1. health and fitness
2. disease

From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
Age-Specific Regulation of Clotting Factor IX Gene Expression in Normal
and Transgenic Mice
By Edward J. Boland, Yuan C. Liu, Christi A. Walter, Damon C. Herbert, Frank J. Weaker, Michael W. Odom, and
Pudur Jagadeeswaran
Factor IX (FIX), a circulating serine protease that serves as
an essential componentof the blood coagulationpathway,
has been shownto increase with age in humans. We show
here that murine FIX mRNA andactivity levels also increase
with age. Furthermore, one form of hemophilia B, hemophilia B Leyden, which is caused by mutations within the
promoter region of the FIX gene, has a distinct age-dependent phenotype.To determine the source of the age-related
increases in FIX gene expression,
we have analyzed
the regulation of the normal FIX gene promoterand FIX Leyden gene
promoter with the + 13 mutation during aging by generating
transgenic mice that contain the -189 to +21 bp promoter
segment ligated to a chloramphenicol acetyttransferase reporter gene. We have established that the normal FIX promoter and the Leyden promoter transgenes are expressed
in a tissue-specific manner
in vivo. Thenormal FIX promoter
transgene does not show any differences in the pattern of
expression with age or sex of the organism, whereas the
Leyden promoter transgene showed age-dependent malespecific expression. Thisis the first demonstration ofthe FIX
Leyden phenotype in a transgenic mouse model.
0 1995 by The American Society of Hematology.
C
proteins, thereby decreasing FIX mRNA synthesis.'"'' This
hypothesis is strengthened by clinical data showing that the
severity of the Leyden phenotype can vary depending on the
type of mutation (transversion or transition) atthe same
location in the promoter.I6 Five sequence-specific DNA
binding proteins have been identified that bind to elements
within the FIX promoter segment in vitro. These proteins
include CAAT enhancer binding protein (C/EBPa),I4 liver
nuclear factor 1 (NF-1L),l4 hepatocyte nuclear factor 4
(HNF-4)," androgen receptor (AR),I8 and D-site binding
protein (DBP)." The +S and + l 3 Leyden mutations appear
to disrupt the binding of C I E B P C ~ ,whereas
~ . ' ~ the -20 and
-26 mutations disrupt HNF-4 binding to human promoter
fragments in vitro.''.'* In addition to these disruptions, the
synergy between DBP and CIEBPa has been shown to compensate for the -5 m ~ t a t i o n . ' ~
The postpubertal increase in FIX activity in male Leyden
patients has been suggested to be caused by androgens. This
idea was supported by the observation that danazol, an androgen derivative, stimulates FIX activity in prepubescent
Leyden malepatients." Furthermore, afflicted individuals
with another form of hemophilia B, hemophilia B Brandenburg (caused by a -26 mutation) do not exhibit postpubertal
increases in FIX activity.]' This mutation has been shown
to disrupt an HNF-4 binding site as well as thatof an overlapping androgen-responsive element (ARE)." The identification of ARE within the FIX promoter directly links androgens withthe upregulation of theFIX gene in Leyden
patients. However, testosterone"and
androgen receptor
mRNAZ2levels reach a maximumshortlyafter
puberty,
whereas FIX levels in Leyden patients continue to increase;
hence it seems thattheandrogen
stimulus cannot be the
sole factor responsible for the age-specific increase in FIX
activity seen inLeyden patients. Rather, it suggests that
another age-dependent regulatory protein(s) must be involved in the regulation of the FIX Leyden gene. Thus, the
mechanism of age-specific recovery in Leyden patients still
remains elusive.
Therefore, to investigate, in vivo, the age-specific expression of the FIX Leyden promoter, we havepreparedtwo
separate fusion genes by linking either a normal -189 to
+21 bphumanFIX promoter or the same promoter containing the + 13 Leyden mutation to a chloramphenicol acetyltransferase (CAT) reporter gene (Fig 1A). Subsequently,
LOTTING FACTOR IX (FIX), a circulating serine protease, is a key component of the coagulation cascade.'
It is synthesized primarily by hepatocytes starting early in
and has been shown to increase in elderly hum a n ~ Failure
.~
to synthesize functional FIX at physiologic
levels results in the bleeding disorder known as hemophilia
B.6 In all hemophilia B patients analyzed to date, the disease
is a consequence of mutations within theFIX gene that result
in the production either of a defective product or a complete
absence of product." These mutations, which vary from large
deletions7 to point mutation^,^.^ occur primarily within coding portions of the FIX gene,' with the most frequent and
severe clustered within the exons for the catalytic domain
of the e n ~ y m e .Intriguingly,
~.~
patients with one variant of
hemophilia B, hemophilia B Leyden, display a unique, agedependent phenotype.'" Prepubescent males with the Leyden
phenotype have decreased clotting activity because of insufficient FIX synthesis. After puberty, FIX activity gradually
increases with age, reaching approximately 60%of adult
normal levels in elderly patients with an associated amelioration of the symptoms of the disease.'" Interestingly, all
Leyden patients have mutations within a small segment of
the FIX promoter region immediately adjacent to the major
transcription start site."."
The first Leyden patient identified had a T to A transversion at the -20 position" and, subsequently, patients with
point mutations at -21, - 5 , -6, +6, +8, and + l 3 have
been identified.9 It has been suggested that these mutations
disrupt the binding of essential trans-acting DNA regulatory
From the Department of Cellular and Structural Biology, The
University of Texas Health Science Centerat San Antonio, San
Antonio, 7X.
Submitted October 11, 1994; accepted May 15, 1995.
Supported by National Institutes of Health Grant No. AG06872.
Address reprint requests to Pudur Jagadeeswaran, PhD, Department of Cellular and Structural Biology, The University of Texas
Health Science Center at San Antonio, 7703 Floyd Curl Dr, San
Antonio, 1x 78284-7762.
The publication costsof this article were defrayedin part by page
charge payment. This article must therefore behereby marked
"advertisement" in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
oooS-497//95/8606-0027$3.00/0
2198
Blood, Vol 86,No 6 (September 15).
1995:
pp 2198-2205
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
EXPRESSION OF FIXTRANSGENES
IN
2199
MICE
FIX promoter
fragment
CAT reporter gene
S V 4 0 polyadenylation
site
A
Fig 1. Transgene structure
and FIXpromoter sequences. (A)
Schematic diagram of the
transgene used in thein vivo
studies that includes a -189 to
+21 bp segment of the human
FIX promoter ligated to a CAT reporter gene with an SV40 polyadenylationsite. (B) Sequence of
-189 to +21 bp human promoter
segment used in the experimental protocols showing the + l
site of transcription initiation.
Boxes delineate either the proposed binding sites of previously
identified transcription factors
CIEBPn, HNF-4,NF-1L.or
the
binding site for which no factor
has been assigned (not labeled)
and ARE. The locationof the +l3
mutation (transversion [A to GI
present in the FIX
Leyden
transgene) is labeled.
- 189
ACTCAAATCAGCCACAGTGGCAGAAGCCCACGAAATCAGAGGTG
AAATTTAATAATGACCACTGCCCATTCTCTTCACTTGTCCCAAGA
NF-1L
G(~CCATTGGAAATAGTCCAAAGACCJCATTGAGGGAGATGGACAT
B
HNF-4
ARE
TATTTCCCAGAAGTAAATAC~GCTCAG
+l
C/EB?ar
*l3
*21
TAATCGACCT~CACTTTCACAGTCTGC
AGGGGGATCTGGGC
CAT reporter gene
AGCTTGGCGAGATTTTCAGGAGCTAAGGAAGCTAAA
MATERIALS AND METHODS
Tronygmic ctnimol.7. We chose to use the - 189 to +2 I bp fragment of the human FIX promoter in the preparation of our fusion
gene constructs. This selection was based on the demonstration by
Crossley and Brownlee’“and Salier et al” of essentially comparable
FIX promoter activity whether roughly 2,300 or 200 bp of5’ flanking
DNA was incorporated into fusion genes, which were thenexpressed
in HepG2 cells by transient transfections. Two chimeric genes were
constructed (in pCATOO vector“) that consisted of the human FIX
promotor segment extending from bp -189 to +212‘ (equivalent to
the shorter promoter of the earlier studies) ligated to the CAT reporter gene and SV40 polyadenylation site (Fig 1 A and B). The first
chimeric gene contained thenormal promoter sequence andwas
constructed in our laboratory; the second contained the same promoter sequence except for the + l 3 mutation (A to G transversion;
Fig IB) identical to that found in one hemophilia B Leyden patient
and was a gift from Dr G.G. Brownlee (University of Oxford, Oxford, UK). The plasmid DNA was isolated by alkaline lysis” and
digested with Asp718 and RomHl and the transgene fragment was
isolated by gel electrophoresis. The restricted fragment was electroeluted and purified by column chromatography (NAC 52s; GIBCO
BRL, Gaithersburg, MD). The identity of the transgene was determined by restriction enzyme digestion and sequencing before insertion into the genome of the mice.
C57BI16J-fertilized eggs were microinjected with the appropriate
transgene according to standard procedures,’0 and the injected embryos were transferred to pseudopregnant B6D2/FI females on the
day of microinjection. Offspring were weaned at approximately 28
were preserved and -bred withnormalC57B1/6to
establish the
transgenic lines.
The copy number of the transgenes was determined by Southern
blot analysis2’ using genomic DNA from transgenic founder mice
and several transgenic progeny in each transgenic line. Approximately IO pg of each genomic DNA was digested with PvulI and
electrophoresed in 0.8% agarose gels. Transgene copy controls were
prepared based on the number of mouse cells represented in IO pg
of genomic DNA such that I. 5. 10. and 50 copies per cell were
represented as appropriate. Transgene copy control DNA was combined with 10 pp of negative control mouse DNA and digested with
Pvull. Standard procedures were followed in preparing DNA for
transfer to Nytran membrane. Prehybridization andhybridization
were performed using a “P-labeled nick-translated full-length
to
transgene as a probe. Afterwashing.themembranewasused
expose x-ray film with intensifying screens. Hybridizing bands were
also counted in a betascope (Betagen, Waltham, MA) before stripping and probing a second time with the murine thyroid-stimulating
hormone P-subunit cDNA (TSHB). Counts fromthehybridizing
bands detected with the TSHB probe were used to correct for differences in loading andor transfer when calculating thenumberof
transgene copies.
PCR prorocol. Standard PCR was performed in 25 pL reaction
volume containing 50 to 100 ng of template DNA. 10 mmol/L TrisHCI, pH 8.4, 50 mmol/L KCI, 1.5 mmol/L MgCI?. 0.1% Triton X100, 0.8 pmol/L of each primer, 0.2 mmol/L of each dNTP, and I
U of To9 DNA polymerase (Promega, Madison, W1). The DNA was
denatured for 1 minute at 95°C followed by a 35-cycle reaction
(94°C for 30 seconds, 54°C for 20 seconds. and 72°C for 30 seconds)
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
2200
and a final elongation at 72°C for 2 minutes. The reaction sample
was resolved on a 5% polyacrylamide gel. If a particular band was
to be analyzed, it was excised, eluted, and purified by column chromatography WAC 52’s) using the manufacturer’s protocol.
RNA isolation. Total cellular RNAwas isolated from fresh or
frozen tissue with Tri Reagent (Molecular Research Center, Inc,
Cincinnati, OH) using the manufacturer’s protocol. The RNA was
rehydrated in 100 pL of diethyl pyrocarbonate (DEPC)-treated distilled water, the concentration was determined spectrophotometrically, and the integrity was determined by agarose gel electrophoresis.
ReversetranscriptionandPCR(RT-PCR).
RT-PCRwas performed using a modification of a one tubeprotocol.’* The initial
annealing of the primers to the RNA was in 9 pL of distilled water
containing of 1 pg of total RNAand 2.2 prnoVL mouse FIX 3’
(complementary
primer 1256GGACAAG~C‘ITAACTGGC1z75
strand sequence)” and 2.2 pmoVL aldolase 3’ primer 686TTATGCCAGTATCTGCCAGCAGAAT7Io (complementary strand sequence; Genbank accession no. M1 1560), followed by incubation at
65°C for 15 minutes and then at 4°C for 5 minutes. Sixteen units of
avian myeloblastosis virus (AMV) reverse transcriptase (Promega)
and 40 U of RNasin (Promega) were added to the hybridization
mixture; the volume was adjusted to 20 pL with buffer containing
50 mmol/L Tris-HC1, pH 8.3, 50 mmol/L KCl, 10 mmol/L MgCI,,
IO mmoVL dithiothreitol (D’IT), 0.5 mmol/L spermidine, and 0.5
mmol/L of each dNTP; and the solution was incubated at 42°C for
1 hour. The FIX 5’ primer 773AATGGATTGTAACTGCTGCC7yz
(coding strand sequence)” and the aldolase 5’ primer 397TCATCCTCTTCCATGAGACACTCTA42’(coding strand sequence; Genbank
accession no. M1 1560) were labeled in the same tube with 2 U of
T4 kinase (BRL) in the presence of 20 pCi [y-”P]rATP at a volume
of 5 pL containing 70 mmol/L Tris-HCI, pH 7.6, 10 mmoK MgC12,
5 mmol/L DTT, and 1 pmol/L of each primer for 1 hour at 37°C.
For the PCR reaction, the above 32P-labeled5’ primers were added
to the reverse transcription reaction mixture and brought to a total
volume of 100 pL. The final concentration of thevarious components
of the reaction was 20 mmol/L Tris-HC1, pH 8.4, 60 mmol/L KCI,
2.5 mmol/L MgC12,2 mmom D’IT, 0.2 m m o n of each dNW, 0.2
pmoVL of each primer, 0.1% Triton X-100, and 2 U of Taq DNA
polymerase (Promega). The solution was denatured for 1 minute at
95°C and then an 18-cycle PCR reaction was performed (95°C for
30 seconds, 58°C for 20 seconds, and 72°C for 30 seconds). Identical
aliquots (15 pL) of amplified products were resolved on a 5% polyacrylamide gel and dried andthe incorporated radioactivity was
determined by Betascope analysis (Betagen). Background was subtracted and the ratio of the cpm (FIX) to cpm (aldolase) was calculated. Ratio data from 30 animals (10 sets of animals in 5 age groups:
2 months, 6 months, 8 months, 20 months, and 28 months) were
pooled, and the statistical significance of age-related differences in
this ratio was analyzed by a one-way analysis of variance (ANOVA).
The identity of the amplified products was verified by cycle sequencing method~logy.~~
BOUND ET AL
FIX activity measurement. FIX activity in plasma from various
ages of mice were measured using an activated partial thromboplastin time (AP’IT)-based assay. Serial dilutions (from 1:5 to1:160)
from normalhuman plasma (Helena, Beaumont, TX) in Owren’s
veronal buffer (American Dade, Miami, FL) were used to generate
a standard curve. Dilutions (0.1 mL) were mixedwith 0.1 mL of
FIX-deficient plasma and 0.1 mL of AP’IT reagent (Dade). After 5
minutes of incubation at 37°C 0.1 mL of 0.02 mol/L CaCl, (Dade)
was added and the clotting time was measured on an MLA Electra
700 automatic coagulation timer (Medical Laboratory Automation,
Inc, Pleasantville, NY). Mouse whole blood was aspirated from the
heart under anesthesia andmixed 9:l with 3.2% sodium citrate.
Plasma was separated, diluted 1:lO into Owren’s veronal buffer, and
treated identically to measure FIX levels in mouse blood. The standard curve is based on a 100%FIX activity in normal human plasma.
Analysis oftransgene expression. Approximately 0.05 g of frozen tissue was placed in 200 pL of ice-cold Tris-HC1, pH 7.8, in a
2-mL Eppendorf tube and homogenized with two 15-second bursts
by a Brinkman homogenizer (Brinkman Instruments Inc, Westbury,
NY) at setting 6. The homogenate was freeze-thawed three times
and cellular debris was pelleted at 12,OOOg for 10 minutes at 4°C.
The supernatant was incubated at 65°C for 5 minutes and spun at
32,OOOg for 10 minutes at 4°C. The protein concentration ofthe
resulting supernatant was determined using the Bradford assay,3’
and the extract was stored at -80°C until use.
Twenty micrograms of crude extract were incubated for 60 minutes at 37°C in 150 pL of total volume containing 0.25 moVL TrisHCl, pH 7.5,530 prnoVL acetyl CoA, and 0.25 pCi of [‘4C]-labeled
chloramphenicol (56 mCi/mmol; Amersham, Arlington Heights, IL).
A second aliquot of acetyl CoA was added and the sample incubated
for a second 60-minute period. The resulting mixture was then extracted with 1 mL of ethyl acetate, lyophilized until dry, and then
dissolved in 35 pL of ethyl acetate. The samples were spotted onto
a 20 X 20 cm silica gel TLC plate (Sigma, St Louis, MO) and run
to the top with a 95% chlorofod5% methanol solution. The plate
was dried and exposed to Kodak XAR autoradiography film (Eastman Kodak, Rochester, NY) at -80°C. Quantitative data were obtained by subsequent analysis of the radiolabel incorporated into the
spots corresponding to the acetylated products of chloramphenicol
with the Betascope.
RESULTS
To investigate whether murine FIX mRNA levels increased during aging, we measured relative FIX mRNA levels using RT-PCR in 2-, 6-, 8-, 20-, and 28-month-old mice
total liver RNA. Aldolase, a medium to low abundant
housekeeping mRNA, showed no significant change with
age and was used as an internal standard in RT-PCR analysis.
To show that the RT-PCR reactions are quantitative, we have
performed the RT-PCR reactions with increasing numbers of
PCR cycles and also with increasing quantities of total RNA.
>
Fig 2. Measurement of murine FIX mRNA and activity levels with age. FIX and aldolase are shown by arrows. (U) Aldolase; IO) FIX. (A)
Optimization of number of PCR cycles in RT-PCR reactions. One microgram total liver RNA was amplffled by RT-PCR using an end-labeled
CPM
primer at an increesing numberof cycles as indicated. After gel elechophoreais,the radioactivity in appropriate bands was counted. The
were plotted against the increasing number of PCR cycles. (B)Optimization of RNA concentrationin RT-PCR reactions. RT-PCR reactions were
performed et 18 cycler with increasing concentrationsof RNA andthe bands were analyzedas above. The CPM were plotted against increasing
concentration of total liver RNA. (C) Representative RT-PCR assay on total liver RNA from C57BV6 mice of various ages.(D) Cumulative data
from RT-PCR analysis. The ratio of CPM
of FIX and aldolase bands(Mean Ratio) was plotted against different ages
of mice. ErrorbaM indicate
for2-month-old animals
the standard deviationsIn = IO). Mean ratiosof 6- and 8-month-old animals were dgnificantly greater than those the
( P c .05). In 20- and 26-month-old animals, these ratios werealso significantly greater than those for
the 2-month-old animals I f < .0011. (E)
of 28-month-old animals was significantly greater than
that for the 2-month-old animals( P < .001). Error
FIX activity during aging. FIX activity
bars indicate the standard deviations (n = 4).
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
EXPRESSION OF FIX TRANSGENES IN
MICE
2201
linear range at 18 cycles of PCR and for 1 pg total RNA
(Fig 2A and B). No nonspecific amplifications were observed
under these conditions. This range was in agreement with
the earlier report on RT-PCR analysis of aldolase mRNA."
The counts per minute (CPM) from the FIX and aldolase
bands were plotted against the number of cycles (Fig 2A)
as well as against the concentration of total RNA (Fig 2B).
The results showed that the RT-FCR reactions were in the
A
B
Number of Cycles
RNA in pg
7
1
l 8 2 02 22 6
28
. .... .
15 1617
-v-
.r.
,
T FIX
+Aldolase
10000
10000
z
0
i?
l000
0
100
1000 -
k
100
10
282420
1
0
Number of Cycles
2
1
4
1
0
1
Total RNA (xpg)
0
E
D
C
1
8
Months
n
100
80
0
2
6
8 20 28
Months
2 28
Months
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
2202
We have used the above optimal conditions in our analysis
of relative FIX mRNA levels. The ratio ofFIX mRNA/
aldolase mRNA was measured in various ages of both male
and female mice. A representative gel separation of RT-PCR
products derived from liver RNA that was obtained from
various ages of male mice is given in Fig 2C.
A moderate but significant increase in relative FIX mRNA
level between mice (of both sexes) of 2, 6, 8, 20, and 28
months of age was shown using the RT-PCR procedure.
There wasno significant difference in FIX mRNA levels
between male and female mice of same age (data not shown).
Figure 2D shows the cumulative data on relative FIX mRNA
levels from both male and female mice of various ages.
Because of the low levels of endogenous FIX mRNA, it has
been difficult to use nuclear run-on assays to determine if
there are age-related changes in the production of newly
transcribed FIX mRNA. Hence, we were unable to definitively show that the increase in FIX mRNA levels is due to
an increase in FIX mRNA synthesis at the transcriptional
level.
To determine if the increase in FIX mRNA levels that is
observed between 2-and 28-month-old mice is physiologically relevant, we have used the one-stage clotting assay’ to
measure FIX activity in 2- and 28-month-old mice of both
sexes. Two-month-old male mice showed only SO% to 60%
of the FIX activity measured in 28-month-old male mice
(Fig 2E). Female mice also showed similar FIX activity
levels as a function of age (data not shown).
Because aged CS7BV6 mice, like humans, show increased
levels of FIX activity with age, we wished to determine if
the expression of a chimeric construct driven either by the
normal human FIXpromoter or the mutant Leyden promoter
would also manifest age-related changes in the transgenic
mouse model. Five transgenic lines were generated that carried the chimeric construct consisting of the - 189 to +21
region of the normal human FIX promoter linked to a CAT
reporter. Two transgenic lines were generated that carried
the same -189 to +21 region of the human FIX promoter
but with the Leyden mutation at + 13 position. Three of the
founder lines bearing the human normal FIX promoter and
one of the lines with the Leyden promoter did not breed or
died before the generation of viable offspring. Analysis of
the two remaining normal lines, designated N71 and N4II1,
and the + 13 mutant line, designated N311, generated the data
outlined in the next paragraph. Southern and PCR analysis
showed that N4III had incorporated 15 to 20 copies of the
transgene into its genome, N71had incorporated 70 to 80
copies, and N31I had incorporated 5 to 15 copies.
The transgene expression was analyzed by measuring
CAT activity in various tissues. A representative CAT activity analysis from N71 animal is shown in Fig 3A. The expression was liver-specific regardless of whether the transgenic
lines were expressing CAT activity driven by the human
normal FIX promoter or the Leyden promoter (Fig 3B). The
expression of the human FIX promoter’s activity was also
evaluated throughout the life span of the mouse by analysis
of CAT activity in liver extracts from mice of various ages.
In the transgenic mice carrying the human normal FIX promoter, no difference in the level of CAT activity was de-
BOUND ET AL
tected in liver extracts (Fig 3B) regardless of age, sex, or
founder line. In contrast, liver-specific expression of the
Leyden promoter-regulated transgene was detected only in
6- and 8-month-old male mice (Fig 3B). Liver extracts from
2- and 3-month-old male mice and from 2- and 8-month-old
female mice did not display CAT activity. The CAT activity
in the liver extracts of 8-month-old Leyden promoter bearing
male mice was approximately 50% to 60% of that observed
in equal amounts of liver extracts from mice carrying normal
FIX promoter of the same age. The liver extracts from 6month-old animals showed approximately 25% to 30%of
the CAT activity observed in normal FIX promoter carrying
mice. We have also analyzed 2 animals (18-month-old male
and female mice) of the Leyden promoter containing line
thatdidnotbreed(copynumberof
transgene unknown).
Only the male mouse showed CAT activity (data not shown)
comparable to the 8-month-old N3II male mice, but the female mouse did not show any detectable CAT activity. Because this line did notbreed, we could not obtain statistically
meaningful data. However, the lack of expression inthe
female mouse was similar to the data collected from N3II
female mice.
DISCUSSION
Our data show that FIX mRNA levels and FIX activity
increase with increasing age in mice of both sexes. In addition, our results provide the first demonstration that the agerelated increase in FIX activity in mice age can be correlated
with a corresponding increase in the level of FIX mRNA.
These observations are consistent with the previous demonstration of an increase in FIX activity in humans with aging.’
The physiologic significance of this age-related increase in
FIX activity is unknown. The developmental expression of
murine FIX mRNA begins at day 4 of gestation but is low
(< 10% of that found in 2-month-old animals) until just before parturition, at which time it increases dramatically to
40%to 50% of the adult level. This increase continues
through 2 months of age, when FIX mRNA levels are reported to stabilize.2However, until now, neither FIX activity
nor FIX mRNA levels have been examined after 2 months
of age in mice. Our data complement the work of Yao et a12
and provide a complete description of FIXmRNA levels
throughout the life span of the mouse. One clear observation,
based on our FIX data and the developmental data of Yao
et a1,’ is that expression of the murine FIX gene throughout
the relative life span of mouse is comparable to that of the
human. This finding suggests that the murine hepatocyte
may serve as a model for the human system to study the
regulation of the FIX gene in vivo.
Our results provide the first demonstration that the - 189
to +21 bp segment of the normal human mX gene promoter
and the homologous Leyden promoter are capable of directing the tissue-specific expression of a CAT reporter gene in
transgenic mice. Because transgenic lines with different copy
numbers of normal human FIX gene promoter have similar
expression levels, low levels of expression of the Leyden
promoter are probably not due to low copy number but may
reflect the mutant promoter. Earlier studies with transgenic
animals expressing an FIX transgene have shown that a 5-
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
EXPRESSION OF FIXTRANSGENES IN MICE
2203
A
140
120
Fig 3. Transgene expression
intransgenic mice. (A) Representative CAT assay of cytoplasmic
extracts from various tissues of
an N71 line female. The positive
controlis a liverextractof
a
transgenic mouse expressing a
chimeric construct in which human transferrin promoter is driving the CAT reporter gene and
the negative control aisliver extract of a nontransgenic C57B1/6
mouse. (B) Quantitative analysis
of CAT expression with age in
the transgenic mouse lines. Relative CAT activity is calculated
with reference t o 2-month-old
male N71 line mice. Each error
calculation is the standard
deviation of activity from 4 mice. (U)
Males and (m) female mice. N71,
N4111, and N311 are the founder
transgenic lines. The numbers
above the founder lines indicate
the age of mice in months.
100
80
60
a,
W
.c.
Q
40
Q)
U
20
0
2
8
2
8
u u
kb segment of the FIX promoter could regulate the liverspecific expression of an FIX cDNA.'~ Our data show that
a much smaller segment of the FIX promoter is capable of
directing liver-specific transcriptional activity in transgenic
mice.
The normal FIXpromoter-driven transgene did notexhibit
any sex- or age-related differences in its expression pattern.
Although equal expression of FIX in both male and female
mice is consistent with previous clinical data: some increases in expression of the normal promoter during aging
might be expected based on clinical data' and on our own
observations (see above). However, no significant changes in
N71
N4111
2 3 6 8
2 8
UU
N311
N311
the expression of the normal FIX promoter-driven transgene
were detectable with aging. On the other hand, the Leyden
promoter-driven transgene was expressed in a distinct ageand sex-specific pattern that closely parallels that observed
in the human Leyden phenotype. In the human Leyden male
patients, FIX activity is between 10% and 20% of normal
at 20 years of age and iseven lower at puberty. Interestingly,
however, FIX activity in these individuals shows a progressive increase with age to reach 50% to 60% of normal in
the fifth decade of life." Considering the relative life span
of the mouse and human, 2-month-old mice are probably
equivalent to 20-year-old individuals and 8-month-old mice
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
2204
BOLAND ET AL
are probably equivalent to 50-year-old individuals. In the
transgenic animals that carried the fusion gene withthe
Leyden promoter, we were unable to detect CAT activity at
2 months of age. However, 8-month-old mice presented a
clearly demonstrable increase in CAT activity. This is the
first demonstration that the + 13 mutation in the - 189 to
+21 bp FIX promoter segment is capable of generating the
Leyden phenotype in a male transgenic mouse model. The
failure of female transgenic mice that carry the Leyden promoter to express CAT activity at any age suggests that a
male-specific factor may be necessary for the expression of
the Leyden phenotype. It also suggests that human females
who are carriers for FIX Leyden shouldhave 50% of normal
levels throughout life, but this possibility remains to be investigated. Our data are consistent with theprevious suggestion of an important role of androgens in the presentation of
Leyden phenotype.'','' On the other hand, although puberty
inmiceoccursat
or near1monthof
age and although
androgen receptor mRNA and hormone levels have
stabilized in 2-month-old male mice,z'~22
the Leyden promoter
does not appear to be activated in transgenic mice of this
age. Hence, although androgens are apparently essential for
the expression of the Leydenphenotype, these steroids do not
appear to be sufficient,by themselves, to produce significant
promoter activity in transgenic males. From our transgenic
data, it appears that an additional factor(s) whose expression
or activation commences some time after puberty is also
required for mediating the age-relatedincrease in the expression of the Leyden promoter.
Ithasbeen
recently shownthat DBP, aliver-specific
DNA-binding protein with a postpubertal expre~sion,~~
may
be involved in theregulation of theFIX gene througha
specific synergistic interaction with C/EBPa atabinding
site -219/-202. It has alsobeenshownthat
DBP binds
weakly to the + 13 mutation site and that the complex of C/
EBPa and DBP binds even better to this site. It is interesting
that our +13 mutant promoter does not contain the major
202-219 binding site and still shows age-dependent expression. If the age-dependent increase is in part due to DBP or
a complex of C/EBPa and DBP bindingto the CEBPa
site, it probably participates in the complex protein-protein
interactions.
In conclusion, our data have shown that thelevels of FIX
mRNA in mice increase with age. Furthermore, the mouse
model regulates a -189 to +21 bp FIX promoter segment
from normal and Leyden FIX genes in a manner analogous
to that observed in the human.
ACKNOWLEDGMENT
We thank Drs William Morgan and Arun Roy for helpful discussions, Dr Gwendolyn Adrian for positive control liver tissue, and
Nyra White for secretarial help.
REFERENCES
1 . Mann KG, Lorand L: Introduction: Blood coagulation. Methods Enzymol 222: 1, 1993
2. Yao SN, DeSilva AH, Kurachi S, Samuelson LC, Kurachi K:
Characterization of a mouse factor IX cDNA and developmental
regulation of the factor D[ gene expression in liver. Thromb Haemost
6552, 1991
3. Terwiel J, Veltkamp JJ, Bertina RM, Muller HP: Coagulation
factors in the human fetus of about 20 weeks of gestational age. Br
J Haematol 45:641, 1980
4. Kisker CT, Robillard JE, Clarke WR: Development of blood
coagulation-A fetal lamb model. Pediatr Res 15:1045, 1981
5. Dodds WJ, Moynihan AC, Benson RE, Hall CA: The value of
age- and sex-matched controls for coagulation studies. Br J Haematol
29:305, 1975
6. Roberts HR: Molecular biologyof hemophilia B. Thromb
Haemost 70:1, 1993
7. Thompson AR, Chen SH: Characterization of factor IX defects
in hemophilia B patients. Methods Enzymol 222:143, 1993
8. Odom MW, Leone G, De Stefan0 V, Montiel MM, Boland EJ,
Anderson J, Jagadeeswaran P Five novel point mutations: two causing haemophilia B and three causing factor X deficiency. Mol Cell
Probes 853, 1994
9. Giannelli F, Green PM, High KA, Sommer S, Poon MC, Ludwig M, Schwaab R, Reitsma PH, Goossens M, Yoshioka A,
Brownlee GG: Haemophilia B: Database of point mutations and
short additions and deletions-Fourth edition. Nucleic Acids Res
21:3075, 1993
10. Briet E, Bertina RM, van Tilburg NH, Veltkamp JJ: Hemophilia B Leyden: A sex-linked hereditary disorder that improves
after puberty. N Engl J Med 306:788, 1982
11. Reijnen MJ, Bertina RM, Reitsma PH: Localization of transcription initiation sites in the human coagulation factor IX gene.
FEBS Lett 270:207, 1990
12. Anson DS, Choo KH, Rees DJ, Giannelli F, Gould K, Huddleston JA, Brownlee GG: The gene structure of human anti-haemophilic factor IX. EMBO J 3:1053, 1984
13. Reitsma PH, Bertina RM, Ploos van Amstel JK, Riemens A,
Briet E: The putative factor IX gene promoter in hemophilia B
Leyden. Blood 72: 1074, 1988
14. Crossley M, Brownlee GG: Disruption of a CBBP binding
site inthe factor M promoter is associated with haemophilia B.
Nature 345:444, 1990
15. Kurachi S, Furukawa M, Salier JP, Wu CT, Wilson ET, French
FS, Kurachi K: Regulatory mechanism of human factor IX gene:
Protein binding at the Leyden-specific region. Biochemistry 33:1580,
1994
16. Vidaud D, Tartary M, Costa JM, Bahnak BR, Gispert-Sanchez
S, Fressinaud E, Gazengel C, Meyer D, Goossens M, Lavergne JM,
Vidaud M: Nucleotide substitutions at the -6 position in the promoter region of the factor IX gene result in different severity of
hemophilia B Leyden: Consequences for genetic counseling. Hum
Genet 91:241, 1993
17. Reijnen MJ, Sladek FM, Bertina RM, Reitsma PH: Disruption
of a binding site for hepatocyte nuclear factor 4 results in hemophilia
B Leyden. h o c Natl Acad Sci USA 89:6300, 1992
18. Crossley M, Ludwig M, Stowell KM, De Vos P, Olek K,
Brownlee GG: Recovery from hemophilia B Leyden: An androgenresponsive element in the factor IX promotor. Science 257:377, 1992
19. Picketts DJ, Lillicrap DP, Mueller CR: Synergy between transcription factors DBP and CBBP compensates for haemophilia B
leyden factor IX mutations. Nat Genet 3:175, 1993
20. Briet E, Wijnands MC, Veltkamp JJ: The prophylactic treatment of hemophilia B Leyden with anabolic steroids. Ann Intern
Med103:225, 1985
21. Roy AK, Schiop MJ, Dowbenko DJ: Regulation of the hepatic
synthesis of aZuglobulin and its corresponding messenger RNA in
maturing male rats. FEBS Lett 70:137, 1976
22. Song CS, Rao TR, Demyan W, Mancini MA, Chatterjee B,
Roy AK: Androgen receptor messenger ribonucleic acid (mRNA)
in the rat liver: Changes in mRNA levels during maturation, aging,
and calorie restriction. Endocrinology 128:349, 1991
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
EXPRESSION OF FIX TRANSGENES IN MICE
23. Salier JP, Hirosawa S , Kurachi K Functional characterization
of the 5’-regulatory region of human factor IX gene. J Biol Chem
265:7062, 1990
24. Yoshitake S , Schach BG, Foster DC, Davie EW, KurachiK
Nucleotide sequenceof thegene forhuman factor M (antihemophilic
factor B). Biochemistry 243736, 1985
25.BirnboimHC:Arapidalkalineextractionmethod
for the
isolation of plasmid DNA. Methods Enzymol 100:243, 1983
26.HoganB,Costantini
F, Lacy E ManipulatingtheMouse
Embryo:ALaboratoryManual.ColdSpringHarbor,
N Y , Cold
Spring Harbor Laboratory, 1986
27. Walter CA, Lu J, Bhakta M, Mitra S , Dunn W, Herbert DC,
WeakerFJ,Hoog T, GarzaP,Adrian GS, Kamolmarin N Brain
and liver targeted overexpression
of 06-methylguanineDNA methyltransferase in transgenic mice. Carcinogenesis 14:1537, 1993
28. Chen D, Magnuson V,Hill S, Arnaud C, Steffensen B, Klebe
W:Regulation of integrin gene expression by substrate adherence.
J Biol Chem 267:23502, 1992
2205
29. Wu SM, StaffordDW, WareJ: Deduced amino acid sequence
of mouse blood coagulation factor IX. Gene 86:275, 1990
30. Innis MA, Myambo KB, GelfandDH,BrownMA:DNA
sequencingwithThermusaquaticusDNApolymeraseanddirect
sequencing of polymerase chain reaction-amplified DNA. Proc Natl
Acad Sci USA 859436, 1988
31. Bradford MM: A rapid and sensitive method
for the quantitationofmicrogram quantities ofproteinutilizingthe
principle of
protein-dye binding. Anal Biochem 72248, 1976
32.Jallat S , PerraudF,DalemansW,BallandA,DieterleA,
Faure T, Meulien P, Pavirani A: Characterization ofrecombinant
human factor IX expressed in transgenic mice and in derived transimmortalized hepatic cell lines. EMBO J 9:3295, 1990
33. Mueller CR. Maire P, Schibler U: DBP, a liver-enriched
transcriptional activator, is expressed late in ontogenyand
its tissue specificity is determined posttranscriptionally. Cell
61:279, 1990
From www.bloodjournal.org by guest on December 29, 2014. For personal use only.
1995 86: 2198-2205
Age-specific regulation of clotting factor IX gene expression in
normal and transgenic mice
EJ Boland, YC Liu, CA Walter, DC Herbert, FJ Weaker, MW Odom and P Jagadeeswaran
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/6/2198.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.