1. No category

From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
1991 78: 132-140
Purification and characterization of factor VII 304-Gln: a variant
molecule with reduced activity isolated from a clinically unaffected
male
DP O'Brien, KM Gale, JS Anderson, JH McVey, GJ Miller, TW Meade and EG Tuddenham
Updated information and services can be found at:
http://www.bloodjournal.org/content/78/1/132.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
Purification and Characterization of Factor VI1 304-Gln: A Variant Molecule
With Reduced Activity Isolated From a Clinically Unaffected Male
By Donogh P. O’Brien, Karen M. Gale, J. Simon Anderson, John H. McVey, George J. Miller,
Tom W. Meade, and Edward G.D. Tuddenham
Factor VI1 (WII) is the plasma serine protease zymogen
which, on binding to its cellular receptor tissue factor (TF),
initiates blood coagulation.A 47-year-old man with no clinical bleeding tendency was found to have undetectable
plasma FVll activity when tested in a one-stage assay using
rabbit brain TF, but 0.3 U/mL using recombinant human TF
and 1.04 U/mL FVll antigen. Variant FVll purified from his
plasma showed an identical migration on sodium dodecyl
sulfate-polyacrylamidegel electrophoresis to wild-type zymogen. By enzyme kinetic analysis the Km of the variant
using FX as a substrate was 12-fold higher than that of
F
ACTOR VI1 (FVII) is a serine protease of the extrinsic
blood coagulation cascade. It belongs to the vitamin
K-dependent group of serine proteases, with homology to
FIX, FX, prothrombin, and protein C. The single-chain
zymogen has a relative molecular mass of 53 Kd that is
converted to a disulphide-linked two-chain enzyme (FVIIa)
after proteolysis of an internal arginine-isoleucine bond.’
This activation is effected by FXa, FIXa, and thrombin in
vitro. FVIIa has little catalytic activity in the absence of an
essential cofactor, tissue factor (TF), a cellular receptor
constitutively expressed by many cells of the subendothelium. FVII and FVIIa form a 1:l stoichiometric complex
with TF2 and this complex rapidly converts zymogen FX
and FIX to the active enzymes. The formation of a complex
between TF and FVII is widely thought to represent the
primary stimulus for blood coagulation.’ In this study we
describe the biochemical analysis of a dysfunctional FVII
molecule isolated from the plasma of a clinically unaffected
male with normal FV1I:Ag (1.04 U FVII:Ag/mL) but with
reduced function (FVI1:C 0.3 U/mL). Thus, this molecule
can be described as cross-reacting material positive
(CRM+). We have developed a micropurification scheme
for the isolation of highly purified FVII from small donations of plasma to facilitate the analysis of the specific
defect in this protein. Our results suggest that the defect is
the consequence of a point mutation in the FVII gene
resulting in a radical substitution in the catalytic domain of
the molecule, which most probably affects its interaction
with TF.
From the Haemostasis Research Group, MRC Clinical Research
Centre; and MRC Epidemiology and Medical Care Unit, Northwick
Park Hospital, Harrow, Middlesex, UK.
Submitted October 18,1990; accepted Februaly 19, 1991.
Address reprint requests to Donogh P. O’Brien, PhD, Haemostasis
Research Group, MRC Clinical Research Centre, Watford Rd, Harrow, Middlesex HA1 3UJ, UK.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1991 by The American Sociery of Hematology.
0006-497119117801-0014$3.0010
132
normal FVII. Also, the variant Wll was unable to compete
with wild-type Wll for limited rabbit TF binding sites. A
ligand blot procedure was used to directly demonstrate
reduced binding of recombinanthuman TF to the variant FVll
compared with normal FVII. Genetic analysis of leukocyte
DNA showed a G to A mutation in the propositus’ gene at
codon 304 that results in the substitution of a glutamine for
an arginine residue in the catalytic domain of the protease.
We conclude that this region of the Wll molecule is important for its function.
o 1991 by The American Society of Hematology.
MATERIALS AND METHODS
Approval was obtained from the Ethics Committee of the
Harrow Health District for these studies. The subject was informed
that blood samples were obtained for research purposes only.
Consent was given for the withdrawal of 500 mL of blood. His
variant FVII was detected during the screening stage for the
Thrombosis Prevention Trial: which includes FVII measurements.
Monoclonal antibody (MoAb) to human FVII, RFF VII-2, was
the gift of Dr A. Goodall (Royal Free Hospital, London, UK).
MoAb to FVII 23117 was the gift of Dr F. Ofosu (McMaster
University, Hamilton, Ontario, Canada). A7 MoAb to human FIX
was the gift of Dr K. Smith (University of New Mexico School of
Medicine, Albuquerque). Recombinant human TF apoprotein was
the gift of Dr D. Higgins (Genentech Inc, South San Francisco,
CA). For clotting assays this material was relipidated as described
previously.’ Rabbit TF (thromboplastin) was from Sigma (Poole,
Dorset, UK). Purified human FX was from Enzyme Research
Laboratories (South Bend, IN). Sulpho-NHS biotin and streptavidin-horseradish peroxidase (HRP) were from Pierce Europe (Luton, UK). Prestained molecular weight standards for sodium
dodecyl sulfate-polyacrylamide electrophoresis (SDS-PAGE) were
from BRL Uxbridge (Middlesex, UK). Superose 12 and TSK
DEAE 5PW HPLC columns were from Pharmacia LKB (Milton
Keynes, UK). The enhanced chemiluminescent detection reagent
(ECL) was from Amersham International (Amersham, UK).
Triton X-100 was from Calbiochem (San Diego, CA). All other
reagents were from Sigma and were reagent grade or better.
Protein estimations were performed by the method of Bradford“
using bovine serum albumin as standard. One-stage FVII coagulation assays were performed with immunodepleted FVII-deficient
plasma as described previously.’ The coupled amidolytic assay for
FVII was performed by the method of Seligsohn et a18: FVII
antigen (FV1I:Ag) was measured using an enzyme-linked immunosorbent assay (ELISA) (Asserchrom FVI1:Ag; Diagnostica Stago,
Asnieressur-Seine, France) according to the manufacturer’s instructions.
FIX was purified according to the method of Smith’ from pooled
normal human plasma donations. After elution from the antibody
column, the peak FIX-containing fractions were concentrated and
applied to a TSK DEAE 5PW column in 0.02 molL Tris HC1 pH
7.4 at a flow rate of 1mL/min. The column was then developed with
a linear gradient from 0% to 75% buffer B (A + 1 molL NaCI).
The purified protein was homogenous by SDS-PAGE and was
stored at -70°C in 50% glycerol.
For the biotinylation of coagulation factors, purified proteins
were dialyzed into 100 mmol/L Na,HCO, pH 7.8. Ten micrograms
of protein in a volume of 250 pL was biotinylated by the addition of
Blood, Vol78, No 1 (July l), 1991:pp 132-140
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
133
CHARACTERIZATIONOF FVll 304-GLN
10 mmol/L sulpho-NHS biotin. The mixture was incubated for 2
hours at room temperature, dialyzed against 0.15 mol/L NaCI, 0.05
mol/L Tris Hcl pH 7.4 (TBS), and stored at -20°C.
Purification of FWZ. Five hundred milliliters of normal or
patient blood was collected into 1/10 vol 3.8% trisodium citrateb
mmol/L benzamidine hydrochloride and the plasma separated by
centrifugation as described previously." BaCl,, 1 m o m , was then
added dropwise to a final concentration of 50 mmoVL and the
solution mixed for 1 hour on ice before centrifugation at 15,OOOg
for 1 hour at 4°C. The precipitate was suspended in 50 mL 0.05
m o w Tris HCl pH 7.4 containing 0.15 mol/L NaCl (TBS) and
recentrifuged. The pellet was then eluted in 50 mL TBS containing
0.2 m o m Na,EDTA. This solution was then dialyzed for 16 hours
at 4°C against 0.02 mol/L Tris HCL pH 7.4 containing 0.25 mol/L
NaCl (VI1 buffer). The dialysate was then applied at a flow rate of
30 mL/h to a 5 mL controlled pore glass-coupled RFFVII-2
antibody column equilibrated in FVII buffer. Five milligrams of
protein A-purified IgG was coupled to this column as described
previously." The column was linked in series with a Sepharose G25
guard column (PD 10; Pharmacia LKB). The column was then
washed with 2 column vol of FVII buffer containing 1 mol/L NaCl
and then developed isocratically with FVII buffer containing 1
mol/L sodium isothiocyanate adjusted to pH 8.5. Two-milliliter
fractions were collected at a flow rate of 30 m u . Peak FVIIcontaining fractions were assayed by one-stage coagulation assay
and then concentrated using Centricon-30 microconcentrators
(Amicon, Danvers, MA). The concentrated eluate was then applied to a Superose 12 high performance liquid chromatography
(HPLC) column, which was developed isocratically with TBS at a
flow rate of 0.5 mumin. One-milliliter fractions were collected.
Peak activity-containing fractions were pooled, reconcentrated,
and stored in 50% glycerol at -70°C.
Kinetic anatysis. Steady state kinetic parameters were derived
for wild-type and CRM+ FVII using the modification of the
methods of Seligsohn et aI8and Osterud et al.'* Briefly, 0.1 mL of
CRM+ or normal diluted plasma containing 0.0125 U FV1I:Ag
was added to 50 p L of a 1:5 dilution rabbit brain thromboplastin
(Sigma) or relipidated human recombinant TF. Both of these TF
preparations gave clot times of exactly 17 seconds in a prothrombin
time assay using 20-normal pooled plasma. All proteins were
diluted in TBS pH 7.4 containing 0.1% bovine serum album
(TBSA). Purified FX diluted in TBSA was then added at various
concentrations ranging from 300 to 37 nmol/L in a final volume of
50 pL. The mixture was incubated at 37°C for 1 minute at which
time 25 pL 25 mmol/L CaC1, was added. Following a further
incubation for 3 minutes at 37°C the reaction was stopped by the
addition of 25 pL of 0.3 mol/L Na,EDTA. FXa generation was
linear over this time period. TBSA, 600 JLL,was then placed in a
cuvette with 100 pL of the chromogenic substrate S2222 (benzoylL-Ile-L-Glu-Gly-L-Arg-p-nitroanalide;
Kabi-Vitrum, Uxbridge,
UK) and 100 pL of the incubation mixture. The initial rate of
change in absorbance at 405 nmoVL was then measured at 37°C in
spectrophotometer (LKB). Results were represented as Lineweaver-Burk plots. Slopes and intercepts were calculated by
linear regression analysis. All points were means of two experiments performed in duplicate.
TF Zigand blots. FVII samples were electrophoresed on native
10%polyacrylamide slab gels. The monomer solution for these gels
was 10% T 5% C. The separating gel buffer was 0.947 mol/L Tris
HCl pH 8.48. The cathodic buffer was 37.6 m m o m Tris, 40 mmol/L
glycine pH 8.89. The anodic chamber buffer was 63 mmol/L Tris, 50
mmol/L HCI, pH 7.47. No stacking gel was used, with combs being
placed directly into the separating gel solution.
Polymerization was effected by the addition of ammonium
persulphate and N,N,N',N'-tetramethylethylenediamine.
Samples
were applied to the gels in 50% glycerol. Gels were run at room
temperature at 37 mA constant current. After electrophoresis, gels
were subjected to Western blotting at 4°C for 2 hours at 0.4 A onto
nitrocellulose membranes. Membranes were blocked with NET/
TXlOO buffer (TBS, 0.1% Triton X-100,2.5 mmoVL CaCl,, 0.25%
gelatin) for 1 hour at room temperature. Membranes were then
incubated with 10 pL biotinylated recombinant human TF apoprotein in 15 mL NET buffer containing 0.1% Triton X-100 for 16
hours at room temperature. After washing with NETlTX100 for 1
hour the membranes were incubated for 15 minutes with 5 p L
streptavidin-HRP complex in 15 mL of the same buffer, washed for
1 hour, and then exposed to XOMAT RP film (Eastman Kodak,
Rochester, NY) following the addition of a chemiluminescent
substrate (ECL-Amersham Ltd).
Activation of FIX by wiZd-type and CRM+ W I . The activation
of biotinylated FIX was assessed by cleavage of the single-chain
zymogen to the two-chain enzyme in the presence of FVII and
human or heterologous TF, as follows. Biotinylated FIX, 5 pL (0.2
pg), was added to 250 p L TBS containing 2.5 mmol/L CaCI, and 10
pL relipidated human or rabbit brain TF and 1 U unlabeled FIXa
that was previously activated with purified human factor XIa
bound to controlled pore glass." Twenty microliters was removed,
acetone precipitated, and resuspended in 30 pL nonreducing
sample buffer."
Normal or CRM+ FVII, 0.1 U/FVII:Ag, was then added and
samples were removed at various time points and acetoneprecipitated. Samples were subjected to SDS-PAGENestern blot
analysis. Biotinylated FIX was detected using streptavidin-HRP
and ECL detection system as described earlier.
DNA isolation. DNA was isolated from lymphocyte pellets
made from blood samples by established methods.13
In vitro amplification using the polymerase chain reaction (PCR).
Exons 2 to 8 of the factor VI1 gene were amplified by PCR using the
oligonucleotides listed in Table 1. Oligonucleotides were synthesized on an Applied Biosystems (Warrington, UK) 391 DNA
synthesizer. One hundred nanograms of genomic DNA, 0.5 pg of
each oligonucleotide, and 1.5 U Taq DNA Polymerase (Cetus,
Beaconsfield, UK) were added to 90 p L buffer containing 1.5
mmol/L MgCl,, 10 mmol/L Tris-HC1 (pH 8.3), 50 mmol/L KCl,
0.01% gelatin, and 200 pmoVL each deoxynucleotide triphosphate.
The reaction mixture was initially incubated at 94°C before
undergoing 30 cycles of PCR using a Perkin-Elmer-Cetus Thermal
Cycler (Beaconsfield, UK). PCR conditions are given in Table 1.
DNA cloning and sequencing. The amplified fragments were gel
purified and cloned into Gemini plasmid vectors (Promega Biotec,
Southampton, UK) or Bluescript plasmid vectors (Stratagene,
Cambridge, UK). The inserts were sequenced by the dideoxy chain
termination m e t h ~ d . ' ~
RESULTS
Measurement of FWZ antigen and activity. Table 2 shows
the results of FVII antigen and activity assays performed on
the plasmas of the CRM+ individual and his parents. All
the individuals tested had normal FVI1:Ag levels as measured using an ELISA based on an HRP-conjugated polyclonal antibody to human FVII:Ag. Using rabbit brain TF
in the one-stage FVII:C assay, both the parents showed
reduced functional activity (ratio of FVII:C to FV1I:Ag
0.5:l) whereas the propositus had no detectable FVII
clotting activity (ratio FVI1:C to FV1I:Ag 0:l). These data
suggest that the parents are heterozygousfor the abnormal-
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
134
OBRIEN ET AL
Table 1. Oligonucleotidesand Conditions Used to Amplify the Human Factor VI1 Gene
Exon
Oligonucleotides
Denaturation
2
5'GCGGGGCACGCGGTGGGCGC3'
5'CGCCGCCGTGCAGTGTCCGC3'
94°C
45 s
-
72°C
135s + 3 s
3+4
5'GGGTGCTCTGGTGAAGGTGC3'
5'CAGCTCCCCAGGGCCCTCTG3'
94°C
30 s
60°C
15 s
72°C
120 s
5
~'CTGACCCCCAGIUGCCCCTC~'
5'CTAGTGGGACAGGGACTGGT3'
94°C
30 s
65°C
15 s
72°C
120 s
6
5'TAGTGGCACGTTCATCCCTC3'
S'AAGGCTTCAAGACCCTCAGG3'
94°C
60 s
58°C
60 s
72°C
180 s
7
5'ATGACAGCAATGTGAClTCCO'
5'GTCTGTGGAAGTGACAGCAG3'
94°C
45 s
58°C
60 s
70°C
128 s
8
~'GGCAGGTGGTGGIUAGGCCC~'
5'CCACAGGCCAGGGCTGCTGG3'
94°C
45 s
70°C
60 s
70°C
128 s
ity and that the propositus is homozygous. Different results
were obtained when human TF was used in the same assay.
Significant FVI1:C levels of 0.3 U/mL were consistently
recorded for the CRM+ individual. Identical results were
obtained using relipidated recombinant human TF and TF
from human brain. These data indicate that the CRM+
molecule is able to catalyze the conversion of FX and/or
FIX to the active enzymes only in the presence of human
TF and not with rabbit TF, in contrast to the wild-type
molecule.
Kinetics of FX activation by wild-type and CRM+ M Z .
Experiments were conducted using a coupled amidolytic
assay to derive steady-state kinetic parameters for wild-type
or CRM+ FVII in the presence of human, bovine, or rabbit
TF. In this assay the substrate, purified human FX, was
varied in an initial incubation mixture in which the other
reactants, FVII and TF, were held constant. After an initial
incubation period the FXa generated was then added to a
chromogenic substrate. The data are presented as Lineweaver-Burk plots where the reciprocal of the initial rate
of generation of FXa (reciprocal of the initial AAbs/min-'
of the chromogenic substrate) is plotted against the reciprocal of the substrate concentration (l/[FX] * pM-I). In
experiments using human recombinant TF and normal
FVII the Km for FX activation was 220 nmol/L, Vmax 0.052
AAbs/min-' (Fig 1). In the same experiment results using
the CRM+ FVII were Km 2.6 pmol/L, Vmax 0.062 AAbs/
min-', representing a 12-fold increase in the Km for FX
activation compared with the normal enzyme. Similar
results were obtained using saturating concentrations of
bovine TF in the same assay: wild-type FVII Km 250
nmol/L, Vmax 0.066 AAbdmin-', CRM+ FVII Km 2.2
bmol/L, Vmax 0.057 AAbs/min-'. Consistent with the
Table 2. One-Stage FVII: C Assays Using Rabbit (rTF), Human (hTF),
and ELlSAfor FVII:Ag
Annealing
Extension
results obtained with the one-stage FVI1:C assays the
CRM+ FVII molecule was unable to catalyze the conversion of FX to FXa in this assay in the presence of rabbit TF.
To determine if the CRM+ FVII competed with normal
FVII for rabbit TF binding sites the following experiments
were performed: The concentration of rabbit TF was
titrated in the amidolytic assay to a rate-limiting concentration and the steady-state kinetic parameters derived for
normal FVII, Km 135 nmol/L, Vmax 0.107 AAbs/min-' (Fig
2A) The apparent decrease in the Km in this system reflects
the reduced concentration of competing phospholipid in
the reaction mixture as a consequence of the lower TF
m
bo
40
20
-m
N I I : C U/mL
-5
;
IO
5
I5
20
1
Subject
rTF
hTF
FVII:Ag U/mL
Father
Mother
Propositus
0.42
0.42
0.00
0.51
0.56
0.3
1.09
0.99
1.04
CFXI ( phi-')
Fig 1. Lineweaver-Burk plot for the activation of FX by CRM+ and
wild-type FVll in the presence of human TF. FVII, (-1;
CRM+ FVII,
(----).
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
CHARACTERIZATION OF FVll 304-GLN
“ 1
A
-I==
I
135
...e-
I
I
C
I
I
I
40
.*-_.--
’ .---
_/-
I
-10
-5
0
1
I
I
I
5
IO
15
20
1
C
Z
7 (uM-’)
Fig 2. Lineweaver-Burk plot for the activation of FX by normal FVll
in the presence of rabbit TF. (A) Normal FVll alone; (E) normal FVll
with twofold molar excess of CRM+ FVII; (C) normal FVll with a
fivefold molar excess of CRM+ FVII.
concentration added. At higher T F concentrations the
increased phospholipid competes with the substrate, FX.I5
Increasing amounts of the CRM+ FVII antigen were then
added to the reaction mixture containing the normal FVII,
rabbit TF, and FX. Km and Vmax for FVII activation of FX
were unaltered in the presence of a twofold and a fivefold
molar excess of the CRM+ FVII over the normal enzyme
(Fig 2, B and C, respectively). These data indicate that the
CRM+ molecule did not compete with the wild-type for the
available TF binding sites in the reaction mixture.
Purification and Western blot analysis of wild-type and
CRM+ M I . Table 3 shows the results of the purification
of CRM+ FVII from 190 mL of frozen citrated plasma. The
protocol involved adsorption to barium chloride, affinity
chromatography using the MoAb RFFVII 2, and Superose
12 HPLC gel permeation chromatography. Overall recoveries of normal FVII using this protocol were routinely 10%
to 20%. The CRM+ and the wild-type molecules gave
similar recoveries of FVI1:Ag at each step. Thus, the
CRM+ molecule was not grossly different in size, charge,
or posttranslational modification, and the epitope for the
MoAb was present. Wild-type FVII purified in this manner
Table 3. Purification of CRM+ FVll From Plasma
FVII:Ag
No.
Vol (mL)
FVII:C (U/mL)
UlmL
Total
% Recovery
Plasma
BaC12 eluate
RFFVll eluate
Superose 12
190
190
15
1
<1
<1
<1
<1
1.04
2.5
5.3
33.3
197
107
80
30
100
98
40
15
FVII: C assays were performed using rabbit TF.
has a specific activity of 1,500 U FVI1:C activity/mg by
one-stage FV1I:C assay and coupled amidolytic assay:
indicating that the molecule does not undergo activation as
a consequence of the purification procedure. Western blot
analysis under reducing conditions using a second MoAb as
the probe (231/7) showed that the relative mobility was
identical to the wild-type molecule (Fig 3). This result
confirmed that there was no gross difference in relative
molecular mass between the wild-type and the CRM+
molecule.
Activation of purified FIX by CRM+ and normal FVII.
Kinetic analysis demonstrated that the CRM+ FVII was
capable of catalyzing the conversion of FX to FXa at a
reduced rate in the presence of human, but not rabbit, TF.
In addition, the CRM+ molecule was unable to compete
with normal FVII for limited rabbit TF binding sites in the
coupled amidolytic assay. To investigate the ability of the
CRM+ molecule to proteolyze FIX, purified biotinylated
human FIX was incubated at 37°C with either human or
rabbit TF, calcium, CRM+ or normal FVII and a trace
amount of cold FIXa to fully activate the FVII. Aliquots
were removed at various time points and subjected to
SDS-PAGE under nonreducing conditions. Gels were subsequently Western blotted onto nitrocellulose membranes,
probed with streptavidin-HRP, and detected with a chemiluminescent substrate. Figure 4A shows the time-course
activation of biotinylated human FIX in the presence of
human TF and normal FVII (lanes 1 through 6) and
CRM+ FVII (lanes 7 through 12). Rapid activation of the
single-chain FIX, as evidenced by the appearance of the
43-Kd two-chain polypeptide, was seen in the reaction
mixture containing wild-type FVII. Some proteolysis of the
zymogen FIX was detected in the reaction mixture containing CRM+ FVII and human TF, but at a much slower rate
and to a lesser extent than that seen with the wild-type
molecule. In contrast, the same experiment performed
using rabbit TF showed a rapid conversion of FIX to FIXa
by the wild-type FVII but little or no conversion in the
presence of the CRM+ enzyme (Fig 4B). After a 16-hour
incubation of the FIX with the rabbit TF and the dysfunctional FVII, minimal activation was detected. These data
confirm that while the CRM+ FVII was able to catalyze the
conversion of FIX to FIXa in the presence of human TF at
a reduced rate, no significant proteolytic activity could be
detected in the presence of the rabbit cofactor.
Ligand blot analysis. To investigate further the interaction between normal and CRM+ FVII and TF, a ligand
blot procedure was developed. In this system purified FVII
was subjected to nondenaturing polyacrylamide gel electrophoresis and electrotransferred onto nitrocellulose membrane. The membranes were then blocked with a gelatin/
CaCl,/Triton X-100 containing buffer (NET buffer) and
probed with nonrelipidated, biotinylated recombinant human TF apoprotein, in the presence of 0.1% Triton X-100.
Binding of the biotinylated T F was detected using HRPconjugated streptavidin and a chemiluminescent detection
system (ECL). In control experiments no binding of T F to
purified FX, FVIII, FIX, or prothrombin could be detected
and binding of TF to FVII was detected in the presence of
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
136
OBRIEN ET AL
200-
976843-
29-
1
Fig 3. Western blot analysis of normal (lane 1) and CRM+
(lane 2) FVll purtfied from plasma. Samples were electrophoresed in reduced SDS-PAGE 10% gels and Western
blotted onto nitrocellulose and probed with MoAb 231/7 a
FVll antibody labeled with '9.
Relative molecular mass x 10'
are shown on the left of the figure.
2
A
97-
6843Fig 4. SDS-PAGEIWestern
blot analysis of the time course
of the activation of labeled FIX
by CRM+ and normal FVII. (A)
Activation of FIX by normal FVll
in the presence of human TF
(lanes 1 through 6) and CRM+
FVII (lanes 7 through 12). Time
points were 0,5 minutes, 30 minutes, 1 hour,2 hours, and 3 hours.
(E) Activation of FIX by normal
FVll in the presence of rabbit TF
(lanes 1 through 8) and CRM+
FVll (lanes 9 through 16). Time
points were 0,5 minutes, 30 minutes, 1 hour, 2 hours. 3 hours, 6
hours, and 16 hours after the
addition of FVII. See Materials
and Methods for full details.
26B
200-
43 97
68
26
-
1
2
3
4
5
6
7
8
9
10 11 12
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
137
CHARACTERIZATION OF FVll 304-GLN
calcium-containing buffers, but not in the presence of
chelating agents such as EDTA (data not shown).
Figure 5 shows the result of a ligand blot of normal and
CRM+ FVII probed with recombinant biotinylated TF. An
equal amount of FVII:Ag, as determined by ELISA, was
loaded in each case. Significantlyreduced binding of the T F
to the CRM+ molecule was detected (Fig 5A, lane 1) with
respect to the wild-type molecule (Fig 5A, lane 2). Two
lanes representing the same antigen loadings were run
concurrently and subjected to Western blot analysis using
an HRP-conjugated polyclonal antihuman FVII antibody
as the probe (Fig 5B). This demonstrated that the amounts
of FVII and CRM+ FVII loaded were similar. The upper
band represents a small amount of residual FVII which
remained in the top of the gel. This phenomenon was not
always seen. In a separate experiment 1,0.5,0.25, and 0.125
U of normal or CRM+ FVII were electrophoresed and first
probed with biotin-TF (Fig 6A) and reprobed with the
HRP-conjugated polyclonal antibody to FVII (Fig 6B).
Because the chemi-luminescent reaction inactivates HRPconjugated streptavidin it was possible to reprobe TF ligand
blots with the polyclonal antibody to FVII to ensure that
the same amount of FVII had been electrophoresed in each
case. The results of the ligand blot analysis clearly demonstrate that the CRM+ FVII molecule exhibited reduced TF
binding. Densitometric scans showed that the binding of
recombinant human TF was approximately 10- to 15-fold
lower that the binding to normal FVII.
FUZgene analysis. To identify the mutation causing the
observed phenotype, exons 2 through 8 were amplified by
PCR. The amplified fragments were completely sequenced
after cloning into plasmid vectors. The sequence of the
cloned PCR products did not differ from the previously
published sequence for the human FVII gene,I6 except at
positions 10828 and 9778. The single-base change at 9778 is
in intron 8 and therefore cannot be responsible for the
altered phenotype of the FVII protein. The single-base
B
Fig 5. Ligand blot analysis of normal and CRM+ FVII. Samples
were electrophoresed on 10% nondenaturing PAGE gels and Western
blotted onto nitrocellulose membranes. (A) Purified CRM+ FVll (lane
1)and normal FVll (lane2) probedwith biotinylated human TF. (B) The
same sample loads probed with an HRP-conjugated polyclonal antibody to human FVll (lane 1 CRM+ FVII, lane 2 normal FVII). See
Materials and Methods for details.
Fig 6. (A) Ligand blot analysis of normal FVll and CRM+ probed
with biotinylated human TF. Lane 1, 1 U normal FVII; lane 2, 0.5 U;
lane 3, 0.25 U; lane 4, 0.125 U; lane 5, 1 U CRM+ N
1
1
;lane 6, 0.5 U;
lane 7,0.25 U; lane 8,0.125 U. (B) The same membrane reprobedwith
an HRP-conjugatedpolyclonal antibody to human FVII.
change at position 10828results in a substitution of arginine
by glutamine at position 304 (Fig 7).
DISCUSSION
In this study we have undertaken the biochemical analysis of a dysfunctional FVII molecule, isolated from the
plasma of a clinically unaffected individual. A differential
response to human and rabbit brain TF was detected in
one-stage and amidolytic FVI1:C functional assays. Significant but reduced FVI1:C activity was detected in the
presence of human TF, but no activity was detected in the
presence of rabbit TF. Even at high concentrations of
FVI1:Ag the CRM+ FVII was unable to catalyze the
conversion of FX to FXa in the presence of the rabbit
cofactor. In a coupled amidolytic assay using human TF and
purified FX a 1Zfold increase in the Km for FX activation
was recorded for the CRM+ over the wild-type enzyme,
with no difference in the Vmax. These results may reflect
the requirement of TF binding to FVII for substrate
recognition, as described by Nemerson and Gentry.” These
investigators have proposed an ordered addition, essential
activation model of the T F pathway of coagulation, in which
the enzyme (FVI1a)-activator (TF) complex picks up sub-
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
OBRIEN ET AL
138
G
T
/;
3'
Thr
A
G
T
A
G
T
Leu
C
*\;
G
Gln304
C
pro
5'
strate (FX or FIX) to form a ternary complex; a model that
precludes the formation of binary enzyme-substrate complexes. Thus, in this model the affinity of the enzyme for its
substrate is dependent on prior TFFVIIFlrIIa binding. It
is also possible that, in addition, defects of substrate
recognition or zymogen activation may result from the point
mutation detected in this study. It has been shown that
FVII bound to TF is more readily activated by FXa.18
Defective TF binding could conceivably result in reduced
enzyme activation in the assays. The dysfunctional molecule did not compete with wild-type FVII for limited rabbit
TF binding sites, because the addition of a fivefold molar
excess of the CRM+ molecule to a reaction mixture
containing wild-type FVII, a rate-limiting concentration of
rabbit TF, and FX did not alter the kinetic parameters
derived for the normal enzyme. This result indicated that
the CRM+ molecule was unable to act as a competitive
inhibitor of the wild-type FVII.
To expand these studies we have developed a purification
protocol that effects the purification of FVII from plasma
donations of approximately 200 mL. FVII purified in this
manner is isolated in zymogen form, as evidenced by a 1:l
correlation between the results of the one-stage coagulation and amidolytic assays for FVII:C.8 Yields of FVII over
the multistep process are routinely 10% to 20%. Purified
CRM+ and normal FVII isolated from plasma by this
protocol had identical relative mobilities on SDS-PAGE/
Western blot analysis, indicating that the defect did not
arise from a major deletion or rearrangement of the gene.
Using the purified CRM+ FVII we were able to demonstrate that the dysfunctional enzyme was able to proteolyze
purified human FIX at a reduced rate in the presence of
human, but not rabbit, TF. These data indicated that the
defect in this molecule may involve the interaction with TF.
Fig 7. Nucleotidesequence of exon 8 of the factor
VI1 304-Gln gene. Exon 8 was sequenced by the
dideoxy chain termination method (Sanger et al)
after subcloning the amplified material into the Bluescript plasmid vector (Stratagene). Arrow indicates
the nucleotide substitution. The translation of the
sequence is shown.
To confirm this hypothesis a ligand blot assay was
developed to assess the binding of biotinylated recombinant
human T F to membrane-bound normal and CRM+ FVII.
This assay is specific for the T F W I I interaction because,
in control experiments, there was no evidence of binding of
biotinylated T F to related vitamin K-dependent coagulation factors. Biotinylated TF bound specifically to FVII in
calcium-containing buffers but not in EDTA-containing
buffers. The binding of TF-apoprotein to immobilized FVII
is known to be calcium dependent." Therefore, the assay
was used to investigate the binding of biotinylated recombinant human TF to purified wild-type and CRM+ FVII.
With identical antigen loading the binding to the CRM+
molecule was repeatedly 10- to 15-fold less than that to the
wild-type FVII.
To characterize the genetic defect, exonic and flanking
intronic sequences of the propositus' FVII gene were
amplified, cloned, and sequenced by the dideoxy chain
termination method.14 The only discrepancy with the previously published sequence of the human FVII gene'6 detected within the coding sequence of the CRM+ gene was a
G to A substitution in codon 304, leading to the substitution
of a glutamine for an arginine residue. This most probably
is the result of a C to T transversion on the noncoding
strand in a CpG dinucleotide. There is now a considerable
body of evidence in the literature that CpG dinucleotides
are mutation hot spots in the human genome.*' This
mutation gives rise to a radical substitution because arginine side chains are positively charged at physiologic pH,
whereas glutamine is a polar but uncharged residue.
Little is known about the structural requirements of the
FVII molecule for interaction with TF. The data presented
in this study suggest that the arginine residue at position
304 (Arg-304), which is located in the catalytic domain of
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
CHARACTERIZATION OF FVll 304-GLN
139
the protease, may be important in this interaction. The
substitution of Arg-304 by Gin-304 could prevent the
association of the FVIIhabbit TF complex and allow only
weak binding of the variant molecule to human TF.
Presumably, differences in the primary structure of rabbit
and human TF account for the differentia1 response Of the
CRM+ FVI1 to the hUnan and rabbit cofactors*Rep1acement of Arg-304 by Gln-304 might cause a conformational
change in the FVII molecule resulting in reduced TF
binding affinity, through a propagat effect on a distal
binding site for TF. Alternatively, the mutation may occur
directly in the TF binding site. It is also possible that the
mutation impacts more than one functional domain of the
enzyme. The present study cannot distinguish between
these possibilities.
By comparison with the primary structures of the other
vitamin K-dependent coagulation factors, it is evident that
Arg-304 is located in a structurally conserved region of
FVII. Furie et a1” have proposed an alignment of the
bovine vitamin K-dependent coagulation factors based on
the crystallographic coordinates of bovine trypsin and
chymotrypsin. We have superimposed the sequences of the
human zymogens on this alignment. Using this model FVII,
Arg-304 is homologous to FIX Arg-333, FX Arg-298,
prothrombin Arg-490, and protein C His-326 (Fig 8). This
residue is not conserved in elastase, chymotrypsin, or
trypsinogen. However, there is an insertion of three residues unique to FVII before a conserved cysteine residue
immediately C-terminal to Arg-304, and a second insertion
of five residues from positions 311 to 315 not found in the
other proteases. Thus, while FVII Arg-304 is located in a
region that is highly conserved in FIX, FX, prothrombin,
and protein C, the insertions in FVII reduce the homology
between it and the other vitamin K-dependent coagulation
factors around this position. Furie et alZ1identified six
variable regions and seven conserved regions in the bovine
vitamin K-dependent coagulation factors. Using the same
model FVII Arg-304 would form part of conserved region 5,
which is not in or near the active site of the enzyme.
Sequences N-terminal to conserved region 5 form part of
variable region 4 which, it was speculated, may define a
recognition domain for the binding of proteins to FIX, FX
prothrombin, protein C, and therefore, by inference FVII.
Interestingly, Arg to Gln-333 of FIX has been identified
as the mutation in patients with severe hemophilia B (in
whom there is synthesis and expression of CRM+ FIX).”
FIX Arg-333 would be homologous to FVII Arg-304 according to the alignment proposed by Furie et al.” Because one
w
0 dU!lo0 1
G0L LD
nGA
TA L
R T HEKGR0STR L
A
,
y G I(
s.
L
L
E
I(
EAKRNRTF
L
R V F H K G R S A L
G0
p
,
L M
v
vv
F
K v G D s P N I T E Y M F c FPP
..
S S I F I I T 0 N Y F C Fx
. . . A T C . . . . . L R S T K F T I Y N N M F C FIX
. . . . .@D s T R I R I T D N M F c I
Iv E R . . , Pv
VP H . . . N E . . . . .SEVMONMVS ENML
Pc
LN
v
P R t MToD
P V DR
P L V D R
Y L E
Y L R
NL
I K I P
. . .NS C
.dl
LOOs R
, .
0
Ifl
Fig 8. Alignment of sequences of the human vitamin K-dependent
coagulation factors based on the model proposed by Furie et al.” Dots
depict areas where an insertion in another protease is found. The
arginine residue at position 304 in FVll is marked with an asterisk (“1.
consequence of the substitution of FVII Arg-304 to Gln is
defective cofactor interaction it is possible that substitution
of FIX Arg-333 to Gln results in an FIX molecule with
defective FVIII binding.
There are several lines of evidence to suggest that the
cofactor binding sites of the vitamin K-dependent group of
serine proteases reside in the catalytic domains of these
molecules. An MoAb has been mapped to residues 180 to
310 of human FIX by Frazier et alz3and this antibody has
been shown to interfere with the binding of FVIII to FIX.24
This region of FIX is homologous to the variable region of
FVII N-terminal to the arginine at position 304. This would
place the FVIII binding site on FIX close to the analogous
region of FVII where the mutation described in this study
leads to defective TF binding. The defect in FX Friuli, a
CRM+ molecule with normal activation by R W X but
defective activation by the intrinsic and extrinsic activators,
has been attributed to abnormal cofactor (TF and FVIII)
binding.” The precise location of the presumed point
mutation in this variant FX gene has not been identified but
the defect has been mapped to the catalytic domain of the
molecule.
Two recent reports also support the hypothesis that the
FVII TF binding site resides in the catalytic domain of the
molecule. Kumar et a126reported that a peptide spanning
residues 206 to 218 of FVII inhibited FVII/TF interaction.
In contrast, Wildgoose et a12’ were unable to demonstrate
inhibition of FVII/TF interaction with this peptide but
reported that three catalytic domain peptides, 195 to 206,
263 to 274, and 314 to 326 were inhibitory, with 195 to 206
inhibiting binding of human FVII to TF expressed on the
surface of human bladder carcinoma (582) cells. In this
report, using a combined epidemiologic and biochemical
approach, another catalytic domain residue, Arg-304, has
been shown to be important in FVII function.
ACKNOWLEDGMENT
We thank David Howarth for performing one-stage factor VI1
assays and Dr Yoshiaki Ohkubo for the purification of FIX.
REFERENCES
1. Bajaj S , Rapaport S , Brown S : Isolation and characterization
of human factor VII. J Biol Chem 256:253, 1981
2. Bach R, Gentry R, Nemerson Y FVII binding to tissue factor
in reconstituted phospholipid vesicles: Induction of cooperativity
by phosphatidylserine. Biochemistry 25:4007,1986
3. Nemerson Y Tissue factor and hemostasis. Blood 71:1, 1988
4. Meade Tw: Low-dose warfarin and low-dose aspirin in the
primary prevention of ischemic heart disease. Am J Cardiol65:7C,
1990
5. O’Brien DP, Tate K, Giles A, Vehar G: FVIII-bypassing
activity of bovine tissue factor using a canine hemophilic model. J
Clin Invest 82:206, 1988
6. Bradford M: A rapid and sensitive method for the quantitation of microgram quantities of protein using the principle of
protein-dye binding. Anal Biochem 72:248,1976
7. Takase T, Tuddenham EGD, Chand S , Goodall AH: Monoclonal antibodies to factor VII: Production of immunodepleted
plasma for FVII:C assays. J Clin Pathol41:342, 1988
From www.bloodjournal.org by guest on October 28, 2014. For personal use only.
140
8. Seligsohn U, Osterud B, Rapaport S: Coupled amidolytic
assay for factor VII: Its use with a clotting assay to determine the
activity status of factor VII. Blood 52:978,1978
9. Smith KJ: Immunoaffinity purification of factor IX from
commercial concentrates and infusion studies in animals. Blood
721269,1988
10. O’Brien DP, Tuddenham EDG: Purification and characterization of FVIII 1689-cys:A nonfunctional cofactor occurring in a
patient with severe haemophilia A. Blood 73:2117,1989
11. Ohkubo Y, OBrien DP, Kanehiro T, Fukui H, Tuddenham
EGD: Characterisation of a panel of monoclonal antibodies to
human coagulation factor XI and detection of FXI in HepG2 cell
conditioned medium. Thromb Haemost 63:3, 1990
12. Osterud B, Kasper CK, Lavine KK, Prodanos C, Rappaport
SI: Purification and properties of an abnormal blood coagulation
factor IX (factor IX BM). Thromb Haemost 45:55,1981
13. Kunkel LM, Smith KD, Boyer SH, Borgaonkar DS, Wachtel
SS, Miller OJ, Breg WR, Jones HW, Rary JM: Analysis of human
Y chromosome-specific reiterated DNA in chromosome variants.
Proc Natl Acad Sci USA 74:1245,1977
14. Sanger F, Nicklen S, Coulson AR: DNA sequencing with
chain terminating inhibitors. Proc Natl Acad Sci USA 74:5463,
1977
15. Bom V, Reinalda-Poot J, Cupers R, Bertina RM: Extrinsic
activation of human blood coagulation factors IX and X. Thromb
Haemost 63:224,1990
16. O’Hara P, Grant F, Haldeman B, Gray C, Insley M, Hagen
F, Murray M: Nucleotide sequence of the gene coding for human
factor VII, a vitamin K-dependent protein participating in blood
coagulation. Proc Natl Acad Sci USA 84:5158,1987
17. Nemerson Y, Gentry R: An ordered addition, essential
activation model of the tissue factor of coagulation: Evidence for a
conformational case. Biochemistry 25:4020,1986
OBRIEN ET AL
18. Rao L, Rapaport S: Activation of factor VI1 bound to tissue
factor: A key early step in the tissue factor pathway of blood
coagulation. Proc Natl Acad Sci USA 85:6687, 1988
19. Broze G, Leykam J, Schwartz B, Miletich J: Purification of
human brain tissue factor. J Biol Chem 260:10917, 1985
20. Gitschier J, Kogan S, Levinson B, Tuddenham EGD: Mutations of factor VI11 cleavage sites in hemophilia A. Blood 72:1022,
1988
21. Furie B, Bing D, Feldman R, Robison D, Burnier J, Furie
BC: Computer generated models of blood coagulation factor Xa
factor IXa and thrombin based upon structural homology with
other serine proteases. J Biol Chem 257:3875,1982
22. Gitschier F, Green PM, High KA, Lozier JN, Lillicrap D,
Ludwig M, Olek K, Reitsma P, Goosens M, Yoshioka A, Sommer
S, Brownlee G: Haemophilia B: Database of point mutations and
short additions and deletions. Nucleic Acids Res 18:4053,1990
23. Frazier D, Smith K, Cheung W, Ware J, Lin S, Thompson A,
Reisner H, Bajaj S, Stafford D: Mapping of monoclonal antibodies
to human FIX. Blood 74:971,1989
24. Bajaj S, Rapaport SI, Maki S: A monoclonal antibody to
factor IX that inhibits the factor VI1I:Ca potentiation of factor X
activation. J Biol Chem 260:11574,1985
25. Fair D, Revak D, Hubbard J, Girolami A Isolation and
characterization of the factor X Friuli variant. Blood 73:2108, 1989
26. Kumar A, Blumenthal D, Fair D: Identification of regions of
factor VI1 mediating the assembly of the extrinsic pathway activation complex. Blood 74:95a, 1989 (abstr, suppl)
27. Wildgoose P, Kazim A, Kisiel W: The importance of
residues 195-206 of human blood clotting factor VI1 in the
interaction of factor VI1 with tissue factor. Proc Natl Acad Sci
USA 87:7290,1990