1. No category

Title
Author(s)
Structure-function and physiological properties of HCNencoded pacemaker channels
Wang, Kai; 王凱
Citation
Issue Date
URL
Rights
2007
http://hdl.handle.net/10722/52103
The author retains all proprietary rights, (such as patent
rights) and the right to use in future works.
Structure-Function and Physiological Properties of
HCN-encoded Pacemaker Channels
by
Wang Kai
A thesis submitted for
The degree of Doctor of Philosophy at The University of Hong Kong
September 2007
Dedicate to my parents and my wife
ii
Abstract of thesis entitled
Structure-Function and Physiological Properties of HCN-encoded
Pacemaker Channels
Submitted by
Wang Kai
For the degree of Doctor of Philosophy at the University of Hong Kong
In August, 2007
Pacemaker current If, encoded by the hyperpolarization-activated, cyclic
nucleotide-gated (HCN) gene family, contributes significantly to cardiac pacing. As
a result, it has become an intensively investigated target to modulate heart rate and
function by using pharmacological, genetical and cell-based methods. However,
detailed structure-function relationships of HCN channel and physiological roles of
If current in different cell types remain largely obscure. On the other hand, other
components, such as inward rectifier current (IK1) has been proposed to play a more
important role in pacemaker activity.
Firstly, to further explore the functional role of If current in pacemaking, I compared
the contribution of If and IK1 current to the automaticity of cultured neonatal rat
ventricular myocytes (NRVMs). I found adenovirus mediated genetically engineered
HCN1 channel overexpression can recover the automaticity of quiescent NRVMs,
confirming the crucial role of If as the initiator of the pacemaker activity. IK1 and
iii
probably sodium current but not If are responsible for the time-dependent change of
automaticity. Furthermore, other mechanisms, such as connexin-encoded gap
junction may also plays an important role in maintaining the synchronized electrical
activity of NRVM monolayer culture. These findings reveal the complexity of
cardiac pacemaker mechanism, and suggest future efforts should be paid to explore
the strategy of fine-tuning If-induced pacemaking activity.
Secondly, to study the structure-function relationship of HCN channel blocking, the
functional consequences of alanine-scanning mutagenesis in pore-forming region
were studied. Pharmacological and kinetics assays showed that alanine-substitutions
of several residues in the middle of S6 segment of HCN1 channel significantly alter
both voltage-dependence of activation and sensitivity to the specific blocker
ZD7288. Based on these results, I proposed that these residues form a hydrophobic
binding pocket within the activation gate for ZD7288. These findings provide useful
information to develop more specific HCN blockers and genetically engineered
HCN channels for clinical application.
Finally, the electrophysiological properties of pluripotent human and mouse
embryonic stem cells (ESCs), which can differentiate into pacemaker cells, were
characterized. Interestingly, functional expression of If current was detected in
mouse but not human ESCs. In addition, several specialized ion channels are
expressed at the mRNA and functional levels in both pluripotent mouse and human
iv
ESCs. The main component, depolarization-activated delayed rectifier K+ currents
(IKDR) were demonstrated to play an important role in controlling the cell
proliferation. By contrast, neither voltage gated sodium nor calcium currents were
detected in both cells. Microarray and RT-PCR analyses identified several candidate
genes for the ionic currents discovered. These findings provide insights into the
similarities and differences between the two species and offer a possible strategy to
inhibit or eliminate tumorgenicity of residual pluripotent ESCs after implantation.
Taken collectively, the results from these studies not only deepen the understanding
of structure-function and physiological properties of HCN channel but also provide
useful information for the future development of gene- and cell- based therapies for
heart diseases.
v
Declaration
I hereby declare that this thesis present my own work, except where
acknowledgement is mentioned, and that all studies mentioned in this
thesis has not been submitted for applying a degree, diploma or other
qualifications in any other institutions.
Signature:
Wang Kai
vi
Acknowledgement
Firstly and foremost I am grateful to all my supervisors, Prof. Hung-Fat Tse, Dr.
Ronald A. Li and Prof. Chu-Pak Lau for their guidance, support, and giving me the
opportunity to receive training in two closely collaborating laboratories. Also, I am
deeply indebted to Dr. Gui-Rong Li, who introduced me to this lab. He always
generously shares facilities and materials in his group and gives brilliant suggestions
and encouragements to me. I sincerely thank Dr. Janet Zhang for teaching me basic
molecular biological techniques when she worked in this laboratory.
Big thanks also go to all my labmates and collaborators. Mr. Alex Chan worked on
pharmacological and kinetics experiments together with me in probing the
bradycardic drug binding receptor of HCN-encoded pacemaker channels. Dr. Tian
Xue, Dr. Suk-Ying Tsang, Dr. Rika Van Huizen, Dr. Zhaohui Ye and Dr. Linzhao
Cheng in Johns Hopkins University did the experiments of patch clamp,
immunohistochemistry, RT-PCR and microarray on human ESCs. Dr. Karen Au
helped me in the cell proliferation experiments of mouse ESCs. I will not finish my
projects and thesis without their huge efforts. I am most grateful to Mr. Kevin Lai,
our technician, for his patient teaching and kind help in all aspects of my study,
especially in the histochemistry works of my projects. I also thank Mr. Johnny
Wong for introducing me to mouse embryonic stem cells culture, Ms. Yuenyuen
Kowk for keeping and ordering materials for me, Dr. Virginia Lau for sharing her
ideas and discussing problems in my projects with me.
vii
I could never thank my parents enough for raising me up. You have taught me
invaluable lessons and given me unconditioned love wherever I was. I could never
reward what you have done for me.
Lastly, I want to thank my wife, Muhan Chen. You have been with me shoulder to
shoulder in the University of Hong Kong for three years, celebrating the good times,
giving me consolation and encouragement during the hard times and waiting for me.
This thesis is a fruit of your patience. Thank you for being my best friend, my closest
confidant and showing me what is really important in life.
viii
Contents
Abstract……………………………………………………………………………...iii
Declaration…………………………………………………………………………..vi
Acknowledgements…………………………………………………………………vii
Contents……………………………………………………………………………..ix
Abbreviations…………………………………………...……………………….…xiv
List of figures…………………………………………….………..…………....…xvii
List of tables…………………………………………….………….………...….…xix
CHAPTER 1
Introduction
1.1 Cardiac pacemaking………………………………...……………………………1
1.1.1 Structure of SA node…………………………………………...…………..1
1.1.2 Mechanisms of pacemaking…………………………………..……………2
1.2 Physiological properties of pacemaker currents………………...……………….5
1.2.1 Biophysical properties of pacemaker currents……………………………..5
1.2.2 Contribution of pacemaker current to automaticity………….....………...10
1.3 Structure-function properties of pacemaker channels………………………..…14
1.3.1 Molecular basis of pacemaker currents: HCN gene family……..........…..14
1.3.2 Structure-function relationships of pacemaker channels…………………17
ix
1.4 Therapeutic applications of pacemaker channels…...……………..………...…25
1.4.1 Pacemaker channels targeted bradycardic agents…………………...……25
1.4.2 Drug binding mechanism and the implications
in structure-function relationship of the HCN channel…………….29
1.4.3 HCN gene based biological pacemaker…….……………...……………..35
1.5 Objectives…………………………………………………………..…………..46
CHAPTER 2
Methodology
2.1 Materials and equipments…...……………..…………………….……………48
2.1.1 Main items………………………………………………….……….……48
2.1.2 Glassware and plastic ware………………………………..………….…..50
2.1.3 Enzymes and biological kits……….…………………………..…………50
2.1.4 Reagents……………………………………………………..……………51
2.1.5 Cell lines and Medium……………………………………………………53
2.1.6 Oligonucleotides primers and probes……………………………….……55
2.1.7 Computer programs…………….……………………………….………..55
2.2 Cell isolation and culture……………………………………………….………56
2.2.1 Mouse embryonic stem cells (mESCs)…………………………………...56
2.2.2 HEK293 cells……………………………...……………………………...60
2.2.3 Neonatal rat ventricular myocytes………………………………………..62
2.3 Cell proliferation assay………………………………………………….…...…63
x
2.4 Cell viability assay…...……………………………………………….….…..…64
2.5 Immunohistochemistry………………………………………………..…..……66
2.6 Ala-scanning mutagenesis……………………………………………………...67
2.6.1 Site-directed mutagenesis………………………………………….……..68
2.6.2 Heat shock transformation…………………………………………….….69
2.6.3 Polymerase Chain Reaction (PCR)………………………………………70
2.6.4 Plasmid DNA extraction…………………………………………………70
2.6.5 Sequencing………………………………………………….……………70
2.7 RT-PCR…………………………………………………………………….…..71
2.8 Gene transfer…………………………………………………………….…...…73
2.8.1 Gene transfer using cationic lipid…………………….………………….73
2.8.2 Adenovirus mediated gene transfer………………………………………74
2.9 Electrophysiology………………………………………………………………75
2.9.1 Patch clamp experiments.....……………………………………..…..…...75
2.9.2 Multielectrode Array (MEA) recording………………………………….76
2.10 Data analysis……………………………………………..…………………....78
CHAPTER 3
Characterizing the basis of automaticity of neonatal ventricular
cardiomyocytes: Implications for cardiac excitability manipulations
3.1 Introduction……………………………………………………………………..79
3.2 Methods………………………………………………………………………....81
xi
3.3 Results…………………………………………………………………………..85
3.4 Discussion…………………………………………………………...………...102
CHAPTER 4
Probing the bradycardic drug binding receptor of HCN-encoded
pacemaker channels
4.1 Introduction……………………………...…………………………..………...109
4.2 Methods…………………………………………...……………………….......112
4.3 Results……………………………………………………...……………….…117
4.4 Discussion…………………………………………………...………………...138
CHAPTER 5
Electrophysiological properties of pluripotent human and mouse
embryonic stem cells
5.1 Introduction…………………………………………………………………...146
5.2 Methods…………………………………………………………………….....147
5.3 Results………………………………………………………………………...155
5.4 Discussion…………………………………………………………………….171
CHAPTER 6
Conclusions…………………………………………………………………….175
xii
REFERENCES ….........……..……...……………………………..................181
APPENDIX
Publications……………………………………………………...……………..202
xiii
Abbreviations
4-AP
4-aminopyridine
AAV
adeno-associated virus
AC
adenylyl cyclase
AP
action potential
APD
action potential duration
APD50
APD at 50% repolarization
APD90
APD at 90% repolarization
AV node
atrioventricular node
BK channel
calcium-activated large-conductance potassium channel
cAMP
cyclic adenosine monophosphate
Cav
voltage-gated Ca2+ channel
cGMP
cyclic guanosine monophosphate
CM
cardiac myocytes
CNBD
cyclic nucleotide binding domain
CNG channel
cyclic nucleotide-gated channel
CV
conduction velocity
ESC
embryonic stem cell
GC
guanylyl cyclase
GFP
green fluorescent protein
HEK293 cell
human embryonic kidney 293 cell
hERG
human ether-à-go-go related channel
HCN channel
hyperpolarization-activated,
channel
IBTX
Iberiotoxin
IBK
calcium-activated large-conductance potassium channel
ICa,L
L-type calcium current
ICa,T
T-type calcium current
If
funny current
Ih
hyperpolarization current
xiv
cyclic
nucleotide-gated
IHCN
current of heterologously expressed HCN channel
IK1
inward rectifier potassium current
INa
sodium current
INCX
Na+-Ca2+ exchange current
IK,ACh
ACh-activated K+ current
IK,ATP
ATP-sensitive K+ current
IKDR
delayed rectifier K+ currents
IKr
rapidly activated delayed rectifier K+ current
IKs
slowly activated delayed rectifier K+ current
Iq
queer current
Ist
sustained inward current
IV
current-voltage
Kv channel
voltage-gated K+ channel
LAT
local activation time
LV
Lentivirus
MDP
maximum diastolic potential
MEA
multielectrode array
MEF
mouse embryonic fibroblast
Nav channel
voltage-gated sodium channel
NO
nitric oxide
NRVM
neonatal rat ventricular myocyte
RMP
resting membrane potential
RyRs
ryanodine receptors
SA node
Sinoatrial node
SAP
spontaneous action potential
SR
sarcoplasmic reticulum
TEA
tetraethylammonium
TOP
takeoff potential
V1/2
half-maximally activated potential)
WT
wild-type
xv
Mathematical Symbols
EC50
half-effective concentration
IC50
half-blocking concentration
kon
association constant
koff
Dissociation constant
τact
activation time constant
τon
time constant for blocking
τoff
time constant for recovery from blocking
KD
equilibrium constant
xvi
List of Figures
Figures
Page
1.1 Action potential and If current from sinus node cell…………..………………..7
1.2 Structural model of HCN channel……………………………..……………….20
1.3 A model of LA block of Nav1.4 channel…………….…..……………………..32
1.4 ESC derived spontaneous beating CMs……..………………………………….44
2.1 MEA system…………………………………………………………………….77
3.1 Representative spontaneous APs during culture……………………………….86
3.2 Time-dependent change of firing rate and MDP/RMP……………..……….…87
3.3 Time-dependent change of APD and maximum AP upstroke velocity………..90
3.4 Time-dependent change of phase 4 depolarization slope and TOP………........91
3.5 Representative If current recordings during culture………………..……..........92
3.6 If current density and activation curve during culture……….………………...93
3.7 Representative IK1 current trace during culture……...………………………….96
3.8 IK1 current density and activation curve during culture………..………………97
3.9 Correlations between IK1 current density and
MDP/RMP, APD or firing rate…………………………………..98
3.10 Representative MEA recordings during culture…………………………….100
3.11 Summary of MEA recording parameters……………….….………………..101
3.12 Color-coded activation maps from a representative culture…………………107
4.1 Schematic diagram and sequence alignment of the HCN1 and Kv channels….110
4.2 Representative recording of WT HCN1………………….………………..…114
xvii
4.3 Representative recordings of Ala-substituted constructs……………………..118
4.4 Immunostaining of dysfunctional channel proteins……………...…………...119
4.5 The effects of Ala-substitutions on ZD7288 block of the HCN1 channel...….121
4.6 Summary of the effects of Ala-substitutions on ZD7288 block…………...…122
4.7 Time courses of the development of
onset and offset of ZD7288 block of WT……………..……………124
4.8 Time courses of ZD7288 block of C347A……………………………………125
4.9 Time courses of ZD7288 block of S357A…………………………………….126
4.10 Time courses of ZD7288 block of M358A…………………………..………127
4.11 Time courses of ZD7288 block of M377A………………………..…………128
4.12 Time courses of ZD7288 block of F378A………………………...…………129
4.13 Time courses of ZD7288 block of V379A………….……….………………130
4.14 Logarithmic plot of the reciprocal of kon versus koff…………………………131
4.15 Effects of Ala-substitution on HCN1 steady-state activation.…………….....135
4.16 Effects of Ala-substitution on HCN1 steady-state activation………..............136
4.17 Effects of Ala-substitution on HCN1 on activation kinetics.………………..137
4.18 A model of ZD7288 block of HCN channels.……………………………….141
5.1 Pluripotent immunostaining of undifferentiated mouse ESCs….……………157
5.2 Representative IKDR traces…………………………………………………….158
5.3 Current-voltage relationship and dose-response relationships of IKDR ……….159
5.4 If current in mESCs……………………………………………….……….. ...161
5.5 Expression of ion channel transcripts in mESCs probed by RT-PCR…….…..162
xviii
5.6 BrdU incorporation and MTT assays on mESCs…………………………….163
5.7 Pluripotent immunostaining of undifferentiated human ESCs………………165
5.8 IKDR in hESCs……………………………………… ………………………...167
5.9 Microarray analysis of pluripotent hESCs for ion channel genes………..……168
5.10 Expression of ion channel transcripts in hESCs probed by RT-PCR………..170
List of Tables
Tables
Page
3.1 The effects of Ala-substitution on ZD7288 block of the HCN1 channel……..132
3.2 Summary of steady-state activation properties
of WT and various ala-substitutions…………………………………….…….134
5.1 Mouse gene-specific primers for RT-PCR……………………………………153
5.2 Human gene-specific primers for RT-PCR……………………………………154
xix
CHAPTER 1
Wang Kai
Chapter 1
Introduction
1.1 Cardiac pacemaking
In human being, the heart beats about one hundred thousand times per day. The
rhythmic cardiac activation is modulated by sympathetic and parasympathetic nervous
system to meet the daily physiological demand. The normal cardiac rhythms originate
from the sinoatrial (SA) node of the heart, which is a specialized cardiac tissue
consisting of a few thousand pacemaker cells that generate spontaneous action
potentials (SAPs). The spontaneous electrical activities subsequently spread through
the surrounding atrium and then into the atrioventricular node before proceeding into
the ventricular conduction system to induce coordinated ventricular contractions for
maintenance of circulation. Malfunctions of pacemaker cells due to diseases or aging
can lead to various forms of cardiac arrhythmias.
1.1.1 Structure of SA node
In human heart, SA node lies directly beneath the epicardium at the edge of right
atrium, bounded by the superior and inferior vena cava and adjacent to the crista
terminalis (Dobrzynski et al., 2007). The nodal cells surround a centrally located
nutrient artery and mixed with connective tissue consisting of collagen and fibroblasts.
Functional studies revealed that SA node is actually a heterogeneous tissue with a
1
CHAPTER 1
Wang Kai
gradient structure from the periphery to the center (Boyett et al., 2003). Normally,
only a small portion of pacemaker cells in the center of SA node acts as the leading
pacemaker site. The function of the peripheral zone is to conduct the electrical
activities from the center to the surrounding atrial myocytes. This structural
complexity is crucial for the function of SA node.
1.1.2 Mechanisms of pacemaking
Isolated SA nodal cells are spindle- or spider-shaped and characterized by an irregular
profile in cross Section (Boyett et al., 2000). These cells show a unique action
potential with slow phase-4 diastolic depolarization (Figure 1.1). In contrast to the
surrounding atrial cardiomyocytes (CMs) which maintain a stable resting membrane
potential following the repolarization, the pacemaker cells slowly depolarize with a
nearly constant slope to the threshold to initiate the SAP. This pacemaker activity is
the result of a number of different voltage- and time- dependent inward currents and is
facilitated by the decay of outward currents (Dobrzynski et al., 2007).
The outward currents in SA node primarily consist of a slowly activated (IKs) and a
rapidly activated (IKr) delayed rectifier potassium (K+) currents. Activation of IKs and
IKs currents lead to repolarization, and adjust the maximum diastolic potential (MDP)
after each action potential. They also determine the action potential duration (APD)
and thus control the firing rate of the SA node. After repolarization, the IKr and IKs
slowly deactivate to facilitate the phase-4 diastolic depolarization by “uncovering”
2
CHAPTER 1
Wang Kai
inward current (Irisawa et al., 1993). Another important outward current at
depolarized membrane potential is the inward rectifier K+ current (IK1). It is
responsible for the repolarization and stabilization of the resting membrane potential
(RMP). This current is absent in the SA node cells which makes the membrane
potential unstable after repolarization and facilitate the diastolic depolarization
(Dhamoon et al., 2005).
On the other hand, the contributions of inward currents to the pacemaker activity in
SA node cells remain controversial (Irisawa et al., 1993; Satoh, 2003; Dobrzynski et
al., 2007). In the center of the SA node, sodium (Na+) current (INa) is generally absent.
But it is present in the periphery of SA node and may be responsible for the
conduction of action potential to the surrounding atrial myocytes (Kodama et al.,
1997). The upstroke of the action potential in the center of the SA node depends
almost exclusively on L-type calcium (Ca2+) current (ICa,L), as manifested by a slow
phase-0 depolarization. Blockade of ICa,L completely abolishes the action potential in
the center of the node. As the activation threshold of ICa,L is about -40 mV, which is
much more positive than the maximum diastolic potential (MDP) of nodal cells (about
-60 to -75 mV), it contributes little to the phase-4 diastolic depolarization (Kodama et
al., 1997). In contrast, the T-type Ca2+ current (ICa,T) activates at about -50 mV and
inactivates between -40 and -90 mV, and is suggested to be involved in the second
half of the phase-4 diastolic depolarization for SA node pacemaking (Hagiwara et al.,
1988).
3
CHAPTER 1
Wang Kai
Recently, activation of another inward current, the Na+-Ca2+ exchange current (INCX)
has also been proposed to underlie and regulate the pacemaker activity (Vinogradova
et al., 2005). During diastolic depolarization, influx of Ca2+ via the ICa,T may activate
ryanodine receptors (RyRs) to induce releasing of Ca2+ from the sarcoplasmic
reticulum (SR). This elevation of cytosolic Ca2+ levels can in turn activate INCX to
exclude Ca2+ from the cytoplasm. Indeed, blocking or depleting the Ca2+ release
through RyRs can reduce the firing rate of SA node cells. Furthermore, other inward
current including sustained inward current (Ist), ACh-activated K+ current (IK,ACh),
ATP-sensitive K+ current (IK,ATP), ATP-sensitive cationic current, and stretch-activated
anion current have also been shown to be present in the SA node and may also affect
pacemaking (Irisawa et al., 1993).
Compared with these inward currents mentioned above, funny current (If) as used in
this thesis (Brown et al., 1979); hyperpolarization current (Ih) as described in nervous
system (Yanagihara et al., 1980) or queer current (Iq) (Halliwell et al., 1982) may play
a predominant role in the initiation and control of phase-4 diastolic depolarization.
This current was first characterized by Brown et al. in SA node cells about 27 years
ago (Brown et al., 1979; Brown et al., 1980). It has been identified in cardiac
Purkinjie fibers (DiFrancesco, 1981b; DiFrancesco, 1981a), atrial (Zhou et al., 1992;
Zhou et al., 1993; Porciatti et al., 1997; Hoppe et al., 1998a; Zorn-Pauly et al., 2004)
and ventricular (Yu et al., 1993; Cerbai et al., 1994; Yu et al., 1995) myocytes and a
wide variety of neuronal and non-neuronal cells (see review (Pape, 1996; Luthi et al.,
4
CHAPTER 1
Wang Kai
1998)). Due to this widespread distribution and potential important physiological role
of If current, it has attracted constant interests from scientists since its initial discovery.
The physiological properties, structure-functional relationships on molecular basis as
well as therapeutic applications of If will be discussed below.
1.2 Physiological properties of pacemaker currents
1.2.1 Biophysical properties of pacemaker currents
As described in detail previously, (DiFrancesco, 1993; Pape, 1996), the pacemaker
current If process several unique properties including hyperpolarization-induced
activation, slow kinetics of activation and deactivation, Na+ and K+ ionic nature and
modulation by cyclic adenosine monophosphate (cAMP).
1.2.1.1 Voltage dependence
Unlike most of the other members of the voltage-gated channel superfamily, If is
activated by hyperpolarization rather than by depolarization. As shown in Figure 1.1B,
the first instantaneous current starts after the hyperpolarizing voltage steps negatively
toward the activation threshold. Then the inward current turns on with a delay and
slowly increases to a steady state, resulting in a characteristic sigmoidal shape of the
current waveform. The delay is voltage dependent and decreases with a more negative
membrane potential. The slow inward current following the delay is a function of
voltage and time: the rate of activation and the amplitude of current increased with
5
CHAPTER 1
Wang Kai
more negative values of the membrane potential. There is no decrement of the current
until termination of the hyperpolarizing voltage steps, indicating a lack of
inactivation.
Typically, this inward current is activated from a threshold of about -40 to -50 mV and
become fully activated at about -100 mV in pacemaker cells. The voltage-dependence
of If activation can be assessed by tail current activation curves, in which the
amplitude of the tail current upon return to a fixed holding potential is plotted against
the hyperpolarizing potential step used to activate the current (Figure 1.1C). These
activation curves show a typical sigmoidal dependence on hyperpolarizing potential.
They can be well fitted by Boltzmann function, and provide estimation of the voltage
at which the channels are half-maximally activated (V1/2).
Typical V1/2 of If in the SA node cells are in the range of -60 to -70 mV at 37°C,
although some more positive and more negative values are reported. Actually, even
within the SA node area, the voltage range for If activation varies from cell to cell, and
shifts to more negative levels when moving from the central to the peripheral zone.
These findings suggest the presence of phenotypic and functional heterogeneity of
tissue within this cardiac region (Boyett et al., 2000).
As the MDP of nodal cells is about -60 to -75 mV, the activation range of If overlaps
with the diastolic depolarization. This implies that activation of the If current after the
6
CHAPTER 1
Wang Kai
A
B
C
Fig. 1.1 A, AP of a swine SA node cell. If current; ICa,T and ICa,L, T-type and L-type
Ca2+ current; INCX, Na+-Ca2+ exchange current; IKr and IKs, rapidly and slowly
activated delayed rectifier K+ currents contribute to different phases of AP. No IK1
expression in SA node cell. B, representative recording of If current using the voltage
protocol provided in the inset. Activation tail currents are enclosed in box and
magnified to the right. C, steady-state activation relationship based on the tail current
of (B).
7
CHAPTER 1
Wang Kai
termination of an action potential can contribute to phase-4 depolarization. In Purkinje
fibers, and atrial and ventricular myocytes, the biophysical properties of If are similar,
except that the positions of their activation curves shifted to more negative potentials
with respect to nodal cells (DiFrancesco, 1981b). For instance, the activation
threshold and V1/2 of If current in adult ventricular myocytes is -120 mV and -150 mV,
respectively (Cerbai et al., 1996; Ranjan et al., 1998), suggesting the lack of
functional role of If in these tissue during physiological conditions.
Moreover, the expression of If in the working CMs changes with the developmental
stage and in pathological conditions. In neonatal rats, If is expressed at significant
levels and is activated at physiological voltages, but its function is lost with adulthood
(Robinson et al., 1997). On the other hand, in an animal model of cardiac hypertrophy
(spontaneous hypertensive rats), adult If expression increases substantially relative to
control animals (Cerbai et al., 1996). These differences can be partly explained by the
different molecular determinants of If channels distributed in different cardiac regions
as discussed below.
1.2.1.2 Ion selectivity
The If is a peculiar mixed cation current carried by Na+ and K+ ions, with a Na+/ K+
permeability ratio ranging from 0.2 to 0.4, yielding values for the reversal potential of
-20 to -40 mV. Although If channels conduct both K+ and Na+, they are not
non-selective, and are almost impermeable to other monovalent cation, such as Li+
8
CHAPTER 1
Wang Kai
and can be blocked by millimolar concentrations of Cs+. The conductance of If
channel is highly sensitive to external K+ level and dependent on external Clconcentration. Similar to other K+ permeable channels, increasing or decreasing
external K+ concentration will dramatically alter the current amplitude without
affecting the reversal potential and steady-state voltage dependence. Furthermore, If
channel also has a very small single channel conductance. Even with an elevated
external K+ level, channel conductance is only 1 pS, hampering the single channel
study.
1.2.1.3 Autonomic regulation
One of the most important features of If current is its regulation by neurotransmitters.
In both SA node cells and some neurons, sympathetic stimulation by adrenaline or
other agonists of β-adrenergic receptors shifts the voltage-dependence activation
curve by up to +10 mV without influence on the steepness of the curve of
current-voltage relation. As a result, during a hyperpolarizing step to a given voltage,
If current activates more completely and rapidly.
It is well known now this modulation of If is mediated by activation of the receptors
which positively coupled to the adenylyl cyclase (AC) via Gs protein and a resulting
increase of intracellular cAMP level. Moreover, nitric oxide (NO) can also induce a
positive shift of activation curve through direct stimulation of guanylyl cyclase (GC)
activity, which leads to an increase of intracellular cyclic guanosine monophosphate
9
CHAPTER 1
(cGMP) level
Wang Kai
(Dawson et al., 1994). By contrast, parasympathetic stimulation by
acetylcholine or other agonists of muscarinic receptors decreases the intracellular
cAMP level by Gi-protein-dependent inhibition of AC and thus negatively shifts the
activation curve by up to -10 mV in a way exactly opposite to that of sympathetic
stimulation (DiFrancesco et al., 1988).
Unlike L-type Ca2+ current, the modulation of If by cAMP and cGMP does not depend
on the channel protein phosphorylation by protein kinase but is mediated by the direct
binding of cAMP and cGMP to the cytoplasmic side of the channel (DiFrancesco et
al., 1991; Ludwig et al., 1998). The binding affinity for cGMP is much less than that
for cAMP. Thus, the channel underlying If combines features of both voltage-gated
channels and cyclic nucleotide-gated (CNG) channels.
1.2.2 Contribution of pacemaker current to automaticity
There are several evidences to support the notion that If may play an important role as
a primary pacemaker current in SA nodal cells and Purkinje fibers in the heart.
First, the actual ionic and kinetic properties of If described above are particularly
appropriate for the generation of the slow diastolic depolarization in the pacemaker
range of voltages.
Second, the expression of If correlates with the presence of spontaneous activity in
10
CHAPTER 1
Wang Kai
both adult pacemaker cells, and developing ventricular myocytes. In adult mammalian
heart, SA node or atrioventricular (AV) node cells display automaticity as well as
robust If current expression, while normally quiescent working myocytes in atrium
and ventricle do not express If at physiological voltages. In neonatal rat ventricular
myocytes which show spontaneous activity, If is activated at a more positive
physiological voltages than resting adult ventricular myocytes (Robinson et al., 1997).
Similar relationships have been observed in chicken and mouse embryonic ventricular
myocytes during developing (Satoh et al., 1993; Yasui et al., 2001). Furthermore, this
correlation was further supported by studying the influence on cell automaticity by
enhancing or suppressing If channel expression in fetal or neonatal rat ventricular
myocytes (Er et al., 2003; Qu et al., 2004).
Third, If current is modulated by autonomic input suggesting its pivotal role in heart
rhythms generation and control. It is well known the sympathetic and parasympathetic
stimulation accelerate and decelerate heart rate through β-adrenergic and cholinergic
receptors, respectively. This regulation of heart rate is largely mediated by
cAMP-dependent modification of voltage dependence and kinetics of If current as
discussed above. More recently, defects in the cAMP binding domain of human If
channel have been reported to be associated with idiopathic and familial SA nodal
dysfunction. These findings provide further support on the pacemaking role of If
current in human (Schulze-Bahr et al., 2003; Milanesi et al., 2006).
11
CHAPTER 1
Wang Kai
Finally, clinical studies have demonstrated that blockage of If with specific If blockers,
such as ZD7288 and ivabradine reduce heart rate in a dose-dependent manner (Borer
et al., 2003; Yusuf et al., 2003). This also provides indirect evidence to prove the
contribution of If to automaticity of human heart rhythm. This aspect is further
discussed in the following Section.
Furthermore, even in quiescent cells without spontaneous automaticity, such as adult
atrial and ventricular myocytes, If also contributes to the resting membrane potential
and thus regulates their excitability.
Nevertheless, there are still some controversies about the dominant role of If in
pacemaking due to its intrinsically slow kinetics and negative activation relative to the
time scale and voltage range of cardiac pacing (Satoh, 2003). Furthermore, a number
of other currents, including T-type Ca2+ current, sustained inward current, ryanodine
receptor-mediated Na+/Ca2+ exchange current, and Na+-dependent background current
as mentioned previously may also contribute to SA node slow diastolic depolarization,
(Irisawa et al., 1993; Zhang et al., 2000; Satoh, 2003; Vinogradova et al., 2005). The
contributions of these currents may vary with status of development and animal
species (Baruscotti et al., 1996; Ono et al., 2003).
More recently, Eduardo and He Cheol proposed a novel theory explaining the pace
maker activity of SA node cells (Eduardo et al., 2007). They suggested that the crucial
12
CHAPTER 1
Wang Kai
factor for pacing is the absence of the strongly polarizing IK1, rather than the presence
of special channels carrying inward current, such as If current. Inward rectifier K+
current (IK1) stabilizes a strongly negative resting potential and thereby suppresses
excitability. is suggested to act as a opponent of If current to Replacement of three
critical residues in the pore region of IK1 encoding gene Kir2.1 by alanines
(Kir2.1AAA)
creates
a
dominant-negative
construct
(Herskowitz,
1987).
Proof-of-concept evidence was provided by suppressing the IK1 current in guinea pig
ventricular myocytes in a dominant-negative manner by transducing cell with
Kir2.1AAA construct (Miake et al., 2002). In this study, suppressing IK1 was proved
to induce idioventricular rhythms in the hearts of the treated guinea pigs. And action
potential recordings from myocytes isolated from these hearts demonstrated phase 4
depolarization and rapid automatic rates. It seems that suppression of IK1 current
unleashes the latent pacemaker activity within adult ventricular myocytes that
normally masked by the IK1 current.
Taken together, due to the physiological importance of pacemaker activity and its
profound modulatory control, more thorough investigation and detailed analysis on
the fundamental operating mechanism of If and its interaction with IK1 current are
required.
13
CHAPTER 1
Wang Kai
1.3 Structure-function properties of pacemaker channels
1.3.1 Molecular basis of pacemaker currents: HCN gene family
Despite the recognition of If for over 20 years, the encoding gene family which is
known as the hyperpolarization-activated, cyclic nucleotide-gated (HCN) has only
been cloned in the late 1990s (Clapham, 1998; Biel et al., 1999). To date, four
mammalian HCN isoforms (HCN1–4) have been identified and characterized. Each of
the isoform has unique tissue distribution, pattern of expression, and functional
properties.
HCN1 is the most abundant isoform in brain (Ludwig et al., 1998; Santoro et al.,
1998). It is also substantially expressed in the SA node and detectably expressed in
Purkinje fibers (Shi et al., 1999), but not in the ventricles or atrium of the heart.
Similarly, HCN2 and HCN4 are also found in brain as well as various heart tissues. In
contrast, HCN2 is the predominant isoform in atrial and ventricular myocytes, and is
secondary to HCN4 in SA node, but has low expression in Purkinje fibers (Ludwig et
al., 1999b; Moosmang et al., 2001). On the other hand, HCN4 is the most abundant
isoform expressed in SA node in all species, and has moderate expression in the
Purkinje fibers and ventricular myocytes (Shi et al., 1999; Moosmang et al., 2001;
Han et al., 2002). HCN3 is found exclusively in the brain at significantly lower levels
than the other three subtypes (Baruscotti et al., 2004).
14
CHAPTER 1
Wang Kai
When HCN channel is heterologously expressed in cell culture, such as HEK293 cells,
each HCN isoform generates a current displaying the typical features of native If,
including activation by hyperpolarization, conduction of Na+ and K+, modulation by
cyclic nucleotides and block by cesium (Cs+), suggesting that the native If channel is
composed of HCN isoforms. Nevertheless, the currents produced by the four different
isoforms differ in their activation kinetics, voltage dependence of activation, and
extent of cAMP modulation: HCN1 displays the fastest kinetics with activation time
constant (τact) between 30 and 300 ms at potentials ranging from -140 to -70 mV
(Santoro et al., 1998); HCN2 and HCN3 have intermediate activation kinetics (τact of
200 to 500 ms at -140 to -100 mV) (Ludwig et al., 1998; Ludwig et al., 1999b;
Moosmang et al., 2001); and HCN4 activates significantly slowly (τact of 300 ms to 30
s at -150 to -70 mV) (Ishii et al., 1999; Ludwig et al., 1999b; Seifert et al., 1999).
Furthermore, the activation kinetics also strongly depends on the temperature.
A wide range of variation exists in the reported voltage dependence of each channel
which is partly due to the different pulse protocols used in different studies (Seifert et
al., 1999). In general, the V1/2 values of the four HCN isoforms determined under
identical conditions vary by no more than 20 mV. HCN2 has the most negative V1/2.
The typical values of the V1/2 for HCN1, HCN2 HCN3 and HCN4 at 37℃ are -73, -92,
-77 and -81mV, respectively, when expressed in HEK293 cells (Accili et al., 2002;
Stieber et al., 2005). Furthermore, the properties of individual HCN isoforms may
also vary when expressed in different cells types. For example, overexpression of
15
CHAPTER 1
Wang Kai
HCN2 or HCN4 isoforms in neonatal rat ventricular myocytes leads to currents whose
activation curves are about 16 to 19 mV more positive than those resulting from
expression of the same isoforms in HEK293 cells. Nevertheless, the curves for HCN2
in both cell types are 9 to 11 mV more negative than that for HCN4 (Qu et al., 2002).
These data, suggest that for each HCN isoform, the voltage dependence of channel
activation, and the voltage range where the channel can contribute to activity, is under
control by a "context-dependent" mechanism.
Like native If current, cAMP activates HCN channels by shifting the activation curve
to more positive voltages. However, each HCN channel has different responsiveness
to cAMP. HCN1 is only minimally responsive to cAMP by +4.3 to +4.8 mV. In
contrast, the activation curves of HCN2 and HCN4 are strongly shifted by +10 to +30
mV (Seifert et al., 1999; Moroni et al., 2001; Viscomi et al., 2001; Wainger et al.,
2001; Wang et al., 2001). Interestingly, mouse and human HCN3 channels seem to be
modulated by neither cAMP nor cGMP (Mistrik et al., 2005; Stieber et al., 2005). The
mechanism underlying the diversity of cyclic nucleotide modulation on different HCN
channels remains largely unclear.
Given the diversity of native If in different cell types and developmental stages, it is
alluring to relate the cellular heterogeneity to the molecular composition of the
channel. The presence of HCN channels in different types of heart cells is compatible
with the description of If current in SA node cell, atrial and ventricular myocytes. For
16
CHAPTER 1
Wang Kai
instance, slow activation and voltage dependence of native If in SA node is consistent
with the expression of HCN4. Nevertheless, native If current actually exhibits greater
diversity than the expressed isoforms. The V1/2 of If in ventricular myocytes ranges
from -95 to -135 mV (Yu et al., 1995; Cerbai et al., 1997; Hoppe et al., 1998b) which
is much more negative than that those in the SA node (-65 to -90 mV) (Denyer et al.,
1990; DiFrancesco et al., 1991; DiFrancesco et al., 1994), and can not be simply
explained by differences of HCN isoforms distribution. Although the detail
mechanism remains obscure, several clues including heteromerous composition of the
channel, intracellular modulation by auxiliary subunits such as MiRP1 or scaffold
proteins such as filamin A, and subcellular compartmentation have been postulated to
explain this phenomena (Baruscotti et al., 2005).
1.3.2 Structure-function relationships of pacemaker channels
Based on the amino acid sequence, HCN channels are classified as members of
voltage-gated K+ (Kv) channels superfamily, and distantly related to the cyclic
nucleotide gated (CNG) channel and the ether-à-go-go (ERG) K+ channel family. Like
Kv channels, HCN channels contain six transmembrane segments (S1–S6) including a
positively charged S4 segment constituting the voltage sensor (Figure 1.2). An
ion-conducting pore lies between S5 and S6 with GYG signature motif which is
highly conserved among K+-permeable channels. In the C-terminal region they
contain a cyclic nucleotide binding domain (CNBD) which is homologous to that of
CNG channels.
17
CHAPTER 1
Wang Kai
Amino acid sequence alignment reveals that the four HCN isoforms are closely
related to each other and have an overall sequence identity of about 60%. The
homology is highest in the central core region (transmembrane segments plus CNBD)
with a sequence identity of 80 to 90%. In contrast, the N- and C-terminus diverge
considerably in their length and share only modest homology, these differences may
responsible for some of the differences in the biological properties among isoforms
(Viscomi et al., 2001).
Analogous to CNG and Kv channels, HCN channel seems to have a tetramer
composition. Xue et al (2002b) provided the first experimental evidence to
demonstrate a pore mutant of HCN1 can suppress co-expressed wild-type (WT)
HCN1 in a dose-dependent dominant negative manner (Xue et al., 2002b). The
tetramer composition of HCN was further confirmed by the use of solved X-ray
crystal structure of HCN2 channel fragment (Zagotta et al., 2003). Although four
HCN isoforms can be functionally expressed as homomers, different HCN isoforms
can heteromerize in vitro (Chen et al., 2001b; Ulens et al., 2001; Xue et al., 2002b),
which greatly increased the molecular diversity of the native currents in different
tissues.
1.3.2.1 Structural determinants of voltage dependence
Although HCN sequences are quite similar to that of Kv channels in the positively
charged S4 voltage-sensing segment, they open on hyperpolarization rather than
18
CHAPTER 1
Wang Kai
depolarization as in the Kv channels. The most likely possibility is the coupling
between S4 movement and the activation gate is opposite in these two kinds of
channels. In the substituted cysteine accessibility experiments, hyperpolarization
induced an inward movement of the S4 segment in HCN channels as in Kv channels,
suggesting a conserved voltage-sensing mechanism. Neverthless, they have different
coupling mechanisms between the S4 and activation gate in HCN and Kv channels
(Mannikko et al., 2002; Sesti et al., 2003; Vemana et al., 2004).
Although detailed mechanism that underlies the coupling of these conserved S4
movements with the opposite gating behavior of HCN channels remains obscure,
there are evidences supporting the involvement of S4–S5 linker. Using
alanine-scanning mutagenesis, interactions between S4–S5 linker and C linker (a
region C-proximal to S6) through salt bridge has been proved to mediate the coupling
between voltage sensing and activation gating in both human ether-à-go-go related
channel (hERG) and HCN channels (Chen et al., 2001a; Tristani-Firouzi et al., 2002;
Decher et al., 2004; Ferrer et al., 2006). Interestingly, a point mutation in the hERG
channel S4–S5 linker (D540K) is able to induce reversed voltage-dependent
activation (Sanguinetti et al., 1999). More recently, Yellen et al demonstrated
cross-linking S4-S5 linker and C linker with high-affinity metal bridges or disulfide
bridges dramatically alters channel gating in the absence of cAMP and reversed the
channel to depolarization activated (Prole et al., 2006).
19
CHAPTER 1
Wang Kai
Fig 1.2 Structural model of HCN channel. The channel displays several functional
parts: the transmembrane core region consisting of the six transmembrane segments
(S1–S6) and the ion-conducting pore loop (P-loop) between S5 and S6; voltage sensor
of the channel formed by positively charged S4; the modulatory C terminus
containing the C linker and the cyclic nucleotide-binding domain (CNBD).
20
CHAPTER 1
Wang Kai
Besides the interaction between S4-S5 linker and C-linker, both the length and
composition of the S3-S4 linker prominently influence the gating of HCN gating
(Henrikson et al., 2003; Lesso et al., 2003; Tsang et al., 2004). At four position in
S4-S5 linker of HCN1 channel: K230A (-62.2 vs. -72.2 mV of WT), G231A (-64.4
mV), M232A (-63.1 mV), and E235G (-65.4), substitutions of alanine can shift the
activation curve to depolarizing direction. Multiple substitutions of E235 have
identified that the composition of the S3-S4 linker affect the activation gating via
changes in surface charge. Furthermore, shortening of the S3-S4 linker shifts the
steady-state activation in the depolarizing direction (e.g. V1⁄2>+10 mV vs. WT),
whereas prolongations of the linker produce length-dependent progressive
hyperpolarizing activation shifts (-35 mV < ∆V1⁄2 < -4 mV).
1.3.2.2 Structural determinants of activation gate
Despite the opposite voltage dependence gating, HCN and Kv channels have
significant similarity in the sequence of the pore and the voltage-controlled gate. In Kv
channels, a cytoplasmic gate is present at the intersection of the S6 helix bundles. As
demonstrated by site-directed mutagenesis, state-dependent cysteine modification and
X-ray crystal structure studies, this gate opens upon depolarization by bending S6
helix at the proline-valine-proline (PVP) motif sequence (Tombola et al., 2006).
In HCN channels, a similar activation gate also appears to exist in the intracellular
side of the channel (Chen et al., 2002). Shin et al (2001) demonstrated that the
21
CHAPTER 1
Wang Kai
specific HCN channel blocker- ZD7288 which applied from the intracellular side of
the channel can enter and leave the pore of mHCN1 channel only at voltages where
the activation gate is open. This suggests that the binding site of ZD7288 locates in
the inner pore vestibule and guarded by the activation gate. This speculation was
further supported by the observation that HCN cloned from sea urchin which gate the
flow of cations, such as Cd2+ also located in the S6-formed pore lining (Rothberg et al.,
2002; Rothberg et al., 2003). Thus, the sequence similarity between Kv and HCN
channels likely extends to structural similarity at activation gate.
However, as in Kv channels (Yellen, 1998; Roux, 2005), the intracellular activation
gate may not be the only region that can control ion flux through HCN channels. An
N-terminal “ball and chain” (N-type inactivation) and a constriction of the
extracellular side of the selectivity filter (C-type inactivation) can also prevent
permeation through the pore (Yellen, 1998; Bezanilla, 2000). Previous studies (Xue et
al., 2002a; Azene et al., 2005a) have shown that external pore vestibule and activation
gate of HCN channels may be allosterically coupled in a manner analogous to C-type
and slow inactivation of Kv and Nav channels, respectively. Furthermore, the HCN
gating is strongly affected by changes in extracellular K+ concentrations (Azene et al.,
2003), suggesting the selective filter may also be involved in gating. It is plausible that
the K+ binds within the selectivity filter and this binding is energetically coupled to the gating
+
mechanism. In this notion, selectivity filter may control K movements through the pore
allosterically (Yellen, 1998).
22
CHAPTER 1
Wang Kai
1.3.2.3 Structural determinants of ion selectivity
The ion selectivity of heterologously expressed HCN channels is in agreement with
that of native If channels. In Kv channels, the pore region is localized between the S5
and S6 segment and consists of a pore helix and the selectivity filter (Doyle et al.,
1998). The signature sequence, glycine-tyrosine-glycine (GYG), highly conserved in
K+ permeable channels, forms the main part of the selectivity filter. All the carbonyl
oxygen from the backbone of this sequence form the narrowest part of the pore which
prohibits pass of other ion particles (Heginbotham et al., 1994; Doyle et al., 1998).
Sequence alignment shows that HCN channels also contain a GYG sequence and is a
critical determinant for ion permeation of HCN channels. Previous studies have
demonstrated that replacing GYG triplet in HCN1 with alanines (HCN1-AAA)
disrupts ion permeation of the channel. Furthermore, coexpression of HCN1-AAA
with WT HCN1 or HCN2 suppressed normal channel activity in a dominant-negative
manner without affecting gating or permeation properties (Xue et al., 2002b). Since
HCN channels are relatively non-selective for monovalent cations (Na+:K+
permeability ratio = 1:10 vs. ≤ 1:100 for Kv channels), it has been postulated that
variant residues flanking the GYG triplet may contribute to this difference (Santoro et
al., 1999; Kaupp et al., 2001). These variances may make HCN channels less rigid in
the carbonyl backbone to allow permeation of both K+ and Na+.
Although Na+ constitutes the major inward cation current in HCN channels at
23
CHAPTER 1
Wang Kai
physiological membrane potentials, it is the K+ that regulates the conduction of the
channel. Both the current amplitude and the ratio of permeability of Na+/K+ of HCN
channels depend on the extracellular K+ concentration (Robertson et al., 1992;
Wollmuth et al., 1992). In the absence of extracellular K+, the conduct of Na+ is
abolished entirely. These findings suggest that HCN channels are a multi-ion pore
possessing at least two cation binding sites: one at the external mouth of the channel
having a higher affinity for K+ and another having a higher affinity for Na+ (Wollmuth,
1995).
Conduction of HCN channels is also regulated by external Cl- suggesting the pore of
HCN channels is likely to contain an extracellular Cl- binding site allosterically
coupled with activation gate (Santoro et al., 1998). This notion is supported by a
recent finding that replacing a single alanine residue C-proximal to GYG motif of
HCN1 by analogous arginine in HCN2 switches the Cl- dependence from HCN1- to
HCN2-type (Wahl-Schott et al., 2005).
1.3.2.4 Structural determinants of cyclic nucleotide modulation
Cyclic nucleotides regulate If current by directly binding to a CNBD of each subunit
at intracellular side with a higher affinity to the open than the closed state (Varnum et
al., 1995; DiFrancesco, 1999; Matulef et al., 1999; Wainger et al., 2001). CNBD
locates in the C-terminus and is connected to S6 via a region termed the C-linker
(Zagotta et al., 2003). The C-linker appears to be responsible for subunit-subunit
24
CHAPTER 1
Wang Kai
interactions and have an inhibitory effect on gating of HCN channel. Deletion mutants
in the CNBD, or C-linker and CNBD positively shift the activation curve of If current,
similar to WT channels in the presence of cAMP (Wainger et al., 2001). In
combination with the recently solved crystal structure of intracellular part of HCN2
channel (Zagotta et al., 2003), these results suggested that binding of cAMP to the
CNBD initiates a conformational change in the C-linker, which is transmitted to the
gate of HCN channel and relieves the inhibitory effect of C-linker on activation gating.
This results in the shift of the channel distribution equilibrium towards the open state.
Based on this notion, the diversity of cAMP sensitivity of HCN isoforms can be
simply explained by the different basal inhibitions of the C-linker on gating for HCN
isoforms.
1.4 Therapeutic applications of pacemaker channels
The finding that If controls automaticity of SA node cells provides a potential target to
modulate heart rate and function by pharmacological or genetical means. Bradycardic
drugs that selectively block HCN channels and HCN gene-based therapy thus have
attracted tremendous research interests.
1.4.1 Pacemaker channels targeted bradycardic agents
Moderate reduction of heart rate is therapeutically beneficial in a variety of
cardiovascular conditions including sinus tachyarrhythmias, chronic ischemic heart
disease, and heart failure. A lower heart rate decreases oxygen demand and improves
25
CHAPTER 1
Wang Kai
myocardial perfusion by prolonging diastole. Currently available pharmacological
interventions aimed to reduce heart rate rely on β-adrenergic blockers and/or L-type
Ca2+ channel antagonists. Unfortunately, in addition to reducing cardiac
chronotropism, these drugs also induce side effects, typically a substantial reduction
of the contractile force of working myocardium (negative inotropism) due to
inhibition of Ca2+ entry. By contrast, specifically blocking If current will only reduce
diastolic depolarization slope in pacemaker cells resulting in slowing of hear rate
without interfering cardiac performance. As a result, “pure bradycardic” drugs that
target If channel have been intensively investigated since initial discovery of this
channel.
In the last few years, substances able to act as specific blockers of If current have been
developed. These molecules, namely heart rate-lowering agents, have been proved to
induce rate slowing without the inotropic side effect (DiFrancesco, 2005). Such
substances include alinidine, zatebradine (UL-FS49), cilobradine (DK-AH26),
falipamil (AQ-A39), ZD7288 and ivabradine. The properties of ZD7288 and
ivabradine will be discussed in detail as these drugs have been used in this project to
characterize HCN channel structural and functional properties.
1.4.1.1 ZD7288
Early experiments performed on isolated beating atrium with intact SA nodal tissue in
guinea pig and dog have showed that ZD7288 can reduce heat rate without interfering
26
CHAPTER 1
Wang Kai
the contractile force in a dose dependent manner. When ZD7288 was applied to
isolated guinea pig SA node cells, it negatively shifted the activation curve and
decreased the maximal conductance of If current in a dose-dependent manner, and
only slightly affected the Ca2+ and delayed rectifier K+ current (BoSmith et al., 1993).
At higher concentration, ZD7288 also blocks If in various of neurons (Baruscotti et al.,
2005) which limited its use as a specific heart rate-reducing agent. Furthermore,
clinical trials on human volunteers showed that ZD7288 was also "arrhythmogenic",
which resulted in termination of ZD7288 development (Yusuf et al., 2003).
On the other hand, due to its specific effect on If current, ZD7288 is now widely used
as a pharmacological tool in studying the HCN channel. As ZD7288 blocks HCN
channel from the intracellular side, it has also been used to locate the activation gate.
When applied from the extracellular side, the blockade of If current by ZD7288 will
take more than ten minutes to plateau (BoSmith et al., 1993; Harris et al., 1995;
Gasparini et al., 1997). Early studies suggested ZD7288 blocked If in a use- or
frequency-independent way in which the blockade of current doesn’t require opening
of the channel. However, using inside-out patch clamp technique, it has been shown
that ZD7288 can enter and exit the pore only at voltages when the activation gate is
open (Shin et al., 2001; Rothberg et al., 2002; Rothberg et al., 2003). Their findings
indicate that the binding site of ZD7288 locates in the pore lining, and is guarded by
an intracellular activation gate formed by S6 segment. These results also implicate
that HCN channels share many similarities in the structure of pore forming region and
27
CHAPTER 1
Wang Kai
intracellular gate with voltage-gated K+ and Na+ channels (discussed in Section
1.4.1.2).
1.4.1.2 Ivabradine
Ivabradine (procoralan, Servier) is the only clinically available heart rate reducing
agent for treatment of chronic stable angina. Experimental studies in guinea pig
papillary muscles and SA node cells showed that ivabradine reduced diastolic
depolarization slope by specific block of If current, without any effect on
voltage-gated Ca2+ or delayed rectifier K+ current (Thollon et al., 1994; Bois et al.,
1996). Unlike ZD7288, it reduces the maximal conductance of If channel without
altering the voltage dependence of activation. Detailed analysis revealed that
ivabradine also blocks If channel from the intracellular side with higher affinity at
depolarized voltage than hyperpolarized one. The block and block removal of
ivabradine only occurred when the channels are open (Bucchi et al., 2002). A unique
feature of ivabradine not shared by other heart rate-lowering agents is that its block
removal requires an inward ionic flow rather than hyperpolarization itself. This
finding suggests that ivabradine blocks If current by entering the channels from the
intracellular side and competing with permeating ions in their binding to specific
ion-binding sites in the permeation pathway. Therefore it is defined as a
current-dependent open channel blocker. The validity of ivabradine for clinical use in
ischemic heart disease and cardiac failure has been carefully verified by both in vitro
and in vivo studies (DiFrancesco et al., 2004).
28
CHAPTER 1
1.4.2
Drug
Wang Kai
binding
mechanism
and
the
implications
in
structure-function relationship of the HCN channel
Specific blockers are available for most classes of ion channels and share many
similarities in the nature of drug-channel interaction. Site-direct mutagenesis,
pharmacology and crystallography studies have identified two general mechanisms of
block (Hille, 2002). In the first, the blocker binds within the pore and physically
obstructs the flow of ions. The other relies on an allosteric effect, i.e. binding of the
blocker to a site of the channel somehow stabilizes the closed conformational states of
the pore to prevent channel opening. In most cases, these two mechanisms may both
contribute and can not be distinguished clearly. On the other hand, according to the
side of blocking action relatively to the selectivity filter, the blockers can be classified
into two categories, i.e. acting from the extracellular side and acting from the
intracellular side.
1.4.2.1 Blocking of Na+ channel
Tetrodotoxin (TTX) and saxitoxin (STX) are well-known external blockers of Na+
channels. Because of their positive charge and polar nature, they are membrane
impermeant and thus act from the extracellular side (Yamaoka et al., 2006).
Mutagenesis studies demonstrated that the binding site for TTX and STX is formed
by the selectivity filter locus Asp-Glu-Lys-Ala (DEKA) and some residues
downstream (Catterall et al., 2007). It has been generally accepted that the toxins’
guanidine group binds to negatively charged residues in the pore narrowing and
29
CHAPTER 1
Wang Kai
physically obstructs the Na+ current.
By contrast, local anesthetics (LAs) such as lidocaine and procaine block Na+
channels from the intracellular side (Fozzard et al., 2005). These drugs usually have
an aromatic moiety (hydrophobic part) and an amine group (hydrophilic part). In the
neutral form, LAs can pass through the membrane and enter inner pore vestibule of
Na+ channel from the inside. Blocking Na+ channel by LAs is characterized by the
accumulated
inhibition
effect
with
repetitive
stimuli,
and
is
known
as
“use-dependent” (or frequency-dependent) property (Courtney, 1975). One well
accepted interpretation of use-dependent block is that both binding and leaving of the
drug from the receptor on the channel require channel opening, and the blockers can
be trapped by closure of the activation and inactivation gates (Fozzard et al., 2005).
Therefore, the binding of drug can obstructs Na+ flow and promotes the inactivation
of Na+ channel in an allosteric manner. As the result, the recovery from the
drug-bound state becomes slow, resulting in accumulation of block. This
use-dependent property is crucial for the antiarrhythmic and local anesthetic activities
of the LA drugs. Those drugs have little effect when the target Na+ channels are
quiescent or firing at a slow rate, but dramatic effect when the channels are active. An
elevated Na+ channel activity is typically observed in nerve fibers and CMs with
higher firing frequency under many pathophysiological conditions.
Since the S6 segments from each of the four domains of Na+ channel comprise lining
30
CHAPTER 1
Wang Kai
of the inner pore, LAs binding site are most likely to locate in the S6 segments. In the
last two decades, scientists have demonstrated that substitution of some amino acid
residues in S6 segments of Na+ channels could significantly decrease the affinity for
use-dependent blocking of LAs (Ragsdale et al., 1994; Ragsdale et al., 1996; Wang et
al., 1998; Wright et al., 1998; Nau et al., 1999; Wang et al., 2000; Yarov-Yarovoy et
al., 2001; Yarov-Yarovoy et al., 2002). These important residues are all located in the
middle of the channel pore, directly beneath the selectivity filter and in a relatively
wide part of the pore above the activation gate. Among them, the alanine substitution
of F1764 in S6 of domain IV of Nav1.2 (IVS6 F1764A) and equivalent mutations in
other isoforms (F1710 of Nav1.3 and F1579 of Nav1.4) can consistently produces a
dramatic reduction in LAs affinity of about 100-fold for use-dependent block. This
finding suggests that the phenylalanine residue is crucial to the inner pore binding of
LAs.
Based on these results, Fozzard et al. proposed a binding model of LAs to Nav1.4, the
skeletal muscle isoform of Na+ channel family (Figure 1.3) (Fozzard et al., 2005).
Four amino acid residues are proposed to form the LAs binding site inside the pore:
F1579 and Y1586 in S6 segment of domain IV, L1280 in S6 segment of domain III,
and N434 in S6 segment of domain I. The aromatic ring of F1579 forms the upper
cover of the binding site. The side chains of F1578 and L1280 locate in close
proximity to each other thus provide a narrow cavity to dock the amine group of LAs.
31
CHAPTER 1
Wang Kai
Fig 1.3 A model of LA block of Nav1.4 channel. Upper panel shows the structural
formula of etidocaine and group analysis. Lower panel shows etidocaine binds to the
receptor formed by F1579 and Y1586 in IV S6, L1280 in III S6, and N434 in I S6 in a
certain orientation.
32
CHAPTER 1
Wang Kai
The bottom of the site is formed by the side chains of Y1586 and N434. In addition,
the side chain of F1579 and K1237 of selectivity filter of domain III are also close to
each other and may bind charged LAs via electrostatic interaction. Further molecular
dynamics studies suggested that when LA, such as etidocaine used by Fozzard group,
enters the inner pore vestibule of Nav1.4, amine head of LA interacts with the
aromatic ring of F1579 and the side chain of L1280, and the aromatic moiety of LA
interacts with the Y1586 and N434. The aromatic ring at position 1579 is essential to
the high-affinity binding of LAs to inner pore. It is most likely that the amine head of
LA interacts with the aromatic ring of F1579 in a cation-pi electron aromatic ring
relationship.
1.4.2.2 Blocking of K+ channel
A similar use-dependent block is observed in the blocking of K+ channels by
intracellular quaternary ammonium compounds (QAs), such as TEA. Previous
electrophysiological studies have demonstrated that QAs can enter and leave the K+
channel only when channel is open (Armstrong, 1971; Armstrong et al., 1972), and
these compounds can be trapped in the closed channel. Site mutagenesis studies
revealed that changing the hydrophobicity of M441, T442 in the P-loop and T469 in
S6 segment of Shaker K+ channel significantly enhance or decrease the affinity for
intracellular TEA (Yellen et al., 1991; Choi et al., 1993). On the other hand,
hydrophobicity of these QA compounds is close related to the blocking specificity
(Armstrong, 1971; French et al., 1981). Based on these results, it is proposed that QAs
33
CHAPTER 1
Wang Kai
bind to the hydrophobic pocket formed by M441, T442 and T469 in Shaker channel
via hydrophobic interactions (Choi et al., 1993).
Actually, both internally and externally applied TEA can block K+ channels. In
contrast to internal blocking, block of K+ channels by extracellular TEA is not
use-dependent and has little influence on channel gating (Zhorov et al., 2004). Since
TEA can not permeate through the channel, the binding sites for external and internal
TEA are different. Site mutagenesis studies showed that external blocking by TEA
largely depends on the presence of an aromatic residue (T449 in the Shaker K+
channel) located near the extracellular mouth of the channel (Heginbotham et al.,
1992; Kavanaugh et al., 1992). Mutation of T449 in Shaker K+ channel to aromatic
residues (tyrosine or phenylalanine) enhances the sensitivity to TEA about 50-fold. It
was previously postulated that the interaction of between TEA and this aromatic
residue is attributed to cation-pi interactions. But later studies argued that TEA binds
to this residue via hydrophobic interaction (Luzhkov et al., 2001) or via water
molecules (Crouzy et al., 2001).
1.4.2.3 Implication in structure-function relationship of HCN channel
For HCN channels, so far all specific blockers act from the intracellular side of the
channel. Most of them show use-dependent block similar to the blocking of K+
channels by internal QAs and blocking of Na+ channels by LAs. These findings
strongly indicate that HCN channels share many similarities in pore forming region
34
CHAPTER 1
Wang Kai
structure with K+ and Na+ channels. Although several residues in S6 segment of HCN
channel were reported to influence the drug binding (Shin et al., 2001), the binding
sites and the nature of interaction of these blockers with the inner pole remain largely
unclear. To develop high-sensitivity and isoform-selective HCN blockers, further
studies combining mutagenesis, electrophysiology, structure and computational
simulation are needed to answer these questions.
1.4.3 HCN gene based biological pacemaker
The SA node is the primary biological pacemaker in the heart, whose malfunctions
due to disease or aging lead to various forms of arrhythmias (e.g. bradycardias and
tachycardias, respectively). Currently, implantation of electronic pacemaker is the
only therapeutic choice in patients with symptomatic SA node dysfunction. Although
this treatment is very effective in relieving symptoms, it is associated with significant
risks (e.g. infection, hemorrhage, lung collapse and death) and expenses (Rosen et al.,
2004).
In recent years, the concept of creating an artificial biological pacemaker for
treatment of cardiac rhythm disorders has been investigated by using various distinct
gene- and/or cell-based approaches. One of the most appealing aspects of a biological
pacemaker is that it should provide better responsiveness than electronic pacemakers
to the changing physiological demands of the body. HCN-encoded If channel has been
selected as the primary candidate to achieve this goal due to two major reasons: First,
35
CHAPTER 1
Wang Kai
If is largely responsible for diastolic depolarization, therefore over-expression of If is
unlikely to cause potentially arrhythmogenic AP prolongation. Second, as a channel
strongly modulated by direct cAMP binding, HCN-based biological pacemaker
provides excellent autonomic regulation on heart rate which is less dependent on
cell-specific variations in kinase and phosphatase cascades than other targets affected
by phosphorylation.
Three different strategies have been used so far to generate an HCN-based biological
pacemaker: (1) viral vector mediated HCN gene transfer (Section 1.4.2.1), (2)
genetically engineered cell mediated HCN gene transfer (Section 1.4.2.2), and (3)
embryonic stem cell originated pacemaker cells (1.4.2.3).
1.4.3.1 Viral vector mediated HCN gene transfer
The concept of this strategy is to directly introduce HCN genes into cardiac cells to
create or enhance spontaneous activity within these cells. So far adenovirus is the
most widely used viral vectors due to several advantages over other gene delivery
systems. The application of other viral vectors including adeno-associated virus or
lentivirus has been suggested due to their unique features.
1.4.3.1.1 Adenoviral vector
Adenoviral vector (based on serotype 5) is so far the most widely used viral vectors
due to several advantages over other gene delivery systems (Heiser, 2003). Adenoviral
36
CHAPTER 1
Wang Kai
vectors were developed by deleting E1 region of virus genome which allowed the
vectors to accommodate more than 8 kb of foreign DNA. Moreover, the loss of
critical viral regulatory genes renders the virus replication deficient. The E1-deleted
replication-deficient adenoviral vectors can be produced in E1-complementing cell
lines and be purified to high titers up to 1013 infectious units per milliliter easily. This
vector can transduce a wide spectrum of cell types and do not require division of the
target cell for gene transfer and expression (Curiel et al., 2002). After infecting target
cells, the viral genome will be delivered to the nucleus but remains
extra-chromosomal, which avoids the risk of insertional mutagenesis. Finally,
adenoviral vectors can mediate transient but high levels of expression of the transgene
in target cells, yielding the recombinant protein of up to 30% of total cellular protein.
Proof-of-concept experiments using adenoviral vectors on primary culture of neonatal
rat ventricular myocytes showed that adenoviral mediated over-expression of HCN2
isoform significantly increases the slow diastolic depolarization rate and the rate of
spontaneous activity, which can be modulated by isoproterenol and carbamylcholine
(Qu et al., 2001). Similar result was obtained with over-expression of mouse HCN2
and HCN4 gene in neonatal rat ventricular myocytes (Er et al., 2003). Further
experimental studies in dogs have shown that direct injection of adenovirus
expressing hHCN2 into the left atrium (Qu et al., 2003) or into the left bundle-branch
(Plotnikov et al., 2004) generate ectopic rhythms. However, WT HCN2 alone did not
suffices to induce pacing in quiescent adult left ventricular myocytes presumably due
37
CHAPTER 1
Wang Kai
to their negative activation profiles (Qu et al., 2001). To overcome this hurdle,
different genetically engineered HCN construct has been developed to enhance the
kinetic of the HCN channels. Tsang et al (2004) systematically shortened the S3-S4
linker by deleting residues 235 to 237 (HCN1-235-7∆∆∆ or HCN1-∆∆∆) to favor
channel opening to construct a biological pacemaker. Furthermore, direct injection of
adenovirus expressing HCN1∆∆∆ into left ventricle of guinea pig can induce the
SAPs from the transduced region recorded by high-resolution ex vivo optical mapping.
In a swine model of SA node dysfunction, adenovirus mediated HCN1-∆∆∆
overexpression
in
the
left
atrium
reproducibly
induced
a
stable,
catecholamine-responsive in vivo pacemaker that exhibited a physiological heart rate
and reduced the dependency on electronic pacemaker (Tse et al., 2006).
Although present studies using adenovirus are clinically significant, this vector is
unlikely to be used as the delivery vehicle clinically. This is because
adenovirus-mediated HCN gene expression is transient (usually peaks at ~1 week,
plateaus, then declining for a period of ~3 to 5 weeks, and no transgene expression
after 10 weeks) due to the adenovirus-elicited
innate and acquired immune
responses. This hurdle is likely to be solved by future utilization of adeno-associated
virus (AAV) or lentivirus (LV).
1.4.3.1.2 Adeno-associated viral vector
Adeno-associated virus (AAV) is a human parvovirus. So far eight known serotypes
38
CHAPTER 1
Wang Kai
of AAV have been identified, and AAV-2 is the most widely used for gene-transfer
studies (Gao et al., 2002). These vectors are emerging as a promising alternative to
replace adenovirus, especially when sustained gene expression is required. Compared
with other viral vectors, AAV is featured with a high safety profile. AAV infection has
not been found to cause human disease, thus seems to be non-pathogenic. AAV also
displays the least inflammatory response in comparison with other viral vectors such
as adenovirus (Wright et al., 2001). This feature may allow the stable expression of
transgenes over several months in contrast to shorter expression with adenoviral
vectors (Chu et al., 2003). Moreover, AAV can not replicate unless a helper virus,
such as adenovirus or herpesvirus, is present in the same cell (Berns et al., 1995). In
addition to the advantage in safety, AAV has attracted increasing research attention
also because of its capability of infecting a wide range of target cells, including both
dividing and non-dividing cells. After transfection, the tansgene carried by AAV
vectors can either integrate into the host genome in a random manner, or remain an
extra-chromosomal form. For cardiac myocardium, AAV vectors transduced cell as
efficiently as adenoviral vectors (Chu et al., 2003).
AAV-2 mediated gene therapies have been successfully used in variety of animal
models of cardiovascular diseases such as ischemic heart attack, hypertension, and
congenital cardiomyopathy (Hoshijima et al., 2002; Kawada et al., 2002; Melo et al.,
2002; Su et al., 2004). Stable high-level expression in myocardium can be achieved
via either direct intra-myocardial injection or coronary artery perfusion. But the
39
CHAPTER 1
Wang Kai
former has been proved to be more organ-specific. The application of AAV vector in
ion channel genes overexpression is now in progress.
However, AAV-based gene therapy also has several obvious limitations. The
maximum transgene size of wild type AAV is about 5 kb, restricting its application for
many larger therapeutic genes (Yang et al., 1996). The production of AAV vector is
very labor-intensive. And it is more difficult to produce a high titer as with adenovirus
(Kozarsky, 2001). Furthermore, in vivo expression transgene has a delayed onset with
minimal expression lasting about 1 month (Chu et al., 2003). These shortcomings are
hopefully to be improved by using other AAV serotypes, overlapping dual vector
approaches and novel virus producing strategies.
1.4.3.1.3 Lentiviral vector
Lentiviruses, such as the human immunodeficiency viruses (HIV) and the feline
immunodeficiency viruses (FIV), constitute a unique subclass of retrovirus. In
contrast to simple retroviruses which can only infect dividing cells, lentiviruses also
have the ability to infect non-dividing cells (Lewis et al., 1992). These viruses have
been intensively studied for more than one decade in the application of gene therapy.
To generate replication-incompetent viral vectors, the virus genome is usually
separated into three individual vectors containing envelope, packaging, and vector
expression genes of the virus respectively. The first lentiviral vector developed was
based on HIV-1 (Burns et al., 1993). Since wild-type HIV can only target CD4+ cells,
40
CHAPTER 1
Wang Kai
this vector is encoated with a heterologous envelope protein encoded by the vesicular
stomatitis virus envelope gene (VSV-G) (Naldini et al., 1996). This pseudotyped
vector can target a very broad cell types. Another advantage of this vector is it
accommodates transgenes up to 10 kb, larger than adenoviral and AAV vectors. Like
AAV, infection of lentiviral vector does not trigger any inflammatory response.
Lentiviral vectors have been proved to be efficient in transducing both dividing and
non-dividing cells, including embryonic stem cells, neonatal, adult and embryonic
stem cell derived CMs (Wolfgang et al., 2001; Zhao et al., 2002; Bonci et al., 2003;
Nagata et al., 2003; Xue et al., 2005). The infection efficiency can be reached >80%
in cultured neonatal rat ventricular myocytes (Bonci et al., 2003). Since lentivirus
integrates the transgene into the genome of target cells, the expression of transgene is
stable and long-term. These advantages make lentiviral vector a promising candidate
to deliver HCN gene into the heart.
Like AAV vectors, generation of lentiviral vectors is also labor-intensive. Moreover,
attenuation of gene expression due to vector silencing is observed in many transduced
cell types cell types despite long-term gene expression mediated by lentivirus vector
(Pannell et al., 2001). But the major drawback in using lentiviral vectors is the safety
issue, including the generation of replication competent viruses, insertional
mutagenesis, infection of germ cells, and vector mobilization by wild-type HIV-1
(Heiser, 2003).
41
CHAPTER 1
Wang Kai
Recent improvements in the lentivirus vector system alleviated some of the safety
concerns, including the development of self-inactivating lentiviral vectors, vectors
with minimized and split packaging genes, and the generation of packaging cell lines
(Sun, 2004). However, more studies are required before using lentiviral vectors in
clinical trials.
1.4.3.2 Genetically engineered cell mediated HCN gene transfer
Due to the limited duration of expression and potential adverse effects of the use of
viral vector, the use of stem cell as a carrier for HCN channels is an attractive
alternative. In vivo transplantation of human mesenchymal stem cells (hMSC) stably
transfected with human HCN2 or guinea-pig lung fibroblast cell overexpressing
mHCN1 into mammalian CMs, respectively, have shown pacemaking functions
(Potapova et al., 2004; Eduardo et al., 2007). Interestingly, hMSC lack intrinsic
automaticity but can elicit spontaneous activity in adjacent CMs by acting as a source
of If current. By contrast, fibroblasts carry the If current to CMs at the injected site
plausibly through cell fusion.
1.4.3.3 Embryonic stem cell derived pacemaker cells
Embryonic stem cells (ESCs) derived from blastocyst stage embryos have the ability
to proliferate indefinitely in culture and to form derivatives of all three germ layers
(endoderm, ectoderm and mesoderm) in vitro and in vivo (Moore et al., 2005). They
are regarded as the most promising tool for cardiac repair because their indefinite
42
CHAPTER 1
Wang Kai
replicative capacity. This makes them a renewable cell source and most suitable for
culturing in large quantities. So far both mouse and human ESCs have been
investigated as a source of CM for transplantation into the hearts aiming to repair the
damaged myocardium or SA node (Strauer et al., 2003) (Figure 1.4). The latter
application mainly relies on human ESCs derived early differentiated CM. These cells
can beat spontaneously in culture and share many similarities with native pacemaker
cells of the SA node (Satin et al., 2004). For example, human ESCs derived CMs do
not express inward rectifying currents which is normally involved in setting a stable
resting potentials. On the other hand, they do express a substantial If current that may
contribute to the pacemaking mechanism.
Xue et al (2005) have shown that human ESCs derived CMs can functionally
integrate with quiescent, recipient, ventricular myocytes to induce rhythmic electrical
and contractile activities in vitro. The integrated syncytium was responsive to the
β-adrenergic agonist-isoproterenol as well as to other pharmacological agents such as
lidocaine and ZD7288. When implanted in the guinea pig left ventricle, human
ESC-derived CMs successfully induced membrane depolarization from the site of
injection to the surrounding myocardium suggesting a functional human ESC-derived
pacemaker function. A similar result was obtained by Kehat et al. in pig, who
evaluated the pacemaking potential of human ESC-derived CMs on swine model of
atrioventricular (AV)-block (Kehat et al., 2004). The firing rate of human ESC-based
pacemaker can be further tuned by genetically manipulating
43
CHAPTER 1
Wang Kai
A
B
Fig. 1.4 ESC-derived CMs in culture capable of spontaneous contraction. A, mouse
ESC-derived CMs; B, human ESC-derived CMs.
44
CHAPTER 1
Wang Kai
the expression of HCN gene (Xue et al., 2005), thus providing a promising source that
fulfills the function of a ideal biological pacemaker in the future.
Although self-renewable ESCs may provide an unlimited supply of cells for
transplantation, little is known about the long-term validity and safety of human ESC
implant. One obvious problem is that immature ESCs derived CM will lose their
pacemaker characteristics once terminally differentiated. Hence, it is necessary to
drive these cells down a cardiac lineage and then stop them precisely and uniformly at
the SA node stage. Another concern is the possibility that transplanting
undifferentiated human ESCs which may form teratocarcinoma. Therefore, it is
equally important to be able to obtain a pure population of differentiated human ESC
derived CMs (Moore et al., 2005). Furthermore, ESC derived CM can be
arrhythmogenic. Zhang et al (2002) showed heterogeneity of repolarization with the
occurrence of after-depolarizations and triggered arrhythmias in mouse ESCs derived
CMs. It remains unclear whether this electrophysiological heterogeneity can cause
arrhythmias
after
ESC
derived
CMs
implantation.
In
addition,
residual
undifferentiated ESCs have also been shown to be capable of proliferating and
differentiating into multiple cell types other than CMs in situ (Singla et al., 2006).
These findings raised caution about the use of pluripotent ESCs in cell based therapy,
because they may act as an unanticipated arrhythmogenic source. Therefore more
rigorous electrophysiological characterization of undifferentiated ESCs and the
derivatives are required before clinical application of ESCs-based biological
45
CHAPTER 1
Wang Kai
pacemaker as well as other myocardial replacement therapy.
1.5 Objectives
Given the physiological and pathological importance of If current, its properties,
molecular basis and clinical applications have been intensively investigated since its
discovery a quarter century ago. Nevertheless, more details information regarding 1)
the structure-function relation in channel gating, 2) the mechanism of blockage by
specific agents; and 3) the mechanical roles in different cell types remain largely
unclear and require further studies. A better understanding of structure-function
relationship of HCN channels, its mechanical contribution to automaticity and
interaction with other ionic channels will help us to create the artificial biological
pacemaker.
As discussed previously, overexpression of If current or suppression of IK1 current can
both induce pacemaker activities in ventricular myocytes, raising the controversy in
pacemaker mechanism. However, so far no direct functional comparison between If
and IK1 current in a same biological system is available. In chapter 3, I studied the
contribution of If and IK1 current in pacemaker activity. The time-dependent change of
SAP of cultured neonatal rat ventricular myocytes (NRVM) was monitored and
correlated with the expression of If and IK1 current over time. To further elucidate the
functional role of If current, adenovirus-mediated engineered mouse HCN1 gene
overexpression was performed. A profile of the mechanism underlying the
46
CHAPTER 1
Wang Kai
automaticity of cultured NRVM was generated in this study.
As discussed above, ion channel blockers can be used as powerful tools to obtain
valuable information about the structural and functional properties of the channel.
Those information are critical for either the development of more specific drugs for
clinical use or ion channel gene-base therapy. In chapter 4, to investigate the
structure-function relationship of HCN channel, I studied the drug binding mechanism
of mouse HCN1 channel using alanine-scanning mutagenesis and then followed by
detail electrophysiological experiments to investigate the structure-function
relationship of HCN channel. Through analyzing the functional consequence of single
amino acid mutation on the channel sensitivity for ZD7288, I identified several
residues responsible for the binding of ZD7288 to the channel. In combination with
the data on mutation induced change of channel gating properties, these results also
shred light on the structure of pore forming region of HCN channel.
As mentioned previously, ESC is a promising resource to repair the damaged
myocardium or serve as HCN gene carrier into the heart to build biological pacemaker.
However, the electrophysiological properties of undifferentiated ESCs remain
unknown. These properties may have important impact on the electrical stability of
the ESCs-based implants. In chapter 5, I characterized and compared functional
expression of the ion channels including HCN channels in human and mouse ESCs
and discussed the possible functional roles and implications.
47
CHAPTER 2
Wang Kai
Chapter 2
Methodology
This chapter contains the materials, equipment and methods exploited repeatedly
thorough this work.
More specialized technique and methodology will be described
in respective chapters.
2.1 Materials and equipments
2.1.1 Main items
z
EPC-10 patch clamp amplifier – from HEKA electronic, Heidelberg, Germany
z
Sutter MP-285 micromanipulator – from Sutter Instrument Company, Novato,
CA, USA
z
Sutter P-87 horizontal puller – from Sutter Instrument Company, Novato, CA,
USA
z
Olympus IX51 inverted phase-contrast microscope – from Olympus Optical Co.
Ltd.
z
Olympus U-LH100 HG xenon arc lamp at 488/530 nm (excitation/emission) –
from Olympus Optical Co. LTD
z
Warner TC-324B temperature controller system – from Warner Instrument
Corporation, Hamden, CT, USA
z
ALA VM4 Bath-perfusion Systems – from ALA Scientific Instruments, Inc.,
48
CHAPTER 2
Wang Kai
Westbury, NY
z
Micro-Electrode Array System – from Multi Channel Systems, Reutlingen,
Germany
z
DU640 Spectrophotometer – from Beckman Instruments Inc, Fullerton, CA, USA
z
GeneAmp PCR System 9700 – from Applied Biosystems, Foster City, CA, USA
z
Mupid-exu submarine electrophoresis system – from Advance co., Ltd, Tokyo,
Japan
z
Chemi Genius Bio imaging system – from Syngene, Cambridge, UK
z
Avanti J-E Centrifuge – from Beckman Coulter, Inc., Fullerton, CA, USA
z
Centrifuge 5415 R – from Eppendorf AG, Hamburg, Germany
z
Kubota Tabletop Centrifuge 2010 – from Kubota Corporation, Tokyo, Japan
z
Thermomixer comfort – from Eppendorf AG, Hamburg, Germany
z
Vortex-Genie 2 – from Scientific Industries Ltd., Bohemia, NY, USA
z
Thermolyne Cimaree Hot Plate Stirrer – from Barnstead International, Dubuque,
IA, USA
z
Grant OLS 200 Shaking Bath – from Grant Instruments (Cambridge) Ltd,
Shepreth, Cambridgeshire, UK
z
Microflow Biological Safety Cabinet – from BIOQUELL UK Limited, Andover,
UK
z
Forma Series II Water Jacketed CO2 Incubator – from Thermo Fisher Scientific,
Inc., Waltham, MA, USA
z
Sartorius BL120S analytical balances – from Sartorius AG, Goettingen, Germany
49
CHAPTER 2
Wang Kai
z
Pipettes P10, P20, P200, P1000 – from Eppendorf AG, Hamburg, Germany
z
Pipet-Aid XP – from Drummond Scientific Company, Broomall, PA, USA
2.1.2 Glassware and plastic ware
z
Borosilicate glass electrodes (1.2 mm OD) – from Sutter Instrument Company,
Novato, CA, USA
z
Pipette tips, blue tips, yellow tips, micro tips – from Eppendorf AG, Hamburg,
Germany
z
Polypropylene microcentrifuge tubes, 1.5 ml, and thin wall (0.5 ml) tubes – from
Eppendorf AG, Hamburg, Germany
z
Tips with aerosol resistant filters, 10 μl, 100 μl and 200 μl – from Eppendorf
AG, Hamburg, Germany
z
Falcon serological pipettes, tissue culture dishes, tissue culture flasks,
polypropylene and test tubes – from Becton Dickinson Labware, NJ, USA
z
Nunc cryo tube vials – from Nalge Nunc International, Albertslund, Denmark
z
Vacuum-driven filtration and storage devices and Pressure-driven filters– from
Millipore Corporation, Billerica, MA, USA
2.1.3 Enzymes and biological kits
z
5-Bromo-2’-deoxy-uridine (BrdU) labeling and detection kit – from Roche
Diagnostics, Basel, Switzerland
z
3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide (MTT) kit – from
Roche Diagnostics, Basel, Switzerland
50
CHAPTER 2
z
Wang Kai
ES Cell Characterization Kit – from CHEMICON International, Inc., Temecula,
CA, USA
z
QuickChange site-directed mutagenesis kit –from Stratagene, La Jolla, CA, USA
z
Ambion totally RNA kit – from Ambion, Austin, TX, USA
z
SuperScript One-Step RT-PCR with the Platinum Taq system – from Invitrogen,
Carlsbad, CA, USA
z
Restriction enzymes – from Promega Corporation, Madison, WI, USA
2.1.4 Reagents
2.1.4.1 Cloning reagents
z
LB medium
5g/L Yeast extract, 10g/L Bacto tryptone, 10g/L NaCl
z
LB Agar
5g/L Yeast extract, 10g/L Bacto tryptone, 10g/L NaCl, 10g/L Bacto-agar
z
LB Agar/antibiotic plates
After autoclaving, LBA was allowed to cool down to 55°C prior to add
antibiotics (ampicillin: 100 µg/ml) and poured into 100mm petri dishes, stored at
4°C
z
Phenol
Phenol, cholorophorm, isoamyl alcohol were mixed at 50:49:1 (v/v)
(Sigma-Aldrich Corporation)
51
CHAPTER 2
z
Wang Kai
TE
10mM Tris, 1mM EDTA, pH 7.6
2.1.4.2 Patch clamp reagents
z
Bath solution (in mM)
110 NaCl, 30 KCl, 1.8 CaCl2, 0.5 MgCl2, 5 HEPES, 10 glucose, pH adjusted to
7.4 with NaOH.
z
Pipette solution (in mM)
110 K-Aspartate, 10 NaCl, 20 KCl, 1 MgCl2·6H2O, 5 Na2-Phosphocreatine, 10
HEPES, 5 K2-EGTA, 5 Mg2ATP, 0.1 GTP, pH adjusted to 7.2 with KOH
z
Amphotericin B (Sigma-Aldrich) was dissolved in DMSO as a stock at the
concentration of 1M. Dilute the stock in pipette solution to get the working
concentration of 100 μM for perforated patch clamp experiment.
2.1.4.3 Ion channel blockers
z
CsCl2, BaCl2, 4-aminopyridine (4-AP), Tetraethylammonium (TEA) – from
Sigma-Aldrich Corporate, St. Louis, MO, USA
z
E-4031 (specific HERG channel blocker), rIberiotoxin (IBTX, specific BK
channel blocker) – from Alomone labs Ltd., Jerusalem, Israel
z
ZD7288 (specific HCN channel blocker) – from Tocris Cookon Inc., Ellisville,
MI, USA
52
CHAPTER 2
Wang Kai
2.1.4.4 Histochemistry reagent
z
0.1% Trition-X-100/PBS (Sigma-Aldrich)
z
10% BSA (Sigma-Aldrich)
z
Rabbit-anti-rat HCN-1 multi-clonal primary antibody – from Alomone labs Ltd.,
Jerusalem, Israel
z
Fluorescent secondary antibody – from Sigma-Aldrich Corporate, St. Louis, MO,
USA
2.1.5 Cell lines and Medium
2.1.5.1 Cell lines
z
R1 mouse embryonic stem cell line – kind gift of Dr. Andras Nagy, University of
Toronto, Canada
z
H1 human embryonic stem cell line – from Wicells, Madison, WN, USA
z
Human embryonic kidney cell line (HEK293) –
from Invitrogen, Carlsbad, CA,
USA
2.1.5.2 Cell culture reagents and medium
z
Dulbecco’s minimal essential medium (DMEM) with high glucose (Gibco, Cat.
No. 11960-044)
z
0.1 mM nonessential amino acids (100 × stock) (Gibco, Cat. No. 11140-019)
z
1 mM sodium pyruvate (100 × stock) (Gibco, Cat. No. 11360-013)
53
CHAPTER 2
Wang Kai
z
10-4 mM β-mercaptoethanol (Sigma, Cat. No. M6250)
z
2 mM L-glutamine (100 × stock) (Gibco, Cat. No. 25030-016)
z
Penicillin and streptomycin solution (P/S)
z
10,000 units of penicillin and 10,000 ug of streptomycin (Invitrogen)
z
Fetal bovine serum (FBS, Gibco)
z
Calcium- and magnesium- free phosphate-buffered saline (PBS, Gibco)
z
Modified Hank’s solution (Gibco)
z
0.05% trypsin in saline/EDTA (Gibco, Cat. No. 25300-054)
z
0.1% gelatin in ddH2O (BDH, Cat. No. 4404548)
z
1000 U/ml leukaemia inhibitory factor (LIF, Chemicon)
z
Mitomycin C (Sigma-Aldrich, Cat. No. M0503)
z
Trypsin digestion solution
5 g Trypsin (Invitrogen) in 250 ml calcium- and magnesium-free PBS
z
Mouse embryonic stem cells (ESCs) culture medium
DMEM (Gibco) supplemented with 20% fetal bovine serum (FBS, Gibco), 2 mM
L-glutamine, 1 mM sodium pyruvate, 0.1 mM β-mercaptoethanol, 0.1 mM
nonessential amino acids, 50 U/ml P/S, 1000 U/ml leukaemia inhibitory factor
(LIF) (Chemicon).
z
Neonatal rat ventricular myocytes (NRVMs) culture medium
Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 5%
FBS, 1.5mM Vitamin B12, 10mg/ml insulin, 10mg/ml transferring, 100 U/ml P/S
and 0.1mM BrdU
54
CHAPTER 2
z
Wang Kai
MEF culture medium
DMEM supplemented with 10% FBS and 50 U/ml P/S, stored at 4°C
z
MEF inactivation medium
DMEM supplemented with 10% FBS and 10 μg/ml mitomycin C
(Sigma-Aldrich), stored at 4°C
z
Freezing Medium
20 ml FBS and 10 ml dimethylsulfoxide (DMSO, Sigma-Aldrich) in 70 ml
DMEM
2.1.6 Oligonucleotides primers and probes
z
Oligonucleotide primers – from previous publications or designed using Primer
Premier 5 and synthesized in Genome Center of University of Hong Kong (see
Chapter 5 for primers list)
z
DNA ladder – from Invitrogen, Carlsbad, CA, USA
2.1.7 Computer programs
z
Pulse v8.6 – from HEKA electronic, Heidelberg, Germany
z
pClamp 9.2 software – from Molecular Devices Corporation, Sunnyvale, CA,
USA
z
OriginPro 7.5 – from OriginLab Corporation, Northampton, MA, USA
z
MC-Rack 3.2 – from Multi Channel Systems, Reutlingen, Germany
z
Matlab – from the MathWorks, Natick, MA, USA
55
CHAPTER 2
z
Wang Kai
Primer Premier 5 – from PREMIER Biosoft International, Palo Alto, CA, USA
2.2 Cell isolation and culture
2.2.1 Mouse embryonic stem cells (mESCs)
2.2.1.1 Preparing mouse embryonic fibroblast (MEF) cells
ESCs can be maintained in an undifferentiated state by culturing them on feeder cell
layers or on gelatin-coated plates with the addition of leukaemia inhibitory factor
(LIF). Primary mouse embryonic fibroblast (MEF) cell is one of the most commonly
used feeder layers. Following protocol describes the procedure of generating primary
MEF cells from mouse embryos.
Protocol
1. Post-coital-day 13.5 or 14.5 pregnant mouse was sacrificed by cervical dislocation
and moistened in the whole body with 70% ethanol.
2. Uterus was then dissect out and transferred into a 10 cm Petri dish containing PBS
the inside the hood.
3. Embryos were dissected away from the uterus and transferred into a new dish
containing PBS.
4. Removing heads and all internal organs (liver, heart, kidney, lung and intestine).
5. Wash the 8 to 10 carcasses in a 50 ml Falcon tube in 50 ml ice cold PBS for 3
56
CHAPTER 2
Wang Kai
times.
6. Mince the carcasses with sterile disposable scalpel into cubes of about 1 mm in
diameter.
7. Add 1ml of 0.5% trypsin per embryo and incubate at 37℃ for 5 minutes.
8. Add equal volume of warm PBS to dilute trypsin to 0.25% and incubate at 37℃ for
another 5 minutes.
9. Stop the digestion by adding equal volume of MEF culture medium followed by
centrifuging to pellet the cells.
10. Resuspend the cells were in appropriate volume of MEF culture medium and
transfer to 10 cm dish at 1 embryo per dish after removing tissue debris.
11. Cells were cultured overnight and in the next day rinsed with PBS to remove dead
cells. After forming confluent monolayer (usually 2-3 days), each plate was
trypsinized and re-plated onto 5 further 15 cm plates.
12. When the plates are confluent, MEF cells were trypsinized with trypsin/EDTA and
frozen in liquid nitrogen for future use.
2.2.1.2 Preparing ESCs feeder layer with mitomycin C-inactivated MEF
cells
Primary MEF cells can proliferate to form monolayers in culture. These cells can
secrete varieties of cytokines to maintain ESCs in undifferentiated state. But before
seeding ESCs, MEF cells need to be mitotically inactivated to prevent proliferation.
This goal can be achieved by mitomycin C treatment.
57
CHAPTER 2
Wang Kai
Protocol
1. A frozen vial of MEF was thawed, washed, plated onto five 15 cm plates and
cultured until forming a confluent monolayer.
2. Culture medium was replaced by MEF inactivation medium containing 10 μg/ml
mitomycin C and incubated with cells for 2.5 hours.
3. After washed with PBS twice, cells were trypsinized with trypsin/EDTA, washed
with PBS and spun down.
4. To prepare the embryonic stem cell feeder layer, cells was re-suspended in MEF
culture medium, counted, and diluted to a concentration of 2×105 cells/ml.
5. After plated onto 10 cm dishes, these mitomycin C treated MEF cells were cultured
overnight to form a feeder layer before adding ES cells.
6. To stock mitomycin C treated MEF cells, cells were resuspended in freezing
medium and stored in liquid nitrogen.
2.2.1.3 Preparing gelatin-coated plates and cover slips
Plates and cover slips were covered with 0.1% gelatin solution (5 ml for a 10 cm
plate). After incubated in hood for about 10 minutes at room temperature, gelatin
solution was aspirated, and plates or cover slips were air dried.
2.2.1.4 ES cell culture on MEF feeder layer or gelatin-coated plates
1. A vial of ES cells was quickly thawed at 37℃. Upon thawing, immediately wipe
58
CHAPTER 2
Wang Kai
the outside of the vial with 70% ethanol and transfer to a 12 ml tube containing 10
ml of ESCs medium.
2. Centrifuged at 1000 rpm for 5 minutes.
3. Remove the supernatant, resuspend cells in 10 ml ESCs medium and plated on a 10
cm plate with MEF feeder layer.
4. Change the medium the next day by swirling the medium in dish to collect debris,
the aspirate. Add fresh medium gently to the side of the plate so that the feeder
layer is no disturbed.
5. When being sub-confluent (usually 2 days), wash cells twice with PBS and add 2
ml trypsin/EDTA.
6. Incubate for about 5 minutes at 37 ℃ until cells begin to come off the plate.
7. Add 5 ml ES cell medium and gently pipette the cells up and down to break cell
clumps.
8. Transfer to a sterile 12 ml tube and pellet cells in centrifuge.
9. Aspirate supernatant and gently resuspend cell pellet in 5-7 ml medium.
10. Add 1 ml of the cell suspension (about 2-5 ×106 cells) to a fresh 10 cm feeder
layer dish containing 9 ml ES cell medium. Disperse cells evenly by pipetting
gently and rocking the plate prior to incubating at 37℃ in a humidified 5% CO2
atmosphere.
11. Change medium everyday and cells were passed every second day.
12. For patch clamp study, cells were pre-plated for 30 minutes to remove MEF cells
and then seeded onto gelatin-coated cover slips at 1×105 cells/ml and studied the
59
CHAPTER 2
Wang Kai
next day.
2.2.2 HEK293 cells
The 293 Cell Line is a permanent line established from primary embryonic human
kidney transformed with sheared human adenovirus type 5 DNA. The E1A
adenovirus gene is expressed in these cells and participates in transactivation of some
viral promoters, allowing these cells to produce very high levels of protein. HEK293
cell is one of the most widely used cell lines for heterologous protein expression.
Starting HEK 293 cell cultures from frozen stocks protocol
1. Thaw 293 cells rapidly by briefly immersing the vial in a 37℃ water bath. Upon
thawing, immediately wipe the outside of the vial with 70% ethanol, and then
transfer the contents of the vial to a 10 cm culture plate.
2. Add an additional 4 ml of medium (DMEM supplemented with 10% FBS and 100
U P/S) to the plate. Gently rock or swirl the plate to distribute cells evenly over the
growth surface. Place the culture in a 37℃, 5% CO2, humidified incubator.
3. The next day, examine the cells under a microscope. Aspirate the medium and
replace with fresh, prewarmed growth medium.
4. Expand the culture as needed. Cell cultures should be split every 2-4 days, when
they reach 70-80% confluency.
5. To split the cells, firstly remove the medium and wash the cells once with
prewarmed sterile Ca2+ or Mg2+-free PBS.
60
CHAPTER 2
Wang Kai
6. Add 1-2 ml of trypsin/EDTA solution and incubate for about for 1-2 minutes at 37
℃ until cells detach.
7. To stop trypsinization, add 5-10 ml of growth medium, and then resuspend the cells
gently.
8. Count cells, and transfer cells to a new culture 10 cm plate containing an
appropriate volume of growth medium at the final density of about
1 × 104/ml.
9. Gently rock or swirl the plate or flask to evenly distribute the cells.
Preparing frozen cultures of HEK 293 fells protocol
Frozen stock should be prepared from an early passage to ensure a renewable source
of cells.
1. Trypsinize cells from the desired number of plates.
2. Pool cell suspensions together, count cells, and calculate total viable cell number.
3. Centrifuge cells at 1000rpm for 10 minutes. Aspirate the supernatant.
4. Resuspend the pellet at a density of 1-2 × 106 cells/ml in freezing medium.
5. Dispense 1 ml aliquots into sterile cryovials.
6. Store the cryovials in Nalgene’s cryo-containers at -70℃ overnight to freeze the
cell slowly (1℃ per minute).
7. Remove vials from cryo-containers the following day and place in liquid nitrogen
for storage.
8. Two or more weeks later, confirm the viability of the frozen stocks by starting a
fresh culture from frozen cells as described above.
61
CHAPTER 2
Wang Kai
2.2.3 Neonatal rat ventricular myocytes (NRVMs)
1. 0 to 1- day-old neonatal Wistar rats were sacrificed by decapitation.
2. The ventricles were quickly removed, rinsed 4 times with ice-cold modified Hank’s
solution and minced into small pieces on ice.
3. Transfer the tissue fragments into a 50 ml Falcon tube and add 10 ml pre-warmed
37℃ 0.2% trypsin.
4. Place the tube in a water bath on the top of a hot plate stirrer and stir the tissue
fragments with a magnetic bar for 10 minutes at 37℃.
5. Discard the supernatant to remove dead cells and blood cells.
6. Add fresh pre-warmed 0.2% trypsin to digest the minced myocardium for another 5
minutes at 37℃.
7. Aspirate the supernatant gently and transfer to a 50 ml tube on ice containing 7 ml
FBS to stop the digestion.
8. Repeat the step 6 and 7 for another 5 times and collect all the supernatant in two 50
ml tube.
9. Centrifuge cells at 1000rpm for 5 minutes. Aspirate the supernatant.
10. Resuspend the cell in NRVM culture medium and pre-plate for 1 hour to reduce
fibroblast contamination.
11. Aspirate the supernatant gently and plate in 6-well plates or MEA dishes at the
density of 6×105 cells/ml.
12. Culture media were changed every day. These procedures reproducibly generate
monolayer cultures that contract synchronously at >300 beats/min consistent with
62
CHAPTER 2
Wang Kai
the normal beating rate of the intact rat heart.
13. For patch clamp experiment, monolayer cultures were resuspended by brief
exposure to trypsin-EDTA.
14. The cells were re-plated onto gelatin-coated coverslips at a lower density (2×105
cells/ml), allowed to settle down overnight and studied within 14 to 24 hours.
2.3 Cell proliferation assay
Cell proliferation was determined in 96-well plates using a non-radioactive
chemiluminescent BrdU kit (Roche Diagnostics, Basel, Switzerland). During cell
proliferation the DNA has to be replicated before the cell divides. This close
association between DNA synthesis and cell doubling makes the measurement of
DNA synthesis very reliable for assessing cell proliferation. 5-bromo-2-deoxy-uridine
(BrdU) is a thymidine analogue and can be incorporated into DNA as a DNA
precursor in place of thymidine. The incorporated BrdU could be detected by a
quantitative cellular enzyme immunoassay using monoclonal antibodies directed
against BrdU.
Protocol
1. ESCs were cultured on MEF feeder layer in the normal ESC culture medium (20%
FBS) for 2 days after passage and then trypsinized trypsin/EDTA from 10cm Petri
dish.
2. After pre-plated for 1 hour to remove MEF contamination, Cells were seeded in
63
CHAPTER 2
Wang Kai
gelatin-coated 96-well plates at 1×103 cells per well.
3. Cells were allowed to attach to the plate overnight in normal ESCs growth medium
(20% FBS) before drug treatment.
4. Different chemicals were diluted to desired concentrations in ESCs culture medium
with low FBS concentration (5% FBS) and incubated with cells for 24 hours (4
wells with one concentration).
5. BrdU labeling solution was then added to give a final concentration of 10 μM of
BrdU and incubated with cells for 2 hours, during which BrdU is incorporated in
place of thymidine into the DNA of cycling cells.
6. After removing the medium, cells were fixed with the addition of FixDenat solution
for 30 minutes at room temperature.
7. After removing FixDenat, 100 μl freshly diluted 1:100 anti-BrdU-POD solution
was added to the wells for 30 minutes to bound to the BrdU incorporated into the newly
synthesized cellular DNA, followed by washing three times.
8. Finally, 100 μl of substrate solution was added which could be catalyzed by POD to
emit luminescence.
9. Luminescence was read by a multi-well scanning spectrophotometer automatic
luminometer.
2.4 Cell viability assay
Cell viability was determined in 96-well plates using a colorimetric MTT kit (Roche
Diagnostics). This assay is based on the fact that cellular damage will result in loss of
64
CHAPTER 2
Wang Kai
the ability of the cell to maintain and provide energy for metabolic cell function and
growth. In the MTT assay, yellow tetrazolium salt MTT is reduced only by
metabolically active cells to a purple, water-insoluble formazan salt, therefore this
assay detects viable cells exclusively. After formed formazan salt is solubilized, it can
easily and rapidly be quantitated in a conventional ELISA plate reader at 540 nm.
Protocol
1. ESCs were cultured on MEF feeder layer in the normal ESC culture medium (20%
FBS) for 2 days after passage and then trypsinized trypsin/EDTA from 10cm Petri
dish.
2. After pre-plated for 1 hour to remove MEF contamination, cells were seeded in
gelatin-coated 96-well plates at 1×103 cells per well.
3. Cells were allowed to attach to the plate overnight in normal ESCs growth medium
(20% FBS) before drug treatment.
4. Different chemicals were diluted to desired concentrations in ESCs culture medium
with low FBS concentration (5% FBS) and incubated with cells for 24 hours (4
wells with one concentration).
5. 10 μl of MTT labeling reagent (5 mg/ml in PBS) was added to each well, followed
by incubation at 37℃ for 4 hours, during which viable cells convert MTT to a
water insoluble formazan dye.
6. Solubilization solution (100 μl) was added and incubated overnight to dissolve the
formazan crystals formed.
65
CHAPTER 2
Wang Kai
7. The dye was quantitated with an ELISA plate reader by measuring the absorbance
at 540 nm which directly correlates with the cell number. Un-treated cells were
used as control (i.e. 100% survival).
2.5 Immunohistochemistry
1. One day before immuostaining, seed cells on coverslips at an appropriate density
(about 100 cells/mm2).
2. Aspirate the medium and incubate cells in 4% paraformaldehyde for 15-20 minutes
at room temperature.
3. Wash cells twice (5-10 minutes each) with PBS.
4. Permeabilize cells with 0.1% Trition-X-100/PBS for 10 minutes at room
temperature.
5. Wash cells twice (5-10 minutes each) with PBS.
6. Apply blocking solution (10% BSA) for 30 minutes at room temperature.
7. Dilute primary antibodies to working concentrations in blocking solution. Incubate
cells with primary antibodies for 1 hour at room temperature or at 4℃ overnight.
8. Wash cells three times (5-10 minutes each) with PBS.
9. Dilute secondary antibodies in PBS just before use. Incubate secondary antibodies
for 30-60 minutes at room temperature.
10. Wash cells three times (5-10 minutes each) with PBS.
11. Mount coverslip on a slide by using antifade mounting solution.
12. Fluorescence images can be visualized with a fluorescence microscope.
66
CHAPTER 2
Wang Kai
2.6 Alanine (Ala)-scanning mutagenesis
Ala-scanning mutagenesis is a scheme to analyze the functions of surface amino acid
residues of a protein (Sambrook et al., 2001). The charged residues, typically arginine,
lysine, glutamate and aspartate, on the surface are not usually required for structural
integrity. But the side chains of these residues are usually exposed to solvent on the
surface of proteins involved in ligand binding, subunit assembling etc. In contrast,
alanine side chain is very non-reactive, and is thus rarely directly involved in protein
function. Using site-directed mutagenesis method to replace them with innocuous
alanine does not disrupt folding of the core of the protein. However, the absence of
polar groups from critical locations on the surface may severely compromise
functions of the protein. Ala-scanning mutagenesis of particular amino acids generates
a systemic set of mutant proteins that can be assayed for loss of function. When
applied to the structure-functional study of ion channel, this method is usually
combined with electrophysiological methods, which allow the assessment of
functional consequences of such alanine-substitutions at a high-resolution level.
The powerful combination of these two methods have been proved to be extremely
useful in determining the drug binding sites of HERG channel (Mitcheson et al., 2000;
Kamiya et al., 2001; Perry et al., 2004), and the voltage sensing mechanism in a
variety of Kv channels including HCN channel (Li-Smerin et al., 2000; Chen et al.,
2001a; Panaghie et al., 2007). The major drawback of Ala-scanning mutagenesis is
the heavy workload required for generating, sequencing and characterizing a large
67
CHAPTER 2
Wang Kai
number of mutants, therefore it is mainly used by commercial companies.
2.6.1 Site-directed mutagenesis
Site-directed alanine mutagenesis was conducted using Site-Directed Mutagenesis Kit
from Stratagene.
1. Two complimentary oligonucleotides containing the desired mutation, flanked by
unmodified nucleotide sequence were designed with Primer premier 5 and
synthesized in Genome Research Center of the University of Hong Kong.
2. Prepare the sample reaction as indicated below:
5 μl of 10 × reaction buffer
2 μl (10 ng) of dsDNA template (5 ng/μl)
1.25 μl (125 ng) of oligonucleotide primer #1 (100 ng/μl)
1.25 μl (125 ng) of oligonucleotide primer #2 (100 ng/μl)
1 μl of dNTP mix
39.5 μl of double-distilled water (ddH2O) to a final volume of 50 μl
Then add
1 μl of PfuTurbo DNA polymerase (2.5 U/μl)
3. Cycle each reaction using the following protocol: Initial denaturing of the template
for 30 seconds at 95℃ followed by 16 repeating cycles of denaturing for 30
seconds at 95℃, annealing for 1 minute at 55℃, extension for 1 minute/kb at 68℃.
4. Following temperature cycling, place the reaction on ice for 2 minutes to cool the
68
CHAPTER 2
Wang Kai
reaction to ≤ 37°C.
5. Add 1 μl of the Dpn I restriction enzyme (10 U/μl) directly to each amplification
reaction using a small, pointed pipette tip.
6. Gently and thoroughly mix each reaction mixture by pipetting the solution up and
down several times. Spin down the reaction mixtures in a microcentrifuge for 1
minute and immediately incubate each reaction at 37℃ for 1 hour to digest the
parental (i.e., the nonmutated) supercoiled dsDNA.
2.6.2 Heat shock transformation
1. XL1-blue supercompetent cells were thawed on ice.
2. dsDNA (100ng) was mixed gently with 50 μl competent cells. The mixture was
incubated for 30 minutes on ice.
3. The mixture was heated at 42°C for 45 seconds.
4. The tube was then placed on ice for 2 minutes.
5. 1 ml NZY+ broth preheated to 42°C was added and incubated for 1 hour at 37°C
with shaking at 250 rpm.
6. 250 µl of transformation mixture was plated on an LB agar/ampicillin plates
containing 80 μg/ml X-gal and 20 mM IPTG (provided in Stratagene Site-Directed
Mutagenesis Kit) and incubated at 37°C overnight.
7. The correct colonies were screened by PCR.
8. The mutations were confirmed by sequencing (in Genome Research Center of the
University of Hong Kong).
69
CHAPTER 2
Wang Kai
2.6.3 Polymerase Chain Reaction (PCR)
Single bacterial colonies were picked and half for inoculation in new LB plates and
half for template of PCR screening. The bacterial cells were added into 20 µl PCR
mix with 1× PCR buffer (Invitrogen), 2mM dNTPs, 0.5µM forward and reverse
primers and 0.2µl Taq DNA polymerase (5U/µl). After denaturing at 94°C for 5
minutes, thermal cycling conditions were 1min at 94°C (denaturing), 58-60°C
(annealing) and 72°C (extension) for 30 cycles and finally, 10 minutes at 72°C. The
PCR product was separated by 1% agarose gel electrophoresis in 1× TBE buffer. The
size of PCR product was indicated by the DNA ladder which was loaded parallel to
the samples.
2.6.4 Plasmid DNA extraction
Single bacterial colony picked from LB plate was inoculated in 3 ml LB medium with
20µg/ml ampicillin (Sigma) at 37°C overnight with shaking at 250rpm. Qiagen
plasmid miniprep protocol was used for preparing plasmid DNA for restriction
enzyme digestion and sequencing analysis. The plasmid DNA was precipitated in
100% ethanol at -20°C, washed with 75% ethanol twice, dried with a vacuum
centrifuge and dissolved in appropriate amount of TE.
2.6.5 Sequencing
Plasmid DNA prepared by Qiagen miniprep kits was added as template in the 20µl
sequencing mix, including, 1× terminator Ready Reaction Mix, 3pM sequencing
70
CHAPTER 2
Wang Kai
oligonucleotide primer and Big Die. PCR was performed on a typical thermal cycle as
96 °C for 10 seconds (denaturation), 50°C for 5 seconds (annealing) and 60°C for 4
minutes (extension) for 25 cycles. The PCR product was kept in dark at 4°C. For
purification, 480 µl ddH2O was added to the PCR product and then same volume of
phenol/chloroform was added with inverse mix. The aqueous phase was aspirated and
transfer into fresh tube. The production was precipitated by adding 3 M (1/10 volume)
sodium acetate and absolute alcohol (2 volumes). Then the supernatant was discarded
and pellet was washed with 75% ethanol twice. Finally, the pellet was dried with a
vacuum centrifuge and ready for sequencing analysis by ABI Prism 377 DNA
sequencer (in Genome Research Center of the University of Hong Kong).
2.7 RT-PCR
Total RNA from cultured cells or tissue specimens was isolated using ToTALLY
RNATM Kit.
Protocol
1. The sample was homogenized with 1ml chloroform/ 5 ml Trizol and incubated at
room temperature for 5 minutes.
2. After centrifugation at 12,000g for 15 minutes at 4°C, the mixtures were
centrifuged at 12,000g for 15min at 4°C, and then separated into a lower
phenol-chloroform phase, protein debris interphase and the colorless upper
aqueous phase that RNA remained.
71
CHAPTER 2
Wang Kai
4. The aqueous phase was mixed with 1:1 (v:v) isopropanol was added to the
supernatant and shake vigorously.
5. The RNA was precipitated by centrifugation at 12,000g for 10 minutes at 4°C. The
pellet was washed with 75% ethanol in DEPC-water and then centrifuged at
12,000g for 5 minutes at 4°C.
6. The pellet was washed with 100% ethanol and spin down at 12,000g for 5 minutes
at 4°C. 7. The ethanol was removed and the pellet was air-dried completely and
dissolved with 100 µl of nuclease-free water and stored at -80℃.
Single stranded cDNA was synthesized from ~1 μg of total RNA using random
hexamers and SuperScriptTM reverse transcriptase (Invitrogen), followed by PCR
amplification with gene-specific primers.
Protocol
1. 1.5µg of total RNA was hybridized to 0.5µg random hexamers for 10 minutes at
70℃.
2. The mixture was used to generate cDNA with the respective reaction buffer
containing 5µl of RT reaction buffer, 1µl of 10mM DTT, 1µl of 1mM dNTP, 1µl of
RNase inhibitor (1:3 dilution) and 1µl of transcriptase.
3. The mixture was incubated at 37℃ for 2 minutes and 42℃ for 1 hour.
4. The reaction was stopped by heating the mixture at 90℃ for 2 minutes.
5. The PCR amplification reactions were performed in 20 µl final volume containing
72
CHAPTER 2
Wang Kai
1× Taqman Buffer A, plus dNTPs (0.5M each), 10-15 units of prime pairs, 1 unit of
primers of 18S ribosomal RNA, cDNA templates (RT products).
6. Thermal cycling conditions were initial denaturing of the template for 5 minutes at
94°C followed by 32 repeating cycles of denaturing for 1 minute at 94°C,
annealing for 1 minute, extension for 1 minute at 72°C and a final elongation at
72°C for 7 minutes.
7. The PCR products were size-fractionated by 1% agarose gel electrophoresis and
visualized by ethidium bromide staining.
2.8 Gene transfer
2.8.1 Gene transfer using cationic lipid
1. Cells were plated at a density of 1 × 105 cells per well in a 6-well tissue culture
plate in 2 ml DMEM (Gibco) supplemented with 10% FBS (Gibco) and 100 U/ml
P/S.
2. The cells were kept in 37℃ incubator with 5% CO2 overnight until the cells are
about 70% confluent.
3. The 1.6 µg plasmid DNA in study was mixed with 50 µl OPTI-MEM medium.
4. Meanwhile, 4 µl Lipofectamine was diluted into 50µl OPTI-MEM medium and
incubated at room temperature for 5 minutes.
5. The two resulting DNA-complex and Lipofectin-complex were mixed together
gently and incubated at room temperature for about 20 minutes.
73
CHAPTER 2
Wang Kai
6. During this period time, the medium of 6-well plate was discarded and washed with
2 ml OPTI-MEM medium once and added 0.9 ml OPTI-MEM to each well.
7. The Lipofectin-DNA mixtures (about 100 µl) were added to the cells per well and
the cells were incubated at 37℃ for 12 hours in the 5% CO2 incubator.
8. The DNA containing medium was changed with 2 ml MEF-DMEM and the cells
are allowed to incubate at 37℃ for another 36hours in the 5% CO2 incubator.
9. The cells were assayed at 48 hours post-transfection.
2.8.2 Adenovirus mediated gene transfer
1. Adenoviral vectors were diluted to the desired concentration in Opti-MEM™
serum-free medium.
2. Growth medium was aspirate from tissue-culture plates, and cells were rinsed with
PBS.
3. Suspension of adenoviral vectors was applied in the smallest volume of
Opti-MEM™ necessary to cover the cells.
4. Adenoviral vectors were incubated with cells overnight at 37℃ in 5% CO2.
5. Viral infection medium was aspirated and replaced with appropriate growth
medium.
6. Cells were incubated at 37℃ in 5% CO2 for a further 24-48 hours.
7. Expression of green fluorescent protein (GFP) of transfected cells can be detected
using a fluorescence microscope.
74
CHAPTER 2
Wang Kai
2.9 Electrophysiology
2.9.1 Patch clamp experiments
Current recordings were performed in whole-cell voltage clamp mode on cells
superfused at room temperature (~23℃). Action potential recordings were performed
at 36±0.5℃ in current clamp mode. Borosilicate glass electrodes (1.2 mm OD) were
fabricated using a Sutter P-97 horizontal puller and had a tip resistance of 2 to 3 MΩ
when filled with pipette solution. For perforated-patch recordings, 100 μM
amphotericin B (Sigma-Aldrich) was added to the pipette solution.
The glass electrode was attached to a pipette holder of amplifier headstage. Before
lowering the electrode into the bathing solution, a slight positive pressure was applied
to the pipette through a flexible tube attached the side port. The tip of electrode then
was guided towards the cell to touch the cell membrane until an appropriate increase
in resistance (usually 1 MΩ) was observed. After releasing the positive pressure,
giga-Ω-seal could form automatically or facilitated by a slight suction. To establish
whole-cell mode, the patch of membrane under the pipette tip was broken by “ZAP”
function (a large current pulse sent through the pipette) in combination with a slight
negative pressure on the electrode.
For perforated patch clamp, whole-cell mode could establish without breaking the
membrane under the pipette tip, but via holes in membrane created by amphotericin B,
75
CHAPTER 2
Wang Kai
permeable to ions but not larger molecules including critically second messenger
molecules such as cAMP, thus largely avoiding replacement of the cytoplasm. Using
100 μM amphotericin B, perforated whole-cell mode would form within 30 minutes.
When the whole-cell mode established, cell capacitance was compensated and data
were acquired with the use of Pulse program and EPC-9 amplifier (Heka Electronik,
Lambrecht, Germany) while sampled at 2 kHz and low-pass filtered at 2 kHz.
2.9.2 Multielectrode Array (MEA) recording of monolayer cultured
NRVMs
Extracellular recordings from cultured NRVMs were performed using a
multielectrode array (MEA) recording system (Multi Channel Systems, Reutlingen,
Germany). The MEA plate consists of a 50×50-mm glass substrate, in the center of
which is embedded a 1.4× 1.4-mm matrix of 60 titanium-nitride, gold contact, 30 μm
diameter electrodes insulated with silicone nitride, in an 8×8 layout grid with an
interelectrode distance of 200 mm, respectively (there are no electrodes at the corners
of the matrix).
As mentioned in Section 2.1.3, NRVMs were cultured on the gelating-coated MEA
plate. To permit data recording, the MEA was removed from the incubator, placed in
the recording apparatus preheated to 36℃, and electrograms were recorded within 1-3
minutes. The raw signals were collected at 25 kHz, bandpass filtered, amplified and
stored by MC_Rack program. Firing rate, spike amplitude and conduction velocity of
76
CHAPTER 2
Wang Kai
A
B
C
Fig. 2.1 MEA system (from Multi Channel Systems, Reutlingen, Germany). A, basic
components of MEA system. B, the electrodes on the bottom of the MEA plate under
microscope. C, the standard electrodes layout of the MEA plate.
77
CHAPTER 2
Wang Kai
NRVMs were measured and calculated by Clampfit. Matlab was used to generate a
conduction map based on the time differences at which signals were detected at each
of the microelectrodes.
2.10 Data analysis
All data reported are means ± S.E.M. Statistical significance was determined for all
individual data points and fitting parameters using one-way ANOVA and Tukey's
HSD post hoc test at the 5 % level.
78
CHAPTER 3
Wang Kai
Chapter 3
Characterizing the basis of automaticity of neonatal rat
ventricular myocytes: Implications for cardiac excitability
manipulations
3.1 Introduction
Neonatal rat ventricular myocyte (NRVM) is one of the most widely used in vitro
models to study electrophysiological properties of the heart. When cultured in a
confluent monolayer, NRVMs can maintain spontaneous beating up to 40 days
(Harary et al., 1963). It has been suggested that pacemaker current-If plays an
important role in controlling the automaticity of NRVM. If, encoded by HCN channel
gene family, is activated by both membrane hyperpolarization and intracellular cAMP,
and depolarizes cells to the action potential threshold (or takeoff potential [TOP]). Qu
et al. (Qu et al., 2001) demonstrated that overexpression of HCN2 gene in NRVM led
to robust expression of If current and accelerated the spontaneous rate of CM.
Furthermore, Er et al. (Er et al., 2003) showed dominant-negative suppression of
HCN2 channels markedly reduced the native If current in NRVM and have made the
CMs to become quiescent. These results strongly supported a critical role of If current
in pacemaking.
Nevertheless, there are still some controversies about the dominant role of If in
79
CHAPTER 3
Wang Kai
pacemaking due to its intrinsically slow kinetics and negative activation relative to the
time scale and voltage range of cardiac pacing (Irisawa et al., 1993; Satoh, 2003;
Baruscotti et al., 2004). Furthermore, Eduardo et al. (Eduardo et al., 2007) proposed a
novel theory explaining the pacemaker mechanism of SA node cells. They suggested
that the crucial factor for pacing is the absence of the strongly polarizing IK1 current,
rather than the presence of special channels carrying inward current, such as If current.
Inward rectifier current IK1, encoded by Kir2 gene family, stabilizes the resting
membrane potential and thus suppresses the excitability. This notion was supported by
the observation that inhibition of Kir2.1-encoded IK1 in a dominant-negative way
could unleash latent pacemaker activity of normally-silent CMs to produce
spontaneous firing activity (Miake et al., 2002). In rat CMs, previous studies (Kilborn
et al., 1990; Wahler, 1992; Masuda et al., 1993; Haddad et al., 1997; Xie et al., 1997)
have documented that IK1 densities increase markedly during fetal heart development
until about neonatal day 5-13. This developmental change is responsible for the
shorting of APD and hyperpolarization of membrane potential. However, the
contribution of IK1 to the automaticity of cultured NRVM remains unknown. Precious
in-silico and mechanical experiments have suggested the relative activity of If and IK1
is important to induce and modulate the pacemaker activity (Azene et al., 2005b; Xue
et al., 2007). Accordingly, I hypothesized that there are changes in the functional
expression levels of If and/or IK1 current during the culture of NRVM, and result in the
corresponding change of SAP. A direct functional comparison between If and IK1
current regarding the contribution to automaticity in such an in vitro system will help
80
CHAPTER 3
Wang Kai
us discriminate their roles in cardiac pacing.
In the present study, the time-dependent change of SAP as well as the relationship
with If and IK1 current expression were studied using a combination of
electrophysiological recording and gene transfer techniques.
3.2 Methods
3.2.1 CMs isolation and culture
NRVMs were isolated and cultured using the protocol described in to Section 2.2.3.
3.2.2 Gene Transfer
Adenovirus mediated HCN1 gene transfer was performed using the protocol
described in Section 2.8.2. In brief, quiescent monolayer culture of NRVM was
transfected with AdHCN1∆235–237-GFP (AdHCN1-∆∆∆) (Tsang et al., 2004). As
described in Chapter 2, AdHCN1-∆∆∆ is an adenovirus construct of HCN1 channel
mutant, whose S3-S4 linker has been shortened and featured with low activation
threshold and rapid opening velocity. The culture medium was removed from each
dish, and a virus containing culture medium was added. The dishes were kept at
37°C in a humidified atmosphere of 95% O2 and 5% CO2 overnight, and then the
supernatant was discarded. The dishes were washed, refilled with the normal culture
81
CHAPTER 3
Wang Kai
medium, and remained in the incubator for 1 day before electrophysiological
experiments were conducted.
3.2.3 Electrophysiological Recording
Patch clamp experiment was performed as described in Section 2.9. Briefly, ion
current recordings were performed in whole-cell patch clamp mode on cells
superfused at room temperature (~23°C), whereas action potential recordings were
performed using perforated-patch technique at 36±0.5°C. For perforated-patch
recordings, 100 μM amphotericin B was added to the pipette solution (Rae et al.
1991). For If/IHCN recordings, [K+]o was increased to 25 mmol/L, and BaCl2 2 mM,
CdCl2 200 μM, and 4-aminopyridine 4 mM were added to block IK1, ICa,L, and Ito,
respectively. If/IHCN size was measured as the difference between the instantaneous
current at the beginning of a hyperpolarizing step ranging from -30 to -140 mV in 10
mV increments and the steady-state current at the end of hyperpolarization for 3 sec.
For IK1 recordings, 200 μM CdCl2 was added to block ICa,L, and INa was steady-state
inactivated by using a holding potential of –40 mV. To obtain IK1 as a Ba2+-sensitive
current, currents recorded before and after the addition of 2 mM BaCl2 were
subtracted.
3.2.4 Multielectrode Array (MEA) Recording
In vitro multielectrode array (MEA) recordings were performed using the protocol
described in Section 2.9. To construct the activation maps, the filtered signal was
82
CHAPTER 3
Wang Kai
differentiated digitally to determine the local activation time (LAT) at each electrode.
Color-coded activation maps were constructed by plotting the LAT values against the
electrode sites and extrapolating the LAT values for the four corners of the MEA
matrix. Activation maps were generated using the Matlab standard two-dimensional
plotting function (pcolor) (Matlab 5.3; Mathworks Inc.).
The conduction velocity (CV) is calculated using the method described previously
(Meiry et al., 2001). The CV vector is expressed as [dx/dt, dy/dt], and t(x,y) describes
the activation time as a function of the electrode position. The gradient of t(x,y) is
always normal to the isochrones and defines the direction of propagation. The
components of a differential vector [dx, dy], therefore, always satisfy Equation 1:
dy/dx = ∂t/∂y/∂t/∂x
(1)
Points on the surface t(x,y) separated by [dx, dy] are related by the identity:
dT = dx ∂t /∂x + dy ∂t /∂y
(2)
From Equations 1 and 2, the CV vectors can be calculated:
CVx= dx/dt = Tx /(Tx2 + Ty2)
(3)
CVy = dy/dt = Ty /(Tx2 + Ty2)
(4)
where Tx = ∂t /∂x, and Ty = ∂t /∂y.
The CV was initially determined for each of the 60 electrodes individually, and CV
83
CHAPTER 3
Wang Kai
at each electrode position was calculated using the LAT at the four surrounding
electrodes (except for the external electrodes, which are bounded by only three
electrodes). Thus, the CV of the culture was defined as the mean CV of all 60
electrodes (Equations 5 to 10):
Txi,e = (t(i - 1,e) - t(i + 1,e))/(∆XL)
(5)
Tyi,e = (t(i - 1,e) - t(i + 1,e))/(∆YL)
(6)
CVxi,e = Txi,e/(Txi,e2 + Tyi,e2)
(7)
CVyi,e = Tyi,e/(Txi,e2 + Tyi,e2)
(8)
CVi,e = (CVxi,e2 + CVyi,e2)1/ 2
(9)
8
8
CV = [∑∑ CVi ,e ] / 60
(10)
i =1 e =1
where ti,e is the LAT at electrode (i,e), and ∆XL and ∆YL are twice the distance
between the electrodes.
3.2.5 Statistical Analysis
All data reported are means ± S.E.M. Statistical significance was determined for all
individual data points and fitting parameters using one-way ANOVA with Tukey's
HSD post hoc test. Calculations were performed OriginPro 7.5 software (OriginLab
Corporation, Northampton, MA). A p value <0.05 was considered statistically
significant.
84
CHAPTER 3
Wang Kai
3.3 Results
3.3.1 Bi-phasic changes of the SAP of individual NRVM
Consistent with the findings from previous studies (Kilborn et al., 1990; Haddad et
al., 1997), no SAP was observed from 12 cells in 3 rounds of experiments in freshly
isolated NRVMs (data not shown). The electrophysiological properties of these cells
resembled those of mature ventricular myocytes. After cultured for 24 hours,
spontaneous firings were recorded from a small portion of individual NRVMs (5 out
of 18) with a mean firing frequency of 62.6±17.4 beats per minute (bpm). As shown
in Figure 3.1, the representative recording of NRVM on day 1 revealed the features
of action potential at the beginning of culture with negative MDP/RMP (-71.0±1.8
mV, n=18), rapid maximum action potential upstroke (288.2±41.6 mV/s, n=5) and
phase 4 depolarization (43.6±12.4 mV/s, n=5), short action potential duration
(APD50=81.4±10.5 ms and APD90=144.4±7.6 ms, n=5), and irregular quiescent
periods between beats. In addition to the spontaneous firing cells, incomplete “phase
4-like” depolarizations that fail to initiate firing could be observed in 2 cells.
On day 3-4 of NRVM culture, their firing rates increased rapidly to a peak of
194.3±12.3 bpm with a MDP of 67.6±1.7 mV (10/13, 77%) (Figure 3.2). Instead of
an inconstant quiescent period between action potential as observed in day 1, the
repolarization phase of action potential was followed by a rapid depolarization to the
threshold of firing in day 4 NRVM culture. On day 9 of NRVM culture, the firing
85
CHAPTER 3
Wang Kai
Day 1
Day 4
Day 7
Day 14
HCN1∆∆∆
transduction
Fig. 3.1 Representative SAPs recorded from control and HCN1-∆∆∆ transduced
NRVMs at 36°C. A single AP was magnified to the right for comparison.
86
CHAPTER 3
Wang Kai
A
B
Fig. 3.2 Summary of SAP parameters. Time-dependent change of firing rate (A) and
MDP/RMP (B) of control and HCN1-∆∆∆ transduced cells
87
CHAPTER 3
Wang Kai
rate of individual cells slowed down with prolonged phase-4 depolarization. As a
result, electrically quiescent cells dominated the NRVM culture over the recordings
(8/11, 73%). After 2 week culture of NRVM, most of CM had become quiescent
(11/13, 92%).
As summarized in Figure 3.2B, MDP/RMP also showed a bi-phasic change during
the culture similar to the firing rate. The average MDP/RMP was -71.0±1.8 mV on
day 1-2 and shifted more positively to -63.0±2.5 mV on day 5-6 (n=15), close to
those values reported by Viswanathan et al. (Viswanathan et al., 2003). Accompanied
with the decline of firing rate, the MDP/RMP reverted to a hyperpolarized level,
which was -67.8±3.1 mV on day 13-14 (n=13).
Similar trends were observed in the APD as evaluated at 50% (APD50) and 90%
(APD90) repolarization from the overshoot to MDP. As showed in Figure 3.3A, on
day 1-2 and day 3-4 of NRVM culture, APD90 was relatively short at 144.4±7.6 ms
(n=5) and 141.1±5.7 ms (n=10), respectively. Then the prolongation of APD was
observed from day 5 to 8 (212.1±12.8ms on day 5-6, n=15 , 198.5±18.0 ms on day
7-8, n=11, p<0.01) when the automaticity began to slow down. Thereafter, APD
partially recovered when cells became quiescent from day 9 to 14 (170.2±31.4 ms on
day 13-14, n=2). The changes in APD50 were the same as APD90, suggesting the
changes in APD were largely due to the change of the depolarization phase.
88
CHAPTER 3
Wang Kai
In contrast to the bi-phasic change of the firing rate, MDP/RMP and APD during
culture, the maximum upstroke velocity and phase-4 depolarization slop decreased
constantly, and TOP (the starting potential of phase-0 fast depolarization) of AP
shifted in the positive direction during the culture (Figure 3.2B-3.4). These results
reflected a profound change of electrical properties of NRVM in culture.
3.3.2 If current can not account for the automaticity change but can
still pace the quiescent NRVMs
To investigate the role of If current in the change of automaticity of individual
NRVMs, the functional expression of If current were monitored daily in these cells. If
was elicited by hyperpolarizing steps to -40 to -140 mV from a holding potential of
-30 mV. Under the physiological extracellular K+ concentration ([K+]o=5 mM) and at
room temperature, no measurable hyperpolarization-activated inward current could
be elicited from NRVMs (data not shown). As reported previously (Er et al., 2003), If
current was determined after [K+]o was increased to 25 mM in present study (Figure
3.5). Although the automaticity of NRVM changed dramatically, the If current
density remained fairly stable, which were -5.2±1.1 pA/pF (n=8), -5.1±1.4 pA/pF
(n=6) and -4.3±1.3 pA/pF (n=5) on day1-2, 7-8 and 13-14, respectively (p>0.05)
(Figure 3.6A). Moreover, the activation curve on day1 and day13 was close to each
other with the similar half activation potential (V1/2) of -109.1±4.2 mV (n=4) and
-113.2±1.7 mV (n=3) respectively (p>0.05). These values were within the range of
V1/2 of ventricular myocytes reported previously (Ludwig et al., 1999a). These data
89
CHAPTER 3
Wang Kai
A
B
Fig. 3.3 Summary of SAP parameters. Time-dependent change of APD50 and APD90
(A) and maximum AP upstroke velocity (B) of control and HCN1-∆∆∆ transduced
cells.
90
CHAPTER 3
Wang Kai
A
B
Fig. 3.4 Summary of SAP parameters. Time-dependent change of phase 4
depolarization slope (A) and TOP (B) of control and HCN1-∆∆∆ transduced cells.
91
CHAPTER 3
Wang Kai
∆∆∆
Fig. 3.5 Representative If current recordings of control (day 1 and 13) and
HCN1-∆∆∆ transduced cells showed If remained relatively unchanged in culture and
increased significantly in altitude after HCN1-∆∆∆ transduction.
92
CHAPTER 3
Wang Kai
A
∆∆∆
B
∆∆∆
Fig. 3.6 Summary of If current in culture. A, If current density at -140 mV of control
and HCN1∆∆∆ transduced cells; B, Activation curve of control (day 1 and 13) and
HCN1∆∆∆ transduced cells.
93
CHAPTER 3
Wang Kai
suggested that the time-dependent change of SAP of NRVM in culture did not
involve If current.
Nevertheless, If current alone can still plays a critical role in determining the
automaticity of the excitable cells. HCN1-∆∆∆ is an engineered construct, the S3-S4
linker of which has been systematically shortened to favor channel opening and
thereby compensate for any context-dependent gating effects. Transduction of
NRCM with AdHCN1-∆∆∆ on day 13 resulted in robust expression of If current with
the current density of -27.5±4.7 pA/pF, n=4 at -140 mV under a physiological [K+]o
(5mM), which was much bigger than that of control cells recorded at [K+]o of 25mM
(Figure 3.5, 3.6A). The overexpression of HCN1-∆∆∆ also shifted the activation
curve in the positive direction with a V1/2 of -56.3±4.5 mV (Figure 3.6B) as shown
previously (Tsang et al., 2004). As the result of adenovirus mediated HCN1-∆∆∆
overexpression, the firing rate of 104.8±18.9, n=5 bpm was achieved in 13-day old
quiescent cells one day after transduction (Figure 3.1, 3.2A). Furthermore, a positive
shift of MDP (-52.3±3.8 mV) and prolongation of APD (APD50 572.6±70.2 ms;
APD90 707.0±80.2 ms) were also observed (Figure 3.3A).
3.3.3 Correlation between IK1 current and the automaticity change
of NRVM
Similarly, IK1 current of individual NRVM was recorded every day during the 14
days of culture at a hyperpolarizing membrane potential from 0 to -120 mV with a
94
CHAPTER 3
Wang Kai
holding potential of -40 mV at the interval 10 mV (Figure 3.7). At -120 mV, the
current density in the cultured cells was -16.9±2.7 pA/pF (n=14) on day 1-2 and
declined rapidly to the valley of -4.4±1.6 pA/pF on day 5-6 (n=14). Since then, it
recovered partially and remained at about -6.0 pA/pF (n=15) by the end of 14 days
culture (Figure 3.8A). The current-voltage (IV) relationships of IK1 current during the
culture is shown in Figure 3.8B. Although the current density changed along the
culture, the inward rectifier and reversal potential remained the same at between -80
to -70 mV.
Since IK1 current show a similar bi-phasic change to that of SAP, correlation analysis
was performed to examine the relationships between various AP parameters and IK1
properties to elucidate the mechanistic role of IK1 current in NRVMs. As shown in
Figure 3.9, the MDP/RMP (r=0.89), APD50 (r=0.73) and APD90 (r=0.75) of NRVM
during the culture were positively correlated to the IK1 density at -120mV. By
contrast, no obvious correlations were observed between firing rate and IK1 current
density (Figure 3.9 C). These results imply that the change of IK1 can only explain
the change of MDP/RMP and APD, rather than the time-dependent change of
automaticity.
3.3.4 The automaticity change of monolayer culture of NRVM
To compare the electrical properties between individual and monolayer of NRVMs
of population, the electrical activities of monolayer culture of NRCM were
95
CHAPTER 3
Wang Kai
Day 1
Day 5
Day 13
Fig. 3.7 Representative IK1 current trace of control (day 1, 5 and 13) cells
96
CHAPTER 3
Wang Kai
A
B
Fig. 3.8 A, IK1 current density at -120 mV of control cells showed IK1 exhibited a
bi-phasic time-dependent change in accordance with that of AP; B, IV curve of
control (day 1,5 and 13) cells showed reversal potential is about -75 mV.
97
CHAPTER 3
Wang Kai
A
B
C
Fig. 3.9 A, The MDPs (or RMP) of NRVM were plotted against the IK1 current
density at the same time point. A strong linear correlation (r=0.89) was observed,
suggesting the bi-phasic change of MDP (or RMP) is caused by the change of IK1. B,
The correlation between APD50/90 and IK1 is relatively weak. (r=0.73 and 0.75,
respectively) C, Correlation was absent between firing rate and IK1 current density,
suggesting the change of IK1 could not account for the time-dependent change of
automaticity.
98
CHAPTER 3
Wang Kai
monitored using MEA recording. Total 6 MEA plates were recorded in 3 rounds of
cultures. Unlike the individual cells, synchronized firing could not be recorded after
day 3. The initial firing rate of monolayer culture was 36±7.9 bpm, which was only
half of that of the individual NRVMs on day 1. The time to the peak of firing rate
also showed a delay (on day 8) compared with that of individual NRVMs (on
around day 4). Nevertheless, the fastest firing rate of 220±29.5 bpm was
comparable to that of individual NRVMs. The firing rate then declined very slowly
to 98±25.6 bpm on day 40 (Figure 3.10 and 3.11A). Surprisingly, the automaticity
of monolayer culture ceased suddenly instead of slowing down further around day
48. Transducing completely quiescent monolayer cultures with AdHCN1-∆∆∆
could partially restore the spontaneous beating with a firing rate of 86.0±23.7 bpm,
which can last for about 4 days. This finding provided further evidence to support
the pacemaking function of If current.
Along with the decrease in the firing rate, the CV and the filed potential amplitude of
the monolayer culture reduced to about one half from 75.3±9.4 μm/ms and
569.3±39.2 μV on day 8 to 36.0±3.4 μm/ms and 301.4±30.8 μV on day 43,
respectively (Figure 3.11B and C). This decrease of CV could not be reversed by
transduction of AdHCN1-∆∆∆. It is notable that after AdHCN1-∆∆∆ transduction,
the filed potential amplitude reduced significantly to 57.9±5.5 μV, about one sixth of
that on day 43 (Figure 3.10, 3.11C), which may reflect the death of cells in culture.
99
CHAPTER 3
Wang Kai
Fig 3.10 Representative MEA recordings of control and HCN1-∆∆∆ transduced
monolayer cultures showed automaticity remained up to 48 days and partially
recovered after HCN1∆∆∆ transduction.
100
CHAPTER 3
Wang Kai
A
B
C
Fig. 3.11 Summary of MEA recording parameters of NRVM monolayer culture. A,
firing rate of control and HCN1-del transduced monolayer cultures; B, CV of control
and HCN1 ∆∆∆ transduced monolayer cultures; C, amplitude of field potential of
control and HCN1-∆∆∆ transduced monolayer cultures
101
CHAPTER 3
Wang Kai
3.4 Discussion
3.4.1 Bi-phasic change of the automaticity of cultured NRVMs
The cultured NRVMs are able to contract spontaneously and rhythmically in a
manner similar to the whole heart when forming a confluent monolayer. Since the
first report by Harary in 1963, it has become one of the most widely used in vitro
model to study the electrophysiological properties of the heart, especially in the
study of ischemia, hypoxia damage and the effect of various drugs (Harary et al.,
1963). Although the electrophysiological properties of NRVM, regarding the
voltage-gated Na+, Ca2+, IK1, If and Ito channels have been extensively studied
(Schanne et al., 1989; Kilborn et al., 1990; Fermini et al., 1991; Xu et al., 1991;
Huynh et al., 1992; Wahler, 1992; Masuda et al., 1993; Robinson et al., 1997; Walsh
et al., 2002), the mechanism underlying the emergence and disappearance of
spontaneous activity of cultured NRVM remains unclear.
In present study, a small potion of NRVMs started to exhibit the SAPs at low rate
after cultured overnight, whereas the freshly isolated cells lacked automaticity at all.
During the culture, the proportion of cells that exhibited SAPs and the firing rate
increased significantly until day 4, and decreased thereafter, showing a bi-phasic
change. Similar trends were also observed when measuring the MDP\RMP and APD.
It seems that the latent automaticity of NRVMs was unleashed at beginning of
culture and faded shortly, probably due to the functional change of one or more ion
102
CHAPTER 3
Wang Kai
channels that influence the automaticity, the MDP and the APD of the cell. The
change in pacemaker current If and/or inward rectifier current IK1 are the most
possible mechanism underlying this phenomena.
3.4.2 The mechanical role of If and IK1 in controlling the
automaticity of NRVMs
It is well accepted that If current is the major component of inward current that
determining the phase 4 depolarization and thus the pacing of sinus node cells
(Baruscotti et al., 2004). In NRVMs, Qu et al (Qu et al., 2001) and Er et al (Er et al.,
2003) have proven the critical role of If in modulating the automaticity. In this study,
no measurable If current could be recorded at physiological extracellular K+
concentration (5 mM) at room temperature. Furthermore, the current density of If
current at [K+]o of 25 mmol/L and its activation relation remained unchanged during
the culture, in sharp contrast to the dramatic bi-phasic change of SAP. This finding
suggested that If current is not responsible for the NRVM time-dependent change of
automaticity in culture. Nevertheless, functional expression of If current by
adenovirus mediated HCN1-∆∆∆ overexpression could recover the automaticity of
either individual NRVMs or monolayer cultures when they became quiescent. These
findings support that If current is a crucial initiator of the pacemaker activity, but
may modulate the pacing activity of NRVM in a subtle manner and also depends on
the activity of other ion current(s). Therefore the time-dependent change of NRVM
automaticity can be counterbalanced by predominant If current expression through
103
CHAPTER 3
Wang Kai
gene transfer.
Compared with If current, the relationships between IK1 current and AP and RMP
have drawn attention of researchers much earlier. In addition to contribution in
phase-3 repolarization, IK1 is thought to stabilizes a negative resting membrane
potential (-80 mV) and suppresses any latent spontaneous electrical activity (Lopatin
et al., 2001). Direct evidences supporting this notion were first provided by Hirano
and Imoto in 1980s. They reported that blocking IK1 by Ba2+ could induce
automaticity of isolated guinea pig ventricular myocytes (Imoto et al., 1987; Hirano
et al., 1988). Miake et al. (Miake et al., 2002) further confirmed their findings in a
more specific way. They demonstrated genetic inhibition of Kir2-encoded IK1 in a
dominant negative manner can unleash the latent pacemaker activity of normally
silent ventricular myocytes in vivo to produce spontaneous firing activity. Based on
these evidences, Eduardo and He Cheol (Eduardo et al., 2007) proposed that the
crucial factor for pacing is the absence of the strongly polarizing IK1 current, rather
than the presence of special channels carrying inward current, such as If current.
In present study, IK1 current was found to decrease and increase in accordance with
the change of the firing rate and the MDP\RMP of individual NRVM. During the
first week of culture, the IK1 current decreased dramatically from -16.9±2.7 pA/pF on
day 1-2 to -4.4±1.6 pA/pF on day 5-6. It seems that the decrease of IK1 current
unleashes the latent automaticity of NRVMs in culture and leads to the increase of
104
CHAPTER 3
Wang Kai
firing rate within 1-week culture. However, as revealed by the absence of the
correlation between IK1 current density and firing rate, the change of IK1 current
alone is not sufficient to explain the vanish of automaticity of NRVMs in culture
longer than 1 week. Also it was notable that during the culture, APD50 prolonged in
accordance with APD90, as reflected from similar correlation factors with IK1 current.
Taking into account that IK1 contributes mainly to the phase-3 repolarization, these
results suggest that IK1 current is just one of the components responsible for the
change of spontaneous activity of NRVMs, whose activity mask the latent autonomic
activity of NRVM.
It is well known that in addition to IK1 and If current, voltage-gated sodium (INa) and
calcium (ICa) currents are also important to the electrical activity of the CMs. In the
central SA node cells, block of L-type Ca2+ current ICa,L abolishes the action potential
because it is responsible for the upstroke of action potential (Kodama et al., 1997).
Furthermore, blockade of INa by tetrodotoxin (TTX) has been shown to slow
pacemaking in the periphery SA node cells (Kodama et al., 1997). Interestingly, a
recent study demonstrated that TTX can prolong the APD of electrically active
AdHCN1-∆∆∆ transduced left ventricular CMs (Xue et al., 2007). This increase was
associated with a decrease in the maximal upstroke velocity of AP, as well as a
depolarized TOP. This phenomenon is similar to the change of SAP of NRVMs in
present study, suggesting a decrease in INa current may be responsible for the silence
of long-term cultured NRVMs.
105
CHAPTER 3
Wang Kai
3.4.2 The electrophysiological differences between individual
NRVMs and monolayer cultures and clinical implications
In this study, the automaticity of individual NRVM in culture could be maintained up
to only 2 weeks. However, the autonomic activity of the monolayer culture recorded
by MEA lasted for up to 48 days, even though the contraction became invisible. It
seems that the electrical properties of monolayer culture of NRVM can not be well
predicted from that of single cells, probably due to the contribution of cell-cell
communication in monolayer culture. In monolayer form, one or more sites of
“pacemaker” may form during long-term culture of NRVM (Figure 3.12), probably
consisting of cells from conductance system which can keep high automaticity for a
long time. These pacing sites can drive the other non-autonomic NRVMs through
electrical coupling formed by gap junctions and lead to a synchronized contraction
of the whole patch. In consistent with this notion, Yasui et al. (Yasui et al., 2000)
have demonstrated that gap junction channels are important in maintaining the
electrophysiological activities and the life of the culture NRVM.
After AdHCN1-∆∆∆ transduction, the spontaneous firing only lasted for no more
than 4 days, accompanied by further decrease of CV. Therefore, overexpression of
HCN1-∆∆∆ could not overcome the dysfunction of intercellular coupling in present
study. Although the mechanism remains unclear, it is possible that the decreased
expression or dysfunction of connexin-encoded gap junction during culture, reflected
from the decreased conductance velocity shown in this study, may increase the
106
CHAPTER 3
Wang Kai
Fig. 3.12 Color-coded activation maps from a representative culture shows the origin
of firing changed and the CV decreased during the culture.
107
CHAPTER 3
Wang Kai
resistance of impulse propagation among cells. This can subsequently result in the
silence of the monolayer culture due to the electrical discoupling between cells. In
conclusion, the findings of this study provide further important mechanistic insight
into spontaneous automaticity of CM. These results provide useful information in the
development of novel therapeutic strategies for engineering cardiac excitability to
reverse the electrical defects in certain arrhythmias.
108
CHAPTER 4
Wang Kai
Chapter 4
Probing the bradycardic drug binding receptor of
HCN-encoded pacemaker channels
4.1 Introduction
Pacemaker activity, the generation of spontaneous cellular electrical rhythms,
governs numerous biological processes from the autonomous beating of the heart to
respiratory rhythms and sleep cycles. In the heart, abnormal pacemaker activity leads
to various forms of arrhythmias (e.g. sick sinus syndrome). Pacemaker current-If, a
diastolic depolarizing current activated by hyperpolarization, is a key player in
cardiac pacing. Although If has been recognized for over a quarter century, the
encoding genes, collectively known as the HCN gene family, were only cloned in
1998 (Gauss et al., 1998; Ludwig et al., 1998; Santoro et al., 1998).
Structurally, like voltage-gated K+ (Kv) channels, HCN channels consist of four
homologous monomers pseudo-symmetrically arranged around a central pore; each of
the four internal repeats is made up of six transmembrane segments (S1-S6; Figure 4.1).
The region between S5 and S6 segments, or the so-called P-loop, inserts back into the
membrane to form part of the pore. Indeed, the pore is analogous to the active site of an
enzyme where major functional (e.g. ionic selectivity, conductance and gating) and
pharmacological determinants are located (Ludwig et al., 1999a; Li et al., 2004).
109
CHAPTER 4
Wang Kai
A
B
Fig. 4.1 Schematic diagram and sequence alignment of the HCN1 and Kv channels.
A, the six putative transmembrane segments (S1–S6) of a monomeric HCN1 subunit.
Ala-scanning substitutions were introduced into 3 different regions: selectivity filter
(SF; C347A, I348A, G349A, G351A), outer (P355, V356, S357, M358) and inner
(M377A, F378A, V379A) pore vestibule. B, the amino acid sequences of HCN1-4
and KV channels from the P-loop to S6. Substituted residues are highlighted in bold.
110
CHAPTER 4
Wang Kai
Given the physiological importance of If, several bradycardic drugs such as ZD7288
and ivabradine that target HCN channels have been developed. However, the
molecular constituents of the HCN channel drug binding receptor have not been
elucidated. A better understanding for the drug binding receptor is crucial for
designing more effective and HCN-specific drugs. For voltage-gated K+ (Kv) and
Na+ (Nav) channels, their drug binding sites have been identified to locate in the pore
regions. Given the structural similarities between HCN and Kv channels, I
hypothesize that the drug receptor (for ZD7288) of HCN channels is similarly
located in the pore. Consistent with this notion, previous studies have demonstrated
that ZD7288 applied from the cytoplasmic side can enter and leave the inner pore of
HCN1 channels only at voltages where the activation gate is opened (Shin et al.,
2001).
In the present study, the technique of Ala-scanning mutagenesis was used to identify
several pore residues that were crucial for bradycardic drug binding. These results
are discussed in relation to the molecular composition of the HCN drug receptor as
well as the mechanism of ZD7288 blockade.
111
CHAPTER 4
Wang Kai
4.2 Methods
4.2.1 Molecular Biology and Heterologous Expression
Murine HCN1 cDNA (a generous gift of Drs. Siegelbaum and Santoro, Columbia)
was cloned from mouse brain RNA (Santoro et al., 1998) and subcloned into the
mammalian expression vector pCI (Promega, Madison, WI, USA) (Ishii et al., 2001).
Desired substitutions were constructed as previously described (see Section 2.6)
(Xue et al., 2002b), followed by full sequencing to confirm for the absence of stray
mutations. HCN1 channels were transiently expressed in human embryonic kidney
293 cells (HEK293) using Lipofectamine Plus 2000 (Invitrogen, Carlsbad, CA)
using the protocol described in Section 2.4.1 (Tsang et al., 2004). For identifying
HCN1-expressing cells, the channel plasmid was co-transfected with pCI-GFP with
a ratio of 10:1. 24-48 hours after transfection, cells were trypsinized and plated on
glass-bottomed culture dishes 2 hours prior to patch-clamp or immunohistochemical
experiments.
4.2.2 Electrophysiology
Whole-cell patch-clamp recordings were performed using protocol described in
Section 2.9. Only GFP-expressing HEK293 cells as identified by their epiflourescence
with an excitation wavelength of 488 nm were selected for experiments. All
recordings were performed at room temperature. The ingredients of bath solution and
the internal solution were given in Section 2.1.2. ZD7288 was diluted to the final
112
CHAPTER 4
Wang Kai
concentrations in the bath solution as indicated and was administrated via superfusion
with a perfusion system. For obtaining the dose-response curves (also see below), the
current amplitude at -100 mV was continuously monitored every 20 seconds. ZD7288
perfusion or washout was initiated after achieving stable recording for at least 3
minutes.
4.2.3 Experimental Protocols and Data Analysis
The steady-state current-voltage (IV) relationship was determined by plotting
currents measured at the end of a 3-s pulse ranging from -140 to 0 mV from a
holding potential of -30 mV against the test potentials. The voltage dependence of
HCN channel activation was assessed by plotting tail currents measured immediately
after pulsing to -140 mV as a function of the preceding 3-s test pulse normalized to
the maximum tail current recorded (Figure 4.2). The data were fit to the Boltzmann
functions using the Marquardt-Levenberg algorithm in a nonlinear least squares
procedure:
m= 1/(1 + exp((Vt – V1/2)/k))
where Vt is the test potential; V1/2 is the half-point of the relationship; k = RT/zF is
the slope factor, and R, T, z, and F have their usual meanings.
The time constant for activation (τact) was estimated by fitting macroscopic currents with a
113
CHAPTER 4
Wang Kai
Fig 4.2 Representative recording of WT HCN1 using the voltage protocol provided in the inset. Trace a, -140 mV; trace b, -100 mV; trace c, -70
mV. Activation tail currents are enclosed in dashed boxes and magnified to the right. Steady-state activation relationship based on the tail current
is also showed.
114
CHAPTER 4
Wang Kai
monoexponential function. A sigmoidal time course after an initial delay but before
the onset of HCN1 currents was observed in some constructs at some voltages. This
poorly defined property of HCN channels was beyond the scope of the present study
and was excluded from the analyses.
The time course of ZD7288 block was fitted with the following single-exponential
equation:
F= (1 - S) × exp(-t/τon) + S
where F is the fraction of remaining current measured at -100 mV in the presence of
ZD7288, t is the cumulative exposure time, τon is the time constant for ZD7288
blocking, and S is the steady-state plateau.
The association (kon) and dissociation (koff) constants at -100 mV were determined by
the following equations,
koff = 1/τoff, kon = ((1/ τ on)-(1/τoff))/ [ZD7288],
KD = koff / kon.
For half-blocking concentration (IC50), the following binding isotherm was used:
I/IO=1/(1+([blocker]/IC50)n)
115
CHAPTER 4
Wang Kai
where n is the Hill's coefficient, IO and I are the peak currents measured at the voltage
indicated before and after blocker application, respectively. The Hill coefficient for
WT as estimated from the fit was 1, suggesting that a single drug binding site exists.
Thus, n=1 was used for all other Ala-substituted constructs. All IC50 values reported
were calculated from individual determinations (i.e. curve fitting to data from
individual experiments). The curves presented in figures were fitted to averaged data
points pooled from all experiments.
4.2.4 Immunostaining
The
membrane
expression
of
HCN1
channel
was
examined
using
the
immunohistological method described in Section 2.5 with the HCN1 rabbit polyclonal
antibodies (Alomone labs, Jerusalem, Israel) at a dilution of 1:200.
4.2.5 Statistical Analysis
All data presented were the means ± S.E. Statistical significance (p<0.05) was
determined using an unpaired Student’s t test.
116
CHAPTER 4
Wang Kai
4.3 Results
As a first step for probing the drug binding receptor of HCN channels, single Ala
substitutions were systematically introduced into three pore regions of HCN1
channels (Figure 4.1): i) the selectivity filter at the interface between the cytoplasmic
and extracellular sides of the pore, ii) the outer and iii) the inner pore vestibules. A
total of 11 Ala-substituted HCN1 pore constructs were generated that correspond to
these regions: C347A, I348A, G349A and G351A in the ascending limb of the P-loop,
P355A, V356A, S357A and M358A in the P-S6 linker that forms part of the extrapore,
and M377A, F378A and V379A in the S6 segment that constitutes part of the
cytoplasmic pore mouth.
Among these constructs, I348A, G349A, G351A, P355A and V356A channels did not
produce functional currents in 5 rounds of transfection (Figure 4.3). Residues 349-351
form the GYG motif that is crucial for permeation (Xue et al., 2002b).
Immunostaining of wild-type (WT), I348A, G349A, G351A and P355A HCN1
channels expressed in HEK293 cells indicate that these non-functional constructs
were indeed localized to the membrane surface in a manner similar to WT (Figure
4.4), suggesting that the loss of function did not result from defects in protein
synthesis, folding or trafficking. In stark contrast, all of C347A, S357A, M358A,
M377A, F378A and V379A channels expressed robust hyperpolarization-activated
currents. These constructs were further characterized for their drug sensitivity as
described below.
117
CHAPTER 4
Wang Kai
Fig 4.3 Representative recordings of Ala-substituted constructs using the same protocol as shown in Fig 3.2. P355A, V356A in the outer pore
vestibule and I348A, G349A, G351A in the P-loop produced no measurable hyperpolarization-activated time-dependent currents.
118
CHAPTER 4
Wang Kai
Fig. 4.4 Immunostaining showed that the four disfunctional channel proteins (I348A,
G349A, G351A, P355A) were localized to the membrane surface, in a manner similar
to that of WT.
119
CHAPTER 4
Wang Kai
4.3.1 Ala substitutions in the HCN1 pore influenced ZD7288 block
Figure 4.5 shows the effects of ZD7288 blockade on WT and Ala-substituted HCN1
channels. Representative current tracings in the absence and presence of ZD7288 are
given at concentrations as indicated. For WT channel, 30 µM and 100 µM ZD7288
reduced the maximum steady-stated current at -100mV to 53.0±2.9% and 23.4±3.2%,
respectively. The complete dose-response relationship for ZD7288 blockade of WT
channel is given in Figure 4.6A, and the corresponding IC50 as estimated from this
binding curve was 34.5±3.2 μM (n=10, Figure 4.6B). The S357A and M358A
channels displayed IC50 values (33.1±7.1 μM, n=5 and 31.8±5.6 μM, n=5 respectively)
identical to WT (p>0.05).
Interestingly, the binding curves of C347A, F378A and V379A channels were
rightward shifted, indicating that these pore substitutions reduced the sensitivity of
HCN1 channels to ZD7288 block (p<0.05). Their IC50’s were 103.9±10.8 μM (n=9),
473.6±44.2 μM (n=5) and 392.4±58.0 μM (n=5), respectively. Despite its proximity
to F378 and V379, the S6 residue M377A exerted the opposite effect by rendering
HCN1 channels more sensitive to ZD7288 block (IC50=4.2±0.8 μM, n=9; p<0.05).
Collectively, these observations suggest that the effects of the Ala pore substitutions
on ZD7288 block were site-specific.
4.3.2 Kinetic Analysis of ZD7288 Block
To explore the mechanisms underlying the effects of WT, C347A, M358A, S357A
120
CHAPTER 4
Wang Kai
Fig. 4.5 The effects of Ala-substitutions on ZD7288 block of the HCN1 channel. Representative current tracings of WT and Ala-substituted
HCN1 channels elicited by hyperpolarization to -100 mV from a holding potential of -30 mV in the absence and presence of ZD7288 as
indicated.
121
CHAPTER 4
Wang Kai
A
B
Fig. 4.6 The effects of Ala-substitutions on ZD7288 block of the HCN1 channel. A,
dose-response relationships for ZD7288 block of the same channels. Normalized
steady state currents at -100 mV were plotted as a function of extracellular ZD7288
concentrations. Data points were fitted with a binding isotherm to estimate the IC50
for ZD7288 of each channel. B, summary of IC50 from A. Dashed line indicates the
level of WT sensitivity. Asterisks indicate statistical differences (p <0.05) compared
with WT.
122
CHAPTER 4
Wang Kai
M377A, F378A and V379A HCN1 channels, a detailed kinetic analysis of ZD7288
block were performed. Figure 4.7 shows a typical example of the time course of
development of 100 µM ZD7288 blockade of WT channels (panels A and C) and the
current recovery from inhibition upon drug washout (panels B and D) under the
recording conditions. The association (τon) and dissociation (τoff) time constants as
estimated by fitting these data with a single exponential function were 203.4 s and
1478.2 s, respectively. The corresponding resultant rate constants for binding and
unbinding (i.e. kon and koff), and the equilibrium constant (KD) were 42.4 M-1s-1,
6.8×10-4 s-1 and 16.0 μM, respectively (Table 4.1).
Similar kinetic analysis of ZD7288 blockade was performed on the Ala-substituted
pore constructs (Figure 4.8-4.13). The rate constants for these channels are
summarized in Figure 4.14. As anticipated from their lack of effect on the IC50 for
ZD7288 blockade, S357A and M358A had effect on neither kon nor koff (p>0.05). For
M377A channels (which displayed a higher sensitivity), kon was exclusively increased
by ~1.6 fold (p<0.05) with koff unaltered. In contrast, C347A, F378A and V379A
increased koff by ~5-fold (p<0.05) and decreased kon by ~2-, 10- and 5-fold,
respectively (p<0.05). The kinetically-derived KD of WT and Ala-substituted channels
were quantitatively similar to the corresponding steady-state IC50 values (Table 4.1).
Of note, it is reassuring that these kinetic and steady-state parameters displayed the
same rank order although different (yet complementary) methods for analysis were
employed.
123
CHAPTER 4
Wang Kai
WT HCN1
A
B
C
D
Fig. 4.7 Time courses of the development of onset and offset of ZD7288 block of WT.
Normalized steady-state If currents elicited by hyperpolarization to -100 mV from a
holding potential of -30 mV were plotted versus time during 100 μM blocker wash-in
(A) and wash-out (B). Data were fitted with a monoexponential function to estimate
for the time constants τon (C) and τoff (D) for binding and unbinding, respectively. kon
and koff were calculated from τon and τoff using the equations listed under Section 4.2.
124
CHAPTER 4
Wang Kai
HCN1 C347A
A
B
C
D
Fig. 4.8 Effects of Ala-substitutions at C347 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 3.7
125
CHAPTER 4
Wang Kai
HCN1 S357A
A
B
C
D
Fig. 4.9 Effects of Ala-substitutions at S357 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 3.7
126
CHAPTER 4
Wang Kai
HCN1 M358A
A
B
C
D
Fig. 4.10 Effects of Ala-substitutions at M358 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 3.7
127
CHAPTER 4
Wang Kai
HCN1 M377A
A
B
C
D
Fig. 4.11 Effects of Ala-substitutions at M377 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 3.7
128
CHAPTER 4
Wang Kai
HCN1 F378A
A
B
C
D
Fig. 4.12 Effects of Ala-substitutions at F378 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 3.7
129
CHAPTER 4
Wang Kai
HCN1 V379A
A
B
C
D
Fig. 4.13 Effects of Ala-substitutions at V379 on the time courses of the onset and
offset of ZD7288 block during 100 μM blocker wash-in (A, C) and wash-out (B, D).
Data were collected and analyzed using the same method as shown in Fig. 4.7
130
CHAPTER 4
Wang Kai
Fig. 4.14 Logarithmic plot of the reciprocal of the association rate constants (kon)
versus the dissociation rate constants (koff). The horizontal and vertical dotted lines
represent the WT levels of koff and 1/kon, respectively.
131
CHAPTER 4
Wang Kai
Table 4.1 The effects of Ala-substitution on ZD7288 block of the HCN1 channel
a
Numbers in parentheses, number of individual determinations.
b
p<0.05 versus WT values
132
CHAPTER 4
Wang Kai
4.3.3 Effects of Ala pore substitutions on gating
Drug (e.g. local anesthetics and antiarrhythmics) binding to Kv and Nav channels is
known to heavily depend on gating. To explore the possibility that the observed
effects of the Ala pore substitutions on ZD7288 blockade were secondary to changes
in gating properties, steady-state activation (Figure 4.15, 4.16) and activation kinetics
(Figure 4.17) were examined. While C347A channel in the selectivity filter region
significantly shifted the steady-state activation midpoint (V½) in the hyperpolarizing
direction by ~24 mV (p<0.01), the outer pore substitutions S357A and M358A did not
alter activation (p>0.05).
As for the S6 substitutions, M377A and V379A channels that were more sensitive and
resistant to ZD7288, respectively, both similarly shifted steady-state activation in the
hyperpolarizing direction (p<0.05). By contrast, the ZD7288-resistant S6-F378A
caused a significant opposite depolarizing shift (~+16 mV; p<0.05). Of note, the slope
factors of V379A and F378A channels were significantly higher than WT (p<0.05).
All steady-state gating parameters of different channels are summarized in Table 4.2.
Kinetically, F378A channel openings was slowed (from -100 mV to -140 mV, p<0.05)
whereas those of V379A channel were hastened (from -70 mV to -140 mV, p<0.05)
(Figure 4.17). These changes did not mirror (for F378A) or could not be accounted for
(for V379A) by their depolarizing and hyperpolarizing V½ shifts, respectively. Other
constructs recorded had activation kinetics identical to WT over the voltage range
133
CHAPTER 4
Wang Kai
Table 4.2 Summary of steady-state activation properties of WT and various
Ala-substitutions
a p<0.05 versus WT values
b NE, not expressed.
134
CHAPTER 4
Wang Kai
A
B
C
Fig. 4.15 Effects of Ala-substitution on HCN1 steady-state activation. A, P-loop
C347A shifted steady-state activation negatively when compared to WT (broken line).
B, S357A and M358A (of P-S6) did not significantly influence activation. The curves
of S357A and WT (broken line) overlapped with each other. C, M377A and V379A of
S6 shifted the WT (broken line) steady-state activation curve in the hyperpolarizing
direction while S6-F378A exerted the opposite shift.
135
CHAPTER 4
Wang Kai
A
B
Fig. 4.16 Effects of Ala-substitution on HCN1 steady-state activation. Summary of
steady-state activation midpoints (V½, A) and slope factors (B) of the same channels
from Fig. 3.15. Asterisks indicate statistical differences (p <0.05) compared with WT.
136
CHAPTER 4
Wang Kai
Fig. 4.17 Effects of Ala-substitution on HCN1 on activation (τact) kinetics. V379A and
F378A channels had accelerated and decelerated activation, respectively.
137
CHAPTER 4
examined (p>0.05).
Wang Kai
Taken collectively, the differential effects of Ala substitutions
on gating and ZD7288 blockade could not be readily correlated.
4.4 Discussion
4.4.1 Novel HCN pore determinants for ZD7288 block
In the present study, the molecular constituents of the drug binding receptor in HCN
channels were probed by Ala-scanning mutagenesis of three distinct pore regions:
the selectivity filer, the outer and the inner pore vestibules. Specifically, the
extra-pore residues studied (i.e. S357A and M358A of the P-S6 linker) did not affect
ZD7288 blockade hinting that this outermost channel region probably does not
directly participate in drug binding of HCN channels. However, four putatively
deeper pore residues from the selectivity filter region (Xue et al., 2002b) (C347 in
the P-loop) and the inner vestibule (Shin et al., 2004) (M377, F378 and V379 in S6)
were identified to play a crucial role in determining the WT drug-blocking
phenotype. When residues C347, F378 and V379 were Ala-substituted, the
sensitivity of HCN1 channels to the bradycardic drug ZD7288 were significantly
diminished by up to 55-fold (of F378A channels as assessed by KD; see Table 3.1).
Kinetic analysis of ZD7288 blockade further revealed that C347A, F378A and
V379A decelerated the association of ZD7288 to the receptor while simultaneously
accelerating its dissociation. Despite the proximity of the S6 residues studied,
138
CHAPTER 4
Wang Kai
M377A enhanced ZD7288 blockade by exclusively accelerating drug association.
The differential effects of the Ala substitutions examined were consistent with the
notion that the observed changes in ZD7288 blockade were site-specific.
4.4.2 Structural and mechanistic implications into the HCN pore
Sequence alignments and comparison with the known crystal structures of KV
channels (Figure 4.1) suggests that the S6 residue V379 of HCN1 may be exposed to
the aqueous phase of the cytoplasmic pore. In Shaker K+ channels, the hydrophobic
binding pocket for quaternary ammonium compounds consists of T469 in S6 (Choi
et al., 1993); the analogous residue of Shaker’s T469 in HCN1 is C374. Taken
together with the present findings that the S6 substitutions F378A and V379A (but
not M377A) reduce ZD7288 blockade, these results suggest that residues F378 and
V379 are located on the same side of the S6-MFV377-379 helical turn that is exposed
to the cytoplasmic pore. Along with the P-loop residue C374, the F378/V379 helical
face forms a receptor pocket to which ZD7288 binds. Although the S6 residue M377
faces a different side of the S6-MFV377-379 helix, it regulates the pathway by which
the drug molecule travels to its binding site. When M377 is substituted by the
smaller alanine, drug access is improved sterically and/or by relieving some negative
interactions and thereby facilitates ZD7288 blockade. By contrast, the receptor
constituents C347, F378 and V379 modulate both the access of ZD7288 to its
binding site as well as the intrinsic receptor affinity (consistent with the
corresponding accelerated dissociation and decelerated association rate constants of
139
CHAPTER 4
Wang Kai
these Ala-substituted pore constructs). This model is schematically presented in
Figure 4.18.
As previously shown, C318 in the S5-P linker is located in the outermost rim of the
external pore mouth (Xue et al., 2002a). Its covalent modification by
methanethiosulfonate reagents shifts the steady-state activation negatively and
drastically decelerates gating kinetics. Based on these results, it is possible that the
external pore and activation gating of HCN channels are allosterically coupled via a
pore-to-gate mechanism that is conserved in classical depolarization-activated K+
and Na+ channels.
Similar to C-type and slow inactivation, the pore-to-gate mechanism of HCN
channels is also dependent on external permeants (Azene et al., 2003); this
dependence is abolished (or diminished) when the P-loop residues A352 and A354
are substituted (Azene et al., 2003; Azene et al., 2005a). In the present study,
Ala-substitutions of I348, G349 and G351 (that are immediately N-terminal to A352)
and P355 and V356 (C-terminal to A354) similarly rendered HCN1 channels
non-functional. On the other hand, S357A and M358A produced robust If currents
without influencing gating. Based on previous experiments (Accili et al., 2002; Xue
et al., 2002b), it is likely that mutating the P-loop residues I348, G349 and G351 that
are relatively deep into the pore disrupts the permeation pathway required for ion
conduction. When substituted, however, the more superficial residues P355 and
140
CHAPTER 4
Wang Kai
Fig. 4.18 A model of ZD7288 block of HCN channels. Schematic diagram
illustrating the mechanism of ZD7288 block and the drug interactions with the
channel receptor consisting of residues C347, F378 and V379. ZD7288 binding to
WT (upper panel) and a substituted HCN channel. Only V379A channel is shown
here as an example. See text for details.
141
CHAPTER 4
Wang Kai
V356 may substantially increase the energy required to dilate the outer pore during
opening (and the associated steric hindrance among the outer pore residues) (Azene
et al., 2003; Azene et al., 2005a) to facilitate permeation via the selectivity filter.
This subsequently shifted the activation midpoint so negatively that whole-cell
currents could not be elicited over the range of voltages tested (Figure 4.18).
This possibility is particularly attractive given that proline is known to have a high
tendency to form a kink in secondary structures. Our present experiments do not
allow us to distinguish among the above possibilities. Nevertheless, the collective
data sets have clearly identified a string of 10 P-loop amino acids (from residues 347
to 356) that carries multiple determinants for drug blockade, permeation, and
pore-to-gate activation. This pore region also does not tolerate substitutions well
(even by alanine which simply replaces the native side chain with a methyl group),
consistent with its functional importance in permeation, gating and pharmacology.
Consistent with previous findings by Yellen’s group (Shin et al., 2001; Rothberg et
al., 2002; Rothberg et al., 2003; Shin et al., 2004), the results of this study also
implicate that the inner pore formed by S6 also participate in activation gating of
HCN channels.
4.4.3 Implications for future HCN-based therapies
HCN-encoded If is one of the key players that prominently modulate the rhythmic
firing activity of cardiac nodal pacemaker and some neuronal cells (Siu et al., 2007a).
142
CHAPTER 4
Wang Kai
Its activities underlie a range of physiological and pathophysiological processes from
the autonomous beating of the heart to the transmission of pain. For instance, nerve
injury in the dorsal root ganglion markedly increases If and results in abnormal
spontaneous action potentials (Chaplan et al., 2003). For the heart, idiopathic and
familial sinus dysfunctions associated with human HCN mutations have been
reported (Schulze-Bahr et al., 2003; Ueda et al., 2004; Milanesi et al., 2006).
Although cardiac If is most abundant in the SA node, it is also found at various levels
in the atrio-ventricular node, the Purkinje fibres, the atria and the ventricles (Cerbai
et al., 1994; Cerbai et al., 1997; Hoppe et al., 1998b; Cerbai et al., 2001;
Fernandez-Velasco et al., 2003). Indeed, up-regulation of If has been suggested to
contribute to atrial ectopy (Zorn-Pauly et al., 2004), and other arrhythmias associated
with diseased states such as heart failure, hypertrophy and hypertension (Cerbai et al.,
1994; Cerbai et al., 1997; Hoppe et al., 1998b; Cerbai et al., 2001;
Fernandez-Velasco et al., 2003). As a result, drugs that target HCN channels such as
ivabradine, ZD7288 have been developed (DiFrancesco, 2005).
Using an engineered HCN channel, an in vivo bioartificial cardiac pacemaker has
been successfully constructed that suffices to replace or supplement conventional
electronic devices in a large animal sick sinus syndrome model (Cowan et al., 2006;
Tse et al., 2006). The present results provide useful information for designing future
HCN drugs and engineered HCN channels with particular drug sensitivities or even a
143
CHAPTER 4
Wang Kai
custom-tailored modulatory drug receptor for gene- (Tse et al., 2006; Xue et al.,
2007) and cell- (Li et al., 2006; Siu et al., 2007b) based therapies. For instance, the
substitution M377A can be combined with others to generate a bioartificial
pacemaker that is ultra-sensitive to bardycardiac drugs to confer drug specificity and
to minimize potential side effects (due to blockade of If in other tissues).
4.4.4 Limitations and future studies
Although key residues that determine ZD7288 blockade of HCN1 channels and their
roles in drug association and dissociation were identified, the nature of their side
chain interactions with ZD7288 remains to be explored. The spatial proximity of
these key residues during the drug-bound state is also not explored. The accessibility
of these residues from the extracellular and cytoplasmic sides, their state-dependence
as well as functional roles in gating also require additional experiments (e.g.
cysteine-scanning mutagenesis). For non-functional single Ala-substituted channels,
the generation of tandem constructs with one, two or three copies of a mutation
introduced the pore may shed insights into their roles in drug block. To date, four
isoforms, namely HCN1 to 4, have been identified. These isoforms exhibit different
patterns of gene expression and tissue distribution (Ludwig et al., 1998; Santoro et
al., 1998; Santoro et al., 2000), and co-assemble to form heteromeric complexes
(except between HCN2 and HCN3) that underlie the native If (Chen et al., 2001b;
Moosmang et al., 2001; Ulens et al., 2001; Xue et al., 2002b; Koni et al., 2003).
Although the primary sequences of the HCN1-4 pores are highly conserved, three of
144
CHAPTER 4
Wang Kai
the residues substituted in this study, V356, S357 and V379, are isoform variants
(Figure 4.1). While S357A does not contribute to ZD7288 binding and V356A
abolishes channel function, V379 was identified as a determinant of drug sensitivity
and propose that it constitutes part of the drug receptor. Recently, isoform-specific
differences in block of HCN1 and HCN4 by the bradycardic drug ivabradine have
been reported (Bucchi et al., 2006). Of note, the analogous residues of V379 of
HCN1 are isoleucines in HCN2, HCN3 and HCN4. Further experiments will be
needed to investigate whether this amino acid variant underlies isoform-specific
ivabradine block, and whether ZD7288 binding to HCN channels is also similarly
isoform-specific. Given the fact that native If currents from different tissues have
different molecular identities due to the different isoforms expressed and their
coassembly (Xue et al., 2002b), a better understanding of isoform-specific
bradycardic drug block of HCN1-4 channels is crucial for developing
tissue-selective blockers of If.
4.5 Conclusion
In summary, that pore residues C347, F378 and V379 of HCN1 channels were found
to be crucial for ZD7288 blockade. These amino acids may constitute part of the
drug binding receptor that is located relatively deep into the pore. These P-loop and
the S6 residues exert their effects by modulating drug access to the receptor and by
stabilizing the drug-bound HCN channel complex.
145
CHAPTER 5
Wang Kai
Chapter 5
Electrophysiological properties of pluripotent human and
mouse embryonic stem cells
5.1 Introduction
Embryonic stem cells (ESCs) are derived from the inner cell mass of blastocysts.
Since ESCs can propagate indefinitely in culture while maintaining their
pluripotency to differentiate into all cell types, they may therefore provide an
unlimited supply of specialized cells such as cardiomyocytes and neurons for
cell-based therapies. For instance, direct injection of pluripotent ESCs after
myocardial infarction has been suggested as a means to repair the damaged heart
(Hodgson et al., 2004). However, transplantation of cells with undesirable electrical
properties into the heart can predispose patients to lethal electrical disorders
(arrhythmias) (Menasche et al., 2003; Smits et al., 2003). Therefore, it is critical to
understand the electrophysiological profile of undifferentiated ESCs, which has not
been characterized. In this study, we hypothesize that ion channels are functionally
expressed in mouse (m) and human (h) ESCs, although the specific encoding genes
(and/or their isoforms) and their expression levels might differ. Indeed, we observed
a number of specialized ion channels are differentially expressed in pluripotent m
and hESCs. Collectively, these findings revealed further similarities and differences
between the two species. These results are discussed in relation to the physiological
146
CHAPTER 5
Wang Kai
function of ion channels in hESC biology, as well as practical considerations for
potential therapeutic applications of hESCs.
5.2 Methods
5.2.1 Maintenance of mouse and human ESCs
The mESC line R1 (Nagy et al., 1993) (kind gift of Dr. Andras Nagy, University of
Toronto) which has been genetically-engineered to constitutively express the GFP
was used in this study to assist their identification from mouse embryonic fibroblast
(MEF) cells (Figure 5.1A). mESCs were maintained in their undifferentiated stage by
growing on mitomycin-treated MEF feeder layer (Doetschman et al., 1985) in
mESCs culture medium (see Section 2.1.3) using the protocol described in Section
2.2.1.
For hESCs, the H1 line (Wicells, Madison, WN) (Thomson et al., 1998) that has
been stably transduced by the recombinant lentivirus LV-CAG-GFP (see below for
further description of the lentiviral vector employed) as recently described was used
(Xue et al., 2005). hESCs were maintained on irradiated MEF feeder layer and
propagated as previously described. The culture media consisted of DMEM
supplemented with 20% fetal bovine serum (HyClone; Logan, Utah, USA;
http://www.hyclone.com), 2 mM L-glutamine, 0.1 mM ß-mercaptoethanol, and 1%
147
CHAPTER 5
Wang Kai
nonessential amino acids. MEF cells were obtained from 13.5 day embryos of CF-1
mice.
5.2.2 Lentivirus-mediated stable genetic modification of hESCs
For stable genetic modification, the self-inactivating HIV1-based lentiviral vector
(LV) was employed (Trono, 2002). The plasmid pLV-CAG-GFP was created from
pRRL-hPGK-GFP SIN-18 (generously provided by Dr. Didier Trono, University of
Geneva, Switzerland) by replacing the human phosphoglycerate kinase 1 (hPGK)
promoter with the CAG promoter, an internal composite constitutive promoter
containing the CMV enhancer and the β-actin promoter. Recombinant lentiviruses
were generated using the 3-plasmid system (Zufferey et al., 1998) by co-transfecting
HEK293T cells with pLenti-CAG-GFP, pMD.G and pCMV∆R8.91. The latter
plasmids encode the vesicular stomatitis virus G envelope protein and the HIV-1
gag/pol, tat, and rev genes required for efficient virus production, respectively.
Lentiviral particles were harvested by collecting the culture medium at 48 hours
post-transfection, and stored at -80°C before use.
hESCs were transduced by adding purified lentiviruses to cells at a final
concentration of 10,000 TU ml-1 with 8 µg/ml polybrene to facilitate transduction.
The multiplicity of infection (MOI) was ~5 for each round of transduction. After 4 to
6 hours of incubation with LV-CAG-GFP, 2 ml fresh medium per 60 mm dish was
added. Transduction was allowed to proceed for at least 12-16 hours. Cells were
148
CHAPTER 5
Wang Kai
washed with PBS twice to remove residual viral particles. For generating stably
LV-CAG-GFP-transduced hESCs, green portions of hESC colonies were
microsurgically segregated from the non-green cells, followed by culturing under
undifferentiating conditions for expansion. This process was repeated until a
homogenous population of green hESC, as confirmed by FACS, was obtained.
Further details are also provided in another recent publication (Moore et al., 2005).
5.2.3 Immunostaining
The expression of undifferentiated markers of mouse or human ESCs were examined
using immunohistological method described in Section 2.5 with the primary
antibodies at a dilution of 1:25 (for SSEA-4 and TRA-1-60 in hESCs staining)
(Chemicon, Temecula, CA; http://www.chemicon.com).
5.2.4 Cell proliferation assay
Cell proliferation was determined in 96-well plates using a non-radioactive
chemiluminescent BrdU kit (Roche Diagnostics, Basel, Switzerland) using the
protocol described in Section 2.3. In brief, mESCs or hESCs were treated with
specified concentrations of TEA, 4-AP or IBTX for 24 hours. BrdU labeling solution
was then added to give a final concentration of 10 μM of BrdU. Medium was
removed after 2 hours, and cells were fixed with the addition of FixDenat solution
for 30 minutes at room temperature. After removing FixDenat, 100 μl freshly diluted
1:100 anti-BrdU POD solution was added to the wells for 30 minutes, followed by
149
CHAPTER 5
Wang Kai
washing three times. Finally, 100 μl of substrate solution was added and
luminescence was read by a multi-well scanning spectrophotometer automatic
luminometer.
Cell viability was determined in 96-well plates using a colorimetric MTT (3-(4,
5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) kit (Roche Diagnostics,
Basel, Switzerland) using the protocol described in Section 2.4. Briefly, specified
concentrations of TEA, 4-AP or IBTX were added for 24 hours. Then 10 μl of MTT
labeling reagent (5 mg/ml in PBS) was added to each well, followed by incubation at
37oC for 4 hours. Solubilization solution (100 μl) was added to dissolve the
formazan crystals formed. Absorbances at 540 nm were read by a spectrophotometer.
Un-treated cells were used as control (i.e. 100% survival).
5.2.5 Electrophysiology
Only GFP-expressing mESCs and hESCs (~15 pF) were selected for experiments.
Electrophysiological recordings were performed at room temperature using whole-cell
patch clamp technique described in Section 2.9. The ingredients of bath solution and
internal solution for patch recordings were described in Section 2.1.2. For recording
Ca2+-activated large-conductance K+ current (IBK), 2.5 mM Ca2+ was added to the
pipette solution. Blockers were diluted to the final concentrations in the bath solution
as indicated, and administrated via superfusion (at least 10ml) a fast-exchange
perfusion system. The current amplitude at +50 mV was monitored every 30 seconds
150
CHAPTER 5
Wang Kai
after 5 minutes of incubation until steady-state current blockage was achieved.
Half-blocking concentrations (IC50) were determined from the following binding
isotherm:
I=Iblocker-ins+ (1-Iblocker-ins)/(1+[blocker]/IC50)n)
where IC50 is the half-blocking concentration, Iblocker-ins is blocker-insensitive
component, n is the Hill's coefficient, IO and I are the peak currents measured at the
voltage indicated before and after application of the blocker, respectively. All IC50
and EC50 values reported were calculated from individual determinations (i.e. curve
fitting to data from individual experiments). The curves presented in figures were
fitted to averaged data points pooled from all experiments.
5.2.6 RT-PCR
The expression of ion channels at mRNA level was examined using RT-PCR method
described in Section 2.7. Briefly, total RNA was prepared from mESCs or mouse
brain using ToTALLY RNATM Kit (Ambion Inc., Texas; http://www.ambion.com).
0
Single stranded cDNA was synthesized from ~1 μg of total RNA using random
hexamers and SuperScriptTM reverse transcriptase (Invitrogen, Carlsbad, CA;
http://www.lifetech.com) according to the manufacturer’s protocols, followed by
1H
PCR amplification with gene-specific primers for ion channel genes. Primers,
annealing temperatures, product sizes and the corresponding references are given in
151
CHAPTER 5
Wang Kai
Table 5.1. 18S ribosomal RNA (498 bp) was used as an internal control. The reaction
was conducted using the following protocol: Initial denaturing of the template for 5
minutes at 94°C followed by 32 repeating cycles of denaturing for 1 minute at 94°C,
annealing for 1 minute, extension for 1 minute at 72°C and a final elongation at 72°C
for 7 minutes. The PCR products were size-fractionated by 1% agarose gel
electrophoresis and visualized by ethidium bromide staining. All the primers were
tested with preparations from mouse brain and water as positive and negative
controls, respectively. To analyze RNA expression in hESCs by RT-PCR, total RNA
was extracted using a NucleoSpin RNAII kit (Clontech, Palo Alto, CA), treated with
DNase I and used for RT-PCR with SuperScript One-Step RT-PCR with the Platinum
Taq system (Invitrogen). The primers for gene-specific RT-PCR are given in Table 5.2.
Equal aliquots of the PCR products were electrophoresed through 2% agarose gels and
visualized by ethidium bromide staining.
5.2.7 Microarray analysis
Microarray analysis was performed using Affymetrix human genome U133A array,
which represents 18,400 transcript and variants, including 14,500 well-characterized
human genes.
Total RNA was extracted from pluripotent hESCs (H1) and
hybridized to microarrays according to the protocols provided by the manufacturer.
The
software
Genespring
6.0
(Silicon
Genetics,
Redwood
City,
CA;
http://www.silicongenetics.com) was used for microarray data analysis. Data were
normalized to the expression level of the 50th percentile of the entire chip and filtered
152
CHAPTER 5
Wang Kai
Table 5.1 Mouse gene-specific primers for RT-PCR. The corresponding references are given.
Gene
Acc. -No.
Forward primer sequence (5'-3')
Reverse primer sequence (5'-3')
Length (bp)
Annealing
Reference
Temp. (℃)
HCN1
NM_010408
CTCTTTTTGCTAACGCCGAT
CATTGAAATTGTCCACCGAA
291
57
Proc Natl Acad Sci U S A. 2003;100:15235-15240.
HCN2
NM_008226
GTGGAGCGAGCTCTACTCGT
GTTCACAATCTCCTCACGCA
229
57
Proc Natl Acad Sci U S A. 2003;100:15235-15240.
HCN3
NM_008227
GACACCCGCCTCACTGATGGAT
GTTTCCGCTGCAGTATCGAATTC
370
57
Proc Natl Acad Sci U S A. 2003;100:15235-15240.
HCN4
XM_287905
TGCTGTGCATTGGGTATGGA
TTTCGGCAGTTAAAGTTGATG
337
47
Proc Natl Acad Sci U S A. 2003;100:15235-15240.
Kv1.1
NM_010595
GCCTCTGACAGTGACCTCAGC
GGGACAGGAGTCGCCAAGGG
240
57
Glia. 1997;20:127-134.
Kv1.2
NM_008417
CGTCCTCCCCTGACCTAAA
CCATGCAGAACCAGATGCTGTAG
296
57
Glia. 1997;20:127-134.
Kv1.3
NM_008418
ATCTTCAAGCTCTCCCGCCA
CGATCACCATATACTCCGAC
478
53
Am J Physiol Cell Physiol. 2000;279:C1123-1134.
Kv1.4
NM_021275
CTCCTCCCATGATCCTCAAGG
GCAGGTCTGTGTACGAACACC
257
57
Glia. 1997;20:127-134.
Kv1.5
NM_145983
GCCATTGCCATCGTGTCGGT
ACATGTGGTCTCCACGATGA
242
53
Am J Physiol Cell Physiol. 2000;279:C1123-1134.
Kv1.6
NM_013568
GCTTGGCAAACCTGACTTTGC
CCTGTTTTCCTGCAGGCC
136
57
Glia. 1997;20:127-134.
Kv2.1
NM_008420
CGGCAGTTCAACCTGATCCC
TTTATTGCCCAGAATGCTGTCG
468
57
Kv3.1
NM_008421
CGAGCTGGAGATGACCAAG
AAGAAGAGGGAGGCAAAGG
156
60
Designed with Primer Premier 5.0
Kv3.2
U52223
AATAGCCATGCCTGTGC
AGCGTCTGATAGGGAGC
296
60
Designed with Primer premier 5.0
Kv4.2
NM_019697
ATCGCCCATCAAGTCACAGTC
CCGACACATTGGCATTAGGAA
111
53
J Physiol. 2002;544:403-415.
Kv4.3
NM_019931
CAAGACCACCTCACTCATCGA
TCGAGCTCTCCATGCAGTTCT
176
60
J Physiol. 2002;544:403-415.
BK
NM_010610
CCATTAAGTCGGGCTGATTTAAG
CCTTGGGAATTAGCCTGCAAGA
188
53
J Biol Chem. 2003;278:45311-45317.
153
Biochem Biophys Res Commun. 2004;313:156-162.
CHAPTER 5
Wang Kai
Table 5.2 Human gene-specific primers for RT-PCR. The corresponding references are given.
Annealing
Gene
Acc. -No.
Forward primer sequence (5'-3')
Reverse primer sequence (5'-3')
Length (bp)
Cav, 2/subunit 2
NM_006030
GCTGCAGAACTCCAACATCA
CGATGGAAGGGATCTCAAAA
224
60
Designed with
Primer3
Cav, 3 subunit
U07139
ACAGCTTGATGCCCTCTGAT
TGGTTGTGCTCTGAGTCCTG
211
60
Designed with
Primer3
Cav 2.1
NM_023035
AGTGAACAAAAACGCCAACC
AAAGTAGCGCAGGTTCAGGA
184
60
Designed with
Primer3
Nav 1.9
NM_014139
CCACCACCAAGAGAAAGGAA
TCAGTCACAGTGGACCTTGC
200
60
Designed with
Primer3
Kv9.3
NM_002252
CAGTGAGGATGCACCAGAGA
TTGCTGTGCAATTCTCCAAG
200
60
Am J Physiol Lung Cell Mol Physiol 2004;226-238.
Kv4.2
NM_0012281
GCCAATGTGTCAGGAAGTCA
TTCTGGGGTGGTTACTGGAG
201
60
Am J Physiol Lung Cell Mol Physiol 2004;226-238.
Kv11.1
NM_000238
CCTTCCTCTGCATTGCTTTT
CTTGTCTTGGGGTGAGCTGT
210
60
Am J Physiol Lung Cell Mol Physiol 2004;226-238.
Kv2.1
NM_004975
ACAGAGCAAACCAAAGGAAGAAC
CACCCTCCATGAAGTTGACTTTA
383
60
Am J Physiol Lung Cell Mol Physiol 2004;226-238.
Kv7.2
NM_172109
GCAAGCTGCAGAATTTCCTC
AGTACTCCACGCCAAACACC
201
60
Designed with Primer3
GAPDH
NM_013568
ACATCAAGAAGGTGGTGAAGCAGG
CTCTTGCTCTCAGATCCTTGCTGG
281
60
Designed with Primer3
HCN1
NM_021072.1
GGCGGCAGTATCAAGAGAAG
GGCATTGTAGCCACCAGTTT
211
60
Designed with Primer3
154
Temp. (oC)
Reference
CHAPTER 5
Wang Kai
to show genes that are labeled as expressed (i.e. ‘present’ flags) as defined by
Affymetrix analysis.
5.2.8 Statistical analysis
All data reported are means ± S.E.M. Statistical significance was determined for all
individual data points and fitting parameters using one-way ANOVA and Tukey's
HSD post hoc test at the 5 % level.
5.3 Results
5.3.1 Ionic currents in pluripotent mouse ESCs
Figure 5.1B shows that undifferentiated mESC colonies were homogenously
immunostained for the pluripotency markers Oct-4 and SSEA-1 (Solter et al., 1978;
Niwa et al., 2000). In 159 of 304 (52.3%) undifferentiated mESCs,
depolarization-activated time-dependent non-inactivating outward currents that
increased progressively with positive voltages could be recorded (8.6±0.9 pA/pF at
+40 mV; Figure 5.2, 5.3A). These outwardly rectifying currents resemble the delayed
rectifier K+ currents (IKDR), and could be dose-dependently inhibited by the known
K+ channel blocker TEA+ (Hille, 1967; Kirsch et al., 1991) (IC50=1.2±0.3 mM, n=13;
Figure 5.2, 5.3B). IKDR in mESCs was also sensitive to 4-aminopyridine (4-AP;
IC50=0.5±0.1 mM, n=17), a more potent K+ channel blocker than TEA+ (Baker et al.,
155
CHAPTER 5
Wang Kai
1993; Mathie et al., 1998), and IBK blocker iberiotoxin (IBTX; current
inhibition=33.2±12.7%, n=3) (Figure 5.2, 5.3C).
As shown in Figures 5.3B & C, increasing TEA or 4-AP to 30mM could not lead to
complete current inhibition. Indeed, even combined application of 30 mM TEA and
30mM 4-AP also could not completely eliminate the IKDR (30 mM 4-AP, 30 mM
TEA and 30 mM TEA + 30 mM 4-AP reduced the IKDR to 45.8±2.1%, 39.3±7.6%
and 45.1±8.1% respectively, n=4; p>0.05). The currents remaining after combined
TEA/4-AP blockade were also not sensitive to 1mM BaCl2, implicating the presence
of some background current.
Although voltage-gated Na+ (INa) and Ca2+ (ICa) currents were completely absent in
all pluripotent mESCs tested (n>200), whether IKDR was present (cf. Figure 5.2) or
not (Figure 5.4A), a modest yet detectable hyperpolarization-activated inward current
(If, encoded by the hyperpolarization-activated cyclic nucleotide-modulated
non-selective or HCN ion channel family (Pape, 1996); -2.2±0.4 pA/pF at −120 mV)
was detected in 79 of 270 cells (29.3%; Figure 5.4B, C). If in mESCs was reversibly
blocked by the HCN inhibitor Cs+ (Champigny et al., 1987; McCormick et al., 1990).
Application of 1μM isoproterenol altered neither the kinetics nor amplitude of If
recorded in mESCs. Inward rectifier K+ currents (IK1) responsible for stabilizing the
resting membrane potential were also not present.
156
CHAPTER 5
Wang Kai
A
B
Fig. 5.1 Undifferentiated mouse ESCs. A, bright field and GFP fluorescence of an
ESC colony; B, images of pluripotent mESCs immunostained for SSEA-1 and Oct-4
merged with GFP fluorescence.
157
CHAPTER 5
Wang Kai
Fig. 5.2 Representative current tracings recorded from undifferentiated mESCs
before (left panels) and after blockade by TEA, 4-AP and IBTX (right panels) as
indicated. The electrophysiological protocol used for eliciting currents is also given.
158
CHAPTER 5
Wang Kai
A
B
C
Fig. 5.3 A, Current-voltage relationship of IKDR of mESCs. Dose-response
relationships for TEA (B) and 4-AP (C) block of IKDR of mESCs.
159
CHAPTER 5
Wang Kai
To obtain insights into the molecular identities of the ionic currents identified, total
RNA was isolated from pluripotent mESCs for RT-PCR. Figure 5.5 shows that Kv1.1,
1.2, 1.3, 1.4, 1.6, 4.2, and BK (or Maxi-K) transcripts but not Kv1.5, 2.1, 3.1, 3.2 and
4.3 were detected. Consistent with the presence of If, HCN2 and HCN3 transcripts
were also expressed. Inhibition by 4-aminopyridine (4-AP) and insensitivity to
extracellular TEA ions is a pharmacological hallmark of A-type currents (Amberg et
al., 2003). However, neither TEA- nor 4-AP-subtracted current traces from IKDR
blockade reveals any transient outward current with the typical rapid inactivation
feature (data not shown). Therefore, while Kv1.1, 1.2, 1.6 and BK channels might
underline the delayed rectifier current recorded, I conclude that Kv1.4- and
4.2-encoded transient outward K+ currents were not functionally expressed.
5.3.2 Effects of ion channel blockers
To investigate possible physiological roles of the ionic currents identified, the
functional consequences of their pharmacological blockade by assessing the effects
of extracellular application of K+ channel blockers on cell proliferation were studied.
Specifically, DNA synthesis as an index for replication by quantifying BrdU
incorporation into genomic DNA during the S phase of the cell cycle, which is
proportional to the rate of cell division were measured (Yu et al., 1992). Application
of TEA+ significantly inhibited the proliferation of mESCs in a dose-dependent
manner (Figure 5.6A, open squares).
160
CHAPTER 5
Wang Kai
A
B
C
Fig. 5.4 A, Stimulation protocol and representative current traces demonstrating the
absence of Nav or Cav currents in a mESC that lacks IKDR. B, CsCl2-sensitive
hyperpolarization-activated currents could be recorded from pluripotent mouse but
not
human
ESCs.
C,
Steady-state
current-voltage
hyperpolarization-activated currents of mouse and human ESCs.
161
relationships
of
CHAPTER 5
Wang Kai
Fig. 5.5 Expression of ion channel transcripts in mESCs probed by semi-quantitative RT-PCR.
162
CHAPTER 5
Wang Kai
A
B
C
Fig. 5.6 Dose-response relationships of (B) TEA (C) 4-AP and (D) IBTX for
inhibition of mESC proliferation assessed by BrdU incorporation (open squares) and
cytotoxic effects by MTT (solid squares).
163
CHAPTER 5
Wang Kai
The half-effective concentration (EC50) was 20.1±3.7 mM (n=3), approximately
~20-fold higher than the IC50 for IKDR inhibition. Similarly, 4-AP (EC50=2.7±0.2 mM,
n=3; Figure 5.6B, open squares) and IBTX (EC50=133.9±25.9 nM, n=3; Figure 5.6C,
open squares) also dose-dependently reduced cell proliferation. Of note, the rank
orders of these agents to inhibit proliferation follow the trend of their potencies to
block IKDR (i.e. IBTX>4-AP>TEA). To assess the cytotoxic effect of K+ channel
blockers, a colorimetric MTT kit was used to examine for changes in metabolism.
Notably, the EC50 values (from 3 rounds of assay) for inhibition of metabolic activity
by TEA (62.7±9.0 mM; Figure 5.6A, solid squares), 4-AP (4.6±0.5 mM; Figure 5.6B,
solid squares) and IBTX (333.9±64.6 nM; Figure 5.6C, solid squares) were
significantly higher than those for inhibiting cell proliferation (p<0.05). These results
implicate that the metabolic influences of these blockers were relatively insignificant
at concentrations where they effectively exert their inhibitory effects on ES cell
proliferation, presumably by K+ channel blockade.
5.3.3 Electrophysiological properties of ESCs: similarities and
differences
Although hESCs and mESCs share a number of similarities, significant differences
are known to exist between the two species (Boheler et al., 2002). Accordingly, the
electrophysiological properties of hESCs and mESC were explored. Pluripotent
hESCs were positive for markers such as alkaline phosphatase, Oct4, SSEA4, and
TRA-60 (Figure 5.7), consistent with previous reports (Thomson et al., 1998).
164
CHAPTER 5
Wang Kai
A
B
Fig. 5.7 Undifferentiated human ESCs. A, bright field and GFP fluorescence of a
typical ESC colony; B, pluripotent hESCs were positive for alkaline phosphatase,
SSEA-4 and TRA-1-60.
165
CHAPTER 5
Wang Kai
Similar to mESCs, TEA+-sensitive IKDR (IC50=2.1±0.2 mM, n=12; Figure 5.8C) was
also detected in hESCs (~100%) but the current density was ~6-fold higher
(47.5±7.9 pA/pF at +40 mV, n=12, p<0.05) (Figure 5.8A, B). Similar to mESCs,
application of TEA+ dose-dependently inhibited hESC proliferation as assayed by
BrdU incorporation, with an EC50 (11.6±2.0 mM, n=3) (Figure 5.8C). Unlike mESCs,
however, there was no measurable If in all hESCs tested (n=30; Figure 5.4B). Same
as mESCs, neither Nav nor Cav currents could be detected in hESCs.
5.3.4 Microarray analysis of ion channel genes in hESCs
Using Affemetrix@ U133A chips, microarray analysis of pluripotent hESCs to
examine the expression of ion channels at the transcriptomic level was performed.
Figure 5.9A shows the expression profile of all genes tested in undifferentiated
hESCs. For voltage-gated ion channels, a total of 36, 19 and 49 genes on the U133A
chips were identified as Cav, Nav or Kv channel genes, respectively. For inspection,
their expression profile was extracted from Figure 5.9A, and further summarized in
Figures 5.9B-C by normalizing signals to the average expression level of the entire
microarray in a manner similar to that of cytokines and their receptors in hESCs as
recently reported by Dvash et al (Dvash et al., 2004). Our data indicate that among
the total 104 voltage-gated ion channel genes mentioned above, only the transcripts
of 3, 1 and 5 Cav, Nav and Kv genes were significantly expressed, as defined by
Affymetrix.
166
CHAPTER 5
Wang Kai
A
B
C
Fig. 5.8 A, Representative current tracings recorded from undifferentiated hESCs.
The same electrophysiological from Figure 5.2 was used. B, Steady-state
current-voltage relationship of IKDR in hESCs. C, IC50 for blockade of IKDR and EC50
for proliferation inhibition by TEA in hESCs.
167
CHAPTER 5
Wang Kai
A
B
C
Fig. 5.9 A, Microarray analysis of pluripotent hESCs for the transcript expression of
all genes tested using Affemetrix@ U133A microarrays; B, Left: 104 voltage-gated
Cav, Nav and Kv channel genes are clustered. The same expression scale bar shown
in (A) was used. Right: Same as the left panel, except only transcripts that were
defined to be expressed, as defined by Affymetrix are shown. C, Bar graph of
normalized transcript levels of the expressed ion channel genes. Data were
normalized to the expression level of the 50th percentile of the entire microarray.
168
CHAPTER 5
Wang Kai
The corresponding gene products were CACNA1A (Cav2.1), CACNA2D2 (Cav α2/δ
subunit 2), CACNB3 (Cav β3 subunit), SCN11A (Nav1.9), KCNB1 (Kv2.1), KCND2
(Kv4.2), KCNQ2 (Kv7.2), KCNS3 (Kv9.3), and KCNH2 (Kv11.1) (note that although
ICa, INa and Kv4.2-encoded transient outward K+ currents could not be
electrophysiologically recorded, like mESCs). Of note, KCNQ2 and KCNH2, which
underlie the non-inactivating, slowly deactivating M-current (Cooper et al., 2003)
and the rapid component of the cardiac delayed rectifier (IKr) (Pond et al., 2001),
were relatively highly expressed. Similarly, KCNB1 and KCNS3, which encode for
the delay rectifier Kv2.1 channels and the silent modulatory α-subunit Kv9.3 that
heteromerizes with Kv2.1 subunits (Stocker et al., 1998; Kerschensteiner et al., 1999;
Kerschensteiner et al., 2003), respectively, were also expressed. Collectively, these
ion channel genes could underlie the KDR current identified, although further
experiments will be needed to confirm and dissect their molecular identities. By
contrast, no HCN transcript was expressed in pluripotent hESCs. RT-PCR confirmed
the array results for 5 of 9 channels (Figure 5.10).
169
CHAPTER 5
Wang Kai
Fig. 5.10 Expression of ion channel transcripts in hESCs probed by semi-quantitative RT-PCR.
170
CHAPTER 5
Wang Kai
5.4 Discussion
The results of this study demonstrated that undifferentiated ESCs express several
specialized ion channels at the mRNA and functional levels. Although cultured
undifferentiated
mESCs
and
hESCs
were
relatively
homogenous
when
immunostained for pluripotency markers, heterogenous expression of ion channels
was observed in mESCs: only fractions of mESCs tested express measurable IKDR
and If. This observation parallels the heterogenous pattern of ion channel expression
recently described for human mesenchymal stem cells (hMSCs) (Heubach et al.,
2004). Unlike mESCs (and hMSCs), however, ion channel expression in hESCs
appears to be much more homogenous. IKDR was recorded in all pluripotent hESCs
tested (vs. 52.3% of mESCs). In addition to the higher occurrence, the expressed
amplitude of IKDR was also ~10-fold higher in hESCs, which in turn could underlie
the more potent effects of K+ channel blockers on cell proliferation. Of note, high
concentrations of TEA+ and IBTX also led to cytotoxic effects. Both the cytotoxicity
of K+ channel antagonists and their effects on cell proliferation could result from
their cellular uptake (e.g. via endocytosis) followed by interactions with some
intracellular targets other than K channels. In this regard, K+ channel blockers would
be anticipated not to affect mESCs that do not express IKDR, if the resultant
functional consequences arise solely from their blockade of K+ channels.
Unfortunately, the present experiments do not dissect the relative contribution of
these possibilities because the two cell populations cannot be readily isolated.
In
addition, tail currents were more often seen in hESCs rather than mESCs. Different
171
CHAPTER 5
Wang Kai
channels, as suggested by the microarray and RT-PCR data, are likely to underlie
these human and mouse delayed-rectifier currents. Further experiments (such as the
use of small interfering RNA and/or dominant-negative ion channel constructs (Xue
et al., 2002b) to suppress the surface expression of ion channel receptors) will be
required to address the above-mentioned questions and to dissect their precise
molecular identities.
Although self-renewable ESCs may provide an unlimited supply of cells for
transplantation, this promising potential is somewhat hampered by concerns that
ESCs (and their multipotent derivatives) also possess the potential to form malignant
tumors. Various lines of evidence have suggested that K+ channels provide a link
between physiological and biochemical processes that regulate cell cycle and
proliferation by influencing the resting membrane potential (e.g. hyperpolarization is
required for the progression of certain cells into the G1 phase of the mitotic cycle) in
a number of vastly different cell types from cancer to T-lymphocytes (Wonderlin et
al., 1996; Vaur et al., 1998; Platoshyn et al., 2000; Parihar et al., 2003; Vautier et al.,
2004). The presence of HCN gene coded If current in mouse ESCs may also
contribute to the maintenance of the resting membrane potential. In accordance with
this notion, my results show that pharmacologic blockade of IKDR also inhibits the
proliferation of both human and mouse ESCs. Perhaps, targeted inhibition of specific
K+ channel activity (e.g. by genetic suppression via overexpression of particular
dominant-negative ion channel constructs (Xue et al., 2002b)) may lead to a novel
172
CHAPTER 5
Wang Kai
strategy to arrest any undesirable cell division of and to cause cytotoxicity in
pluripotent ESCs, thereby inhibiting or eliminating their tumorgenicity.
Not surprisingly, the transcript expression profiles of mESCs and hESCs do not
always correspond to the functional expression profile of ion channels. Previously,
Van Kempen et al. (van der Heyden et al., 2003) have demonstrated that a variety of
ion channel transcripts, such as those of Kv4.3, KvLQT1, Nav, HCN channels, are
present in pluripotent mESCs but no ionic currents at all can be detected
electrophysiologically before differentiation is induced. Similarly, a direct
correlation between mRNA and membrane ionic currents is also not seen in the
pluripotent P19 embryonic carcinoma cell line. Nevertheless, time-dependent
changes in ion channel mRNA expression upon in vitro differentiation of hESCs
have been reported (Mummery et al., 2003). The differences between these
observations and those presented here could be attributed to the different pluripotent
cell lines investigated or the different culturing conditions employed, which may
likewise contribute to the “species” differences in the electrophysiological profiles
observed between mouse and human ESCs.
Although injection of undifferentiated mESCs into mice does not appear to be
arrhythmogenic (Hodgson et al., 2004), the associated electrophysiological
consequences could be masked due to the slow current kinetics of IKDR in ESCs
relative to the high mouse heart rate (~600bpm) and thus extremely short cardiac
173
CHAPTER 5
Wang Kai
cycles. Such arrhythmogenic potential could become prominent in species whose
heart rates are much slower (e.g. ~80bpm for humans). Like MSCs (Valiunas et al.,
2004), pluripotent ESCs also express gap junction proteins (Oyamada et al., 1996;
Sohl et al., 2001; Satin et al., 2004) for electrical coupling. Furthermore, ESCs can
even subsequently differentiate into electrically-active lineages (Kehat et al., 2001;
He et al., 2003; Mummery et al., 2003; Xue et al., 2005). Taken collectively, these
results highlight additional similarities and differences between mouse and human
ESCs, and further suggest that the electrophysiological profile, in addition to the
tumorgenic potential, of a given undifferentiated hESC line needs to be carefully
assessed before it can be used for therapeutic application, especially when organs or
systems where electrical coordination is key for their functions (e.g. cardiac and
neuronal) are involved.
174
CHAPTER 6
Wang Kai
Chapter 6
Conclusion
Pacemaker current If, encoded by HCN gene family, has been amply demonstrated to
underlie the generation of spontaneous activity of heart since its discovery 30 years
ago (Brown et al., 1977; Brown et al., 1980). However, due to its intrinsically slow
kinetics and negative activation potential, the mechanistic actions of If current
remain largely inferential and somewhat controversial (Irisawa et al., 1993; Satoh,
2003). More recently, it has been proposed that the crucial factor for pacing is the
absence of the strongly polarizing IK1 current, rather than the presence of If current
for the pacemaker mechanism (Eduardo et al., 2007). A better understanding of the
mechanism underlying cardiac pacemaking is a prerequisite for development of
novel drug or gene therapy for cardiac arrhythmias.
In this dissertation, I first compared the contribution of If and IK1 current to the
automaticity of cultured NRVMs. Surprisingly, in contrast to the dramatic bi-phasic
change of automaticity of NRVMs, the functional expression of If current remained
fairly stable regarding both the current density and voltage-dependent activation.
Although If current has been functionally linked to autonomous beating of cultured
NRVMs (Qu et al., 2001; Er et al., 2003), obviously it is not responsible for the
NRVM time-dependent change of automaticity in culture. Nevertheless, adenovirus
175
CHAPTER 6
Wang Kai
mediated genetically engineered HCN1 channel overexpression could recover the
automaticity of quiescent NRVMs, assessed by either whole cell patch clamp or
MEA recording. These results provide further evidence to support that If current is a
crucial initiator of the pacemaker activity. Furthermore, gene therapy based on HCN
channels, especially the genetically tailored forms, can be a promising strategy to
rebuild the pacemaker activity in patients with SA node dysfunction. The results of
this study also confirmed the notion that the contribution of If current is dependent
on the relative expression level of IK1. The freshly isolated NRVMs showed no
spontaneous AP, which can be recorded shortly and increased rapidly in culture
within the first week. This change was accompanied by dramatic decrease of IK1
current density. It seems that the decrease of IK1 current unleash the latent
automaticity of NRVMs. However, IK1 current still can not explain the fade of
spontaneous AP of NRVM in long-term culture, which could be the decrease of INa.
Furthermore, the electrophysiological properties of monolayer culture of NRVM
differs from individual cells culture as the former could keep beating for up to 48
days, while the individual ones lost automaticity within 2 weeks. The decreased of
firing rate and conduction velocity revealed by MEA recording might indicate that
connexin-encoded gap junction plays an important role in maintaining the
synchronized electrical activity of NRVM monolayer culture. Thus the reliability of
HCN gene based therapy need to be proved in certain conditions such as aging and
degenerative fibrosis, which are usually associated with the dysfunction of gap
176
CHAPTER 6
Wang Kai
junctions.
Due to the complexity of cardiac pacing as revealed in this in vitro model, future
efforts should be paid to explore the strategy of fine-tuning If-induced pacemaking
activity. This goal can be hopefully achieved by the construction of HCN mutant
with tailored gating properties or response to cAMP that can overcome the
influences of other factors. Contrary to pacemaking, HCN channel is also an obvious
target for the search of specific blockers that can control the heart rate. In last decade,
drugs able to block this pacemaker channel have been developed. These blockers,
especially ZD7288, have been proved extremely useful in studying the
structure-function relationship of HCN channel. However the drug binding site and
the nature blocking remain unknown.
Accordingly, I systematically introduced Ala-scanning substitutions into three
distinct pore regions of HCN1 channel, the selectivity filter (C347A, I348A, G349A,
G351A in the P-loop), the outer (P355A, V356A, S357A, M358A in the P-S6 linker)
and the inner (M377A, F378A, V379A in S6) pore vestibules, and studied the
functional consequences using patch clamp technique. I found several key residues
are distinctively involved in the activation gating and the binding of ZD7288 to the
channel. For residues I348, G349, G351, P355 and V356, single amino acid
mutations completely disrupted the channel function, which indicates their crucial
roles involved in HCN channel permeation and/or gating. More importantly, several
177
CHAPTER 6
Wang Kai
hydrophobic residues in the lower part of S6, M377, F378 and V379, were identified
to be involved in both channel gating and ZD7288 blocking. Pharmacological and
kinetics experiments revealed F378 and V379 significantly diminished the
sensitivity of HCN1 channels to ZD7288 by decelerating the association of ZD7288
to the receptor while simultaneously accelerating its dissociation. Despite the
proximity, M377A enhanced ZD7288 block by exclusively accelerating drug
association. The differential effects of the Ala substitutions examined were
consistent with the notion that the observed changes in ZD7288 block were
site-specific. Based on these findings, I proposed a drug binding model that like their
homologues in Kv channels, M377, F378 and V379 may form a hydrophobic binding
pocket within the activation gate and interact with ZD7288 through hydrophobic or
pi-cation interaction.
These findings shed a light on the structure-function relationship in pore-forming
region of HCN channel and provide useful information for designing high specific
HCN blockers. Since the Ala-substitution of F378 shift the activation of HCN1
channel in positive direction, which make the channel more readily to open, it can be
used as genetically modified form for generating biological pacemaker. However, to
get a full understanding of structure-function relationship in this region, more
detailed works are required. For example, multi substitutions of M377, F378 and
V379 and double or triple mutations of these residues will be helpful in disecting
their mechanical roles in channel gating and drug binding and in revealing the
178
CHAPTER 6
Wang Kai
mechanism underlying differences between HCN isoforms in acitivation gating,
kinetics and drug specificity.
In addtion to cardiac cells, If current has also been found in various autonomic and
non-autonomic cell types, including neurons, retina, and taste buds. Kempen et al.
have demonstrated that a variety of ion channel transcripts, including HCN channels,
are present in pluripotent mESCs but no ionic currents at all can be detected
electrophysiologically before differentiation is induced (van Kempen et al., 2003).
However, in the study of the electrophysiological properties of undifferentiated
ESCs, I demonstrated that several specialized ion channels are expressed at the
mRNA and functional levels in both pluripotent mESCs and hESCs. The expression
profiles were much more heterogenous in mouse than that in human. Their
pharmacological properties and molecular identities documented by either RT-PCR
or microarray agreed on that these ion channels are mainly delayed rectifier K+
current. Furthermore, pharmacologic blockade revealed IKDR in both human and
mouse ESCs might play an important role in controlling the cell proliferation,
probably by influencing the resting membrane potential. These findings indicate a
novel strategy that can be used to inhibit or eliminate tumorgenicity of residual
pluripotent ESCs after implantation by targeted inhibition of specific K+ channel
activity which may cause a kind of cytotoxicity.
Interestingly, functional expression of If current was found in mESCs but not in
179
CHAPTER 6
Wang Kai
hESCs, encoded by HCN3 and low level of HCN2 at mRNA level. They may
contribute to the maintenance of the resting membrane potential of mouse ESCs. The
existence of If current could be arrhythmogenic, especially in species with slow heart
rate. This finding suggests that a given undifferentiated ESC line needs to be
carefully assessed before it can be used for therapeutic application. Future works
using small interfering RNA and/or dominant-negative ion channel constructs to
suppress the surface expression of ion channel receptors will hopefully to dissect the
precise molecular identities of current recorded and their physiological role in
proliferation and further differentiation.
Taken collectively, my research works not only deepen the understanding of
structure-function and physiological properties of HCN channel but also provide
useful information for the future development of gene- and cell- based therapies for
heart diseases.
180
REFERENCES
Wang Kai
References
Accili, E. A., C. Proenza, M. Baruscotti and D. DiFrancesco. 2002. From Funny
Current to HCN Channels: 20 Years of Excitation. News Physiol Sci 17(1): 32-37.
Amberg, G. C., S. D. Koh, Y. Imaizumi, S. Ohya and K. M. Sanders. 2003. A-type
potassium currents in smooth muscle. Am J Physiol Cell Physiol 284(3): C583-595.
Armstrong, C. M. 1971. Interaction of tetraethylammonium ion derivatives with the
potassium channels of giant axons. J Gen Physiol 58(4): 413-37.
Armstrong, C. M. and B. Hille. 1972. The inner quaternary ammonium ion receptor
in potassium channels of the node of Ranvier. J Gen Physiol 59(4): 388-400.
Azene, E. M., D. Sang, S. Y. Tsang and R. A. Li. 2005a. Pore-to-gate coupling of
HCN channels revealed by a pore variant that contributes to gating but not
permeation. Biochem Biophys Res Commun 327(4): 1131-42.
Azene, E. M., T. Xue and R. A. Li. 2003. Molecular basis of the effect of potassium
on heterologously expressed pacemaker (HCN) channels. J Physiol 547(Pt 2):
349-56.
Azene, E. M., T. Xue, E. Marban, G. F. Tomaselli and R. A. Li. 2005b.
Non-equilibrium behavior of HCN channels: insights into the role of HCN channels
in native and engineered pacemakers. Cardiovasc Res 67(2): 263-73.
Baker, M., J. R. Howe and J. M. Ritchie. 1993. Two types of
4-aminopyridine-sensitive potassium current in rabbit Schwann cells. J Physiol 464:
321-42.
Baruscotti, M., A. Bucchi and D. DiFrancesco. 2005. Physiology and pharmacology
of the cardiac pacemaker ("funny") current. Pharmacology & Therapeutics 107(1):
59-79.
Baruscotti, M. and D. Difrancesco. 2004. Pacemaker Channels. Ann NY Acad Sci
1015(1): 111-121.
Baruscotti, M., D. DiFrancesco and R. B. Robinson. 1996. A TTX-sensitive inward
sodium current contributes to spontaneous activity in newborn rabbit sino-atrial node
cells. J Physiol 492 ( Pt 1): 21-30.
Berns, K. I. and R. M. Linden. 1995. The cryptic life style of adeno-associated virus.
Bioessays 17(3): 237-45.
Bezanilla, F. 2000. The voltage sensor in voltage-dependent ion channels. Physiol
181
REFERENCES
Wang Kai
Rev 80(2): 555-92.
Biel, M., A. Ludwig, X. Zong and F. Hofmann. 1999. Hyperpolarization-activated
cation channels: a multi-gene family. Rev Physiol Biochem Pharmacol 136: 165-81.
Boheler, K. R., J. Czyz, D. Tweedie, H. T. Yang, S. V. Anisimov and A. M. Wobus.
2002. Differentiation of pluripotent embryonic stem cells into cardiomyocytes. Circ
Res 91(3): 189-201.
Bois, P., J. Bescond, B. Renaudon and J. Lenfant. 1996. Mode of action of
bradycardic agent, S 16257, on ionic currents of rabbit sinoatrial node cells. Br J
Pharmacol 118(4): 1051-7.
Bonci, D., A. Cittadini, M. V. Latronico, U. Borello, J. K. Aycock, A. Drusco, A.
Innocenzi, A. Follenzi, M. Lavitrano, M. G. Monti, J. Ross, Jr., L. Naldini, C.
Peschle, G. Cossu and G. Condorelli. 2003. 'Advanced' generation lentiviruses as
efficient vectors for cardiomyocyte gene transduction in vitro and in vivo. Gene Ther
10(8): 630-6.
Borer, J. S., K. Fox, P. Jaillon and G. Lerebours. 2003. Antianginal and antiischemic
effects of ivabradine, an I(f) inhibitor, in stable angina: a randomized, double-blind,
multicentered, placebo-controlled trial. Circulation 107(6): 817-23.
BoSmith, R. E., I. Briggs and N. C. Sturgess. 1993. Inhibitory actions of ZENECA
ZD7288 on whole-cell hyperpolarization activated inward current (If) in guinea-pig
dissociated sinoatrial node cells. Br J Pharmacol 110(1): 343-9.
Boyett, M. R., H. Dobrzynski, M. K. Lancaster, S. A. Jones, H. Honjo and I.
Kodama. 2003. Sophisticated architecture is required for the sinoatrial node to
perform its normal pacemaker function. J Cardiovasc Electrophysiol 14(1): 104-6.
Boyett, M. R., H. Honjo and I. Kodama. 2000. The sinoatrial node, a heterogeneous
pacemaker structure. Cardiovasc Res 47(4): 658-87.
Brown, H. and D. Difrancesco. 1980. Voltage-clamp investigations of membrane
currents underlying pace-maker activity in rabbit sino-atrial node. J Physiol 308:
331-51.
Brown, H. F., D. DiFrancesco and S. J. Noble. 1979. How does adrenaline accelerate
the heart? Nature 280(5719): 235-6.
Brown, H. F., W. Giles and S. J. Noble. 1977. Membrane currents underlying activity
in frog sinus venosus. J Physiol 271(3): 783-816.
Bucchi, A., M. Baruscotti and D. DiFrancesco. 2002. Current-dependent block of
rabbit sino-atrial node I(f) channels by ivabradine. J Gen Physiol 120(1): 1-13.
182
REFERENCES
Wang Kai
Bucchi, A., A. Tognati, R. Milanesi, M. Baruscotti and D. DiFrancesco. 2006.
Properties of ivabradine-induced block of HCN1 and HCN4 pacemaker channels. J
Physiol 572(Pt 2): 335-46.
Burns, J. C., T. Friedmann, W. Driever, M. Burrascano and J. K. Yee. 1993. Vesicular
stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very
high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc
Natl Acad Sci U S A 90(17): 8033-7.
Catterall, W. A., S. Cestele, V. Yarov-Yarovoy, F. H. Yu, K. Konoki and T. Scheuer.
2007. Voltage-gated ion channels and gating modifier toxins. Toxicon 49(2):
124-141.
Cerbai, E., M. Barbieri and A. Mugelli. 1994. Characterization of the
hyperpolarization-activated current, I(f), in ventricular myocytes isolated from
hypertensive rats. J Physiol 481 ( Pt 3): 585-91.
Cerbai, E., M. Barbieri and A. Mugelli. 1996. Occurrence and properties of the
hyperpolarization-activated current If in ventricular myocytes from normotensive
and hypertensive rats during aging. Circulation 94(7): 1674-81.
Cerbai, E., R. Pino, F. Porciatti, G. Sani, M. Toscano, M. Maccherini, G. Giunti and
A. Mugelli. 1997. Characterization of the hyperpolarization-activated current, I(f), in
ventricular myocytes from human failing heart. Circulation 95(3): 568-71.
Cerbai, E., L. Sartiani, P. DePaoli, R. Pino, M. Maccherini, F. Bizzarri, F. DiCiolla, G.
Davoli, G. Sani and A. Mugelli. 2001. The properties of the pacemaker current I(F)in
human ventricular myocytes are modulated by cardiac disease. J Mol Cell Cardiol
33(3): 441-8.
Champigny, G., P. Bois and J. Lenfant. 1987. Characterization of the ionic
mechanism responsible for the hyperpolarization-activated current in frog sinus
venosus. Pflugers Arch 410(1-2): 159-64.
Chaplan, S. R., H. Q. Guo, D. H. Lee, L. Luo, C. Liu, C. Kuei, A. A. Velumian, M. P.
Butler, S. M. Brown and A. E. Dubin. 2003. Neuronal hyperpolarization-activated
pacemaker channels drive neuropathic pain. J Neurosci 23(4): 1169-78.
Chen, J., J. S. Mitcheson, M. Tristani-Firouzi, M. Lin and M. C. Sanguinetti. 2001a.
The S4-S5 linker couples voltage sensing and activation of pacemaker channels.
PNAS 98(20): 11277-11282.
Chen, J., D. R. Piper and M. C. Sanguinetti. 2002. Voltage Sensing and Activation
Gating of HCN Pacemaker Channels. Trends in Cardiovascular Medicine 12(1):
42-45.
Chen,
S.,
J.
Wang
and
S.
A.
183
Siegelbaum.
2001b.
Properties
of
REFERENCES
Wang Kai
hyperpolarization-activated pacemaker current defined by coassembly of HCN1 and
HCN2 subunits and basal modulation by cyclic nucleotide. J Gen Physiol 117(5):
491-504.
Choi, K. L., C. Mossman, J. Aube and G. Yellen. 1993. The internal quaternary
ammonium receptor site of Shaker potassium channels. Neuron 10(3): 533-41.
Chu, D., C. C. Sullivan, M. D. Weitzman, L. Du, P. L. Wolf, S. W. Jamieson and P. A.
Thistlethwaite. 2003. Direct comparison of efficiency and stability of gene transfer
into the mammalian heart using adeno-associated virus versus adenovirus vectors. J
Thorac Cardiovasc Surg 126(3): 671-9.
Clapham, D. E. 1998. Not so funny anymore: pacing channels are cloned. Neuron
21(1): 5-7.
Cooper, E. C. and L. Y. Jan. 2003. M-channels: neurological diseases,
neuromodulation, and drug development. Arch Neurol 60(4): 496-500.
Courtney, K. R. 1975. Mechanism of frequency-dependent inhibition of sodium
currents in frog myelinated nerve by the lidocaine derivative GEA. J Pharmacol Exp
Ther 195(2): 225-36.
Cowan, D. B. and F. X. McGowan, Jr. 2006. A Paradigm Shift in Cardiac Pacing
Therapy? Circulation 114(10): 986-988.
Crouzy, S., S. Berneche and B. Roux. 2001. Extracellular blockade of K(+) channels
by TEA: results from molecular dynamics simulations of the KcsA channel. J Gen
Physiol 118(2): 207-18.
Curiel, D. T. and J. T. Douglas (2002). Adenoviral Vectors for Gene Therapy. . New
York, NY., Academic Press.
Dawson, T. M. and S. H. Snyder. 1994. Gases as biological messengers: nitric oxide
and carbon monoxide in the brain. J Neurosci 14(9): 5147-59.
Decher, N., J. Chen and M. C. Sanguinetti. 2004. Voltage-dependent Gating of
Hyperpolarization-activated, Cyclic Nucleotide-gated Pacemaker Channels:
MOLECULAR COUPLING BETWEEN THE S4-S5 AND C-LINKERS. J. Biol.
Chem. 279(14): 13859-13865.
Denyer, J. C. and H. F. Brown. 1990. Pacemaking in rabbit isolated sino-atrial node
cells during Cs+ block of the hyperpolarization-activated current if. J Physiol 429:
401-9.
Dhamoon, A. S. and J. Jalife. 2005. The inward rectifier current (IK1) controls
cardiac excitability and is involved in arrhythmogenesis. Heart Rhythm 2(3): 316-24.
184
REFERENCES
Wang Kai
DiFrancesco, D. 1981a. A new interpretation of the pace-maker current in calf
Purkinje fibres. J Physiol 314: 359-76.
DiFrancesco, D. 1981b. A study of the ionic nature of the pace-maker current in calf
Purkinje fibres. J Physiol 314: 377-93.
DiFrancesco, D. 1993. Pacemaker mechanisms in cardiac tissue. Annu Rev Physiol
55: 455-72.
DiFrancesco, D. 1999. Dual allosteric modulation of pacemaker (f) channels by
cAMP and voltage in rabbit SA node. J Physiol 515 ( Pt 2): 367-76.
DiFrancesco, D. 2005. Cardiac pacemaker I(f) current and its inhibition by heart
rate-reducing agents. Curr Med Res Opin 21(7): 1115-22.
DiFrancesco, D. and J. A. Camm. 2004. Heart rate lowering by specific and selective
I(f) current inhibition with ivabradine: a new therapeutic perspective in
cardiovascular disease. Drugs 64(16): 1757-65.
DiFrancesco, D. and M. Mangoni. 1994. Modulation of single
hyperpolarization-activated channels (i(f)) by cAMP in the rabbit sino-atrial node. J
Physiol 474(3): 473-82.
DiFrancesco, D. and P. Tortora. 1991. Direct activation of cardiac pacemaker
channels by intracellular cyclic AMP. Nature 351(6322): 145-7.
DiFrancesco, D. and C. Tromba. 1988. Muscarinic control of the
hyperpolarization-activated current (if) in rabbit sino-atrial node myocytes. J Physiol
405: 493-510.
Dobrzynski, H., M. R. Boyett and R. H. Anderson. 2007. New insights into
pacemaker activity: promoting understanding of sick sinus syndrome. Circulation
115(14): 1921-32.
Doetschman, T. C., H. Eistetter, M. Katz, W. Schmidt and R. Kemler. 1985. The in
vitro development of blastocyst-derived embryonic stem cell lines: formation of
visceral yolk sac, blood islands and myocardium. J Embryol Exp Morphol 87: 27-45.
Doyle, D. A., J. Morais Cabral, R. A. Pfuetzner, A. Kuo, J. M. Gulbis, S. L. Cohen, B.
T. Chait and R. MacKinnon. 1998. The structure of the potassium channel: molecular
basis of K+ conduction and selectivity. Science 280(5360): 69-77.
Dvash, T., Y. Mayshar, H. Darr, M. McElhaney, D. Barker, O. Yanuka, K. J. Kotkow,
L. L. Rubin, N. Benvenisty and R. Eiges. 2004. Temporal gene expression during
differentiation of human embryonic stem cells and embryoid bodies. Hum. Reprod.
19(12): 2875-2883.
185
REFERENCES
Wang Kai
Eduardo, M. and C. Hee Cheol. 2007. Creation of a biological pacemaker by geneor cell-based approaches. Medical and Biological Engineering and Computing 45(2):
133-144.
Er, F., R. Larbig, A. Ludwig, M. Biel, F. Hofmann, D. J. Beuckelmann and U. C.
Hoppe. 2003. Dominant-Negative Suppression of HCN Channels Markedly Reduces
the Native Pacemaker Current If and Undermines Spontaneous Beating of Neonatal
Cardiomyocytes. Circulation 107(3): 485-489.
Fermini, B. and O. F. Schanne. 1991. Determinants of action potential duration in
neonatal rat ventricle cells. Cardiovasc Res 25(3): 235-43.
Fernandez-Velasco, M., N. Goren, G. Benito, J. Blanco-Rivero, L. Bosca and C.
Delgado. 2003. Regional distribution of hyperpolarization-activated current (If) and
hyperpolarization-activated cyclic nucleotide-gated channel mRNA expression in
ventricular cells from control and hypertrophied rat hearts. J Physiol (Lond) 553(2):
395-405.
Ferrer, T., J. Rupp, D. R. Piper and M. Tristani-Firouzi. 2006. The S4-S5 Linker
Directly Couples Voltage Sensor Movement to the Activation Gate in the Human
Ether-a-go-go-related Gene (hERG) K+ Channel. J. Biol. Chem. 281(18):
12858-12864.
Fozzard, H. A., P. J. Lee and G. M. Lipkind. 2005. Mechanism of local anesthetic
drug action on voltage-gated sodium channels. Curr Pharm Des 11(21): 2671-86.
French, R. J. and J. J. Shoukimas. 1981. Blockage of squid axon potassium
conductance by internal tetra-N-alkylammonium ions of various sizes. Biophys J
34(2): 271-91.
Gao, G. P., M. R. Alvira, L. Wang, R. Calcedo, J. Johnston and J. M. Wilson. 2002.
Novel adeno-associated viruses from rhesus monkeys as vectors for human gene
therapy. Proc Natl Acad Sci U S A 99(18): 11854-9.
Gasparini, S. and D. DiFrancesco. 1997. Action of the hyperpolarization-activated
current (Ih) blocker ZD 7288 in hippocampal CA1 neurons. Pflügers Archiv
European Journal of Physiology 435(1): 99-106.
Gauss, R., R. Seifert and U. B. Kaupp. 1998. Molecular identification of a
hyperpolarization-activated channel in sea urchin sperm. Nature 393(6685): 583-7.
Haddad, G. E., E. R. Petrich, A. P. Zumino and O. F. Schanne. 1997. Background K+
currents and response to metabolic inhibition during early development in rat
cardiocytes. Mol Cell Biochem 177(1-2): 159-68.
Hagiwara, N., H. Irisawa and M. Kameyama. 1988. Contribution of two types of
calcium currents to the pacemaker potentials of rabbit sino-atrial node cells. J
186
REFERENCES
Wang Kai
Physiol 395: 233-53.
Halliwell, J. V. and P. R. Adams. 1982. Voltage-clamp analysis of muscarinic
excitation in hippocampal neurons. Brain Res 250(1): 71-92.
Han, W., W. Bao, Z. Wang and S. Nattel. 2002. Comparison of ion-channel subunit
expression in canine cardiac Purkinje fibers and ventricular muscle. Circ Res 91(9):
790-7.
Harary, I. and B. Farley. 1963. In vitro studies on single beating rat heart cells. I.
Growth and organization. Exp Cell Res 29: 451-65.
Harris, N. C. and A. Constanti. 1995. Mechanism of block by ZD 7288 of the
hyperpolarization-activated inward rectifying current in guinea pig substantia nigra
neurons in vitro. J Neurophysiol 74(6): 2366-78.
He, J. Q., Y. Ma, Y. Lee, J. A. Thomson and T. J. Kamp. 2003. Human embryonic
stem cells develop into multiple types of cardiac myocytes: action potential
characterization. Circ Res 93(1): 32-9.
Heginbotham, L., Z. Lu, T. Abramson and R. MacKinnon. 1994. Mutations in the
K+ channel signature sequence. Biophys J 66(4): 1061-7.
Heginbotham, L. and R. MacKinnon. 1992. The aromatic binding site for
tetraethylammonium ion on potassium channels. Neuron 8(3): 483-491.
Heiser, W. C. (2003). Gene delivery to mammalian cells. Totowa, NJ, Humana Press.
Henrikson, C. A., T. Xue, P. Dong, D. Sang, E. Marban and R. A. Li. 2003.
Identification of a surface charged residue in the S3-S4 linker of the pacemaker
(HCN) channel that influences activation gating. J Biol Chem 278(16): 13647-54.
Herskowitz, I. 1987. Functional inactivation of genes by dominant negative
mutations. Nature 329(6136): 219-22.
Heubach, J. F., E. M. Graf, J. Leutheuser, M. Bock, B. Balana, I. Zahanich, T. Christ,
S. Boxberger, E. Wettwer and U. Ravens. 2004. Electrophysiological properties of
human mesenchymal stem cells. J Physiol 554(Pt 3): 659-72.
Hille, B. 1967. The Selective Inhibition of Delayed Potassium Currents in Nerve by
Tetraethylammonium Ion. J. Gen. Physiol. 50(5): 1287-1302.
Hille, B. (2002). Ion channels of exitable membranes. Sunderland, U.S.A., Sinauer
Associates, Inc.
Hirano, Y. and M. Hiraoka. 1988. Barium-induced automatic activity in isolated
ventricular myocytes from guinea-pig hearts. J Physiol 395: 455-72.
187
REFERENCES
Wang Kai
Hodgson, D. M., A. Behfar, L. V. Zingman, G. C. Kane, C. Perez-Terzic, A. E.
Alekseev, M. Puceat and A. Terzic. 2004. Stable benefit of embryonic stem cell
therapy in myocardial infarction. Am J Physiol Heart Circ Physiol 287(2):
H471-479.
Hoppe, U. C. and D. J. Beuckelmann. 1998a. Characterization of the
hyperpolarization-activated inward current in isolated human atrial myocytes.
Cardiovasc Res 38(3): 788-801.
Hoppe, U. C., E. Jansen, M. Sudkamp and D. J. Beuckelmann. 1998b.
Hyperpolarization-activated inward current in ventricular myocytes from normal and
failing human hearts. Circulation 97(1): 55-65.
Hoshijima, M., Y. Ikeda, Y. Iwanaga, S. Minamisawa, M. O. Date, Y. Gu, M. Iwatate,
M. Li, L. Wang, J. M. Wilson, Y. Wang, J. Ross, Jr. and K. R. Chien. 2002. Chronic
suppression of heart-failure progression by a pseudophosphorylated mutant of
phospholamban via in vivo cardiac rAAV gene delivery. Nat Med 8(8): 864-71.
Huynh, T. V., F. Chen, G. T. Wetzel, W. F. Friedman and T. S. Klitzner. 1992.
Developmental changes in membrane Ca2+ and K+ currents in fetal, neonatal, and
adult rabbit ventricular myocytes. Circ Res 70(3): 508-515.
Imoto, Y., T. Ehara and H. Matsuura. 1987. Voltage- and time-dependent block of
iK1 underlying Ba2+-induced ventricular automaticity. Am J Physiol 252(2 Pt 2):
H325-33.
Irisawa, H., H. F. Brown and W. Giles. 1993. Cardiac pacemaking in the sinoatrial
node. Physiol Rev 73(1): 197-227.
Ishii, T. M., M. Takano and H. Ohmori. 2001. Determinants of activation kinetics in
mammalian hyperpolarization-activated cation channels. J Physiol (Lond) 537(1):
93-100.
Ishii, T. M., M. Takano, L. H. Xie, A. Noma and H. Ohmori. 1999. Molecular
characterization of the hyperpolarization-activated cation channel in rabbit heart
sinoatrial node. J Biol Chem 274(18): 12835-9.
Kamiya, K., J. S. Mitcheson, K. Yasui, I. Kodama and M. C. Sanguinetti. 2001.
Open channel block of HERG K(+) channels by vesnarinone. Mol Pharmacol 60(2):
244-53.
Kaupp, U. B. and R. Seifert. 2001. Molecular diversity of pacemaker ion channels.
Annu Rev Physiol 63: 235-57.
Kavanaugh, M. P., R. S. Hurst, J. Yakel, M. D. Varnum, J. P. Adelman and R. A.
North. 1992. Multiple subunits of a voltage-dependent potassium channel contribute
to the binding site for tetraethylammonium. Neuron 8(3): 493-497.
188
REFERENCES
Wang Kai
Kawada, T., M. Nakazawa, S. Nakauchi, K. Yamazaki, R. Shimamoto, M. Urabe, J.
Nakata, C. Hemmi, F. Masui, T. Nakajima, J. Suzuki, J. Monahan, H. Sato, T.
Masaki, K. Ozawa and T. Toyo-Oka. 2002. Rescue of hereditary form of dilated
cardiomyopathy by rAAV-mediated somatic gene therapy: amelioration of
morphological findings, sarcolemmal permeability, cardiac performances, and the
prognosis of TO-2 hamsters. Proc Natl Acad Sci U S A 99(2): 901-6.
Kehat, I., D. Kenyagin-Karsenti, M. Snir, H. Segev, M. Amit, A. Gepstein, E. Livne,
O. Binah, J. Itskovitz-Eldor and L. Gepstein. 2001. Human embryonic stem cells can
differentiate into myocytes with structural and functional properties of
cardiomyocytes. J Clin Invest 108(3): 407-14.
Kehat, I., L. Khimovich, O. Caspi, A. Gepstein, R. Shofti, G. Arbel, I. Huber, J. Satin,
J. Itskovitz-Eldor and L. Gepstein. 2004. Electromechanical integration of
cardiomyocytes derived from human embryonic stem cells. Nat Biotechnol 22(10):
1282-9.
Kerschensteiner, D., F. Monje and M. Stocker. 2003. Structural determinants of the
regulation of the voltage-gated potassium channel Kv2.1 by the modulatory
alpha-subunit Kv9.3. J Biol Chem 278(20): 18154-61.
Kerschensteiner, D. and M. Stocker. 1999. Heteromeric assembly of Kv2.1 with
Kv9.3: effect on the state dependence of inactivation. Biophys J 77(1): 248-57.
Kilborn, M. J. and D. Fedida. 1990. A study of the developmental changes in
outward currents of rat ventricular myocytes. J Physiol 430: 37-60.
Kirsch, G. E., M. Taglialatela and A. M. Brown. 1991. Internal and external TEA
block in single cloned K+ channels. Am J Physiol 261(4 Pt 1): C583-90.
Kodama, I., M. R. Nikmaram, M. R. Boyett, R. Suzuki, H. Honjo and J. M. Owen.
1997. Regional differences in the role of the Ca2+ and Na+ currents in pacemaker
activity in the sinoatrial node. Am J Physiol 272(6 Pt 2): H2793-806.
Koni, P. A., R. Khanna, M. C. Chang, M. D. Tang, L. K. Kaczmarek, L. C. Schlichter
and R. A. Flavella. 2003. Compensatory anion currents in Kv1.3 channel-deficient
thymocytes. J Biol Chem 278(41): 39443-51.
Kozarsky, K. F. 2001. Gene therapy for cardiovascular disease. Curr Opin
Pharmacol 1(2): 197-202.
Lesso, H. and R. A. Li. 2003. Helical secondary structure of the external S3-S4
linker of pacemaker (HCN) channels revealed by site-dependent perturbations of
activation phenotype. J Biol Chem 278(25): 22290-7.
Lewis, P., M. Hensel and M. Emerman. 1992. Human immunodeficiency virus
infection of cells arrested in the cell cycle. Embo J 11(8): 3053-8.
189
REFERENCES
Wang Kai
Li-Smerin, Y., D. H. Hackos and K. J. Swartz. 2000. alpha-helical structural
elements within the voltage-sensing domains of a K(+) channel. J Gen Physiol
115(1): 33-50.
Li, R. A., J. C. Moore, Y. S. Tarasova and K. R. Boheler. 2006. Human Embryonic
Stem Cell-Derived Cardiomyocytes:Therapeutic Potentials and Limitations. Journal
of Stem Cells 1(2): 109.
Li, R. A. and G. F. Tomaselli. 2004. Using the deadly mu-conotoxins as probes of
voltage-gated sodium channels. Toxicon 44(2): 117-22.
Lopatin, A. N. and C. G. Nichols. 2001. Inward rectifiers in the heart: an update on
I(K1). J Mol Cell Cardiol 33(4): 625-38.
Ludwig, A., X. Zong, F. Hofmann and M. Biel. 1999a. Structure and function of
cardiac pacemaker channels. Cell Physiol Biochem 9(4-5): 179-86.
Ludwig, A., X. Zong, M. Jeglitsch, F. Hofmann and M. Biel. 1998. A family of
hyperpolarization-activated mammalian cation channels. Nature 393(6685): 587-91.
Ludwig, A., X. Zong, J. Stieber, R. Hullin, F. Hofmann and M. Biel. 1999b. Two
pacemaker channels from human heart with profoundly different activation kinetics.
Embo J 18(9): 2323-9.
Luthi, A. and D. A. McCormick. 1998. H-current: properties of a neuronal and
network pacemaker. Neuron 21(1): 9-12.
Luzhkov, V. B. and J. Aqvist. 2001. Mechanisms of tetraethylammonium ion block
in the KcsA potassium channel. FEBS Lett 495(3): 191-6.
Mannikko, R., F. Elinder and H. P. Larsson. 2002. Voltage-sensing mechanism is
conserved among ion channels gated by opposite voltages. Nature 419(6909):
837-41.
Masuda, H. and N. Sperelakis. 1993. Inwardly rectifying potassium current in rat
fetal and neonatal ventricular cardiomyocytes. Am J Physiol 265(4 Pt 2): H1107-11.
Mathie, A., J. R. A. Wooltorton and C. S. Watkins. 1998. Voltage-activated
potassium channels in mammalian neurons and their block by novel pharmacological
agents. General Pharmacology: The Vascular System 30(1): 13-24.
Matulef, K., G. E. Flynn and W. N. Zagotta. 1999. Molecular rearrangements in the
ligand-binding domain of cyclic nucleotide-gated channels. Neuron 24(2): 443-52.
McCormick, D. A. and H. C. Pape. 1990. Properties of a hyperpolarization-activated
cation current and its role in rhythmic oscillation in thalamic relay neurones. J
Physiol 431: 291-318.
190
REFERENCES
Wang Kai
Meiry, G., Y. Reisner, Y. Feld, S. Goldberg, M. Rosen, N. Ziv and O. Binah. 2001.
Evolution of action potential propagation and repolarization in cultured neonatal rat
ventricular myocytes. J Cardiovasc Electrophysiol 12(11): 1269-77.
Melo, L. G., R. Agrawal, L. Zhang, M. Rezvani, A. A. Mangi, A. Ehsan, D. P. Griese,
G. Dell'Acqua, M. J. Mann, J. Oyama, S. F. Yet, M. D. Layne, M. A. Perrella and V. J.
Dzau. 2002. Gene therapy strategy for long-term myocardial protection using
adeno-associated virus-mediated delivery of heme oxygenase gene. Circulation
105(5): 602-7.
Menasche, P., A. A. Hagege, J. T. Vilquin, M. Desnos, E. Abergel, B. Pouzet, A. Bel,
S. Sarateanu, M. Scorsin, K. Schwartz, P. Bruneval, M. Benbunan, J. P. Marolleau
and D. Duboc. 2003. Autologous skeletal myoblast transplantation for severe
postinfarction left ventricular dysfunction. J Am Coll Cardiol 41(7): 1078-83.
Miake, J., E. Marban and H. B. Nuss. 2002. Gene therapy: Biological pacemaker
created by gene transfer. Nature 419(6903): 132-133.
Milanesi, R., M. Baruscotti, T. Gnecchi-Ruscone and D. DiFrancesco. 2006. Familial
Sinus Bradycardia Associated with a Mutation in the Cardiac Pacemaker Channel. N
Engl J Med 354(2): 151-157.
Mistrik, P., R. Mader, S. Michalakis, M. Weidinger, A. Pfeifer and M. Biel. 2005.
The murine HCN3 gene encodes a hyperpolarization-activated cation channel with
slow kinetics and unique response to cyclic nucleotides. J Biol Chem 280(29):
27056-61.
Mitcheson, J. S., J. Chen, M. Lin, C. Culberson and M. C. Sanguinetti. 2000. A
structural basis for drug-induced long QT syndrome. Proc Natl Acad Sci U S A
97(22): 12329-33.
Moore, J. C., L. W. van Laake, S. R. Braam, T. Xue, S. Y. Tsang, D. Ward, R. Passier,
L. L. Tertoolen, R. A. Li and C. L. Mummery. 2005. Human embryonic stem cells:
genetic manipulation on the way to cardiac cell therapies. Reprod Toxicol 20(3):
377-91.
Moosmang, S., J. Stieber, X. Zong, M. Biel, F. Hofmann and A. Ludwig. 2001.
Cellular
expression
and
functional
characterization
of
four
hyperpolarization-activated pacemaker channels in cardiac and neuronal tissues. Eur
J Biochem 268(6): 1646-52.
Moroni, A., L. Gorza, M. Beltrame, B. Gravante, T. Vaccari, M. E. Bianchi, C.
Altomare, R. Longhi, C. Heurteaux, M. Vitadello, A. Malgaroli and D. DiFrancesco.
2001. Hyperpolarization-activated cyclic nucleotide-gated channel 1 is a molecular
determinant of the cardiac pacemaker current I(f). J Biol Chem 276(31): 29233-41.
Mummery, C., D. Ward-van Oostwaard, P. Doevendans, R. Spijker, S. van den Brink,
191
REFERENCES
Wang Kai
R. Hassink, M. van der Heyden, T. Opthof, M. Pera, A. B. de la Riviere, R. Passier
and L. Tertoolen. 2003. Differentiation of human embryonic stem cells to
cardiomyocytes: role of coculture with visceral endoderm-like cells. Circulation
107(21): 2733-40.
Nagata, M., M. Takahashi, S. Muramatsu, Y. Ueda, Y. Hanazono, K. Takeuchi, K.
Okada, Y. Suzuki, Y. Kondo, M. Suemori, U. Ikeda, I. Nakano, E. Kobayashi, M.
Hasegawa, K. Ozawa, N. Nakatsuji and K. Shimada. 2003. Efficient gene transfer of
a simian immuno-deficiency viral vector into cardiomyocytes derived from primate
embryonic stem cells. J Gene Med 5(11): 921-8.
Nagy, A., J. Rossant, R. Nagy, W. Abramow-Newerly and J. C. Roder. 1993.
Derivation of completely cell culture-derived mice from early-passage embryonic
stem cells. Proc Natl Acad Sci U S A 90(18): 8424-8.
Naldini, L., U. Blomer, P. Gallay, D. Ory, R. Mulligan, F. H. Gage, I. M. Verma and
D. Trono. 1996. In vivo gene delivery and stable transduction of nondividing cells by
a lentiviral vector. Science 272(5259): 263-7.
Nau, C., S. Y. Wang, G. R. Strichartz and G. K. Wang. 1999. Point mutations at N434
in D1-S6 of mu1 Na(+) channels modulate binding affinity and stereoselectivity of
local anesthetic enantiomers. Mol Pharmacol 56(2): 404-13.
Niwa, H., J. Miyazaki and A. G. Smith. 2000. Quantitative expression of Oct-3/4
defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet 24(4):
372-6.
Ono, K., S. Shibata and T. Iijima. 2003. Pacemaker mechanism of porcine sino-atrial
node cells. J Smooth Muscle Res 39(5): 195-204.
Oyamada, Y., K. Komatsu, H. Kimura, M. Mori and M. Oyamada. 1996. Differential
regulation of gap junction protein (connexin) genes during cardiomyocytic
differentiation of mouse embryonic stem cells in vitro. Exp Cell Res 229(2): 318-26.
Panaghie, G. and G. W. Abbott. 2007. The role of S4 charges in voltage-dependent
and voltage-independent KCNQ1 potassium channel complexes. J Gen Physiol
129(2): 121-33.
Pannell, D. and J. Ellis. 2001. Silencing of gene expression: implications for design
of retrovirus vectors. Rev Med Virol 11(4): 205-17.
Pape, H. C. 1996. Queer current and pacemaker: the hyperpolarization-activated
cation current in neurons. Annu Rev Physiol 58: 299-327.
Parihar, A. S., M. J. Coghlan, M. Gopalakrishnan and C. C. Shieh. 2003. Effects of
intermediate-conductance Ca2+-activated K+ channel modulators on human prostate
cancer cell proliferation. Eur J Pharmacol 471(3): 157-64.
192
REFERENCES
Wang Kai
Perry, M., M. J. de Groot, R. Helliwell, D. Leishman, M. Tristani-Firouzi, M. C.
Sanguinetti and J. Mitcheson. 2004. Structural determinants of HERG channel block
by clofilium and ibutilide. Mol Pharmacol 66(2): 240-9.
Platoshyn, O., V. A. Golovina, C. L. Bailey, A. Limsuwan, S. Krick, M. Juhaszova, J.
E. Seiden, L. J. Rubin and J. X. Yuan. 2000. Sustained membrane depolarization and
pulmonary artery smooth muscle cell proliferation. Am J Physiol Cell Physiol 279(5):
C1540-9.
Plotnikov, A. N., E. A. Sosunov, J. Qu, I. N. Shlapakova, E. P. Anyukhovsky, L. Liu,
M. J. Janse, P. R. Brink, I. S. Cohen, R. B. Robinson, P. Danilo, Jr and M. R. Rosen.
2004. Biological Pacemaker Implanted in Canine Left Bundle Branch Provides
Ventricular Escape Rhythms That Have Physiologically Acceptable Rates.
Circulation 109(4): 506-512.
Pond, A. L. and J. M. Nerbonne. 2001. ERG proteins and functional cardiac I(Kr)
channels in rat, mouse, and human heart. Trends Cardiovasc Med 11(7): 286-94.
Porciatti, F., B. Pelzmann, E. Cerbai, P. Schaffer, R. Pino, E. Bernhart, B. Koidl and
A. Mugelli. 1997. The pacemaker current I(f) in single human atrial myocytes and
the effect of beta-adrenoceptor and A1-adenosine receptor stimulation. Br J
Pharmacol 122(5): 963-9.
Potapova, I., A. Plotnikov, Z. Lu, P. Danilo, Jr, V. Valiunas, J. Qu, S. Doronin, J.
Zuckerman, I. N. Shlapakova, J. Gao, Z. Pan, A. J. Herron, R. B. Robinson, P. R.
Brink, M. R. Rosen and I. S. Cohen. 2004. Human Mesenchymal Stem Cells as a
Gene Delivery System to Create Cardiac Pacemakers. Circ Res 94(7): 952-959.
Prole, D. L. and G. Yellen. 2006. Reversal of HCN Channel Voltage Dependence via
Bridging of the S4-S5 Linker and Post-S6. J Gen Physiol 128(3): 273-82.
Qu, J., C. Altomare, A. Bucchi, D. DiFrancesco and R. B. Robinson. 2002.
Functional comparison of HCN isoforms expressed in ventricular and HEK 293 cells.
Pflugers Arch 444(5): 597-601.
Qu, J., A. Barbuti, L. Protas, B. Santoro, I. S. Cohen and R. B. Robinson. 2001.
HCN2 overexpression in newborn and adult ventricular myocytes: distinct effects on
gating and excitability. Circ Res 89(1): E8-14.
Qu, J., Y. Kryukova, I. A. Potapova, S. V. Doronin, M. Larsen, G. Krishnamurthy, I.
S. Cohen and R. B. Robinson. 2004. MiRP1 Modulates HCN2 Channel Expression
and Gating in Cardiac Myocytes. J. Biol. Chem. 279(42): 43497-43502.
Qu, J., A. N. Plotnikov, P. Danilo, Jr., I. Shlapakova, I. S. Cohen, R. B. Robinson and
M. R. Rosen. 2003. Expression and function of a biological pacemaker in canine
heart. Circulation 107(8): 1106-9.
193
REFERENCES
Wang Kai
Ragsdale, D. S., J. C. McPhee, T. Scheuer and W. A. Catterall. 1994. Molecular
determinants of state-dependent block of Na+ channels by local anesthetics. Science
265(5179): 1724-8.
Ragsdale, D. S., J. C. McPhee, T. Scheuer and W. A. Catterall. 1996. Common
molecular determinants of local anesthetic, antiarrhythmic, and anticonvulsant block
of voltage-gated Na+ channels. Proc Natl Acad Sci U S A 93(17): 9270-5.
Ranjan, R., N. Chiamvimonvat, N. V. Thakor, G. F. Tomaselli and E. Marban. 1998.
Mechanism of anode break stimulation in the heart. Biophys J 74(4): 1850-63.
Robertson, B. E., P. R. Corry, P. C. Nye and R. Z. Kozlowski. 1992. Ca2+ and
Mg-ATP activated potassium channels from rat pulmonary artery. Pflugers Arch
421(2-3): 94-6.
Robinson, R. B., H. Yu, F. Chang and I. S. Cohen. 1997. Developmental change in
the voltage-dependence of the pacemaker current, if, in rat ventricle cells. Pflugers
Arch 433(4): 533-5.
Rosen, M. R., P. R. Brink, I. S. Cohen and R. B. Robinson. 2004. Genes, stem cells
and biological pacemakers. Cardiovasc Res 64(1): 12-23.
Rothberg, B. S., K. S. Shin, P. S. Phale and G. Yellen. 2002. Voltage-controlled
gating at the intracellular entrance to a hyperpolarization-activated cation channel. J
Gen Physiol 119(1): 83-91.
Rothberg, B. S., K. S. Shin and G. Yellen. 2003. Movements near the gate of a
hyperpolarization-activated cation channel. J Gen Physiol 122(5): 501-10.
Roux, B. 2005. Ion conduction and selectivity in K(+) channels. Annu Rev Biophys
Biomol Struct 34: 153-71.
Sambrook, J. and D. W. Russell (2001). Molecular Cloning: A Laboratory Manual
New York, Cold Spring Harbor Laboratory Press.
Sanguinetti, M. C. and Q. P. Xu. 1999. Mutations of the S4-S5 linker alter activation
properties of HERG potassium channels expressed in Xenopus oocytes. J Physiol
514 ( Pt 3): 667-75.
Santoro, B., S. Chen, A. Luthi, P. Pavlidis, G. P. Shumyatsky, G. R. Tibbs and S. A.
Siegelbaum.
2000.
Molecular
and
functional
heterogeneity
of
hyperpolarization-activated pacemaker channels in the mouse CNS. J Neurosci
20(14): 5264-75.
Santoro, B., D. T. Liu, H. Yao, D. Bartsch, E. R. Kandel, S. A. Siegelbaum and G. R.
Tibbs. 1998. Identification of a gene encoding a hyperpolarization-activated
pacemaker channel of brain. Cell 93(5): 717-29.
194
REFERENCES
Wang Kai
Santoro, B. and G. R. Tibbs. 1999. The HCN gene family: molecular basis of the
hyperpolarization-activated pacemaker channels. Ann N Y Acad Sci 868: 741-64.
Satin, J., I. Kehat, O. Caspi, I. Huber, G. Arbel, I. Itzhaki, J. Magyar, E. A. Schroder,
I. Perlman and L. Gepstein. 2004. Mechanism of spontaneous excitability in human
embryonic stem cell derived cardiomyocytes. J Physiol (Lond) 559(2): 479-496.
Satoh, H. 2003. Sino-atrial nodal cells of mammalian hearts: ionic currents and gene
expression of pacemaker ionic channels. J Smooth Muscle Res 39(5): 175-93.
Satoh, H. and N. Sperelakis. 1993. Developmental changes and modulation through
G-proteins of the hyperpolarization-activated inward current in embryonic chick
heart. Ann N Y Acad Sci 707: 413-6.
Schanne, O. F., L. Boutin and J. Derosiers. 1989. Effects of K-channel blockers,
calcium, and verapamil suggest different pacemaker mechanisms in cultured
neonatal rat and embryonic chick ventricle cells. Can J Physiol Pharmacol 67(7):
795-800.
Schulze-Bahr, E., A. Neu, P. Friederich, U. B. Kaupp, G. Breithardt, O. Pongs and D.
Isbrandt. 2003. Pacemaker channel dysfunction in a patient with sinus node disease.
J Clin Invest 111(10): 1537-45.
Seifert, R., A. Scholten, R. Gauss, A. Mincheva, P. Lichter and U. B. Kaupp. 1999.
Molecular characterization of a slowly gating human hyperpolarization-activated
channel predominantly expressed in thalamus, heart, and testis. Proc Natl Acad Sci
U S A 96(16): 9391-6.
Sesti, F., S. Rajan, R. Gonzalez-Colaso, N. Nikolaeva and S. A. Goldstein. 2003.
Hyperpolarization moves S4 sensors inward to open MVP, a methanococcal
voltage-gated potassium channel. Nat Neurosci 6(4): 353-61.
Shi, W., R. Wymore, H. Yu, J. Wu, R. T. Wymore, Z. Pan, R. B. Robinson, J. E.
Dixon, D. McKinnon and I. S. Cohen. 1999. Distribution and prevalence of
hyperpolarization-activated cation channel (HCN) mRNA expression in cardiac
tissues. Circ Res 85(1): e1-6.
Shin, K. S., C. Maertens, C. Proenza, B. S. Rothberg and G. Yellen. 2004.
Inactivation in HCN channels results from reclosure of the activation gate:
desensitization to voltage. Neuron 41(5): 737-44.
Shin, K. S., B. S. Rothberg and G. Yellen. 2001. Blocker state dependence and
trapping in hyperpolarization-activated cation channels: evidence for an intracellular
activation gate. J Gen Physiol 117(2): 91-101.
Singla, D. K., T. A. Hacker, L. Ma, P. S. Douglas, R. Sullivan, G. E. Lyons and T. J.
Kamp. 2006. Transplantation of embryonic stem cells into the infarcted mouse heart:
195
REFERENCES
Wang Kai
formation of multiple cell types. Journal of Molecular and Cellular Cardiology
40(1): 195-200.
Siu, C.-W., D.-K. Lieu and R. A. Li. 2007a. HCN-Encoded Pacemaker Channels:
From Physiology, Biophysics to Bioengineering. J Mem Biol In press.
Siu, C.-W., J. C. Moore and R. A. Li. 2007b. Human Embryonic Stem Cell-Derived
Cardiomyocytes as a Potential Solution to Heart Diseases. Cardiovascular &
Hematological Disorders - Drug Targets In press.
Smits, P. C., R. J. van Geuns, D. Poldermans, M. Bountioukos, E. E. Onderwater, C.
H. Lee, A. P. Maat and P. W. Serruys. 2003. Catheter-based intramyocardial injection
of autologous skeletal myoblasts as a primary treatment of ischemic heart failure:
clinical experience with six-month follow-up. J Am Coll Cardiol 42(12): 2063-9.
Sohl, G., M. Theis, G. Hallas, S. Brambach, E. Dahl, G. Kidder and K. Willecke.
2001. A new alternatively spliced transcript of the mouse connexin32 gene is
expressed in embryonic stem cells, oocytes, and liver. Exp Cell Res 266(1): 177-86.
Solter, D. and B. B. Knowles. 1978. Monoclonal antibody defining a stage-specific
mouse embryonic antigen (SSEA-1). Proc Natl Acad Sci U S A 75(11): 5565-9.
Stieber, J., G. Stockl, S. Herrmann, B. Hassfurth and F. Hofmann. 2005. Functional
expression of the human HCN3 channel. J Biol Chem 280(41): 34635-43.
Stocker, M. and D. Kerschensteiner. 1998. Cloning and tissue distribution of two
new potassium channel alpha-subunits from rat brain. Biochem Biophys Res
Commun 248(3): 927-34.
Strauer, B. E. and R. Kornowski. 2003. Stem cell therapy in perspective. Circulation
107(7): 929-34.
Su, H., S. Joho, Y. Huang, A. Barcena, J. Arakawa-Hoyt, W. Grossman and Y. W.
Kan. 2004. Adeno-associated viral vector delivers cardiac-specific and
hypoxia-inducible VEGF expression in ischemic mouse hearts. Proc Natl Acad Sci U
S A 101(46): 16280-5.
Sun, Z. (2004). Molecular Cardiology: Methods and Protocols Totowa, NJ, Humana
Press
Thollon, C., C. Cambarrat, J. Vian, J. F. Prost, J. L. Peglion and J. P. Vilaine. 1994.
Electrophysiological effects of S 16257, a novel sino-atrial node modulator, on rabbit
and guinea-pig cardiac preparations: comparison with UL-FS 49. Br J Pharmacol
112(1): 37-42.
Thomson, J. A., J. Itskovitz-Eldor, S. S. Shapiro, M. A. Waknitz, J. J. Swiergiel, V. S.
196
REFERENCES
Wang Kai
Marshall and J. M. Jones. 1998. Embryonic stem cell lines derived from human
blastocysts. Science 282(5391): 1145-7.
Tombola, F., M. M. Pathak and E. Y. Isacoff. 2006. How Does Voltage Open an Ion
Channel? Annu Rev Cell Dev Biol 22: 23-52.
Tristani-Firouzi, M., J. Chen and M. C. Sanguinetti. 2002. Interactions between
S4-S5 Linker and S6 Transmembrane Domain Modulate Gating of HERG K+
Channels. J. Biol. Chem. 277(21): 18994-19000.
Trono, D. (2002). Lentiviral vectors. New York, Spring-Verlag Berlin Heidelberg.
Tsang, S. Y., H. Lesso and R. A. Li. 2004. Dissecting the structural and functional
roles of the S3-S4 linker of pacemaker (hyperpolarization-activated cyclic
nucleotide-modulated) channels by systematic length alterations. J Biol Chem
279(42): 43752-9.
Tse, H.-F., T. Xue, C.-P. Lau, C.-W. Siu, K. Wang, Q.-Y. Zhang, G. F. Tomaselli, F. G.
Akar and R. A. Li. 2006. Bioartificial Sinus Node Constructed via In Vivo Gene
Transfer of an Engineered Pacemaker HCN Channel Reduces the Dependence on
Electronic Pacemaker in a Sick-Sinus Syndrome Model. Circulation 114(10):
1000-1011.
Ueda, K., K. Nakamura, T. Hayashi, N. Inagaki, M. Takahashi, T. Arimura, H.
Morita, Y. Higashiuesato, Y. Hirano, M. Yasunami, S. Takishita, A. Yamashina, T.
Ohe, M. Sunamori, M. Hiraoka and A. Kimura. 2004. Functional Characterization of
a Trafficking-defective HCN4 Mutation, D553N, Associated with Cardiac
Arrhythmia. J. Biol. Chem. 279(26): 27194-27198.
Ulens, C. and J. Tytgat. 2001. Functional heteromerization of HCN1 and HCN2
pacemaker channels. J Biol Chem 276(9): 6069-72.
Valiunas, V., S. Doronin, L. Valiuniene, I. Potapova, J. Zuckerman, B. Walcott, R. B.
Robinson, M. R. Rosen, P. R. Brink and I. S. Cohen. 2004. Human mesenchymal
stem cells make cardiac connexins and form functional gap junctions. J Physiol
(Lond) 555(3): 617-626.
van der Heyden, M. A., M. J. van Kempen, Y. Tsuji, M. B. Rook, H. J. Jongsma and
T. Opthof. 2003. P19 embryonal carcinoma cells: a suitable model system for cardiac
electrophysiological differentiation at the molecular and functional level. Cardiovasc
Res 58(2): 410-22.
van Kempen, M. J. A., A. van Ginneken, I. de Grijs, N. A. M. Mutsaers, T. Opthof, H.
J. Jongsma and M. A. G. van der Heyden. 2003. Expression of the
Electrophysiological System During Murine Embryonic Stem Cell Cardiac
Differentiation. Cell Physiol and Biochem 13(5): 263-270.
197
REFERENCES
Wang Kai
Varnum, M. D., K. D. Black and W. N. Zagotta. 1995. Molecular mechanism for
ligand discrimination of cyclic nucleotide-gated channels. Neuron 15(3): 619-25.
Vaur, S., L. Bresson-Bepoldin, B. Dufy, S. Tuffet and L. Dufy-Barbe. 1998.
Potassium channel inhibition reduces cell proliferation in the GH3 pituitary cell line.
J Cell Physiol 177(3): 402-10.
Vautier, F., S. Belachew, R. Chittajallu and V. Gallo. 2004. Shaker-type potassium
channel subunits differentially control oligodendrocyte progenitor proliferation. Glia
48(4): 337-45.
Vemana, S., S. Pandey and H. P. Larsson. 2004. S4 movement in a mammalian HCN
channel. J Gen Physiol 123(1): 21-32.
Vinogradova, T. M., V. A. Maltsev, K. Y. Bogdanov, A. E. Lyashkov and E. G.
Lakatta. 2005. Rhythmic Ca2+ oscillations drive sinoatrial nodal cell pacemaker
function to make the heart tick. Ann N Y Acad Sci 1047: 138-56.
Viscomi, C., C. Altomare, A. Bucchi, E. Camatini, M. Baruscotti, A. Moroni and D.
DiFrancesco. 2001. C terminus-mediated control of voltage and cAMP gating of
hyperpolarization-activated cyclic nucleotide-gated channels. J Biol Chem 276(32):
29930-4.
Viswanathan, S., T. Benatar, M. Mileikovsky, D. A. Lauffenburger, A. Nagy and P. W.
Zandstra. 2003. Supplementation-dependent differences in the rates of embryonic
stem cell self-renewal, differentiation, and apoptosis. Biotechnol Bioeng 84(5):
505-17.
Wahl-Schott, C., L. Baumann, X. Zong and M. Biel. 2005. An arginine residue in the
pore region is a key determinant of chloride dependence in cardiac pacemaker
channels. J Biol Chem 280(14): 13694-700.
Wahler, G. M. 1992. Developmental increases in the inwardly rectifying potassium
current of rat ventricular myocytes. Am J Physiol 262(5 Pt 1): C1266-72.
Wainger, B. J., M. DeGennaro, B. Santoro, S. A. Siegelbaum and G. R. Tibbs. 2001.
Molecular mechanism of cAMP modulation of HCN pacemaker channels. Nature
411(6839): 805-10.
Walsh, K. B. and G. E. Parks. 2002. Changes in cardiac myocyte morphology alter
the properties of voltage-gated ion channels. Cardiovasc Res 55(1): 64-75.
Wang, G. K., C. Quan and S. Wang. 1998. A common local anesthetic receptor for
benzocaine and etidocaine in voltage-gated mu1 Na+ channels. Pflugers Arch 435(2):
293-302.
Wang,
J.,
S.
Chen
and
S.
A.
198
Siegelbaum.
2001.
Regulation
of
REFERENCES
Wang Kai
hyperpolarization-activated HCN channel gating and cAMP modulation due to
interactions of COOH terminus and core transmembrane regions. J Gen Physiol
118(3): 237-50.
Wang, S. Y., C. Nau and G. K. Wang. 2000. Residues in Na(+) channel D3-S6
segment modulate both batrachotoxin and local anesthetic affinities. Biophys J 79(3):
1379-87.
Wolfgang, M. J., S. G. Eisele, M. A. Browne, M. L. Schotzko, M. A. Garthwaite, M.
Durning, A. Ramezani, R. G. Hawley, J. A. Thomson and T. G. Golos. 2001. Rhesus
monkey placental transgene expression after lentiviral gene transfer into
preimplantation embryos. Proc Natl Acad Sci U S A 98(19): 10728-32.
Wollmuth, L. P. 1995. Multiple ion binding sites in Ih channels of rod photoreceptors
from tiger salamanders. Pflugers Arch 430(1): 34-43.
Wollmuth, L. P. and B. Hille. 1992. Ionic selectivity of Ih channels of rod
photoreceptors in tiger salamanders. J Gen Physiol 100(5): 749-65.
Wonderlin, W. F. and J. S. Strobl. 1996. Potassium channels, proliferation and G1
progression. J Membr Biol 154(2): 91-107.
Wright, M. J., L. M. Wightman, C. Lilley, M. de Alwis, S. L. Hart, A. Miller, R. S.
Coffin, A. Thrasher, D. S. Latchman and M. S. Marber. 2001. In vivo myocardial
gene transfer: optimization, evaluation and direct comparison of gene transfer
vectors. Basic Res Cardiol 96(3): 227-36.
Wright, S. N., S. Y. Wang and G. K. Wang. 1998. Lysine point mutations in Na+
channel D4-S6 reduce inactivated channel block by local anesthetics. Mol
Pharmacol 54(4): 733-9.
Xie, L. H., M. Takano and A. Noma. 1997. Development of inwardly rectifying K+
channel family in rat ventricular myocytes. Am J Physiol 272(4 Pt 2): H1741-50.
Xu, Y. Q., A. S. Pickoff and C. W. Clarkson. 1991. Evidence for developmental
changes in sodium channel inactivation gating and sodium channel block by
phenytoin in rat cardiac myocytes. Circ Res 69(3): 644-56.
Xue, T., H. C. Cho, F. G. Akar, S. Y. Tsang, S. P. Jones, E. Marban, G. F. Tomaselli
and R. A. Li. 2005. Functional integration of electrically active cardiac derivatives
from genetically engineered human embryonic stem cells with quiescent recipient
ventricular cardiomyocytes: insights into the development of cell-based pacemakers.
Circulation 111(1): 11-20.
Xue, T. and R. A. Li. 2002a. An external determinant in the S5-P linker of the
pacemaker (HCN) channel identified by sulfhydryl modification. J Biol Chem
277(48): 46233-42.
199
REFERENCES
Wang Kai
Xue, T., E. Marban and R. A. Li. 2002b. Dominant-negative suppression of HCN1and HCN2-encoded pacemaker currents by an engineered HCN1 construct: insights
into structure-function relationships and multimerization. Circ Res 90(12): 1267-73.
Xue, T., C.-W. Siu, D. K. Lieu, C.-P. Lau, H.-F. Tse and R. A. Li. 2007. Mechanistic
Role of If Revealed by Induction of Ventricular Automaticity by Somatic Gene
Transfer of Gating-Engineered Pacemaker (HCN) Channels. Circulation 115(14):
1839-1850.
Yamaoka, K., S. M. Vogel and I. Seyama. 2006. Na+ channel pharmacology and
molecular mechanisms of gating. Curr Pharm Des 12(4): 429-42.
Yanagihara, K. and H. Irisawa. 1980. Inward current activated during
hyperpolarization in the rabbit sinoatrial node cell. Pflugers Arch 385(1): 11-9.
Yang, S. N., U. B. Finnman and K. Fuxe. 1996. The non-peptide neuropeptide Y Y1
receptor antagonist BIBP3226 blocks the [Leu31,Pro34]neuropeptide Y-induced
modulation of alpha 2-adrenoceptors in the nucleus tractus solitarii of the rat.
Neuroreport 7(15-17): 2701-5.
Yarov-Yarovoy, V., J. Brown, E. M. Sharp, J. J. Clare, T. Scheuer and W. A. Catterall.
2001. Molecular determinants of voltage-dependent gating and binding of
pore-blocking drugs in transmembrane segment IIIS6 of the Na(+) channel alpha
subunit. J Biol Chem 276(1): 20-7.
Yarov-Yarovoy, V., J. C. McPhee, D. Idsvoog, C. Pate, T. Scheuer and W. A.
Catterall. 2002. Role of amino acid residues in transmembrane segments IS6 and
IIS6 of the Na+ channel alpha subunit in voltage-dependent gating and drug block. J
Biol Chem 277(38): 35393-401.
Yasui, K., K. Kada, M. Hojo, J.-K. Lee, K. Kamiya, J. Toyama, T. Opthof and I.
Kodama. 2000. Cell-to-cell interaction prevents cell death in cultured neonatal rat
ventricular myocytes. Cardiovascular Research 48(1): 68-76.
Yasui, K., W. Liu, T. Opthof, K. Kada, J. K. Lee, K. Kamiya and I. Kodama. 2001.
I(f) current and spontaneous activity in mouse embryonic ventricular myocytes. Circ
Res 88(5): 536-42.
Yellen, G. 1998. The moving parts of voltage-gated ion channels. Q Rev Biophys
31(3): 239-95.
Yellen, G., M. E. Jurman, T. Abramson and R. MacKinnon. 1991. Mutations
affecting internal TEA blockade identify the probable pore-forming region of a K+
channel. Science 251(4996): 939-42.
Yu, C. C., A. L. Woods and D. A. Levison. 1992. The assessment of cellular
proliferation by immunohistochemistry: a review of currently available methods and
200
REFERENCES
Wang Kai
their applications. Histochem J 24(3): 121-31.
Yu, H., F. Chang and I. S. Cohen. 1993. Pacemaker current exists in ventricular
myocytes. Circ Res 72(1): 232-6.
Yu, H., F. Chang and I. S. Cohen. 1995. Pacemaker current i(f) in adult canine
cardiac ventricular myocytes. J Physiol 485 ( Pt 2): 469-83.
Yusuf, S. and A. J. Camm. 2003. Sinus tachyarrhythmias and the specific
bradycardic agents: a marriage made in heaven? J Cardiovasc Pharmacol Ther 8(2):
89-105.
Zagotta, W. N., N. B. Olivier, K. D. Black, E. C. Young, R. Olson and E. Gouaux.
2003. Structural basis for modulation and agonist specificity of HCN pacemaker
channels. Nature 425(6954): 200-205.
Zhang, H., A. V. Holden, I. Kodama, H. Honjo, M. Lei, T. Varghese and M. R.
Boyett. 2000. Mathematical models of action potentials in the periphery and center
of the rabbit sinoatrial node. Am J Physiol Heart Circ Physiol 279(1): H397-421.
Zhao, J., G. J. Pettigrew, J. Thomas, J. I. Vandenberg, L. Delriviere, E. M. Bolton, A.
Carmichael, J. L. Martin, M. S. Marber and A. M. Lever. 2002. Lentiviral vectors for
delivery of genes into neonatal and adult ventricular cardiac myocytes in vitro and in
vivo. Basic Res Cardiol 97(5): 348-58.
Zhorov, B. S. and D. B. Tikhonov. 2004. Potassium, sodium, calcium and
glutamate-gated channels: pore architecture and ligand action. J Neurochem 88(4):
782-99.
Zhou, Z. and S. L. Lipsius. 1992. Properties of the pacemaker current (If) in latent
pacemaker cells isolated from cat right atrium. J Physiol 453: 503-23.
Zhou, Z. and S. L. Lipsius. 1993. Effect of isoprenaline on I(f) current in latent
pacemaker cells isolated from cat right atrium: ruptured vs. perforated patch
whole-cell recording methods. Pflugers Arch 423(5-6): 442-7.
Zorn-Pauly, K., P. Schaffer, B. Pelzmann, P. Lang, H. Machler, B. Rigler and B.
Koidl. 2004. If in left human atrium: a potential contributor to atrial ectopy.
Cardiovasc Res 64(2): 250-9.
Zufferey, R., T. Dull, R. J. Mandel, A. Bukovsky, D. Quiroz, L. Naldini and D. Trono.
1998. Self-Inactivating Lentivirus Vector for Safe and Efficient In Vivo Gene
Delivery. J. Virol. 72(12): 9873-9880.
201
APPENDIX
Wang Kai
Publications
1. Wang K, Xue T, Tsang SY, Van Huizen R, Wong CW, Lai KW, Ye Z, Cheng L,
Au KW, Zhang J, Li GR, Lau CP, Tse HF, Li RA. Electrophysiological Properties
of Pluripotent Human and Mouse Embryonic Stem Cells. Stem Cells. 2005;
23(10):1526-1534.
2. Tse HF, Xue T, Lau C-P, Siu C-W, Wang K, Zhang Q-Y, Tomaselli GF, Akar FG,
Li RA. Bioartificial Sinus Node Constructed via In Vivo Gene Transfer of an
Engineered Pacemaker HCN Channel Reduces the Dependence on Electronic
Pacemaker in a Sick-Sinus Syndrome Model. Circulation. 2006; 114(10):
1000-1011
3. Wang K, Chan Y-C, Lau C-P, Tse HF, Li RA. Probing the bradycardiac drug
binding receptor of HCN-encoded pacemaker channels. Journal of Biological
Chemistry. (under revision)
4. Wang K, Tse H-F, Lau CP,
Li RA. Characterizing the basis of automaticity of
neonatal rat ventricular myocytes: Implications for cardiac excitability
manipulations. (manuscript in preparation)
Conference Proceedings
1. Wang K, Xue T, Tsang SY, et al. Electrophysiological Properties of Pluripotent
Human and Mouse Embryonic Stem Cells. Presented at AHA Scientific Sessions
2004, New Orleans, LA, November 7, 2004 and Annual Scientific Meeting of the
Institute of Cardiovascular Science and Medicine, Hong Kong, December 11, 2004
2. Wang K, Tse H-F, Lau CP, et al. Characterizing the basis of automaticity of
neonatal ventricular myocytes: Implications for cardiac excitability manipulations.
Presented at the International Symposium on Healthy Aging, Hong Kong, March 4,
2006
3. Chan Y-C, Wang K, Lau C-P, et al. Probing the drug binding site of the inner pore
vestibule of the HCN-encoded pacemaker channels. Presented at AHA Young
Investigators Forum, San Francisco, CA, September 29, 2006
4. Wang K, Chan Y-C, Lau C-P, et al. Probing the bradycardiac drug binding
receptor of HCN-encoded pacemaker channels. Presented at MGH-HKU-Nature
China Forum, Hong Kong, March 5, 2007
202