNA fragments of two patients (CO and AW)
hybridized with an’HTLV-I-specific pol probe and extracts
from cells of four patients hybridized with HTLV-1/11 Env
probes. The last-named fragments are under further study.
Southern blot analyses of PCR products using an HTLV-Ispecific pol probe have been published previously? These
data are included here only to underline the specificity of
results obtained on DNA extracted from EB cells. To
further identify the virus with which EB appeared infected,
the pol region primer pairs SK110-111 and SK58-5928were
used in the PCR performed, with DNA from the patient’s
freshly isolated cells as well as from her cultured cells.
Hybridization with the HTLV-11-specific pol probes, SK60
and SK188, showed that only the DNA fragments extracted
from EB-derived cell$ and those from the HTLV-IIinfected cell line, MOT,were positive for HTLV-I1 (Fig 6).
Similar results were obtained when 2P4-2P6,29another set
of HTLV-I1 pol-specific primers, was used (data not shown).
To conclusively identify the virus harbored by EB cells, a
portion of the fragment amplified by the SK58-59 primers
was sequenced and compared to MOT DNA similarly
amplified and sequenced. As seen in Fig 7, comparative
analysis showed greater than 90% hotnology between the
two sequences.
DISCUSSION
There is little doubt that one of the nine patients with MF
studied here is infected with HTLV-11. Although there is
considerable immunologic cross-reactivity between HTLV-I
and HTLV-11, a 103-bp DNA fragment extracted from the
patient’s freshly isolated, as well as her cultured, lymphocytes showed greater than 90% homology with the same pol
fragment extracted from cells known to be infected with
HTLV-11. This fragment was not found in HTLV-Iinfected cells, nor in DNA extracted from the cultured
lymphocytes of the other eight patients with MF, five
healthy individuals, and HL60 cells examined at the same
time. In addition, the virus particles that emerged in
cultures of the patient’s mononuclear cells reacted with
antisera to HTLV-1/11. EB presented with classical MF.
Her symptoms and pathology were indistinguishable from
those of other patients with this disease. Only a small
number of patients with MF have antibodies to HTLV-1/11
when this is tested with commercially available reagents by
enzyme-linked immunosorbent assay (ELISA) or Western
blot.5-8330In our own series of MF patients, this may amount
to less than 3%, particularly if black patients or individuals
who originate from endemic regions are excluded (unpublished data). The present patient, a middle-aged black
female, had no risk factors, except that her husband abused
intravenous drugs alledgedly for only 2 years before his
death in 1987. Because two of the patient’s siblings, who
had been breast-fed by the same mother as EB, as well as
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
Hnv-i AND HTLV-II IN MYCOSIS FUNGOIDES
1541
Fig 2 R . p " t a t h f e llluatratlons of vim particles obaewed in cultured wib. (A) Cell aeiected from a 93day-old culture, surrounded by an
unusually large number of particles. MogniRutton ~6,000. The amas demarcated 1 and 2 are shown at higher magnification in (8) and (C),
respectively. ( 8 )Area 1 in (A) seen at higher rmlutlon shows many incomplete pattlcies lacking nucleoids, as well as a large number of complete
virions (arrows). Magnification x51,OOO. (C) Higher magnificationof area 2 demarcated In (A) shows virus particles to better advantage (arrow).
Magnification x51,OOO. (D) Example of rarely seen viral budding (arrows) at the surface membrane of a cell from a 3-month-old cutture.
Magnification x66,OOO.
her daughter were seronegative for HTLV-1/11. it is likely
that EB acquired HTLV-I1 from her late husband.
The pathogenic relationship between the patient's viral
infection and her neoplastic disease deservesseriousconsid-
eration. Firstly, the patient's cultured PBMC showed,
within the first 2 weeks of growth, an ample number of viral
particles that resembled published electron micrographsof
HTLV-I/II.3'J* Almost 80% of the patients freshly isolated
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
1542
ZUCKER-FRANKLIN, HOOPER, AND EVAlT
Flg 3. D.trlh of thm d h n t d k mkon from 7O-dly.old culture ahowing VIMplrtkla rtrlnod with the Innnunogoldtochnlqw (ow
Moteriah and Methods). Magni&.tlon ~50,006.
cells were typical MF cells and, when subjected to PCR
before culture, were shown to harbor the virus. The cells
have become immortalized, ie, as of this writing, they have
been maintained for more than 1 year in the absence of any
growth factors. Thirdly, while reverse transcriptase was not
detected in the culture medium, there was evidence of viral
budding (Fig 2). This provides incontrovertible evidence of
a productive infection. Moreover, coculture studies of the
Flg 4. (A)0R
llluatration of lmmunogdd-stalwd mgbm of plasma mombranos. The membranes appear thkkened ot auch rih.,
suggesting integration of viral proteln. M.gnifk.tlon ~50,006.(e)In this lllurtratlon, the antiremm did not react with the plasma membrane, but
specifically with the virus particle (arrow). Magnification x50,OOO.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
HTLV-I AND HTLV-II IN MYCOSIS FUNGOIDES
wlth autobgOU5 Ig of a 71-daysld culture.
Aa can be reen, the majority of cella reacted
with the antibody. The arrow lndicatea a
negative cell. (B) Representative syncytium
formed by Mok-4 cells cocukured with irradiated EB culture. Arrows indicate singla
cells before fusion.
1543
I
patient’s irradiated cells with a noninfected lymphocyte line
resulted in the formation of syncytia (Fig 5B) believed to be
characteristic for retroviral infections.33Last, but not least,
the PCR performed with DNA extracted from the cells
proved to have proviral sequences that hybridized with
HTLV-I1 pol-specific probes. Thus, integration of the
proviral genome into the DNA of the patient’s cells was
established. PCR performed on DNA extracted from mononuclear cell cultures derived from eight other patients with
MF as well as from five lymphocyte cultures prepared from
the blood of healthy individuals and run in parallel with
EBs specimen were negative. At the time these experiments were conducted, no cell lines containing HTLV-I1
had been maintained in this laboratory. Because the patient’s PB cells used to initiate the cultures were identical to
those seen in her skin lesions, it seems reasonable to
assume that, in this particular individual, HTLV-I1 infection is related to her cutaneous disease.
Although HTLV-I1 was first isolated from a patient with
atypical HCL, the clinical presentation and pathology of the
patient reported here did not warrant the inclusion of HCL
in the differential diagnosis. However, it may be important
to reiterate some features of the patient’s cells, which could
turn out to be suggestive of infection with HTLV-11 rather
than HTLV-I. The cytoplasm of the majority of her cells
was replete with filaments, which led us to perform immunofluorescence studies with a variety of antisera directed
against cytoskeletal proteins. As expected from their ultrastructural appearance, the most intense cytoplasmic fluorescence was obtained with a monoclonal antiserum directed
against vimentin, whereas an antibody directed against
Table 3. AmplfRution of DNA Fragment5 ExtractedFrom the
Cultured Blood Lwkcxytea of Nine Patiant. With MF
Patient
NG
RH
co
HC
AB
EB
AW
JG
OD
POI wnv-ii
Pol (HTLV-II)
Tax
EW
+
-
-
+
-
+
-
+
-
+
-
-
-
-
keratin was negative (data not shown). We commented on
the presence of conspicuouscytoplasmic filaments in Stzary
cells of some patients in very early reports on this subject.zo.26This feature has not been described in the cells of
patients with HTLV-I-associated adult T-cell leukemia,”
nor have they been observed in ATL or hairy cells in this
laboratory. The cells of EB also appear to have more
surface villi (Fig 1C) than most Stzary cells studied by us.
At no time could these be mistaken for the long processes
visible on light microscopy of hairy cells. A patient who
developed Skzary syndrome after having been observed for
many years with bona fide HCL illustrated this distinction.z
The latter case antedated discovery of HTLV-1/11 and the
availability of antisera to these viruses. EBs cells also
lacked ribosome lamellar complexes, often considered an
ultrastructural hallmark of hairy cell^?^.^ In the future, it
may be useful to note these features to determine whether
-
103 bp
+
-
+
+
-
Fig 6. PCR amplfRution of HTLV-II pol In only one of 9 MF T-cell
lines.The primen uaedwere SK58-59. The HTLV-ll-apedic oligonucleotide probe used for hybridization waa SK80. DNA from MOTcella
Infected with HTLV-II Mwed as a poaitive control. HL-BO and normal
PMBC were negative controla. Patients AW and CO are known to be
Infected with HTLV-I.
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
1544
ZUCKER-FRANKLIN, HOOPER, AND EVATT
CGACCCAATTTCCACCTTCAATGAATACACAGACTCCCTTATCTTAGCTCCCTTGT E.B.
1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 l l l l l l l l l 1 1 1 1 1 1 1 1 1 1 1 1 1
11111:II I I
CGACCCAATTTCCACCTTCAATGAATACACAGACTCCCTTATTGTAGCTXCCCTTT MOT
4222
4290
Fig 7. Comparativenucleotide sequence of the amplified HTLV-I1 pol region in the EB cell line (top) and the MOTcell line (bottom).
they are indicative of infection with HTLV-I1 rather than
HTLV-I.
What is the significance of these observations in the
context of the disease defined as MF? On the basis of our
own findings7y8as well of those of 0thers,9,~~
it seems likely
that patients with MF may harbor various types of HTLVs
as well as their incomplete forms? This is the first demonstration that HTLV-I1 may also be associated with this
disease. In the light of an increasing prevalence of adultacquired HTLV-I1 infection, the observation provides food
for thought. The existence of a population of lymphocytes
that recirculates primarily to the skin has been recogn i ~ e d ? ~A
, ~ cutaneous
’
neoplasm consisting of CD4+ lymphocytes could be the final common pathway of circulating
CD4+ cells serving as targets for a variety of retroviruses.
Alternatively, cells other than CD4+ lymphocytes may
harbor the virus. Even specimens with very high SCzary cell
counts are not devoid of a few cells belonging to different
cell populations, such as monocytes, B cells, and hematopoi-
etic progenitors. In vitro conditions may favor proliferation
and release of virions from such reservoirs and could
subsequently infect almost any cell in the culture?* To
determine the exact cell type from which the particles
emerge requires in situ hybridization in conjunction with
phenotypic analyses at repeated time intervals. It has also
been shown that transactivating genes, such as tax, may
have oncogenic p0tential.3~The possibility that in vivo
“externally” driven transformation of CD4+ lymphocytes
could occur as a result of factors released by other cells is
supported by the observation that it is not always possible to
detect clonality among freshly isolated SCzary cells either by
karyotypic analysis or by gene rearrangements of the T-cell
receptor+ hai in.^.^^ These considerations, together with
the observation that deleted viral sequences of HTLV-I1 as
well as HTLV-I have been found in the mononuclear
leukocytes of patients with MF, may throw a new light on
the pathogenesis of this disease.
REFERENCES
1. Poiesz BJ, Ruscetti FW,Gazdar AF, et al: Detection and
isolation of type C retrovirus particles from fresh cultured lymphocytes of a patient with cutaneous T cell lymphoma. Proc Natl Acad
Sci USA 777415,1980
2. Miyoshi I, Kubonishi I, Yoshimoto S, et al: Type-C virus
particles in a cord T-cell line derived by co-cultivating normal
human cord leukocytes and human leukemic T cells. Nature
294:770,1981
3. Popovic M, Reitz MS, Sarngadharan MG, Robert-Guroff M,
Kalyamaranan VS, Nakao Y, Miyoshi I, Minowada J, Yoshida M,
It0 Y, Gallo RC: The virus of Japanese adult T cell leukemia is a
member of the human T-cell leukemia virus group. Nature 300:63,
1982
4. Kim JH, Durack D T Manifestations of human T-lymphotropic virus type-I infection. Am J Med 84919,1988
5. Lange-Wantzin G, Thomsen K, Nissen NI, Saxinger D, Gallo
R C Occurrence of human T cell lymphotropic virus (type I)
antibodies in cutaneous T cell lymphoma. J Am Acad Dermatol
15598,1986
6. Hall WW, Liu CR, Schneewind 0,Takahashi H, Kaplan MH,
Roupe G, Vahlne A Deleted HTLV-I provirus in blood and
cutaneous lesions of patients with mycosis fungoides. Science
253:317,1991
7. Zucker-Franklin D, Coutavas EE, Zouzias D C Retrovirus
infection of blood lymphocytes in patients with mycosis fungoides.
Clin Res 38:283,1990
8. Zucker-Franklin D, Coutavas EE, Rush MG, Zouzias DC:
Detection of human T-lymphotropic virus-like particles in cultures
of peripheral blood lymphocytes from patients with mycosis fungoides. Proc Natl Acad Sci USA 88:7630,1991
9. Manzari V, Gismondi A, Barillari G, Morrone S , Modesti A,
Albonici L,DeMarchis L, Fazio V, Gradilone A, Zani M, Frati L,
Santoni A HTLV-V A new human retrovirus isolated in a
tac-negative T cell lymphomalleukemia. Science 2381581,1987
10. Kalyanaraman VS, Sarngadharan MG, Robert-Guroff M,
Miyoshi I, Golde D, Gallo RC: A new subtype of human T-cell
leukemia virus (HTLV-11) associated with a T-cell variant of hairy
cell leukemia. Science 218571,1982
11. Chen ISY, McLaughlin J, Gasson J, Clark SC, Golde D W
Molecular characterization of genome of a novel human T-cell
leukemia virus. Nature 305:502,1983
12. Rosenblatt JD, Golde DW, Wachsman W, Giorgi JV, Jacob
A, Schmidt GM, Quan S, Gasson JC, Chen IS: A second HTLV-I1
isolate associated with atypical hairy cell leukemia. N Engl J Med
325:372,1986
13. Sohn CC, Blayney DW, Misset JL, Math6 G, Moran EM,
Jensen FC, Winberg CD, Rappaport H Leukopenic chronic T-cell
leukemia mimicking hairy cell leukemia: Association with human
retroviruses. Blood 67:949,1986
14. Rosenblatt JD, Giorgi JV,Golde DW, Ezra JB, Wu A,
Winberg CD, Glaspy J, Wachsman W, Chen ISY: Integrated
human T-cell leukemia virus I1 genome in CD8+ T-cell from a
patient with atypical hairy cell leukemia: Evidence for distinct T
and B cell lymphoproliferative disorders. Blood 71:363, 1988
15. Lee H, Swanson P, Shorty VS, Zach JA, Rosenblatt JD,
Chen ISY: High rate of HTLV-I1 infection in seropositive IV drug
abusers in New Orleans. Science 244:471,1989
16. Ehrlich G, Glaser JB, LaVigne K, Quan D, Mildvan D,
Sninsky JJ, Kwok S , Papsidero L, Poiesz B J Prevalence of human
T-cell leukemia/lymphoma virus (HTLV) type I1 infection among
high-risk individuals: Type-specific identification of HTLV’s by
polymerase chain reaction. Blood 74:1658,1989
17. Kwok S , Gallo D, Hanson C, McKinney N, Poiesz B, Sninksy
JJ: High prevalence of HTLV-I1 among intravenous drug abusers:
PCR confirmation and typing. AIDS Res Hum Retroviruses 6561,
1990
18. Zella D, Mori L, Sala M, et al: HTLV-I1 infection in Italian
drug abusers. Lancet 336574,1990
19. Kelen GD, DiGiovanna TA, Lofy L, Junkins E, Stein A,
Silverton KT, Lairmore M, Quinn TC: Human T-lymphotropic
From www.bloodjournal.org by guest on November 24, 2014. For personal use only.
HTLV-I AND HTLV-II IN MYCOSIS FUNGOIDES
virus (HTLV-1-11) infection among patients in an inner city
emergency department. Ann Int Med 113:368,1990
20. Zucker-Franklin D, Melton JW,Quagliata F Ultrastructural immunologic, and functional studies on Stzary cells: A
neoplastic variant of thymus-derived (T) lymphocytes. Proc Natl
Acad Sci USA 71:1877,1974
21. Myrie C, Zucker-Franklin D, Ramsey D: Light-microscopic
analysis of sectioned Stzary cells: An accurate alternative to
electron microscopy. Am J Pathol99243, 1980
22. Hyde P, Zucker-Franklin D: Antigenic differences between
human platelets and megakaryocytes. Am J Pathol 127:349,1987
23. Winship PR: An improved method for directly sequencing
PCR amplified material using dimethyl sulphoxide. Nucleic Acids
Res 171266,1989
24. Katayama I, Schneider GB: Further ultrastructural characterization of hairy cells of leukemic reticuloendotheliosis. Am J
Pathol86:163,1977
25. Zucker-Franklin D, Amorosi EL, Ritz ND: Evolution of
Stzary syndrome in the course of hairy cell leukemia. Blood
60:1030,1982
26. Zucker-Franklin D: Properties of the Stzary lymphoid cell:
An ultrastructural analysis. Proc Mayo Clinic 49:567,1974
27. Chadburn A, Athan E, Wieczorek R, Knowles DM: Detection and characterization of human T-cell lymphotrophicvirus type
I (HTLV-I) associated T cell neoplasms in an HTLV-I nonendemic
region by polymerase chain reaction. Blood 17:2419,1991
28. Kwok S, Ehrlich GD, Poiesz B, Kalish R, Sninsky JJ:
Enzymatic amplification of HTLV-I viral sequences from peripheral blood mononuclear cells and infected tissues. Blood 721117,
1988
29. De BK, Srinivasan A Detection of human immunodeficiency virus (HIV) and human lymphotropic virus (HTLV) type I
and I1 dual infections by polymerase chain reaction. Oncogene
41533,1989
30. Captslus C, Saal F, Maero E, Bazarbachl A, Lasneret J,
Laroche L, Gessain A, Hojman F, Ptrlts J: No evidence for
HTLV-I infection in 24 cases of French and Portuguese mycosis
1545
fungoides and Stzary syndrome (as seen in France). Leukemia
5:416,1991
31. Palmer EL, Goldsmith CS: Ultrastructure of human retroviruses. J Electron Microsc Tech 83,1988
32. Palmer EL, Harrison AK, Ramsey RB, Feorino PM, Frances
DP, Evatt BL, Kalyanaraman VS, Martin M L Detection of two
human T cell leukemia/lymphotropic viruses in cultured lymphocytes of a hemophiliacwith acquired immunodeficiencysyndrome.
J Infect Dis 151:559,1985
33. Nagy K, Clapham P, Cheingsong-Popov R, Weiss R A
Human T-cell leukemia virus type I. Induction of syncytia and
inhibition by patients’ sera. Int J Cancer 32:321,1983
34. Uchiyama T, Yoidoi J, Saga K, Takatsuki K, Uchino H
Adult T-cell leukemia: Clinical and hematologic features of 16
cases. Blood 50:481,1977
35. Saal F, Gessain A, Lasneret J, Foldbs C, Dronne P, Wallach
D, Cottenot F, Sigaux F, Flandrin G, Ptrbs J: Detection of
retrovirus particles and reverse transcriptase activity in mid-term
cultured peripheral blood and lymph node cells from a French
woman with Stzary syndrome. Nouv Rev Fr Hematol31:333,1989
36. Streilein JW:Lymphocyte traffic, T cell malignancies and
the skin. J Invest Dermatol71:167,1978
37. Goudie RB, MacFarlane PS, Lindsay MK Homing of
lymphocytes to non-lymphoid tissues. Lancet 1:292,1974
38. Markham PD, Salahuddin SZ, Macchi B, Robert-Guroff M,
Gallo R C Transformation of different phenotypic types of human
bone marrow T-lymphocytesby HTLV-I. Int J Cancer 33:13,1984
39. Hinrichs SH, Nerenberg M, Reynolds RK, Khoury G, Jay G:
A transgenic mouse model for human fibromatosis. Science 237:
1340,1987
40. Weiss LM, Woods GS, Hu E, Abel EA, Hoppe RT, Sclar J:
Detection of clonal T-cell receptor gene rearrangements in the
peripheral blood of patients with mycosis fungoides/Stzary syndrome. J Invest Dermatol92601,1989
41. Abrams JT, Lessin SR, Ghosh SK, Norwell PC, Ju W,
Vonderheid EC, Rook AH, DeFreitas E Malignant and nonmalignant T cell lines from human lymphotropic virus type I-negative patients with Stzary syndrome. J Immunol 146:1455,1991