Environomics: Taking the pulse on the marine environment
Environomics: Taking the pulse on the marine environment [email protected] Key Challenges for Environmental Monitoring Programs Samples: -High frequency -High spatial resolution Analysis by highly trained taxonomists Bottleneck!! Classical environmental monitoring Schander and Willassen 2005 Key Challenges for Environmental Monitoring Programs Samples: -High frequency -High spatial resolution Analysis by highly trained taxonomists Bottleneck!! Ideally; - All species. - At all times. - Everywhere. How do we attain an accurate ”enough” characterization of the marine environment? ”omics”-Technologies - Genomics - Epigenomics - Transcriptomics - Proteomics - Metabolomics Environomics (Meta-”omics”) -Who is there? (Meta-genomics) -What is their potential? (Meta-genomics) -What are their state? (Meta-transcriptomics and Meta-proteomics) -How do they influence each other? (Meta-metabolomics) How an anthropogenic stressor influence the living marine resourses? Phylogenetic microarrays and high-throughput sequencing: A new tool for biodiversity assessment in Northern Norway Havet og Kysten Objectives Our primary objective is to improve the resolution of current environmental monitoring programs (EMP). Towards this objective we aim to develop and evaluate the potential of using genomic-era technology (Environomics). Specifically, we aim to conduct: 1. Metagenome sequencing for biodiversity of current monitoring stations to evaluate the environomic approach. 2. Development and evaluation of microarray technology for species detection for high throughput biodiversity monitoring (phylochip). 3. Set standards for the coupling between traditional morphology based taxonomy and modern genomic-era technology. Biodiversity (”meta”-genomics) Sampling sites Universal primers w. site specific tag 5´ Divergent sequence site 1 site 2 site 3 All sites are sequenced simultaneously by 454 pyrosequencing GATCGAAGATCGAGGTAGTGACGAAAAATAACAATACAAGACTCTTCCGAGGCCTTGTAATTGGAATGAGTA CGTTCCCGAGGATCTATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTAGC GTTGTGGTTAAAAAGCTCGTAGTTGGATTTCGGCGGGTATTGGTCGGTTTGAATAGCTTCAACACTGACTTT species sequence site tag Why eukaryotic microorganisms? Meiofaunal versus micro-organism approach Meiofaunal approach (12% microorganisms) Microorganism approach (79% microorganisms) Fungi Porifera Rhizaria Dinoflagellates Ciliates Apicomplexa Diatoms Chlorophyta Plathyhelminthes Annelida Nematoda Arthropoda Creer et al., 2010 Separation of different marine sediments Clay Oligohymenophorea Litostomatea Dinophyceae ascomycota Coscinodiscophyceae Polychaeta Fine sand Demospongiae Karyorelictea Turbellaria Conoidasina Ichthyosporea Chromadorea Medium sand Laberinthulomycetes Coscinodiscophyceae Ostracoda Phyllopharyngea Vannellidae Maxillopoda Coarse sand Oligohymenophorea Chlorarachniophyceae Euamoebida Anthozoa Haptophyceae Chrysophyceae Trebouxiophyceae Mediophyceae Bacillariophyceae Imbricatea udef Principal Component analysis of 4 sediments Medium and Medium coarse sand sand 0,5 Coarse sand B2 B1 B3 C1 Factor 2 : 12,11% C3 Fine sand C2 0,0 A3 A1 A2 Clay -0,5 D2 D3 D1 clay and fine sand -1,0 -0,5 Factor 1 : 50,94% Phylogenetic microarrays http://www.mbari.org/ESP/espworks.htm Capitella capitata Capitella Capitella Capitellidae Capitellida Scolecida Polycheata Annelida 5` Protostomia Coelamata Metazoa 18S rDNA gene 3` Key Challenges for Environmental Monitoring Programs Samples: Samples: -High frequency -High frequency -High spatial resolution -High spatial resolution Analysis by highly trained taxonomists Bottleneck!! High throughput analysis by Environomics No Bottleneck!! Thank you! - Katrine Lekang - Kenan Hadziavdic - Katrine Sandnes Skaar - Eric Thompson - Anders Lantzen - Inge Jonassen - Marc Frischer - Christoffer Schander - Christian Collin-Hanssen -Seksjon for anvendt miljøforskning -Den Norske Veritas
© Copyright 2024