1. health and fitness
2. disease

WORLD JOURNAL OWorld
F PHJournal
ARMAof
CY
AND Pand
H AR
MACEUTICSciences
AL SCIENCES
El-Bakry
Pharmacy
Pharmaceutical
SJIF Impact Factor 5.210
Volume 4, Issue 05, 1962-1983.
Research Article
ISSN 2278 – 4357
EXOGENOUS MELATONIN INHIBITS IMMUNE FUNCTION IN
SHAW’S JIRD (MERIONES SHAWI)
Hanan A. El-Bakry*
Department of Zoology, Faculty of Science, Minia University.
ABSTRACT
Article Received on
13 March 2015,
Revised on 06 April 2015,
Accepted on 30 April 2015
The pineal hormone melatonin is reported to be a fundamental
immunomodulator in a variety of species. Nevertheless, evidence
supporting the immunoregulatory role of melatonin is conflicting, and
information concerning its role in desert animals is scarce. The present
*Correspondence for
study addressed the effects of exogenous melatonin administration on
Author
immune function in a wild-caught desert rodent species (Shaw’s jird;
Dr. Hanan A. El-Bakry
Meriones shawi). The serum levels of cytokines (TNFα, IL-1β, IL-6,
Department of Zoology,
Faculty of Science, Minia
University.
IFNγ and IL-4) and immunoglobulins (IgA and IgE) were measured by
ELISA assay; the frequency of CD8+ cells (cytotoxic T-lymphocytes)
or IgM+ (immunoglobulin M) cells was assessed by
immunohistochemistry; the percentage of splenic lymphocyte populations in the white pulp
was assessed by quantitative image analysis. In addition, the levels of TNFα and IL-4
mRNAs in the thymus and spleen were assessed by Semi-quantitative RT-PCR. Daily
administration of melatonin (50 µg/ml of drinking water for 8 weeks) decreased both humoral
and cell-mediated immunity in Meriones shawi. It significantly decreased the secretion of
Th1 cytokines (IFNγ and TNFα) and the production of Th2 cytokines (IL4). It also lowered
the serum levels of IL1β and IL6 which are secreted by activated macrophages, and
decreased the serum levels of IgA and Ig E. Similarly, the cellularity of splenic white pulp
and red pulp, and the frequency of CD8+ and IgM+ cells were markedly decreased.
Melatonin also down-regulated the level of gene expression of TNFα and IL-4 in thymus.
Male jirds did not differ from female jirds in any of these parameters. Altogether, these
results demonstrate for the first time that exogenous melatonin has immunosuppressive
effects in Meriones shawi.
KEYWORDS:
melatonin,
cytokines,
immunoglobulins,
cytotoxic
T-lymphocytes,
immunohistochemistry, RT-PCR.
www.wjpps.com
Vol 4, Issue 05, 2015.
1962
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
INTRODUCTION
The immune and neuroendocrine systems help an organism to cope with altering demands of
the environment. Accordingly, there is ample evidence indicating a bidirectional relationship
between the neuroendocrine and immune systems, in which the immune system acts on the
neuroendocrine system through its cytokines, and the neuroendocrine system, in return
modulates the immune system through its hormones.[1] It is evident from previous studies that
proinflammatory cytokines such as tumor necrosis factor (TNF)-α, interleukin (IL-1β), and
interleukin (IL-6) initiate and mediate many of the metabolic, neuroendocrine, and
immunological alterations which occur in response to various stimuli. Interferon (IFN)-γ and
anti-inflammatory cytokines such as interleukin (IL-4) and interleukin (IL-10) play a pivotal
role in modulating the neuroendocrine-immuno-regulatory network as well.[2] These
cytokines are produced mainly by monocytes and macrophages (TNFα; IL1β; IL6), T helper
1 (Th1) lymphocytes (IFNγ; TNFα), and T helper 2 (Th2) lymphocytes (IL-4; IL-10).[2] The
pineal gland is considered as an essential part of this neuroendocrine-immune network, and a
clear bidirectional functional relationship has been shown between the pineal gland and the
immune system.[3] The pineal gland translates environmental cues (such as daylength and
temperature) into physiologically meaningful endocrine signals through the secretion of its
hormone melatonin, N acetyl-5-methoxytryptamine.[4] The synthesis and release of melatonin
by the pineal gland exhibit a circadian rhythm with a peak at night and lowest levels at
daytime.[5]
The contribution of melatonin in the establishment of a pineal-immune axis has received a
great deal of attention. Pinealectomy or any other experimental manipulation that inhibits
melatonin synthesis and secretion has been shown to cause a state of immunodepression that
counteracted by exogenous melatonin treatment.[6] Nevertheless, the data concerning the role
of exogenous melatonin as an immunomodulator is puzzling and sometimes contradictory.
Most studies have shown that melatonin has immunoenhancing properties[7]; it enhances
immune responses through activating T lymphocytes[8], enhancing of antibody-dependent
cellular toxicity[9], and stimulating the release of cytokines such as interleukin 2 (IL2),
interleukin 6 (IL6), and interferon γ (IFN γ).[10] Some other studies have indicated that
melatonin may inhibit immune responses and acting as anti-inflammatory agent.[11]
Most of the available data about the action of melatonin on the immune system is from
laboratory species. Information concerning the immunoregulatory role of melatonin in wild
www.wjpps.com
Vol 4, Issue 05, 2015.
1963
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
caught rodent species, especially desert rodents is scarce. Indeed, desert rodents have not
received the attention other rodents have in studying the relationship between the pineal
gland, immune system, and photoperiod. The value of studying desert rodents resides in the
ability to investigate their physiological responses under controlled environmental conditions
in the laboratory, and then relate the obtained results to the natural conditions in the wild
where the animal live and face challenges of the harsh desert environment. In a previous
study, the correlation between the pineal gland and the immune system has been
demonstrated in a wild-caught desert rodent species (Meriones shawi; the Shaw’s jird) using
constant light exposure regimen (functional pinealectomy) which mimics the effects of actual
pinealectomy in inhibiting melatonin synthesis and release; functional pinealectomy appeared
to impair both cellular and humoral immune responses in those desert animals.[12] Therefore,
it has been suggested that an influential functional link exists between the pineal gland and
the immune system in desert rodents to cope with harsh environmental conditions and
physiological needs.
The present study was conducted to extend these previous findings and to assess the possible
immunomodulating effects of exogenous melatonin administration in normal jirds, i. e. in
presence of normal endogenous melatonin synthesis and secretion. Indeed, this study aimed
to determine whether exogenous melatonin has immunoenhancing properties in desert
rodents, similar to those observed in most of temperate-zone species studied so far.
MATERIALS AND METHODS
Animals
Adult wild-caught male and female Shaw's jirds (Meriones shawi) were obtained from
Western desert, Egypt (~30No latitude). The animals were weighed and housed under normal
laboratory conditions with respect to both photoperiod and temperature (early spring) for
about 2 weeks as an acclimatization period. Food and water were available ad libitum.
Experimental design
Male and female jirds were randomly divided into control and experimental subgroups (n=5
each). Control jirds received vehicle (0.001% ethanol) in drinking water. Experimental jirds
were given melatonin (Sigma Chemical Co., St. Louis, MO, USA) continuously via the
drinking water (50 µg/ml). The reason for choosing this route of administration was to
prevent jirds from unnecessary stress. Since jirds drink ~ 8 ml of water per day
[13]
, the
administered melatonin dosage provided approximately 400μg melatonin/day. Melatonin was
www.wjpps.com
Vol 4, Issue 05, 2015.
1964
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
prepared by dissolving 20 mg in 96% ethanol and diluting to 400 ml with drinking water;
final ethanol concentration in drinking water was 0.001%. The water bottles containing
melatonin were wrapped in aluminium foil to prevent light-induced degradation of melatonin.
The experiment was conducted for 8 weeks during April to June. All procedures were in
accordance with institutional guidelines, and follow the Guide for Care and Use of
Laboratory Animals.
Blood and tissue sampling
At the end of the experiment, the animals were weighed and killed by decapitation under
deep ether anaesthesia in the morning time. Blood samples were collected and allowed to clot
at room temperature. After that, they were centrifuged for 30 min at 4000 rpm. Serum
aliquots were extracted and stored in microcentrifuge tubes at -08oC until assayed.
After blood sampling, the thymus and spleen were immediately removed from each animal.
Samples of spleen were harvested into neutral formalin solution (10%) for histological and
immunohistochemical analyses. Moreover, samples of thymus and spleen were kept in -80oC
until used for RNA extraction and reverse-transcriptase polymerase chain reaction (RT-PCR)
analysis.
Measurement of cytokines
Serum TNFα, IL-1β, IL-6, IFNγ, and IL-4 concentrations were measured using enzymelinked immunosorbent assay (ELISA) kits (ALPCO Diagnostics, Salem, New Hampshire,
USA; Catalog # 75-TNFRT-E01, 61-I1BRT-E01, 61-IL6RT-E01, 61-IFGRT-E01, and 45IL4RT-E01, respectively) according to the manufacturer’s instructions. The results are
expressed as picograms per milliliter.
Measurement of IgA and IgE
Humoral immune response was determined by measuring serum IgA and IgE concentrations
using two-site enzyme-linked immunosorbent assay (ELISA) kits (ALPCO Diagnostics,
Salem, NH, USA; Catalog # 41-IGART-E01, 41-IGERT-E01, respectively) in accordance to
the manufacturer’s instructions. The results were expressed as nanograms per milliliter.
Histological study and Image Analysis
Formalin-fixed spleen tissues were dehydrated, embedded in Paraplast (Sigma, m.p. 56-58),
cut at 5 μm and stained with hematoxylin and eosin using standard procedures. Stained spleen
www.wjpps.com
Vol 4, Issue 05, 2015.
1965
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
sections were investigated using Leica DM 750 microscope equipped with computerized
image analysis system (Leica Application Suit; LAS version 3.8 Buil: 878). Images were
captured at a magnification of x 400, and were transferred by means of the RGB (red, green,
blue) system. The regions of the tissue sections that have debris or poor histological quality
were interactively excluded from analysis to increase the accuracy. A strategy designed by
Carol et al.[14] was applied with some modifications; briefly, three equidistant segments of
spleen were drawn starting at a central arteriole and ending in the red pulp. In each segment
three zones were determined: the white pulp, the marginal zone, and the red pulp. In this
study, image analysis was not applied to marginal zone or red pulp because a poor
demarcation was noticed between these two zones in some areas of spleen sections of treated
rats. Therefore, images were automatically segmented to select the white pulp; within the
white pulp images were automatically segmented to select the lymphocytes. In order to count
equal areas in every tissue section, fixed frames of 9237.607 μm2 comprising exclusively the
histological compartments of interest were applied, and lymphocyte population was counted
and expressed as a percentage of the total count. Percentages reported were average
measurements of different compartments of the white pulp. The image analysis was
performed by experienced technician in a blind manner.
Immunohistochemical study
Immunohistochemical staining of spleen sections (5 μm) was performed using the avidinbiotin-peroxidase technique. The sections were deparaffinized in xylene, passed through
graded alcohols, and rehydrated with water. They were incubated with 3% hydrogen
peroxidase for 15 min to quench endogenous peroxidase activity, and covered with normal
goat serum (10%) in PBS for 20 min to block nonspecific binding. The sections were then
incubated overnight at 4 oC with primary antibodies, CD8 (1:400 monoclonal mouse anti-rat,,
Thermo Fischer Scientific Inc., IL, USA ) and IgM (1: 200 Goat anti-Rat, Bethyl
Laboratories, Inc. Montgomery, TX, USA). Sections were then incubated with appropriate
secondary antibody (biotinylated anti-rabbit, 1: 100, Sigma-Aldrich Co. Germany) for 1h at
room temperature with followed by avidin-biotinylated –peroxidase complex (ABC; Vector
Laboratories Ltd, UK) for 1h at room temperature. Finally, sections were incubated in a
chromogen solution containing 0.02% 3,3ʹdiaminobenzidine (DAB) 0.03% hydrogen
peroxide until the brown color developed. The sections were then counterstained with
hematoxylin, dehydrated, cover-slipped, and investigated by using Leica DM 750
www.wjpps.com
Vol 4, Issue 05, 2015.
1966
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
microscope. Image analysis was not applied to immunohistochemistry because of the
presence of highly heterogeneous positive staining.
Determination of Gene expression of Cytokines by RT-PCR
In the present study, the genomic sequences of Meriones unguiculatus were used to assess the
gene expression of cytokines in Meriones shawi, because Meriones shawi–specific cytokines
cDNA sequences have not been cloned yet. cytokines sequence similarity between these two
species was expected to be very high. Semiquantitative reverse-transcriptase-polymerase
chain reaction (RT-PCR) analysis using co-determination of a constitutive gene (β-actin) was
performed to investigate the effects of melatonin on the gene expression of cytokines in the
thymus and spleen. The analyzed jird cytokines were TNFα, (GenBank accession no.
AB177841.1) and IL-4 (GenBank accession no.L37779.1). Briefly, total RNA was isolated
from spleen or thymus samples using QIAamp RNA Blood Mini Kits (QIAGEN, Valencia,
CA, USA) according to the manufacturer’s instructions. Total RNA was reverse-transcribed
using High-Capacity cDNA Reverse Transcription kits (Applied Biosystems®, CA, USA).
Samples was then incubated for 10 min at 25oC and then for 120 min at 37oC. The reaction
was terminated and the reverse transcriptase was inactivated by heating the samples at 85oC
for 5 minutes; these conditions were optimized for use with the High-Capacity cDNA
Reverse Transcription kits. Obtained cDNAs were used in the PCR as follows: The cDNA
(2μl) was amplified in a GoTaq® Green Master Mix (Promega, Madison, WI, USA)
containing specific primers. The sequence chosen for primes were shown in Table 1.
Amplification reactions were set up and run in an automated thermal cycler. One PCR cycle
consisted of initial denaturation at 95oC for 5 min, subsequent denaturation at 95oC for 30
sec, annealing at optimal temperature for 30 sec, extension at 72oC for 1 min, and a final
extension at 72oC for 10 min. The PCR products were electrophoresed in agarose gel and
visualized by ethidium bromide staining. DNA size markers (100 bp DNA Ladder H3 RTU,
Nippon Genetics, Europe GmbH, Dueren, Germany) providing bands ranging from 100-3000
bp were run in parallel. . All procedures were carried out at Molecular Biology Research
Unit, Assuit University, Egypt. The densitometric analyses of the PCR products were
conducted using UN-SCAN-IT gel software (version 6.1, Silk Scientific, Inc. Orem, UT,
USA), and the ratios of TNFα or IL-4 to β-actin as an internal control were obtained. Results
were expressed as the mean ± SEM.
www.wjpps.com
Vol 4, Issue 05, 2015.
1967
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Table 1. Primer sequences used in RT-PCR
Cytokine
Sequences
5′- GAGCTGGCGGAGGAGGCGCTCC -3′
TNFα
5′- AGCACGAGGTGGGGGCAG -3′
Forward primer
5′- GCTAGCTGCTGTCCTGCTCTG -3′
IL-4
Reverse primer
5′- CTTAGGCGTCCCAGGAAG -3′
Forward primer
5′- ATG GAT GAC GAT ATC GCT 3′
β-actin
Reverse primer
5′- TGG ACT GTC TGA TGG AGTA-3′
TNFα, tumor necrosis factor α; IL-4, interleukin 4.
Forward primer
Reverse primer
Product
length
428
bp
381 bp
314 bp
Statistical analysis
Data were presented as mean ± SEM (standard error of the mean). All data were analyzed
using student’s t-tests (SPSS software, version 13.0; SPSS Inc., Chicago, IL, USA.
Differences between group means were considered statistically significant if P > 0.05, and
highly significant if P > 0.01.
RESULTS
Although males tend to have lower immune parameters than females, no significant sexspecific differences were noticed in immune parameters in either control or treated groups
(P> 0.05); therefore, data from males and females were pooled together for statistical
analysis.
As shown in Fig. (1) jirds receiving melatonin demonstrated lower concentrations of
proinflammatory cytokines (TNFα, IL1β, and IL6) as compared to control (vehicle-receiving)
animals (P< 0.05). However, this inhibitory effect of melatonin was more pronounced with
TNFα- levels which showed highly significant (P<0.01) decrease after melatonin treatment.
Fig. (2) Illustrates the effect of melatonin administration on the concentrations of IFNγ and
the anti-inflammatory cytokine IL4. Similar to TNFα, it was obvious that the administration
of melatonin resulted in highly significant decrease in the serum levels of IFNγ and IL4 (P<
0.01).
The serum concentrations of immunoglobulin A (IgA) and immunoglobulin E (IgE) are
shown in Fig. (3). Melatonin treatment markedly reduced the concentrations of IgA and IgE
(P< 0.01); specifically, IgA and IgE levels in the control jirds were about 1.5- and 2-fold
higher than those in the melatonin treated animals, respectively.
www.wjpps.com
Vol 4, Issue 05, 2015.
1968
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Fig.1. Mean (± SEM) serum cytokine (TNFα, IL1β, IL6) concentrations (pg/ml) for
control and melatonin-treated jirds. TNFα, tumor necrosis factor α; IL-1β, interleukin
1β; IL-6, interleukin 6. *=P<0.05 versus control animals; **=P<0.01versus control
animals.
Fig. 2. Mean (± SEM) serum interferon γ ( IFNγ) and interleukin-4 (IL4) cytokine levels
(pg/ml) of control and melatonin-treated Shaw’s jirds. *=P<0.01 versus control
animals.
Fig, 3. Mean (± SEM) serum immunoglobulin A (IgA) and immunoglobulin E (IgE)
concentrations (ng/ml) of control and melatonin-treated jirds. *=P<0.01 versus control
animals.
www.wjpps.com
Vol 4, Issue 05, 2015.
1969
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Histological study
The spleen of control jirds showed normal histological architecture composed of two distinct
compartments, the red pulp and the white pulp. Melatonin treatment resulted in decreased
lymphocyte cellularity of both the white pulp and red pulp (Fig. 4). All compartments of the
white pulp including periarteriolar lymphoid sheath (PALS), lymphoid follicles, and marginal
zones were similarly affected (Fig.4). The follicles contained prominent germinal centers, but
they appeared with reduced cellularity both in the germinal center cell areas and in the mantle
cell areas; these germinal centers mostly contained tangible body macrophages with
cytoplasmic-engulfed apoptotic bodies (Fig. 4B). Quantitative image analysis of lymphocyte
population confirmed these histological findings and showed that the number of lymphocytes
(expressed as a percentage of the total white pulp cells) was significantly decreased (P<0.05)
in melatonin-treated jirds compared with control jirds (Fig. 5).
RP
A
MZ
GC
PALS
B
GC
www.wjpps.com
Vol 4, Issue 05, 2015.
1970
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Fig 4 (A & B). Spleen sections from melatonin-treated group showing variable decrease
in cellularity in the PALS, marginal zones (MZ), and red pulp (RP). Note the presence
of follicles containing prominent germinal centers (GC) with tangible body
macrophages (arrow) which appeared with cytoplasmic engulfed apoptotic debris. (H &
E x 400).
Fig. 5. Quantitative image analysis of hematoxylin and eosin-stained sections of spleen
from control and melatonin-treated jirds, with count of lymphocytes expressed as a
percentage of the total count of white pulp cells. Bars represent the Mean (± SEM).
*=P<0.05 vs. control animals.
Immunohistochemical study
Cytotoxic T-lymphocyte immunohistochemistry (CD8)
Immunohistochemical analysis of spleen revealed that, intense membranous and cytoplasmic
staining for CD8 were seen in clusters of lymphocytes in the white pulp of control jirds.
However, the greater proportion of positive cells for CD8 were found closer to the arterioles
in the periarteriolar lymphoid sheaths (PALS), and they were less frequent in the outer rim of
PALS (Fig. 6A). The follicles also showed cytoplasmic and membranous expression of CD8
cells in the follicular germinal center cells and mantle cells (Fig. 6B).Within the marginal
zone and red pulp CD8+ cells were identified in fewer numbers (Fig. 6 B). In melatonintreated jirds the frequency of lymphocytes positive for CD8 was much diminished.
Specifically, occasional CD8+ cells were seen in the PALS and in the follicles of the white
pulp. Also, there was a scattering of CD8+ lymphocytes throughout the red pulp (Fig. 6C).
Immunoglobulin M (IgM) immunohistochemistry
In control jirds, most IgM positive B cells were detected in distinct concentric areas
surrounding the PALS; they exhibited intense cytoplasmic staining.
In addition, small
numbers of IgM+ B cells and IgM+ plasma cells were seen in the marginal zone and germinal
centers, and were also scattered throughout the red pulp (Fig. 7A). In melatonin-treated jirds
occasional IgM+ B cells and IgM+ plasma cell were observed in the germinal center. The
concentric areas around the PALS showed very little or no IgM expression (Fig.7B).
www.wjpps.com
Vol 4, Issue 05, 2015.
1971
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
A
PALS
B
MZ
GC
C
www.wjpps.com
Vol 4, Issue 05, 2015.
1972
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Fig. 6. Immunohistochemical staining with anti CD8 antibodies. (A) & (B) spleen from
a control jird, showing the presence of clusters of CD8+ lymphocytes (arrows)
expressing membranous and cytoplasmic staining within the white pulp; note the
presence of fewer numbers in the marginal zone (MZ). (C) from melatonin-treated jird
showing reduced CD8 staining (thick arrows) within the PALS and the follicles; the red
pulp also show very little CD8 expression. For abbreviations see Fig. 4. (x 400).
A
B
Fig. 7. Immunohistochemistry with anti IgM antibody in spleen, (A) from the control
group showing cytoplasmic staining of numerous B cells in concentric areas around
PALS (thin arrow) .IgM+ cells were also identified within the germinal centers,
marginal zone and red pulp (thick arrows). (B) From melatonin-treated group showing
a very little expression of IgM (arrows). (x 400).
www.wjpps.com
Vol 4, Issue 05, 2015.
1973
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Gene expression of cytokines
Expressions of the pro-inflammatory cytokine TNFα and the anti-inflammatory cytokine IL-4
mRNAs in thymus and spleen from control and melatonin-treated jirds were measured by
semiquantitative RT-PCR, in which the expression of the mRNA of the constitutive gene (βactin) served as an internal control in order to normalize the levels of cytokine gene
expressions. As shown in Fig. 8, expression of TNF α and IL-4 mRNAs were significantly
decreased (P <0.05) in the thymus of melatonin-treated jirds compared to that of control
group, i.e. the gene expression of TNFα and IL-4 in the thymus were remarkably downregulated by melatonin treatment. On the other hand, TNFα mRNA expression was
significantly elevated (P <0.05) in the spleen of melatonin-treated jirds compared with
control animals (Fig. 8), that is to say there was up-regulation of the gene expression of this
proinflamatory cytokine in spleen after melatonin treatment. However, expression of IL-4
mRNA in the spleen did not show any significant differences between control and melatonintreated group (Fig. 8; P > 0.05). In this regard, it is important to mention that the levels of
mRNA expression of TNFα and IL-4 in the spleen of control and melatonin-treated animals
were unrelated to serum levels of these cytokines as measured by ELISA.
A
www.wjpps.com
B
Vol 4, Issue 05, 2015.
1974
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Fig. 8. Cytokine mRNA expression in thymus and spleen of control and melatonintreated jirds. (A) RT-PCR amplification of β-actin, Tumor necrosis factor α (TNFα) and
interleukin 4 (IL-4) mRNAs. Total RNA was extracted and subjected to RT-PCR. The
cDNAs were normalized against β-actin mRNA levels in corresponding samples and
amplified. PCR products were electrophoresed in agarose gel containing ethidium
bromide. DNA size markers (M; 100 bp DNA Ladder H3 RTU) were run in the Left
most lanes. Lane 1: thymus from control jird; Lane 2: thymus from melatonin-treated
jird; Lane 3: spleen from control jird; Lane 4: spleen from melatonin-treated jird. (B)
semiquantitative analysis of TNFα and IL-4 mRNAs expression in thymus and spleen,
as determined by the densitometric analysis of the PCR products. Data represent the
mean ± SEM. *P < 0.05 vs. control group.
DISCUSSION
The results of the current study indicate that melatonin administration in drinking water
decreased both humoral and cell-mediated immunity in Meriones shawi. Although, the data
presented herein are inconsistent with most of the previous reports which demonstrated that
melatonin enhances both cellular and humoral immune responses under basal or
immunodepressed conditions
[15]
, they support the suggestion that melatonin does not have
universal immunoenhacing properties. [16] To the best of available knowledge, this is the first
report of the effect of exogenous melatonin on the immune function of shaw’s jirds, and the
first study that employs RT-PCR for the detection of cytokine gene expression in this species.
In this study, melatonin treatment in vivo significantly decreased the levels of cytokine tumor
necrosis factor (TNF) α, interleukin 1 (IL-1) β, interleukin 6 (IL-6), interleukin 4 (IL-4), and
interferon (INF) γ. It also induced a significant decrease in the serum levels of both
immunoglobulin A (IgA) and immunoglobulin E (IgE). Additionally, the cellularity of
splenic white pulp and red pulp, and the frequency of CD8+ (cytotoxic T-lymphocytes) and
IgM+ (immunoglobulin M) cells were markedly decreased after melatonin treatment.
Moreover, the expression of TNFα and IL-4 mRNAs was noticeably suppressed in thymus by
melatonin treatment.
The present observations are in contrast to several previous reports in which melatonin has
been shown to exert immunoenhancing effects in a variety of species.
[7]
Melatonin
immunostimulating action has been suggested to be mediated by regulating the production of
cytokines from immunocompetent cells, particularly by enhancing the production of various
www.wjpps.com
Vol 4, Issue 05, 2015.
1975
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
T helper 1 (Th1) cytokines. [7] The differentiation of thymic CD+4 cells into T helper 1 (Th1)
and T helper 2 (Th2) cells is essential for proper immune responses. Th1 cells secret
cytokines e.g. IFNγ, TNFα, and are responsible for inflammatory immune responses and cellmediated immunity; Th2 cells produce cytokines e.g. IL-4, IL10 and are responsible for
inducing anti-inflammatory and humoral immune responses. [17] It has been shown previously
that melatonin augments IL2 and IFNγ production in mice.
[18, 19]
It also enhances antigen
presentation by mouse splenic macrophages to T cells, and concurrently augments the
expression of MCH class II molecules as well as the production of the proinflammatory
cytokines IL-1 and TNFα.
[8]
Additionally, in cultured human mononuclear cells, melatonin
enhances IL2 and IFNγ production in Th1 lymphocytes, and IL6 production in monocytes.[10]
Such enhancing effects of melatonin on Th1 cytokines have been proposed to be attributed to
its role in regulating the gene expression of cytokines in the lymphoid organs. This
suggestion has been strengthened by the findings of Liu et al. [20] who reported that melatonin
up-regulate the levels of gene expression of IL1β, TNFα, IFNγ, Stem cell factor (SCF), and
macrophage-colony stimulating factor (M-CSF) in spleen cells.
Other studies have showed opposite pattern of results. Specifically, melatonin treatment was
ineffective in modulating immune functions in rats,[21] mice[22] or humans.[23] Melatonin also
has been reported to act as an anti-inflammatory agent and inhibit immune responses.[11] For
instance, abolishment of melatonin secretion by pinealectomy has been demonstrated to skew
Th1/Th2 thymic cells towards Th1 response by augmenting the production of IFNγ and
diminishing the production of IL-10; this indicates that melatonin drives the immune
response towards Th2 dominance.
[24]
Melatonin has been shown to enhance the production
of IL4, which is a hallmark of Th2 cells, in bone marrow lymphocytes. [25] Such observations
were also reported by Shaji et al.
[26]
who revealed that melatonin treatment enhanced the
proliferation of antigen specific T helper (Th) cells and increased their ability to secrete IL-4,
and down-regulated the levels of IL-2 and IFNγ in BALB/c mice. So it has been assumed that
the anti-inflammatory action of melatonin is at least partially owing to the induction of Th2
lymphocytes that produce cytokines such as IL4, thus inhibiting the function of Th1. In
analogy with those reports, Lin et al.[27] reported that administration of melatonin suppressed
the mRNA expression of TNFα, IL-1β and IL-6 in rats.
Accordingly, it is evident from previous reports that there is a debate whether melatonin has a
pro Th1 influences, thus augmenting the production of Th1 cytokines such as TNFα and
IFNγ, or it has an anti Th1 response and promotes the production of Th2 cytokines such as
www.wjpps.com
Vol 4, Issue 05, 2015.
1976
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
IL4. It seems that melatonin has positive modulatory effects on natural and acquired
immunity, but it shows alternative behavior in conditions with aggravated immune responses.
Specifically, melatonin has been demonstrated to neutralize the provoked production of proinflammatory cytokines in many in vivo models of inflammation and autoimmunity.[15] For
example, in sleep deprived mice with colitis, melatonin treatment decreased the serum levels
of pro-inflammatory cytokines such as Il-β, Il-6, IL- 17, IFNγ and TNFα.[28] Also, in mice
with Atopic dermatitis (AD)-like skin lesions, melatonin treatment reduced total IgE in
serum, and IL-4 and IFN-γ production by activated CD+4 T cells.[29] Interestingly, this was
not the case in the present study wherein melatonin, under basal conditions, significantly
decreased the production of Th1 cytokines such as IFNγ and TNFα and the synthesis of IL4
which is a hallmark of Th2 cells. It also decreased the serum levels of IgA and IgE, and the
frequency of CD8+ as well as IgM+ cells. The decreased levels of Th1- and Th2-type
cytokines reported herein, as well as the suppressed expression of TNFα and IL-4 genes in
the thymus indicate that melatonin could down-regulate the production of both Th1 and Th2
type cytokine. The underlying mechanism is not exactly known. However, it is noteworthy to
mention that melatonin inhibited TNFα and IL-4 mRNAs expression in the thymus, but not in
the spleen, which may suggest that thymus-dependent mechanism are involved in the
regulation of immune response by melatonin in Meriones shawi.
In addition to the T cell pathways, earlier studies have shown that melatonin treatment
augments the antibody response to various antigens and restores the antibody production in
mice immunodepressed by acute stress or by corticosterone.[30] Direct influence of melatonin
on B cells as well as its effect on humoral immune responses in non immunodepressed
animals is obscure. Raghavendra et al.[31] demonstrated that melatonin failed to influence the
activity of B cells in a T-cell independent (TI) manner, and had no effect either on the
proliferation of LPS-stimulated B cell or the secretion of immunoglobulins (IgA, IgM, IgG1
and IgG2a). Alternatively, Černyštov et al.[32] showed that melatonin could modify T-cellindependent (TI) and T-cell-depenent (TD) antibody secretion by B cells in mice. Again,
those observations are in contrast to the present data. The mechanism by which melatonin
diminished the production of antibodies in the present study is not known. This decrease
could be due to a direct effect of melatonin on B-Lymphocytes, or through the downregulation of IL-4 by melatonin. There is some line of evidence that IL-4 promotes the
humoral response by enhancing the differentiation of B lymphocytes into antibody secreting
B cells and B cell immunoglobulin switching to IgE.[2]
www.wjpps.com
Vol 4, Issue 05, 2015.
1977
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
In this work, melatonin effect on immune function did not depend on the gender of the
animals, in that there were no significant differences in immune parameters between males
and females, even though males tend to display lower immune responses than females.
Generally, it is well established that males display noticeable lower immune responses than
female conspecifics [33], and these sex differences in immune functions are correlated, in part,
to the suppressive effect of testosterone on the immune system.[34] Still, it can be assumed
from the present results that that gonadal hormones are not involved in driving the effects of
melatonin on the immune system. This finding is supported by Černyšiov et al.[32] who
noticed no major sex differences in immune responses among mice with suppressed
melatonin production (due to constant light exposure) or among mice exposed to constant
light and administrated melatonin as well. Contrary to these observations, sex differences in
immune functions after melatonin treatment were detected among MRL-1pr mice which are
susceptible to spontaneous development of systemic lupus erythematosus (an autoimmune
disease). In females, melatonin decreased the pro-inflammatory cytokines (IL-2, IL-6, IFNγ,
TNFα, and IL-1β), enhanced anti-inflammatory cytokine IL-10, and reduced the titers of
autoantibody. The influence of melatonin on males was just the opposite. Therefore, it has
been suggested that different cytokine patterns and antibody isotopes depend on sex
hormones.[35] The reasons for this inconsistency are not fully understood, but it could be due
to differences in species or genotype of the animals. As a matter of fact, the discrepancies
observed among different reports concerning the immunomodulatory role of melatonin are
difficult to explain, they may reflect differences in factors such as dosing, species age of the
organism, and the physiological status of the immune system.
The mechanism underlying the obtained immunodepressive effect of melatonin in Meriones
shawi is not exactly known. Generally, the effects of melatonin on the immune system appear
to be attributed to the presence of melatonin receptors on immunnocompetent cells.
Membrane and nuclear melatonin receptors have been detected primarily on CD+4 T
lymphocytes, as well as on CD8 T lymphocytes and B lymphocytes. It has been suggested
that melatonin modulates the proliferative immune response of stimulated lymphocytes
through these receptors.[11] In addition to this direct effect of melatonin on immune functions,
melatonin can indirectly affect immune function through modifying steroid levels,[5] or
releasing of opoide peptides.[30]
www.wjpps.com
Vol 4, Issue 05, 2015.
1978
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Conclusively, the immunodepressive effect of melatonin reported for Meriones shawi in the
present study is interesting yet unexpected in terms of three issues, 1) in a closely related
species (Meriones ungulates), daily afternoon treatment with melatonin induced an increase
in thymus weight, indicating immunoenhancement actions.[36] 2) Meriones shawi has been
previously demonstrated to be reproductively unresponsive to the photoperiod, in that short
day (SD) exposure did not affect the reproductive status of male or female jirds.[37] In other
mammalian species that are reproductively unresponsive to photoperiod (e.g., laboratory rats,
house mice and humans), exogenous melatonin treatment has been shown to enhance both
cell mediated and humoral immune responses[38,30]; so, it would be predicted that immune
functions would be enhanced in individuals of
Meriones shawi after melatonin
administration. 3). Suppression of melatonin synthesis and secretion by constant light
exposure has been reported to decrease the immune responses of Meriones shawi.
[12]
This
again might indicate that melatonin administration would enhance Meriones shawi’s immune
functions; in other words, if constant light is immunosuppressive in these animals, then it
would be expected that melatonin might be immunoenhancer. The reasons for the observed
immunodepressive effects of melatonin in the current study are not fully understood. Here
melatonin was continuously available through drinking water, and this may cause apparent
increase in the duration of the peak of endogenous nocturnal melatonin. Since prolonged
secretion of melatonin is known to cause winter, or short-day, adaptations
[4]
, and since field
studies have shown decreases in lymphoid tissue size and immune activity during winter
[39]
,
the current results presumably represent comprised immune functions in response to winterlike exposure. Nevertheless, it should be realized that most of the previous studies on
immunoenhancing actions of melatonin have used a regimen of melatonin administration
similar to that used in this study. In addition, virtually all previous investigators who studied
changes in immune parameters under different laboratory conditions showed enhanced
immune function in short (i.e. winter) day lengths (For example,
[40, 41]
). One possible
explanation for this discrepancy is that, these previous data are based on studies of laboratory
species that have undergone strong artificial selection for optimal physiological performance
in well-controlled laboratory environments, compared to the currently used animals which are
representative of wild populations. Also it remains possible that the existing results reflect
species-specific differences in immunomodulation by melatonin even among closely related
species.
www.wjpps.com
Vol 4, Issue 05, 2015.
1979
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
Taken together, these data suggest an important role of the pineal gland in mediating immune
responses in desert rodents. Explicitly the present finding that melatonin suppresses the
immune system in Shaw’s jirds provides preliminary evidence that the activity of the pineal
gland is a possible factor that mediates potential winter reduction in immune functions in
desert rodents. Likewise, Meriones shawi has been confirmed to be a valuable subject in
pineal-immune interaction research and it can offer new insights of investigations on the sites
and mechanisms of melatonin action in future.
REFERENCES
1. Blalock JE. The syntax of immune-neuroendocrine communication. Immunol Today
1994; 15: 504- 511.
2. Elenkov IJ. Neurohormonal-cytokine interactions: implications for inflammation,
common human diseases and well-being. Neurochem. Int. 2008; 52: 40–51.
3. Skwarło-Sońta, K. Functional connections between the pineal gland and immune system.
Acta Neurobiol. Exp. 1996; 56: 341-357.
4. Bartness TJ, Powers JB, Hastings MH, Bittman EL, Goldman BD. The timed infusion
paradigm for melatonin delivery: what has it taught us about the melatonin signal, its
reception, and the photoperiodic control of seasonal responses?. J Pineal Res. 1993; 15:
161-90.
5. Reiter, RJ. Pineal melatonin: cell biology of its synthesis and of its physiological
interactions. Endocr. Rev. 1991; 12: 151-180.
6. Maestroni, GJM. The photoperiod transducer melatonin and the immune-hematopoietic
system. J. Photochem Photobiol B: Biol 1998; 43: 186-192.
7. Carrillo-Vico A, Guerrero JM, Lardone PJ, Reiter RJ. A review of the multiple actions of
melatonin on the immune system. Endocrine 2005; 27: 189-200.
8. Pioli C, Caroleo MC, Nistico G, Doria G. Melatonin increases antigen presentation and
amplifies specific and non specific signals for T-cell proliferation. Int. J.
Immunopharmacol. 1993; 15: 463-468
9. Giordano M, Palermo MS. Melatonin induced enhancement of antibody-dependent
cellular cytotoxicity. J. Pineal Res. 1991; 10: 117–121.
10. Garcia-Mauriño S, Gonzalez-Haba MG, Calvo JR, Rafii-El-Idrissi M, Sanchez-Margalet
V, Goberna R, Guerrero JM. Melatonin enhances IL-2, IL-6, and IFN-gamma production
by human circulating CD4+ cells: a possible nuclear receptor-mediated mechanism
involving T helper type 1 lymphocytes and monocytes. J. Immunol.1997; 159: 574–581.
www.wjpps.com
Vol 4, Issue 05, 2015.
1980
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
11. Szczepanik M. Melatonin and its influence on immune system. J. Physiol Pharmacol.
2007; 58: 115-124.
12. El-Bakry, HA. Pineal-immune axis in a desert rodent: effect of constant light
exposure. Journal of the Egyptian German Society of Zoology ch 2005; 47(C): 89-115
13. Mbarek S, Saidi T, González-Costas JM, González-Romero E, Chekir BC. Effects of
dietary cadmium exposure on osmoregulation and urine concentration mechanisms of the
semi-desert rodent Meriones shawi J. Environ. Monit., 2012; 14: 2212-2218.
14. Carol M, Pelegri C, Franch A, Garcia-Valero J, Castellote C, Castell M. An image
analysis strategy to determine the distribution of cell types in spleen sections. Acta
Histochemica 1999; 101: 281–291.
15. Carrillo-Vico A, Lardone PJ, Álvarez-Sánchez N , Rodríguez-Rodríguez A, Guerrero JM.
Melatonin: Buffering the Immune System. Int. J. Mol. Sci. 2013; 14: 8638-8683
16. Demas GE, Klein SL, Nelson RJ. Reproductive and immune responses to photoperiod
and melatonin are linked in Peromyscus subspecies. J Comp Physiol A. 1996; 179: 81925.
17. Abbas AK, Murphy KM, Sher A. Functional diversity of helper T lymphocytes. Nature.
1996 31; 383(6603): 787-93.
18. Caroleo MC, Frasca D, Nisticó G, Doria G. Melatonin as immunomodulator in
immunodeficient mice. Immunopharmacology. 1992; 23: 81-89.
19. Colombo LL, Chen GJ, Lopez MC, Watson RR. Melatonin induced increase in gammainterferon production by murine splenocytes. Immunol Lett. 1992; 33: 123-126.
20. Liu F, Ng TB, and Fung MC. Pineal indoles stimulate the gene expression of
immunomodulating cytokines. J Neural Transm. 2001; 108: 397-405.
21. Pahlavani MA, Vargas DA, Evans TR, Shu J, Nelson, JF. Melatonin Fails to Modulate
Immune Parameters Influenced by Calorie Restriction in Aging Fischer 344 Rats. Exp
Biol Med. 2002; 227: 201-207.
22. Provinciali M, Di Stefano G, Bulian D, Stronati S, Fabris N. Long-term melatonin
supplementation does not recover the impairment of natural killer cell activity and
lymphocyte proliferation in aging mice. Life Sci. 1997; 61: 857-864.
23. Arzt ES, Fernández-Castelo S, Finocchiaro LM, Criscuolo ME, Díaz A, Finkielman S,
Nahmod VE. Immunomodulation by indoleamines: serotonin and melatonin action on
DNA and interferon-gamma synthesis by human peripheral blood mononuclear cells. J
Clin Immunol. 1988; 8: 513-520.
www.wjpps.com
Vol 4, Issue 05, 2015.
1981
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
24. Kelestimur, H.; Sahin, Z.; Sandal, S.; Bulmus, O.; Ozdemir, G.; Yilmaz, B. Melatoninrelated alterations in th1/th2 polarisation in primary thymocyte cultures of
pinealectomized rats. Front. Neuroendocrinol. 2006; 27: 103–110.
25. Maestroni, G.J. T-helper-2 lymphocytes as a peripheral target of melatonin. J. Pineal Res.
1995; 18: 84–89.
26. Shaji AV, Kulkarni SK, and Agrewala JN. Regulation of secretion of IL-4 and IgG1
isotype by melatonin-stimulated ovalbumin-specific T cells. Clin Exp Immunol. 1998;
111: 181-185.
27. Lin G-J, Huang S-H, Chen S-J, Wang C-H, Chang D-M, Sytwu H-K. Modulation by
melatonin of the pathogenesis of inflammatory autoimmune diseases. Int J Mol Sci. 2013;
14: 11742-11766.
28. Park YS, Chung SH, Lee SK, Kim JH, Kim JB, Kim TK, Kim DS, Baik HW. Melatonin
improves experimental colitis with sleep deprivation. Int J Mol Med. 2015; 35: 979-986.
29. Kim TH, Jung JA, Kim GD, Jang AH, Ahn HJ, Park YS, Park CS. Melatonin inhibits the
development of 2,4-dinitrofluorobenzene-induced atopic dermatitis-like skin lesions in
NC/Nga mice. J Pineal Res. 2009; 47: 324-329.
30. Maestroni, G J M. The immunoendocrine role of melatonin. J Pin Res. 1993, 14: 1-10.
31. Raghavendra, V., Singh, V., Shaji, A. V., Vohra, H., Kulkarni, S. K. and Agrewala, J. N..
Melatonin provides signal 3 to unprimed CD4(+) T cells but failed to stimulate LPS
primed B cells. Clin. Exp. Immunol. 2001; 124: 414.
32. Černyšiov V, Gerasimčik N, Mauricas M, Girkontaitė I.
Regulation of T-cell-
independent and T-cell-dependent antibody production by circadian rhythm and
melatonin. Int. Immunol. 2009; 22: 25–34.
33. Schuurs, A H W M., Verheul H A M. Effects of gender and sex steroids on the immune
response. J Steroid Biochem.1990; 35: 157–172.
34. Olsen, NJ, Kovacs W J. Gonadal steroids and immunity. Endocrine Reviews 1996; 17:
369–384.
35. Jimenez-Caliani AJ, Jimenez-Jorge S, Molinero P, Fernandez-Santos JM, Martin-Lacave
I, Rubio A, Guerrero JM, Osuna C. Sex-dependent effect of melatonin on systemic
erythematosus lupus developed in Mrl/Mpj-Faslpr mice: it ameliorates the disease course
in females, whereas it exacerbates it in males. Endocrinology 2006; 147: 1717-1724.
36. Vaughan MK, Vaughan GM, Blask DE, Reiter RJ. Influence of melatonin, constant light,
or blinding on reproductive system of gerbils (Meriones unguiculatus). Experientia. 1976;
32: 1341-1342.
www.wjpps.com
Vol 4, Issue 05, 2015.
1982
El-Bakry
World Journal of Pharmacy and Pharmaceutical Sciences
37. El-Bakry HA, Zahran WM, Bartness TJ. Control of reproductive and energetic status by
environmental cues in a desert rodent, Shaw's jird. Physiol Behav. 1999; 66(4): 657-666.
38. Guerrero JM and Reiter RJ. A brief survey of pineal gland-immune system
interrelationships. Endocrinol Res 1992; 18: 91-113.
39. Nelson R, Demas GE Seasonal changes in immune function. Q Rev Biol. 1996; 71: 511548.
40. Champney TH, McMurray DN. Spleen morphology and lymphoproliferative activity in
short photoperiod exposed hamsters. Role of Melatonin and Pineal Peptides in
Neuroimmunomodulation NATO ASI Series, F. Franchini and R. J. Rieter, eds, 1991;
204: 219-223, Plenum Press, New York. USA.
41. Blom JM, Gerber JM, Nelson RJ. Day length affects immune cell numbers in deer mice:
interactions with age, sex, and prenatal photoperiod. Am J Physiol. 1994; 267: R596-601.
www.wjpps.com
Vol 4, Issue 05, 2015.
1983