1. No category

Cell Reports, Volume 9
Supplemental Information
SDF-1 Inhibition Targets the Bone Marrow Niche
for Cancer Therapy
Aldo M. Roccaro, Antonio Sacco, Werner G. Purschke, Michele Moschetta, Klaus
Buchner, Christian Maasch, Dirk Zboralski, Stefan Zöllner, Stefan Vonhoff, Yuji
Mishima, Patricia Maiso, Michaela R. Reagan, Silvia Lonardi, Marco Ungari, Fabio
Facchetti, Dirk Eulberg, Anna Kruschinski, Axel Vater, Giuseppe Rossi, Sven
Klussmann, and Irene M. Ghobrial
Suppl. Table I
All data represent arithmetic means
A
Suppl. Figure 1
MM-BM-MSCs
Scramble RFP
SDF-1 KD RFP #1
SDF-1 KD RFP #2
B
C
D
E
SUPPLEMENTAL LEGENDS
Supplemental Table I: Rate constants for association (ka) and dissociation (kd), as
well as equilibrium binding constants (Kd), of ola-PEG and recombinant human
and mouse SDF-1
Summary of determined rate- and dissociation constants of ola-PEG binding to
recombinant human SDF-1 α/β/γ and mouse SDF-1 α/β.
Supplemental Table II: Summary of plasma pharmacokinetic parameters following
single i.v. or s.c. injection of ola-PEG in mice.
Individual pharmacokinetic parameters following administration (i.v. or s.c.) of 10 mg/kg
ola-PEG to CD1 mice (n = 64 male and 64 female animals per group; 4 animals of each
gender per time point). All data represent arithmetic means.
Supplemental Gene List: Gene Expression Profiling.
SCID/Bg mice (n=3) were treated with ola-PEG (20 mg/kg; every other day; s.c.) for
three weeks. Untreated mice (n=3) were used as controls. BM was harvested, RNA was
isolated, and gene expression profiling was performed on cDNA, using the Mouse
Genome 430 2.0 array. The reported list of genes was generated using dChip software
Supplemental Figure 1. Role of bone marrow mesenchymal stromal cell (BM-MSC)derived SDF-1 on MM cells.
(A) RFP reporter visualized in primary MM BM-MSCs transduced with either scrambleor SDF-1-shRNAs (#1: clone 111678; #2: clone 227310). (B) SDF- knockdown
efficiency was tested by ELISA. Bars indicate standard deviations (S.D.). (C; D)
Inhibition of MM cell adhesion (C) and migration (D) was demonstrated in the context of
primary MM BM-MSC-knockdown for SDF-1, compared to scramble-shRNAtransduced cells. MM cell lines MM.1S, RPMI.8226, OPM2, and U266 were used. Bars
indicate S.D. (E) MM cells (MM.1S) were cultured in presence of scramble-shRNA-,
SDF1-shRNA1-, or SDF1-shRNA2 transduced primary MM BM-MSCs, for 8 hours.
MM.1S cells were then harvested and cell lysates were subjected to Western blotting,
with use of antibodies against p-ERK1/2, ERK1/2, p-S6R, p-GSK3, p-cofilin. MM.1S
cells cultured in absence of MM BM-MSCs were used as control.
Supplemental Figure 2. Identification of SDF-1-binding Spiegelmer ola-PEG and
pharmacokinetic profiles of ola-PEG after i.v. and s.c. administration to mice.
(A) Course of in vitro selection to human D-SDF-1. As a measure of the enrichment of
binding sequences within the RNA library, the ratio of the fraction bound to immobilized
peptide over the peptide concentration itself is plotted against the selection round
number. A transient decline in round 3 was followed by an increase in binding, with an
intermediate plateau in rounds 6-8, and then a plateau in rounds 9- 14. The decrease in
binding in rounds 15 and 17, caused by mutagenic PCR, was immediately overcome in
the following non-mutagenic rounds, which exceeded the plateau of rounds 9-14. After
round 18, the enriched library was cloned and sequenced. (B) Nucleotide sequences
resulting from in vitro selection to D-SDF-1 without primer binding sites. One family of
almost identical sequences and a non-related orphan sequence were obtained. [nt]: length
in nucleotides; _: point mutations in aptamer sequences of the family. (C) Truncation of
193-G2. affinity (rel): affinity to
D-SDF-1
relative to 193-G2, as determined by pull-
down assays; =: equal, -: weaker. (D) Time-concentration profiles of ola-PEG in plasma,
following a single i.v. or s.c. injection of 10 mg/kg ola-PEG (n = 64 male and 64 female
animals per group; 4 animals of each gender per time point); arithmetic means ± S.D.
Supplemental Figure 3. Ola-PEG does not exert cytotoxicty in MM cells, molds the
BM niches leading to a less receptive microenvironment for MM cells, and it is
delivered to MM-enriched BM niches.
(A) MM cell lines were exposed to increasing concentrations of ola-PEG for 48h, and
cell survival was evaluated with use of the MTT assay. (B) SCID/Bg mice (n=3) were
treated with ola-PEG (20 mg/kg; every other day; s.c.) for three weeks. Untreated mice
(n=3) were used as controls. BM was harvested, RNA was isolated, and gene expression
profiling was performed on cDNA, using the Mouse Genome 430 2.0 array. The heatmap
was generated after supervised hierarchical cluster analysis. Differential expression of
genes is shown by the intensity of red (up-regulation) versus blue (down-regulation) (dChip software; untreated vs. treated: 1.5 fold change; P <0.05). (C) SCID/Bg mice were
injected with MM.1S-GFP+ cells. Three weeks later, AlexaFluor(AF)647-conjugated olaPEG was administered i.v. and mouse skull BM niches were imaged after 4 hours by
using intravital confocal microscopy. (MM.1S-GFP+/Luc+ cells: green; vessels/dextran:
red; AF647-ola-PEG: blue).
Supplemental Figure 4. Ola-PEG leads to MM cell mobilization to the peripheral
blood.
(A) SCID/Bg mice were injected (i.v.) with MM.1S-GFP+/Luc+ cells, and treated with
vehicle (control) or ola-PEG (20mg/kg, every other day; s.c.). Peripheral blood and bone
marrow were harvested at the 5th week and percentage of MM cells was evaluated by
flow cytometry. Bars indicate S.D.
Supplemental Figure 5. Ola-PEG and bortezomib act synergistically in targeting
MM cell proliferation in vitro and in vivo.
(A; B; C; D) Primary MM BM stromal cells were treated with ola-PEG (50 nM; 100 nM)
for 4 hours, and subsequently co-cultured with MM cells (MM.1S: panel a; RPMI.8226:
panel b; OPM2: panel c; U266: panel d) in the presence or absence of bortezomib
(2.5 nM or 5 nM) for 48 hours. Cell proliferation was assessed using [3H]-thymidine
uptake. Calcusyn software: combination indices (C.I.) and fractions affected (F.A.) by the
combination of ola-PEG and bortezomib are shown. Bard indicate S.D. (E) SCID/Bg
mice were injected (i.v.) with MM.1S-GFP+/Luc+ cells, and treated with vehicle
(control), bortezomib (0.5 mg/kg, twice/week; i.p.) or ola-PEG (20mg/kg, every other
day; s.c.), either alone or in combination (ola-PEG followed by bortezomib) (n=5 per
group). Femurs were harvested from each group and quantification of MM.1S-GFP+
cells was performed. Average ± S.D. count is shown.
Supplemental Figure 6. Ola-PEG and bortezomib synergize in targeting MM cell
adhesion to MM-BM-MSCs.
(A; B; C; D) Primary bone marrow mesenchymal stromal cells (BM-MSCs) were treated
with ola-PEG (50 nM; 100 nM) for 4 hours, then co-cultured with Calcein-labeled MM
cells (MM.1S: panel a; RPMI.8226: panel b; OPM2: panel c; U266: panel d) in presence
or absence of bortezomib (2.5 nM; 5 nM), for 2 hours. The effect of each agent alone, or
in combination, on the adhesion of MM cells to primary BMSCs was evaluated. Calcusyn
software: combination indices (C.I.) and fractions affected (FA) by the combination of
ola-PEG and bortezomib are shown. Bars indicate S.D.
SUPPLEMENTAL MATERIAL AND METHODS
In vitro selection of OLAPTESED PEGOL
The nucleotide sequence of OLAPTESED PEGOL was determined by screening a library
of synthetic RNA for binding to human SDF-1 in the non-natural all-D configuration. The
target molecule (KPVSLSYRCP CRFFESHVAR ANVKHLKILN TPNCALQIVA
RLKNNNRQVC IDPKLKWIQE YLEKALNKRF K-biotin) was custom synthesized
from D-amino acid building blocks (Bachem, Bubendorf, Switzerland). It carried a biotin
residue bound via a PEG2-PEG2 linker (PEG2: 8-amino-3,6-dioxaoctanoic acid) to the
C-terminus which facilitated immobilization of the polypeptide and bound RNA aptamers
to streptavidin beads and neutravidin beads (Pierce Biotechnology, Rockford, USA)
during the in vitro selection.
The RNA library had a length of 83 nucleotides (nt) and contained a central 34 nt long
random
region
(5'GGAGCUUAGACAACAGCAGCGUGC-N34
GCACGCUCAGGUGAGUCGGUUCCAC3').
It was enzymatically generated from a single stranded template DNA library, synthesized
by standard phosphoramidite chemistry at NOXXON Pharma AG (Berlin, Germany),
using
the
forward
primer
-3',
Taq
DNA
polymerase and T7 RNA polymerase (Invitrogen, Karlsruhe, Germany) and was
amplified
during
in
vitro
selection
GTGGAACCGACTCACCTGAG-3'
with
using
reverse
the
reverse
transcriptase
primer
Superscript
5'II
(Invitrogen) followed by PCR and in vitro transcription. The RNA library was
radioactively labeled by T4 polynucleotide kinase (Invitrogen) with [γ-32P]-ATP
(Hartmann Analytic, Braunschweig, Germany) to measure the fraction of the RNA
library that was immobilized via
D-SDF-1
on the beads in a scintillation counter (LS
6500; Beckman Coulter, Fullerton, USA) during the selection process.
Three nanomoles of RNA were used in the initial selection round, which corresponds to
approximately 1.8 x 1015 individual molecules. The RNA library was incubated in
selection buffer (20 mM Tris-HCl pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1
mM CaCl2, 0.1% Tween 20, 10 µg/ml human serum albumin, 10 µg/ml yeast RNA) at
37 °C together with the target in solution before bound RNAs were immobilized via the
biotinylated peptide on streptavidin or neutravidin beads. The beads were washed with
selection buffer to discard non-binding and weak binding aptamers. The bound fraction
was quantitated and amplified for the following selection round. A pre-selection step with
beads was performed beginning with round 3 before each selection reaction to
circumvent development of bead binding aptamers. In the course of the selection the
stringency was increased to select most affine binders by reducing the concentration of
the target D-SDF-1 from 10 nM in the first round to finally 0.5 pM. The already enriched
libraries for the late rounds 15 and 17 were amplified by mutagenic PCR,41,42 in order to
extend the complexity for the selection of most affine binders. After eighteen rounds of in
vitro selection, the sequences of SDF-1-binding RNA aptamers were determined by
cloning and sequencing. The affinity of RNA libraries and aptamers to
D-SDF-1
was
determined by pull-down binding assays with radioactively labeled RNA using Prism
Software Version 5.04 (GraphPad) and a 2-parameter fitting algorithm after
normalization of the data.
Synthesis of Spiegelmers
OLAPTESED PEGOL and revOLAPTESED PEGOL are both 5'-aminohexyl modified
45-mer
L-oligoribonucleotides
(L-RNA) to which a branched 40 kDa monomethoxy
polyethylene glycol (PEG) unit is covalently attached to the amino linker via an N-alkyl
amide linkage. The sequence of OLAPTESED PEGOL is 5'-GCG UGG UGU GAU
CUA GAU GUA UUG GCU GAU CCU AGU CAG GUA CGC-3', while the nonfunctional control Spiegelmer revOLAPTESED PEGOL has the reverse sequence 5'CGC AUG GAC UGA UCC UAG UCG GUU AUG UAG AUC UAG UGU GGU GCG
3'. MMT-protected aminohexyl phosphoramidite, and 2'-TBDMS-protected L-rA(N-Bz)-,
L-rC(Ac)-, L-rG(N-ibu)-,
and L-rU-phosphoramidites were purchased from ChemGenes,
Wilmington, MA. Syntheses were performed on L-rC- or L-rG-functionalized 600Å CPG
obtained from PrimeSynthesis, Aston, PA. Oxidizer, capping solution, detritylation
solution and the activator 0.3M benzylthiotetrazole in acetonitrile were purchased from
Biosolve (Valkenswaard, The Netherlands). All other reagents and solvents were
purchased from Sigma-Aldrich (Taufkirchen, Germany). Source30RPC (GE Healthcare,
Freiburg, Germany) was used for the preparative reversed phase purification of the
Spiegelmer pre and post PEGylation. For desalting NAP columns (GE Healthcare,
Freiburg, Germany) or ultrafiltration using a 5 kDa regenerated cellulose membrane
(Millipore, Bedford, MA) was used. Y-shaped 40 kDa PEG N-hydroxysuccinimide
(NHS) ester from JenKem Inc. (Allen, Tx) was used for the PEGylation.
Synthesis of PEGylated Spiegelmers is essentially described in Hoffmann et al. (RNA
aptamers and spieglmers: synthesis, purification, and post-synthetic PEG conjugation
(2011) Curr. Protoc. Nucleic Acid Chem., Chapter 4, Unit 4.46, 1-30). All
oligonucleotides were synthesized at NOXXON Pharma AG (Berlin, Germany).
Pharmacokinetics of OLAPTESED PEGOL
CD1 mice (n=64 female and n=64 male animals per group) were injected with a single
dose of 10 mg/kg OLAPTESED PEGOL either i.v. or s.c. Blood samples for the
preparation
of
lithium-heparin
plasma
and
concomitant
assessment
of
the
pharmacokinetic profile of OLAPTESED PEGOL were collected up to 336 h post-dose.
Therefore four male and four female mice were sacrificed humanely at each collection
time and terminal blood removed by cardiac puncture. Plasma concentrations of
OLAPTESED PEGOL were quantified with a validated sandwich hybridization assay
that only recognizes the full-length OLAPTESED PEGOL oligonucleotide efficiently by
capture and detect L-DNA/L-RNA probes complementary to the 5’ and 3’ end of the
Spiegelmer, respectively. Quantification was performed from a 5-parameter calibration
curve. The assay has a lower limit of quantification of 8 nM for plasma samples. The
assay accepted an accuracy of ≤ 20% relative error from the nominal concentration and a
precision between the duplicate values of ≤ 20%. Pharmacokinetic parameters for the
concentration of OLAPTESED PEGOL in plasma were derived by non-compartmental
analysis using WinNonlin Pro Version 4.0.1. All calculations were based upon nonrounded concentrations and nominal sampling times. The maximum observed
concentration (Cmax) and time of Cmax (tmax) were recorded as observed. The area
under the curve from administration to the last measured concentration (AUC0-t) was
calculated by the linear / log trapezoidal rule and the area under the curve from
administration to infinity (AUC0-∞) was estimated by extrapolating the concentrationtime curve from zero to infinity. The apparent terminal elimination half-life (t½) was
calculated from ln2/λz, where λz, is the apparent terminal elimination rate constant. The
total body clearance of test substance (CL) was calculated from dose/AUC0-∞ and the
apparent volume of distribution of test substance at steady-state from CLxMRT, where
MRT is the mean residence time. The bioavailability (F) was calculated as (AUC0-∞
(s.c.) x dose (i.v.)) / (AUC0-∞ (i.v.) x dose (s.c.)) * 100.
Kinetic evaluation of OLAPTESED PEGOL binding to SDF-1 using surface
plasmon resonance
Human SDF-1α (R&D Systems, Wiesbaden, Germany), human SDF-1β (R&D
Systems), mouse SDF-1α (R&D Systems), mouse SDF-1β (Peprotech, Hamburg,
Germany); immobilization buffer HBS-EP (GE Healthcare); measurement buffer 20 mM
Tris-HCl pH 7.4, 150 mM NaCl, 5 mM KCl, 1 mM MgCl2 and 1 mM CaCl2; 5 M NaCl
(Ambion); Biacore 2000 system (GE Healthcare, Munich, Germany), CM4 sensor chips
(GE Healthcare).
For Biacore measurements SDF-1 was immobilized on a carboxy-dextran-coated sensor
chip (CM4 chip) using a 1:1 mixture of 0.4 M EDC (1-ethyl-3-(3-dimethylaminopropyl)
carbodiimide in H2O) and 0.1 M NHS in H2O. Subsequently 300-500 response units
(RU) of a 10 µM SDF-1 stock solution in PBS with 0.1% BSA was diluted to 1 µM in
water and immobilized in immobilization buffer at a flow of 10 µl/min. After completion
of the immobilization the respective flow cell was washed with 1 M NaCl to avoid carryover due to unspecific interaction of the sample with the Biacore tubing. The reference
flow cell on the same sensor chip was also activated with NHS/EDC and all flow cells
were blocked with ethanolamine.
Kinetic parameters and dissociation constants of the Spiegelmer binding to immobilized
SDF-1 were evaluated at a temperature of 37 °C and flow of 30 µL/min by a series of
Spiegelmer injections at concentrations of 1,000, 500, 250, 125, 62.5, 31.3, 15.6, 7.80,
3.90, 1.95, 0.980, 0.490, 0.240 and 0 nM diluted in measurement buffer. Association and
dissociation were recorded for 180 seconds each. At least one concentration was injected
twice to monitor optimal regeneration conditions and flow cell integrity. Regeneration
was performed by injecting 60 μl of 5 M NaCl followed by a 1 min baseline stabilization
with measurement buffer. The assay was double-referenced, whereas FC1 served as
(blocked) surface control (bulk contribution of each Spiegelmer concentration) and a
series of buffer injections without analyte determined the bulk contribution of the buffer
itself. Data analysis and calculation of dissociation constants (Kd) was done with the
BIAevaluation 3.1.1 software (BIACORE AB, Uppsala, Sweden) using a modified
Langmuir 1:1 stoichiometric fitting algorithm, with a constant RI and mass transfer
evaluation with an initial mass transport coefficient kt of 1 x 107 RU·M-1·s-1. Data fitting
was performed using the injected OLAPTESED PEGOL concentrations up to 0.24-3.9
nM where the concentrations injected are near the estimated Kd range, but the sensorgram
curvature is still optimal to calculate Rmax). Each measurement was done at least 3 times
on different days.
Chemokine selectivity of OLAPTESED PEGOL
Despite sequence identities of chemokines are as low as 20%, their three dimensional
structure is remarkably conserved. A panel of human and murine chemokines was
therefore analyzed to evaluate the ability of OLAPTESED PEGOL to bind to those
chemokines and potentially inhibit their biological function.
Human chemokines: CXCL1/GROα, CXCL2/GROβ, CXCL3/GROγ, CXCL8/IL-8,
CXCL9/MIG, CXCL10/IP-10, CCL1/I-309, CCL4/MIP-1β, CCL5/RANTES and
XCL1/Lymphotactin were from ProSpec Technologies. CXCL4/PF4, CXCL5/ENA-78,
CXCL6/GCP-2, CXCL11/I-TAC, CCL8/MCP-2, CCL13/MCP-4, CCL14/HCC-1 and
CX3CL1/Fraktalkine
were
from
PeproTech.
CXCL7/NAP-2,
CXCL12/SDF-1α,
CXCL12/SDF-1β, CCL3/MIP-1α, CCL4/MIP-1β and CCL11/Eotaxin were from R&D
Systems.
Murine chemokines: CXCL1/GROα, CXCL2/GROβ, CXCL5/LIX, CXCL7/Thymus
Chemokine-1, CXCL9/MIG,
CXCL10/IP-10,
CXCL11/I-TAC,
CXCL12/SDF-1α,
CXCL12/SDF-1β, CXCL13/BCA-1, CXCL15/Lungkine, CXCL16/SRPSOX, CCL1/I309, CCL3/MIP-1α, CCL4/MIP-1β, CCL5/RANTES, CCL6/GCP-2, CCL7/I-TAC,
CCL8/MCP-2, CCL9/10/MIP-1γ, CCL11/Eotaxin, CCL12/MCP-5, CCL19/MIP-3β,
CCL20/MIP-3α, CCL21/6Ckine, CCL22/MDC, CCL24/Eotaxin-2, CCL25/TECK,
CCL27/CTACK, and CCL28/mMEC were from ProSpec Technologies. CXCL2, CCL2,
and CCL17 were from R&D Systems.
To address the selectivity of OLAPTESED PEGOL binding to SDF-1-related human and
murine chemokines a competitive Biacore assay was set up. Immobilization of human
SDF-1α was performed as described above. OLAPTESED PEGOL (12.5 nM) and 2000,
200 and 20 nM of each chemokine were pre-incubated (30 min or longer) and injected
into the Biacore. A lower OLAPTESED PEGOL-binding to the SDF 1-coated sensor
chip in the presence of a competing chemokine indicates a binding between
OLAPTESED PEGOL and the chemokine. Unspecific binding of the chemokines to the
sensor chip surface or immobilized human SDF-1α was monitored by injections of
chemokine without OLAPTESED PEGOL. Each injection was repeated two times. The
RU after 240 seconds of injection were determined and double referenced data were
plotted using the Prism 5.04 Software (GraphPad).
Cell-based assays for OLAPTESED PEGOL characterization
For CXCR4 internalization, Jurkat cells were stimulated with human recombinant SDF-1,
preincubated with various concentrations of OLAPTESED PEGOL, for 3 hours and
subsequently stained with PE-labeled anti-CXCR4 (R&D systems, clone #44717). Cell
surface expression of CXCR4 was quantified as mean fluorescence intensity (MFI) by
flow cytometry using a Guava easyCyte 6HT-2L instrument (Millipore, Darmstadt,
Germany).
CXCR7 signaling induced by CXCL12/SDF-1 was analyzed using a β-arrestin
complementation assay with a reporter cell line (PathHunter eXpress CHO-K1 CXCR7
β-arrestin cells; DiscoeRx Corp.) following the instructions of the suppplier.
MAP-kinase activation was studied in CHO-K1 cells transfected with a plasmid coding
for human CXCR4 (NM_003467.2). Cells were cultured in 6-well plates and stimulated
with SDF-1 in the presence or without OLAPTESED PEGOL. Thereafter cells were
washed with cold phosphate buffered saline containing 6 mM NaF, 12 mM βglycerophosphate, 12 mM para-nitrophenyl phosphate and 1.2 mM NaVO3 , harvested
and lysed in cold 20 mM TrisHCl, pH7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X100. Immunoblotting was performed as described below with anti-MAP-K and antiPhospho-MAP-K antibodies from Cell Signaling.
For chemotaxis assays, Jurkat cells were washed once in HBH (HBSS, containing 1
mg/ml bovine serum albumin and 20 mM HEPES) and added to the upper compartments
of a 96 well Corning Transwell plate with 5 µm pores (Costar Corning, #3388; NY,
USA) (1x105 cells/well). In the lower compartments recombinant SDF-1 was preincubated together with Spiegelmers in various concentrations at 37°C for 20 to 30 min
prior to addition of cells. Cells were allowed to migrate at 37°C for 3 h. Migrated cells in
the lower compartment were quantitated by measuring resazurin (Sigma, Deisenhofen,
Germany) fluorescence.