1. health and fitness
2. disease
3. cancer

From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
The Accumulation of p53 Abnormalities Is Associated With Progression of
Mucosa-Associated Lymphoid Tissue Lymphoma
By Mingqing Du, Huaizheng Peng, Nalini Singh, Peter G. Isaacson, and Langxing Pan
The genetic mechanisms underlying the genesis of lowgrade mucosa-associated lymphoid tissue (MALT) lymphomas and their transformation into
high-grade lymphoma are
poorly understood. p53 inactivation, commonly caused by
mutation and allele loss, has been shown t o play an imdisease
portant role in the early development andlor the late
progression of many humantumors including lymphoid main MALT
lignancies and, thus, may also beimportant
lymphomagenesis. We examined 75 cases(48low grade and
27 high grade) of MALT lymphoma for p53 allele loss and
mutation as well as protein accumulation. DNA samples prepared from microdissected cell populations were used for
the detection of p53 gene abnormalities. Loss of heterozygosity (LOH) of the gene was detected by polymerase chain
reaction-based analysis of p53 CA repeat polymorphism,
whereas p53 mutation was studied by single-strand conformation polymorphism analysis and direct sequencing. p53
expression was assessed by immunostaining with CM1
polyclonal antibody. p53 allele loss and mutation, which resulted in the alteration in the amino acid sequence, were
found in both low-grade (LOH, 3 of 44 [6.89/01; mutation, 9 of
48 [18.8%1) and high-grade (LOH, 6 of 21 [28.6%3; mutation,
9 of 27 [33.3%1) MALT lymphomas, particularly in the latter
group. p53 staining was not observed in any low-grade tumors but in 6 high-grade cases that harbored missense mutations. There were also differences in the extent of p53
abnormalities, between low- and high-grade tumors. Of the
11 low-grade tumors showing p53 abnormalities, only 1 tumor showed the concomitance of p53 mutation and allele
loss, whereas in high-grade tumors, 6 of 9 affected cases
displayed both p53 mutation and allele loss. Our results suggest that p53 partial inactivation may playan important role
in the development of low-grade MALT lymphomas,
whereas complete inactivation may
be associated with highgrade transformation.
0 1995 by The American Societyof Hematology.
M
Various frequencies of p53 mutation have been documentedin
lymphoid malignan~ies.‘~-~~
p53 mutation is
thought to be associated with high-grade transformation of
follicular lymphoma” and chronic lymphocytic leukemia.”
Recently, a high frequency of p53 mutation has been reported in marginal zone splenic B-cell lymphoma,’8 which
is analogous to MALT lymphoma in its origin of cell lineage,
immunophenotyping, histology, and genetic findings such
as the absence of bcl-2 and bcl-l rear~-angement.’~.’~
Thus,
inactivation of the p53 gene may also be important in the
tumorigenesis of MALT lymphoma.
Most previous p53 studies have failed to pay full attention
to the analysis of both allele loss and mutation together in
the same tumor g r o ~ p , ” ~and
’ ~ thus the full potential of p53
inactivation in tumorigenesis may have been underestimated.
In the present study, we examined p53 gene abnormalities,
including both allele loss and mutation as well as protein
accumulation in 75 cases of well-characterized low- and
high-grade MALT lymphoma to determine the full potential
of p53 inactivation in MALT lymphomagenesis. Our results
suggest that p53 partial inactivation may be associated with
the development of low-grade tumor, whereas complete inactivation may be important for high-grade transformation.
ALIGNANT LYMPHOMA derived from mucosa-associated lymphoid tissue (MALT) accounts for the
majority of extranodal lymphomas and arises from acquired
MALT in several extranodal sites such as the stomach, salivary gland, and t h y r ~ i d . ”Low-grade
~
B-cell lymphoma usually exhibits an indolent clinical
but is capable of
transforming into high-grade tumor! Although the clinical,
pathologic, and immunophenotypic features of MALT
lymphoma have been well documented,”3 the genetic basis
underlying its development and high-grade transformation
is poorly understood.
p53, a transcription factor, acts as a cell cycle check point
proteinandinducescellcyclearrestinthelate
G1 phaseor
apoptosis after DNA di~nage.5.~
p53 inactivation, abolishing its
tumor-suppressor activity, is the most common event in human
m a l i p a n c i e ~ and
~ , ~contributestobothearlytumordevelopmentl0.” and late disease pro~ssion.’’The inactivation of p53
tumor-suppressor activity can be causedatthegenelevelby
mutation,I3 deletion,I4 andarrangement'^ or at the protein level
bybinding tooncogenicproteinssuch
as MDM2.I6Among
these, p53 mutation and allelic loss are the most common.
Inactivation of p53 tumor-suppressor activity during tumor development is a process of accumulation of its genetic
abnormalitie~.~,’~
p53 mutation can precede allele loss or
vice versa.” In both circumstances, p53 function isonly
partially inactivated because only one allele of the p53 gene
is affected. Mutant p53 loses tumor-suppressor activity and
may also exert a dominant negative effect on the remaining
wild-type; however, it is unable completely to suppress wildtype function.19-*’p53 inactivation involving both alleles,
usually by mutation in one allele and loss of the other, results
in the complete loss of p53 function. These different p53
abnormalities have been shown to exhibit distinct tumorigenic potentials in p53 transgenic mice with increasing tumorigenicity after one allele loss, one allele mutation, and
inactivation of both alleles.” These different p53 gene abnormalities may also be expected to be involved at different
stages of human tumor development.
Blood, Vol86, No 12 (December 15), 1995: pp 4587-4593
From the Department of Histopathology, University CollegeLondon Medical School, London, UK.
Submitted June 7, 1995; accepted August 7, 1995.
Address reprint requests to Peter G. Isaacson, DM, FRC Path,
Department of Histopathology, University College London Medical
School, Rockefeller Building, University Street, London WCIE SJJ,
UK.
The publication costsof this article were defrayed in part by page
chargepayment. This article must therefore behereby marked
“advertisement” in accordance with 18 U.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
0006-4971/95/86/2-0035$3.00/0
4587
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
DU ET AL
4588
MATERIALSANDMETHODS
Tissuesamples. Seventy-five cases (paraffin-embedded tissues
available in 63,frozen tissues available in 24) of B-cellMALT
lymphoma were retrieved from the Department of Histopathology,
UniversityCollegeLondonMedicalSchool.
These comprised 48
low-grade and 27 high-grade MALT lymphomas. Tumors originated
from the stomach in 60 cases, salivary gland in 6 cases, small intestine in 5 cases, and thyroid in 4 cases. The diagnosis of low-grade
MALT lymphoma was established bythe characteristic histologic
appearances’” together with immunophenotyping and clonal analysis
oftheIgheavy
chaingene. Of the27high-gradelymphomas,
a
low-grade MALT lymphoma component could be identified in 21,
usually as one or more small foci present in paraffin sections from
a minority of the blocks.
Microdissection andDNA preparation. Paraffin (28 low-grade
cases and 23 high-grade cases) and frozen (20 low-grade cases and
4 high-grade cases) sections were briefly stained with hematoxylin
and eosin. Tumor andnontumorcellpopulationswereseparately
microdissected from each case, as described previously.” The microdissected cell population was digested with
200 &mL proteinase
K in a 40 to 1 0 0 pL solution containing 10 mmol/L Tris HCI (pH
8.3). 50 mmol/L KC1 at 37°C for 16 hours. Proteinase K was inactivated at 95°Cfor I O minutes. Celldebris was pelleted by centrifugation and the resulted supernatant was used
for the subsequent genetic
analysis of the p53 gene.
Detection of loss of heterozygosit?,(LOH) of the p53 gene. LOH
of the p53 gene was detected by polymerase chain reaction (PCR)basedanalysis of thep53 dinucleotide repeat (CA25) polymorphism.” The CA repeat was PCR-amplificd from both tumor and
nontumor DNA preparations of the same patient using primers: GT
strand, AGGGATACTATTCAGCCCGAGGTG, andAC
strand,
ACTGCCACTCCTTGCCCCATTC (OswellDNA Service, Department of Chemistry, Edinburgh University, Edinburgh, UK). One of
theprimerswasend-labeledusing
[y-”P] and T4 polynucleotide
kinase. PCR products (2 yL) were mixed with 4 yL sequence stop
solution (98% formamide, IO mmol/L NaOH, 20 mmol/L EDTA,
0.05%bromophenolblue,and0.05%xylene
cyano1 FF), andthe
mixtures were denatured at 98°Cfor 5 minutes and separated on 6%
sequencing gel. The gel was routinely dried and exposed to an xray film for I to 2 days.
Single-strand conformation polymorphism (SSCP) ana1.vsi.r. Because the majority of p53 mutations occur in exon 5, 6, 7, and 8 of
thegene,’.’ these exons wereseparatelyamplified byPCR using
primers described previously.”SSCP analysis of these PCR products
was performed using our recently described protocol, which used
polyacrylamide agarose composite gel together with a background
free silver staining method and showed a high sensitivity (97%) for
p53 mutation detection.” Briefly, PCR products (2 to 5 yL) were
mixed with sequence stop solution. The mixtures were denatured at
98°C for 5 minutes, cooled on ice, and loaded onto a composite gel
containing 5% acrylamide (acry1amide:bis-acrylamide = 99:l) and
0.25% agarose with or without 10% glycerol. Electrophoresis was
performed at 6 W for 12 to 18 hours at 4°C maintained by a refrigerated circulator (Pharmacia, Uppsala, Sweden), and gel was subjected
to silver staining.
Direct DNA sequencing. Samples for whichmutationwas suggested by SSCP were further analyzed by direct DNA sequencing
using fmol DNA sequencing system (Promega, Southampton, UK).
Immunostaining of p53 protein. Immunostaining for p53 protein
was performed in cases with paraffin-embedded tissues, which were
composed of 37 low-grade and 26 high-grade tumours. For antigen
retrieval, paraffin sections were treated in 0.01 moln sodium citrate
buffer (pH 6.0) in a pressure cooker for 2 minutes before staining.25
G0015
N T
G0078
N T
Fig 1. Detection of LOH of the p53 gene in MALT lymphomas. p53
CA repeat was amplified by PCR, in which one of the primer was
end-labeled (see the Materials and Methods). The PCR products were
denatured and separated on 6% sequence gel. N and T indicate nontumor and tumor samples from the same patient. Case G0078
showed loss of one p53 allele in the tumor sample.
p53 proteinwasroutinelyimmunostainedusingCM1polyclonal
antibody (I/5,000 dilution) for 16 hours at room temperature, followedby Biotinylated Swine antirabbit Ig(11250 dilution) for 40
minutes and StreptABComplexRIRP
(11100 dilution) for 40 minutes.
Finally, sections were visualized by incubation with diaminobenzidine (DAB) and HzOz.All reagents used for the staining were purchasedfromDako(HighWycombe,UK).Foreachexperiment,
positive (a breast carcinoma known to express mutant p53 protein)
and negative controls (without the primary antibody) were included.
Immunostaining for p53 using more concentrated CM1 antibody
(either U2.500 dilution for 16 hours or 111,OOO dilution for 1 hour)
wasadditionallyperformed
in someoftheMALTlymphomas,
which showed negative staining for p53 when CM1 antibody was
usedat115.000 dilution.
RESULTS
LOH qf the p53 gene in MALT lymphoma. Of the 15
MALT lymphomas studied, nontumor DNA preparations
were available from 74 cases. Among these cases, 65
(87.8%) were heterozygous for the p53 CA repeat and thus
were informative for LOH analysis. Because the analysis was
performed from DNA samples prepared from microdissected
cell populations, this largely eliminated the interference from
nontumor cells and LOH was easily determined by a direct
comparison of the allelic density between tumor and nontumor samples of the same patient (Fig l). In total, LOHof
the p53 gene was found in 9 (13.8%) cases, with a much
higher frequency in high-grade (6/21 [28.6%]) than in lowgrade (3/44 [6.8%]) tumors.
Mutation of the p53 gene in MALT lymphoma. Using
PCR-SSCP analysis, mutations suggested by the altered electrophoretic mobility were identified in 21 cases and these
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
4589
p53 INACTIVATION IN MALTLYMPHOMA
1
2
3
4
5
6
7
8
9
1
0
Fig 2. Detection of p53
mutation
in MALT
lymphomas byPCR-SSCP analysis. PCR products of
p53 exon6 were denatured, separated o n polyacryl(see
amide-agarose gel, and shown by silver staining
the Materials and Methods).
Lane 1 and 10, placenta
2 through 8, individDNA as negative controls; lanes
ual MALT samples; lane 9, A3/kawa cell line containing a missense mutation in exon 6'' used as a
positive control. Lanes 4 (case G00151 and 6 (case
60114) showed migrating fragments different from
the normal control.
mutations occurred in exon S in 7 cases, exon 6 in 8 cases.
exon 7 in 4 cases, andexon 8 in 2 cases. Examples are
shown in Fig 2.
To confirm the results obtained by SSCP analysis and to
characterize the nature of these mutations, SSCP-positive
cases were further analyzed by direct sequencing. The results
are presented in Table 1 and an example is shown in Fig 3.
Mutation was confirmed in all cases. In 18 cases, mutations
lead to alterations in amino acid sequence, most frequently
amino acid substitution caused by missense mutations (point
mutation in 14 cases; tandem double mutations in 1 case)
and less frequently truncated protein due to frame shift mutation (l-bp deletion in 2 cases) and nonsense mutation ( I
case). Mutations in the remaining three cases weresilent
and did not alter the amino acid sequence. The mutations
identified showed a wide spectrum with a similar frequency
of transition (10/20) and transversion (10/20) mutations.
Four of 20 mutations, including 2 C+T, l G"A transitions
and I G"T transversion, occurred atCpG dinucleotides.
However, no predominant type of mutation was seen.
In summary, inactivating p53 mutation, which alters
amino acid sequence, was found in l8 of 75 (24%) MALT
lymphomas. Similar to LOH of the p53 gene, mutation is
more frequent in high-grade (9/27 [33.3%]) than in lowgrade (9148 [ 18.8%]) tumors.
Accunrulntiorl of p53 protein it1 MALT iwlpkotncr. Of
Table 1. Summary of MALT Lymphoma Cases Showing p53 Abnormalities
Case
Malignant Grade
Tumor Site
G0015
G0318
G0078
G0178
G2098
G0123
G0062
G0177
G0208
G021 1
G1181
G2099
G0525
LG
LG
LG
LG
LG
LG
LG
LG
LG
LG
LG
LG
LG
st
st
st
st
G1201
G1200
G0168
G0114
G0210
G 1207
G0016
G0399
G1918
G 1205
HG
HG
HG
HG
HG
HG
HG
HG
HG
HG
p53 Staining
-
LOH
SSCP
ND
-
6+
Exon
-
+
-
ND
+
-
-
-
st
-
Thy
-
Exon 6 +
5+ Exon
-ATG
1605+
Exon
6+
Exon
- 1655+
Exon
8+
Exon
5+
Exon
5+
Exon
+
7+
Exon
-
-
-
-
-
-
+
-
st
st
st
st
st
st
SG
st
st
st
ST
st
st
st
st
-
-
-
-
+
+
st
+
+
SI
+
Codon
+
+
+
+
+
+
7+
Exon
Exon 6 +
Exon 6+
6+
Exon
158 5+
Exon
8+
Exon
5+
Exon
Exon 6 +
Exon 7 +
7+
Exon
197
GTG
196
178
CGA
CAC
197
GTG
CAG
CGT
CAG
CAG
ATG
273
165
165
243
253
206
194
212
274
151
192
248
254
Abbreviations: St, stomach; SG, salivary gland; Thy, thyroid; SI, small intestine; ND, not done.
* Deletion.
--
Mutation
- CAT
1936+
Exon
CAC
GTA
--------
----------
Amino Acid Substitution
His
Val
His
Val
TGA
*AC
CTG
Val
ATG
CTG
Arg
TGT
CCG
CCG
GTG
Arg End
Frameshift
Met Leu
Met
Gln Leu
Cys
Gln Pro
Gln Pro
Met Val
ACC ACT
l T G T*G
CTT -CAT
"r-lTA
CGC CTC
GTT GAT
CCC CAC
CAG CGG
CGG CAG
ATC GAC
Thr Thr
Frameshift
Leu His
Phe Leu
Arg Leu
Val Asp
Pro His
Gln Arg
Arg Gln
Ile - A s p
+
+
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
DU ET AL
4590
GO016
‘T
Fig 3. Direct sequencing of the PCR product from SSCP-positive
cases.CaseG0016 showed amissense mutation (CCC + CAC) in
codon 151.
the 63 cases in which p53 staining was performed, positive
staining was found in 6 cases. All of the positive cases (6/
26 [23%]) were high-grade tumors and none of the 37 lowgrade tumors studied showed any staining for p53. Nuclear
staining was found in the majority of tumor cells in the
positive cases. Strong nuclear staining was observed in 5
cases, whereas moderate nuclear staining wasseen in the
remaining case. Of the positive cases, 1 case showed the
presence of abundant low- and high-grade tumor components
together with follicles colonized by high-grade tumor cells.
p53 staining in this case was observed mainly in high-grade
blasts, but also in a few low-grade tumor cells (Fig 4).
Interrelationships between p53 mutation and p53 staining
or p53allele loss in MALT lymphoma. Cases showing p53
staining, LOH, and mutation are summarized in Table 1. All
tumors showing p53 staining contained missense mutations
in the p53 gene. However, 14 cases harboring p53 mutations,
including 9 cases with missense mutations, 2 cases with
silent mutations, 2 cases with frameshift mutations, and 1
case with a nonsense mutation, did not show any staining
for p53 in at least two separate staining experiments using
more concentrated CM1 antibody.
In addition to the difference in the frequency of p53 allele
loss and mutation between low- and high-grade tumors, difference in the extent of p53 abnormalities was also observed
between the two groups. Of the 11 low-grade cases presenting p53 abnormalities, only 1 case showed the concomitance of p53 mutation and LOH, whereas in the high-grade
tumours, 6 of 9 involved cases displayed both p53 mutation
and LOH, suggesting the association between the accumulation of p53 abnormalities and disease progression.
high-grade lymphoma has resulted from transformation of
low-gradedisease. This assumption is reinforced by the
finding in such cases of the same Ig light chain restriction
in both lesions4 and a recent case report36 of identical Ig
gene rearrangement. In this context, it has been shown that
the chances of identifying a low-grade component are increased as more sections are examined: Even when no lowgrade component has been identified, as in 7 of our cases,
a relationship to MALTlymphoma cannot be excluded. Factors that support this relationship include the association with
preceding Helicobacter pylori infection inbothlow-and
high-grade gastric lymph0mas,3~”*the frequent presence of
chromosome trisomy 3,39 and the similar survival statistics
reported in high-grade cases with or without a low-grade
component.40
To understand the full potential of p53 inactivation in
MALT lymphomagenesis, we have examined gene abnormalities, including both mutation andallele loss, and protein
expression in a large series of low- and high-grade MALT
lymphomas. Several precautions were taken in the present
R
DISCUSSION
The relation between low-grade MALT lymphoma and
high-grade B-cell lymphoma arising in mucosalsites is problematic. Where foci of low-grade MALT lymphoma rm he
detected in the same specimen: as was the case in 21 of 27
cases in our study, it seems reasonable to assume that the
Fig 4. Accumulation of the p53 protein in MALT lymphomas. p53
was immunostained with CM1 antibody. Case GOll4showed nuclear
staining in majority of the high-grade (HGI but also in a few of the
low-grade (LG) tumor cells. The high- and low-grade foci are from
the same histologic section.
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
p53 INACTIVATION IN MALT LYMPHOMA
study to ensure the maximal detection of p53 abnormalities.
First, microdissection was performed in each case to isolate
both tumor and nontumor cell populations, from which p53
gene analysis was performed. This has been proven to be
the crucial step because MALT lymphoma frequently coexists with reactive components and many of our samples contained only a small tumor mass. The DNA isolated from a
whole tumor section or tissue may be adequate for SSCP
analysis in some cases but is far below the requirement for
direct sequencing and LOH analysis due to the presence of
abundant nontumor cells (our unpublished results). Secondly, a highly sensitive SSCP analysis using polyacrylamide agarose composite gel and a background free silver
staining method was used in the present study, which, in a
previous
was shown to detect 97% of p53 mutations.
Finally, a highly polymorphic p53 CA repeat was used for
detection of LOH that allowed us to analyze nearly 90% of
our samples.
Our results show that frequent p53 mutation and allelic
loss are associated with both low- (LOH, 6.8%; mutation,
18.8%) and high- (LOH, 28.6%; mutation, 33.3%) grade
MALT lymphomas, particularly in the high-grade tumors.
Our data also indicate that there is a significant difference
in the extent of p53 abnormalities between low- and highgrade MALT lymphomas. In low-grade tumours, most p53defective cases (10/1 l ) showed either one allele mutation or
one allele loss, suggesting only partial loss of p53 function.
Whereas in high-grade tumors, the majority (6/9) of affected
cases exhibited both p53 mutation and allele loss, implying
complete loss of p53 function. Thus, the extent of p53 inactivation is closely associated with the progression of MALT
lymphoma. A partial inactivation of p53 function may be
involved in the development of some low-grade MALT
lymphomas, whereas a complete loss of p53 function may
be important for high-grade transformation. In this aspect,
the pathologic role of p53 inactivation in MALT lymphoma
is different from that in follicular lymphoma in which p53
mutation has been suggested to be mainly associated with
high-grade transformation” or that in splenic marginal zone
B-cell lymphoma in which p53 inactivation appears to be
involved with the development of low-grade tumors.”
The observation of distinct p53 gene abnormalities at the
different stages of MALT lymphoma shows the nature of
multistage tumorigenesis and highlights the fact that the loss
of normal p53 function is a process of the accumulation of
its genetic abnormalities. Our results also emphasizes the
importance of analyzing both p53 mutation and allele loss
to evaluate its full potential in tumorigenesis. Distinct p53
gene abnormalities (p53 allele loss, p53 mutation, or both)
may cause different degree of p53 inactivation, exert different tumorigenic potentials, and thus play different roles during multistage tumorigenesis.
Mutant p53 protein frequently accumulates in cell nuclei
due to its increased half-life and can be detected by immunochemical ~taining.”.~’
p53 staining frequently indicates mutation of the gene. In the present study, all cases showing
p53 staining contained missense mutations in the gene. However, 14 cases harboring p53 mutation did not show any p53
459 1
staining with CM1 antibody. Staining was not expected for
5 cases, including 2 cases in which the mutation was silent
and another 3 cases in which mutations resulted in truncated
protein products. The mechanism underlying the absence of
p53 staining in the remaining 9 cases, in which missense
mutations were found, is unclear. Lack of staining in tumors
harboring p53 missense mutation has been reported prev i o u ~ l y . ”Two
~,~~
possibilities may account for this. First, the
accumulation of mutant p53 may not reach the level detectable by immunochemistry. This could be due to the insufficient stabilization of some mutations or lack of sufficient
protein expression?2.MSecondly, the antibody used may not
recognize all mutant p53. However, this possibility is small
in our case because p53 staining was performed using CM1
and antigen retrieval method, which together have been
shown to be highly sensitive for the ~taining.~’
In addition,
the CM1 antibody is polyclonal and theoretically should
recognize all p53. Nevertheless, the use of immunostaining
with CM1 antibody alone as a marker for p53 mutation in
MALT lymphomas is limited.
Increasing expression of mutant p53 during tumor progression has been observed previously?* This suggests that
additional mechanisms other than gene mutation may affect
the protein expressionM and the expression of mutant p53
may also be functionally important. Increasing evidence suggests that mutant p53 can exert dominant negative effects
on the ~ i 1 d - t y p e . l Thus,
~ ~ ~ ’ the lack of mutant p53 expression
in tumors harboring p53 mutation may indicate the absence
of such dominant negative effects and represent a relatively
weak model of mutation-mediated p53 inactivation. In keeping with this hypothesis, the majority of our cases not showing protein accumulation but with mutation were low grade
and did notshow loss of the other allele. Further studies
following-up p53 expression and disease progression in these
cases are necessary to understand the significance of mutant
p53 expression in tumorigenesis.
Analysis of the p53 mutation spectrum in a tumor may
show the possible etiology involved in its carcinogene~is.’.~~
For example, the high frequency of G+T transversion in the
codon 249 in human hepatocellular carcinoma is related to
alfatoxin B 1-mediated mutagenesis,4’ whereas the predominant transition mutation in the CpG island observed in colon
cancer and lymphomas suggests the endogenous mutagenesis4’ No predominant type of mutation in the p53 gene was
found in MALT lymphoma and the mechanism underlying
the diverse p53 mutations in this tumor remains unclear.
Oxygen-reactive species, which are actively produced during
inflammatory diseases49and cause various types of mutation
in DNA:’ may be important in the carcinogenesis of MALT
lymphoma because this tumor is frequently derived from a
background of inflammatory diseases.
Despite the progress in the understanding of clinical,
pathologic, and immunophenotypic features of MALT
lymphoma, the genetic mechanism underlying its development and high-grade transformation is not fully understood.
This tumor does not show bcl-2 or bcl-l rea~~angement.’~,~~
Although c-myc rearrangement has been reported in 1 of 2
high-grade MALT tumors,53we have been unable to detect
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
4592
DU ET AL
c-mycrearrangement in arelativelylargeseriesofwelldefined high-grade MALT cases (our unpublished results).
Recently, a high frequency (56%) of chromosome trisomy
3 hasbeen found in low-gradeMALT lymphoma,which
indicates its important rolein the developmentof the tumor.54
However, trisomy of chromosome 3 does not appear to be
important for the high-grade transformation because its frequency is lower(33%) in high-grade tumors.” Thus, the
finding of p53 inactivation in MALT lymphoma represents
the first gene identified so far to be frequently involved in
its development as well as high-grade transformation.
REFERENCES
1. Isaacson P, Wright DH: Malignant lymphoma of mucosa-asso-
ciated lymphoid tissue. A distinctive type of B-cell lymphoma. Cancer 52:1410, 1983
2. Isaacson P, Spencer J: Malignant lymphoma of mucosa-associated lymphoid tissue. Histopathology 11:445, 1987
3. lsaacson PG: Lymphomas of mucosa-associated lymphoid tissue (MALT). Histopathology 16:617, 1990
4. Chan JKC, Ng CS, Isaacson PG: Relationship between highgrade lymphoma and low-grade B-cell mucosa-associated lymphoid
tissue
lymphoma
(MALToma)
of the
stomach.
Am J Pathol
136:1153,1990
5. Kastan MB, Onyekwere 0, Sidransky D, Vogelstein B, Craig
RW: Participation of p53 protein in the cellular response to DNA
damage. Cancer Res 51 :6304, 1991
6. Kuerbitz SJ, Plunkett BS, Walsh WV, Kastan MB: Wild-type
p53is a cellcyclecheckpointdeterminantfollowingirradiation.
Proc Natl Acad Sci USA 89:7491, 1992
7. Lane DP: p53, guardian of the genome. Nature 358:15, 1992
8. Hollstein M, Sidransky D, Vogelstein B, Harris C: p53 mutations in human cancers, Science 253:49, 1991
9. Levine AJ, Perry ME, Chang A, Silver A, Dittmer D, Wu M,
of the p53 tumourWelsh D: The 1993 Walter Lecture: The role
suppresser gene in tumourigenesis. Br J Cancer 69:409, 1994
IO. Shirasawa S, Urabe K, Yanagawa Y, Toshitani K, Iwama T,
Sasazuki T: p53 gene mutations in colorectal tumours from patients
with familial polyposis coli. Cancer Res 51:2874,
1991
1 I . Malkin D, Li FP, Strong LC, Graumeni JF, Nelson CE, Kim
DH, Kassel J, Gryka MA, Bischoff FZ, Tainsky MA,
Friend SH:
Germline p53 mutations in a familial syndrome
of breast cancer,
sarcomas, and other neoplasms. Science 250:1233, 1990
12. Lassam NJ, From L,
Kahn HJ: Overexpression of p53 is a
late event in the development of malignant melanoma. Cancer Res
53:2235,1993
13. Nigro, JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R,
Cleary K, Bigner SH, Davidson N, Baylin S, Devilee P, Glover T,
Collin FS, Weston A, Modali
R, Harris CC: Mutation of the p53
gene occurs in diverse tumour types. Nature 342:705, 1989
14. Caron de FromentalC,SoussiT:TP53tumoursuppressor
gene: A model for investigating human mutagenesis. Genes Chromosom Cancer 4: I , 1992
15. Masuda H, Miller C, Koeffler HP,BattiforaH,ClineMJ:
Rearrangement of the p53 gene in human osteogenic sarcoma. Proc
Natl Acad Sci USA 84:7716, 1987
16. Oliner JD, Kinzler KW, Meltzer PS, George DL, Vogelstein
B: Amplification of ageneencoding a p53-associatedproteinin
human sarcomas. Nature 358:80, 1992
17. Lane DP: p53 and human cancers. Br Med Bull 50582, 1994
18. Nakai H, Misawa S, Toguchida J, Yandel DW, Ishizalu K:
Frequent p53 gene mutations in blast crisis of chronic myelogenous
leukaemia, especially in myeloid crisis harbouringloss 01 a chromosome 17p. Cancer Res 52:6588, 1992
19. Srivastava S, Wang S, Tong YA, Hao ZM, Chang EH: Dominant negativeeffect of agerm-linemutant p53: Asteptostering
tumourigenesis. Cancer Res 53:4452, 1993
20. Frebourg T, Sadelain M, Ng YS, Kassel J, Friend SH: Equal
transcription of wild-type and mutant p53 using bicistronic vectors
results in the wild-type phenotype. Cancer Res 54:878, 1994
2 I . Harvey M, Vogel H, Morris D, Bradley A, Bernstein A, Donehower LA: A mutant p53 transgene accelerates tumour development
in heterozygous but not nullizygous p53-deficient mice. Nat Genet
9:305, 1995
22. Gaidano G, Ballerini P, Gong JZ, Inghirami G, Neri A. Newcomb EW, Magrath IT, Knowles DM, Dalla-Favera R: p53 mutation
in human lymphoid malignancies associated with Burkitt lymphoma
andchroniclymphocyticleukaemia.Proc
Natl Acad Sci USA
88:5413. 1991
23. Sugimoto K, Toyoshima H, Sakai R, Miyagawa K, Hagiwara
K, Hirai H, IshikawaF,Takaku F: Mutationsofthep53gene
in
lymphoid leukemia. Blood 77: I 153, I991
24. Cesarman E, Chadburn A, Inghirami G, Gaidano G , Knowles
DM:Structuralandfunctionalanalysis
of oncogenesandtumour
suppressor genes in adult T-cell leukemidymphoma shows frequent
p53 mutations. Blood 80:3205, 1992
25. Wada M, Bartram CR, Nakamura H, Hachiya M, Chen DL,
Borenstein J. MillerCW,Ludwig
L, Hansen-HaggeTE,Ludwig
WD. Reiter A, Mizoguchi H, Koeffler HP: Analysis of p53 mutation
in a large seriesof lymphoid hematologic malignanciesof childhood.
Blood 82:3163, 1993
26. lchikawa A, Hotta T, Saito H: Mutations of the p53 gene in
B-cell lymphoma. Leuk Lymphoma 1 l:2l, 1993
27. Sander CA, Yano T, Clark HM, Harris C, Longo
D, Jaffe ES.
Raffeld M: p53 mutation is associated with progression in follicular
lymphomas. Blood 82:1994, 1993
28. Baldini L, Francchiolla NS, Cro LM, Trecca D, Romitti L,
Polli E,MaioloAT,Neri
A: Frequentp53geneinvolvement
in
splenic B-cell leukaemidlymphomas of possible marginal zone origin. Blood 84:270. 1994
29.IsaacsonPG:Malignantlymphomaof
the gastrointestinal
tract, in lsaacsonPG,Norton
AJ (eds):ExtranodalLymphomas.
New York. NY, Churchill Livingstone, 1994, p 15
30. lsaacson PG, Matures E, Burke M, Catovsky D: The histopawith villous lymphocytes.Blood
thology of spleniclymphoma
84:3828,1994
3 I . Pan LX, Diss TC, Peng HZ, Isaacson PG: Clonality analysis
of defined B-cell populations in archival tissue sections using microdissectionandpolymerasechainreaction.Histopathology24:323,
1994
32. Jones MH, Nakamura Y : Detection of loss of heterozygosity
at the human TP53 locus usinga dinucleotide repeat polymorphism.
Genes Chromosom Cancer 5:89, 1992
33. Murakami Y, Hayashi K, Sekiya T: Detection of aberrations
of the p53 alleles and the gene transcript in human tumor cell lines
by single-strand conformation polymorphism analysis. Cancer
Res
5 1 :3356, 1991
34. Peng HZ, Du MQ, Ji JX, Isaacson PG, Pan LX: High resolution SSCP analysis using polyacrylamide agarose composite gel and
a background silver staining method. Biotechniques 19:410, 1995
35. Norton AJ, Jordan S, Yeomans P: Brief high temperature heat
denaturation (pressure cooking): A simple and effective
method of
antigen retrieval for routinely processed tissues. J Pathol 173:371,
1994
36. Montalban C, Manzanal A, Castrillo JM, Escribano L, Bellas
C: Low grade gastric B-cell MALT lymphoma progressing into high
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
p53 INACTIVATION INMALT LYMPHOMA
grade lymphoma. Clonal identity of the two stages of the tumour,
unusual bone involvement and leukaemic dissemination. Histopathology 27:89, 1995
37. Wotherspoon AC, Ortiz Hidalgo C, Falzon MR, Isaacson PG:
Helicobacter pylori-associated gastritis and primary B-cell gastric
lymphoma. Lancet 338:1175, 1991
38. Parsonnet J, Hansen S, Rodriguez L, Gelb AB, Warnke RA,
Jellum E, Orentreich N, Vogelman JH, Friedman GD: Helicobacter
pylori infection and gastric lymphoma. N Engl J Med330:1267,
1994
39. Wotherspoon AC, Finn T, Isaacson PG. Numerical abnormalities of chromosome 3 and 7 in lymphomas of mucosa associated
lymphoid tissue and the spleen marginal zone. Lab Invest 70: 124A,
1994
40. Cogliatti SB, Schmid U, Schumacher U, Eckert F, Hansmann
ML, Hedderich J, Takahashi H, Lennert K: Primary B-cell gastric
lymphoma: A clinicopathological study of 145 patients. Gastroenterology 101:1159, 1991
41. Rotter V: p53, a transformation-related cellular encoded protein, can be used asa biochemical marker for the detection of primary
mouse tumour cells. Proc Natl Acad Sci USA 80:2613, 1983
42. Wynford-Thomas D: p53 in tumour pathology: Can we trust
immunocytochemistry? J Pathol 166:329, 1992
43. Dix B, Robbin P, Carrello S, House A, Iacopetta B: Comparison of p53 mutation and protein overexpression in colorectal carcinomas. Br J Cancer 70585, 1994
44. Hall PA, Lane DP: p53 in tumour pathology: Can we trust
immunohistochemistry?-Revisited! J Pathol 172:1, 1994
45. Baas IO, Mulder JWR, Offerhaus GJO, Vogelstein B, Hamil-
4593
ton SR: An evaluation of six antibodies for immunohistochemistry
of mutant p53 gene product in archival colorectal neoplasms. J Pathol
1725, 1994
46. Harris CC: p53: At the crossroads of molecular carcinogenesis
and risk assessment. Science 262:1980, 1993
47. Bressac B, Kew M, Wands J, Ozturk M: Selective G to T
mutations of p53 gene in hepatocellular carcinoma from Southern
Africa. Nature 350:429, 1991
48. Rideout W M 3d, Coetzee-GA, Olumi AF, Spruck CH, Jones
PA: 5-Methylcytosine as an endogenous mutagen in the p53 tumour
suppressor gene. Princess Takamatsu Symp 22:207, 1991
49. Weitzman SA, Gordon LI: Inflammation and cancer: Role of
phagocyte-generated oxidants in carcinogenesis. Blood 76:655, 1990
50. McBride TJ, Preston BD, Loeb LA: Mutagenic spectrum resulting from DNA damage by oxygen radicals. Biochemistry 30:307,
1991
51. Pan LX, Diss TC, Cunningham D, Isaacson PG: The hcl-2
gene in primary B-cell lymphoma of mucosa-associated lymphoid
tissue (MALT). Am J Pathol 135:7, 1989
52. Wotherspoon AC, Pan L, Diss TC, Isaacson PG: A genotypic
study of low grade B-cell lymphomas, including lymphomas of mucosa associated lymphoid tissue (MALT). J Pathol 162:135, 1990
53. Krieken JHJM, Raffeld M, Raghoebier S, Jaffe ES, van Ommen GJB, Kluin PM: Molecular genetics of gastrointestinal nonHodgkin’s lymphomas: Unusual prevalence and pattern of c-myc
rearrangements in aggressive lymphomas. Blood 76:797, 1990
54. Wotherspoon AC, Finn TM, Isaacson PG: Trisomy 3 in low
grade B cell lymphomas of mucosa associated lymphoid tissue
(MALT). Blood 85:2000, 1995
From www.bloodjournal.org by guest on January 26, 2015. For personal use only.
1995 86: 4587-4593
The accumulation of p53 abnormalities is associated with
progression of mucosa-associated lymphoid tissue lymphoma
M Du, H Peng, N Singh, PG Isaacson and L Pan
Updated information and services can be found at:
http://www.bloodjournal.org/content/86/12/4587.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American
Society of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.